#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA12	26154	genome.wustl.edu	37	2	215831644	215831644	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:215831644G>C	ENST00000272895.7	-	39	6031	c.5812C>G	c.(5812-5814)Cca>Gca	p.P1938A	ABCA12_ENST00000389661.4_Missense_Mutation_p.P1620A	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1938					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.P1938A(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGGTAAGCTGGAAGGGAGTGA	0.388																																					Ovarian(66;664 1488 5121 34295)	dbGAP											1	Substitution - Missense(1)	breast(1)											176.0	155.0	162.0					2																	215831644		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5812C>G	2.37:g.215831644G>C	ENSP00000272895:p.Pro1938Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P1938A	ENST00000272895.7	37	c.5812	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685086	0.88639	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.86694	-2.16;-2.16	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000004	D	0.93255	0.7851	M	0.71036	2.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91880	0.5515	10	0.41790	T	0.15	.	20.097	0.97855	0.0:0.0:1.0:0.0	.	1938;1620	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	A	1938;1620	ENSP00000272895:P1938A;ENSP00000374312:P1620A	ENSP00000272895:P1938A	P	-	1	0	ABCA12	215539889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.673000	0.98631	2.754000	0.94517	0.650000	0.86243	CCA	ABCA12	-	NULL	ENSG00000144452		0.388	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	147	0.00	0	G	NM_173076		215831644	215831644	-1	no_errors	ENST00000272895	ensembl	human	known	69_37n	missense	119	30.81	53	SNP	1.000	C
ABR	29	genome.wustl.edu	37	17	962030	962030	+	Silent	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:962030G>C	ENST00000302538.5	-	11	1406	c.1260C>G	c.(1258-1260)ctC>ctG	p.L420L	ABR_ENST00000291107.2_Silent_p.L383L|ABR_ENST00000574437.1_Silent_p.L374L|ABR_ENST00000573895.1_5'Flank|ABR_ENST00000536794.2_Silent_p.L202L|ABR_ENST00000544583.2_Silent_p.L374L	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	420	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Poly-Leu.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L420L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		TGGGGGAGTTGAGCAGCAGCA	0.567											OREG0024068	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(197;2016 2115 4129 29033 46447)	dbGAP											1	Substitution - coding silent(1)	breast(1)											122.0	112.0	115.0					17																	962030		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1260C>G	17.37:g.962030G>C		Somatic	592	WXS	Illumina GAIIx	Phase_IV	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q87E	ENST00000302538.5	37	c.259	CCDS10999.1	17																																																																																			ABR	-	pfam_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000159842		0.567	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	HGNC	protein_coding	OTTHUMT00000206675.4	228	0.00	0	G			962030	962030	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000574544	ensembl	human	putative	69_37n	missense	125	11.35	16	SNP	1.000	C
ABCA8	10351	genome.wustl.edu	37	17	66891114	66891114	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:66891114C>T	ENST00000269080.2	-	20	2822	c.2685G>A	c.(2683-2685)caG>caA	p.Q895Q	ABCA8_ENST00000586539.1_Silent_p.Q935Q|ABCA8_ENST00000430352.2_Silent_p.Q935Q	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	895					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.Q895H(2)|p.Q895Q(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					AAGCTATGTTCTGGTGCTCCA	0.378																																						dbGAP											3	Substitution - Missense(2)|Substitution - coding silent(1)	lung(2)|breast(1)											178.0	149.0	159.0					17																	66891114		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.2685G>A	17.37:g.66891114C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,pfam_Ribosome_biogen_GTPase_RsgA,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E583K	ENST00000269080.2	37	c.1747	CCDS11680.1	17																																																																																			ABCA8	-	NULL	ENSG00000141338		0.378	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	170	0.00	0	C	NM_007168		66891114	66891114	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000589533	ensembl	human	known	69_37n	missense	98	26.47	36	SNP	0.970	T
ABTB2	25841	genome.wustl.edu	37	11	34182470	34182470	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:34182470C>T	ENST00000435224.2	-	11	2801	c.2377G>A	c.(2377-2379)Gac>Aac	p.D793N	ABTB2_ENST00000298992.2_Missense_Mutation_p.D607N	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	793					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)		p.D607N(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TTGAGGATGTCGAACATGAGC	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	104.0	109.0					11																	34182470		2202	4298	6500	-	-	-	SO:0001583	missense	0			AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.2377G>A	11.37:g.34182470C>T	ENSP00000410157:p.Asp793Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.D793N	ENST00000435224.2	37	c.2377	CCDS7890.2	11	.	.	.	.	.	.	.	.	.	.	C	5.218	0.225735	0.09916	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.58358	0.34;0.34	5.15	4.23	0.50019	.	0.278923	0.41001	N	0.000972	T	0.21227	0.0511	N	0.02539	-0.55	0.36323	D	0.858371	B	0.12013	0.005	B	0.04013	0.001	T	0.25537	-1.0129	10	0.02654	T	1	-21.5631	9.3348	0.38043	0.0:0.7792:0.1443:0.0765	.	607	Q8N961	ABTB2_HUMAN	N	793;607	ENSP00000410157:D793N;ENSP00000298992:D607N	ENSP00000298992:D607N	D	-	1	0	ABTB2	34139046	0.965000	0.33210	0.948000	0.38648	0.975000	0.68041	1.098000	0.31000	1.169000	0.42739	0.561000	0.74099	GAC	ABTB2	-	NULL	ENSG00000166016		0.597	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	HGNC	protein_coding	OTTHUMT00000388703.3	36	0.00	0	C	NM_145804		34182470	34182470	-1	no_errors	ENST00000435224	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.888	T
ADAMTS3	9508	genome.wustl.edu	37	4	73205317	73205317	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:73205317C>T	ENST00000286657.4	-	5	791	c.755G>A	c.(754-756)gGa>gAa	p.G252E		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	252					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G252E(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATCGTTTTCTCCCGCGTGTCT	0.493																																					NSCLC(168;1941 2048 2918 13048 43078)	dbGAP											1	Substitution - Missense(1)	breast(1)											271.0	259.0	263.0					4																	73205317		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.755G>A	4.37:g.73205317C>T	ENSP00000286657:p.Gly252Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U9|Q9BXZ8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G252E	ENST00000286657.4	37	c.755	CCDS3553.1	4	.	.	.	.	.	.	.	.	.	.	C	1.550	-0.539566	0.04053	.	.	ENSG00000156140	ENST00000286657	T	0.60672	0.17	5.31	5.31	0.75309	.	0.065738	0.64402	D	0.000010	T	0.52058	0.1711	L	0.54323	1.7	0.49687	D	0.999818	B	0.14805	0.011	B	0.15484	0.013	T	0.51818	-0.8657	10	0.06625	T	0.88	.	19.1722	0.93583	0.0:1.0:0.0:0.0	.	252	O15072	ATS3_HUMAN	E	252	ENSP00000286657:G252E	ENSP00000286657:G252E	G	-	2	0	ADAMTS3	73424181	0.044000	0.20184	0.978000	0.43139	0.027000	0.11550	1.532000	0.36029	2.763000	0.94921	0.563000	0.77884	GGA	ADAMTS3	-	NULL	ENSG00000156140		0.493	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	HGNC	protein_coding	OTTHUMT00000252164.2	115	0.00	0	C			73205317	73205317	-1	no_errors	ENST00000286657	ensembl	human	known	69_37n	missense	140	25.13	47	SNP	0.994	T
ADGB	79747	genome.wustl.edu	37	6	146993405	146993405	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:146993405G>A	ENST00000397944.3	+	8	965	c.889G>A	c.(889-891)Gag>Aag	p.E297K	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	297	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.E297K(2)		breast(1)|endometrium(2)|kidney(2)	5						AATATTGCCTGAGTTTAAGCT	0.373																																						dbGAP											2	Substitution - Missense(2)	breast(2)											61.0	54.0	56.0					6																	146993405		692	1591	2283	-	-	-	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.889G>A	6.37:g.146993405G>A	ENSP00000381036:p.Glu297Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.E297K	ENST00000397944.3	37	c.889		6	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959709	0.53400	.	.	ENSG00000118492	ENST00000397944	D	0.86694	-2.16	5.01	4.14	0.48551	Peptidase C2, calpain, catalytic domain (3);	1.138400	0.06270	N	0.695423	T	0.80874	0.4707	L	0.60455	1.87	0.23827	N	0.996731	P	0.43477	0.808	B	0.43082	0.407	T	0.71994	-0.4424	10	0.62326	D	0.03	-16.8089	11.4263	0.50012	0.0853:0.0:0.9147:0.0	.	297	Q8N7X0	CAN7L_HUMAN	K	297	ENSP00000381036:E297K	ENSP00000381036:E297K	E	+	1	0	C6orf103	147035098	0.996000	0.38824	0.888000	0.34837	0.435000	0.31806	2.416000	0.44644	1.238000	0.43771	0.591000	0.81541	GAG	ADGB	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat	ENSG00000118492		0.373	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	99	0.00	0	G	NM_024694		146993405	146993405	+1	no_errors	ENST00000397944	ensembl	human	known	69_37n	missense	46	52.08	50	SNP	0.574	A
AGAP3	116988	genome.wustl.edu	37	7	150819866	150819866	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:150819866C>T	ENST00000335367.3	+	9	1816	c.1723C>T	c.(1723-1725)Cca>Tca	p.P575S	AGAP3_ENST00000397238.2_Intron|AGAP3_ENST00000479901.1_Missense_Mutation_p.P342S|AGAP3_ENST00000473312.1_Missense_Mutation_p.P395S|AGAP3_ENST00000463381.1_Intron			Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	0	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)	p.P395S(1)		central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						CCAACTCCTTCCAAATTAGAA	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	88.0	88.0					7																	150819866		1877	4119	5996	-	-	-	SO:0001583	missense	0			AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000335367.3:c.1723C>T	7.37:g.150819866C>T	ENSP00000335589:p.Pro575Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	pfam_MIRO-like,pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.P395S	ENST00000335367.3	37	c.1183		7	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132016	0.37630	.	.	ENSG00000133612	ENST00000473312;ENST00000479901;ENST00000335367;ENST00000468796	D;D;D;T	0.91180	-2.15;-2.8;-2.54;0.82	4.03	3.14	0.36123	.	.	.	.	.	T	0.79997	0.4543	N	0.08118	0	0.24833	N	0.992512	B;B;B	0.29862	0.139;0.259;0.139	B;B;B	0.29524	0.017;0.103;0.024	T	0.70868	-0.4755	9	0.51188	T	0.08	.	8.9387	0.35715	0.0:0.8923:0.0:0.1077	.	342;575;395	C9J975;E7ESL9;E9PAL8	.;.;.	S	395;342;575;176	ENSP00000418921:P395S;ENSP00000418125:P342S;ENSP00000335589:P575S;ENSP00000418159:P176S	ENSP00000335589:P575S	P	+	1	0	AGAP3	150450799	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.819000	0.75262	0.814000	0.34374	0.462000	0.41574	CCA	AGAP3	-	NULL	ENSG00000133612		0.498	AGAP3-005	NOVEL	basic	protein_coding	AGAP3	HGNC	protein_coding	OTTHUMT00000351912.1	73	0.00	0	C	NM_031946		150819866	150819866	+1	no_errors	ENST00000473312	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	T
PHYKPL	85007	genome.wustl.edu	37	5	177656971	177656971	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:177656971T>G	ENST00000308158.5	-	3	542	c.308A>C	c.(307-309)cAg>cCg	p.Q103P	PHYKPL_ENST00000476170.2_Missense_Mutation_p.Q103P|PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	103						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.Q103P(2)								L-Alanine(DB00160)	CACACAGAGCTGCTCCGGCAG	0.567																																						dbGAP											2	Substitution - Missense(2)	breast(2)											102.0	100.0	101.0					5																	177656971		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.308A>C	5.37:g.177656971T>G	ENSP00000310978:p.Gln103Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.Q103P	ENST00000308158.5	37	c.308	CCDS4434.1	5	.	.	.	.	.	.	.	.	.	.	T	1.279	-0.610814	0.03690	.	.	ENSG00000175309	ENST00000308158;ENST00000323594;ENST00000476170	T;T;T	0.40756	2.27;1.02;2.27	5.22	1.23	0.21249	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	1.309960	0.04994	N	0.467903	T	0.14356	0.0347	N	0.00392	-1.555	0.26220	N	0.979163	B	0.02656	0.0	B	0.04013	0.001	T	0.20371	-1.0277	10	0.09338	T	0.73	-18.026	11.8422	0.52361	0.0:0.0:0.4237:0.5763	.	103	Q8IUZ5	AT2L2_HUMAN	P	103;117;103	ENSP00000310978:Q103P;ENSP00000321290:Q117P;ENSP00000421810:Q103P	ENSP00000310978:Q103P	Q	-	2	0	AGXT2L2	177589577	0.999000	0.42202	0.162000	0.22713	0.855000	0.48748	4.190000	0.58365	0.041000	0.15688	-0.451000	0.05528	CAG	AGXT2L2	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000175309		0.567	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2L2	HGNC	protein_coding	OTTHUMT00000253477.1	60	0.00	0	T	NM_032921		177656971	177656971	-1	no_errors	ENST00000308158	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.869	G
ALDOA	226	genome.wustl.edu	37	16	30080238	30080238	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr16:30080238C>T	ENST00000566897.1	+	8	1631	c.479C>T	c.(478-480)tCa>tTa	p.S160L	ALDOA_ENST00000564546.1_Missense_Mutation_p.S160L|ALDOA_ENST00000412304.2_Missense_Mutation_p.S160L|ALDOA_ENST00000564595.2_Missense_Mutation_p.S214L|ALDOA_ENST00000395240.3_Missense_Mutation_p.S160L|ALDOA_ENST00000569798.1_Missense_Mutation_p.S160L|ALDOA_ENST00000395248.1_Missense_Mutation_p.S214L|ALDOA_ENST00000563060.2_Missense_Mutation_p.S160L|ALDOA_ENST00000338110.5_Missense_Mutation_p.S160L|ALDOA_ENST00000569545.1_Missense_Mutation_p.S160L			P04075	ALDOA_HUMAN	aldolase A, fructose-bisphosphate	160					actin filament organization (GO:0007015)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homotetramerization (GO:0051289)|regulation of cell shape (GO:0008360)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|membrane (GO:0016020)|nucleus (GO:0005634)|platelet alpha granule lumen (GO:0031093)	actin binding (GO:0003779)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|tubulin binding (GO:0015631)	p.S160L(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	17						CACACCCCCTCAGCCCTCGCC	0.577											OREG0023729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	90.0	93.0					16																	30080238		2197	4300	6497	-	-	-	SO:0001583	missense	0			X05236	CCDS10668.1, CCDS58450.1	16p11.2	2008-03-06			ENSG00000149925	ENSG00000149925	4.1.2.13		414	protein-coding gene	gene with protein product		103850				3570299	Standard	NM_000034		Approved		uc010veg.2	P04075	OTTHUMG00000132107	ENST00000566897.1:c.479C>T	16.37:g.30080238C>T	ENSP00000455724:p.Ser160Leu	Somatic	814	WXS	Illumina GAIIx	Phase_IV	B4DXI7|Q6FH76|Q6FI10|Q96B15|Q9BWD9|Q9UCN2	Missense_Mutation	SNP	pfam_Aldolase_I	p.S160L	ENST00000566897.1	37	c.479	CCDS10668.1	16	.	.	.	.	.	.	.	.	.	.	C	31	5.069151	0.93950	.	.	ENSG00000149925	ENST00000395248;ENST00000338110;ENST00000412304;ENST00000395240	D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.64	5.67	5.67	0.87782	Aldolase-type TIM barrel (1);	0.117785	0.64402	D	0.000014	D	0.97284	0.9112	H	0.97465	4.01	0.80722	D	1	D;B;D	0.76494	0.998;0.397;0.999	D;B;D	0.78314	0.964;0.315;0.991	D	0.98402	1.0568	10	0.87932	D	0	.	18.5563	0.91086	0.0:1.0:0.0:0.0	.	19;42;160	A4UCT0;A4UCS9;P04075	.;.;ALDOA_HUMAN	L	214;160;160;160	ENSP00000378669:S214L;ENSP00000336927:S160L;ENSP00000400452:S160L;ENSP00000378661:S160L	ENSP00000336927:S160L	S	+	2	0	ALDOA	29987739	1.000000	0.71417	0.746000	0.31095	0.915000	0.54546	7.724000	0.84798	2.673000	0.90976	0.655000	0.94253	TCA	ALDOA	-	pfam_Aldolase_I	ENSG00000149925		0.577	ALDOA-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ALDOA	HGNC	protein_coding	OTTHUMT00000435360.1	109	0.00	0	C	NM_000034		30080238	30080238	+1	no_errors	ENST00000338110	ensembl	human	known	69_37n	missense	50	18.03	11	SNP	1.000	T
ANAPC7	51434	genome.wustl.edu	37	12	110819687	110819687	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:110819687C>T	ENST00000455511.3	-	8	1104	c.1104G>A	c.(1102-1104)ctG>ctA	p.L368L	ANAPC7_ENST00000481473.1_5'Flank|ANAPC7_ENST00000450008.2_Silent_p.L368L	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	368					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)	p.L334L(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						TATTACTGTTCAGCTGAATGG	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											80.0	65.0	70.0					12																	110819687		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1104G>A	12.37:g.110819687C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Silent	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L368	ENST00000455511.3	37	c.1104	CCDS9145.2	12																																																																																			ANAPC7	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000196510		0.453	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	116	0.00	0	C	NM_016238		110819687	110819687	-1	no_errors	ENST00000455511	ensembl	human	known	69_37n	silent	48	26.15	17	SNP	0.997	T
ANGPTL3	27329	genome.wustl.edu	37	1	63064371	63064371	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:63064371T>C	ENST00000371129.3	+	2	580	c.500T>C	c.(499-501)tTt>tCt	p.F167S	DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000340370.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	167					acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)	p.F167S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						ATCCAGACTTTTGTAGAAAAA	0.294																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	80.0	80.0					1																	63064371		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.500T>C	1.37:g.63064371T>C	ENSP00000360170:p.Phe167Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLS0|B1ALJ0|B2RCW1	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.F167S	ENST00000371129.3	37	c.500	CCDS622.1	1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419870	0.62622	.	.	ENSG00000132855	ENST00000371129	T	0.60672	0.17	5.17	5.17	0.71159	.	0.188503	0.47455	D	0.000223	T	0.46619	0.1402	M	0.61703	1.905	0.43250	D	0.995174	P	0.44478	0.836	P	0.44359	0.447	T	0.44034	-0.9354	10	0.22109	T	0.4	.	15.3877	0.74714	0.0:0.0:0.0:1.0	.	167	Q9Y5C1	ANGL3_HUMAN	S	167	ENSP00000360170:F167S	ENSP00000360170:F167S	F	+	2	0	ANGPTL3	62836959	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	5.242000	0.65389	2.254000	0.74563	0.460000	0.39030	TTT	ANGPTL3	-	NULL	ENSG00000132855		0.294	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL3	HGNC	protein_coding	OTTHUMT00000025344.1	132	0.00	0	T	NM_014495		63064371	63064371	+1	no_errors	ENST00000371129	ensembl	human	known	69_37n	missense	151	21.83	43	SNP	1.000	C
ANGPTL5	253935	genome.wustl.edu	37	11	101777891	101777891	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:101777891C>T	ENST00000334289.3	-	3	779	c.184G>A	c.(184-186)Gag>Aag	p.E62K		NM_178127.4	NP_835228.2	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	62						extracellular region (GO:0005576)		p.E62K(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(2)|skin(3)	29		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		CATGATTCCTCACAGTCTTCC	0.264																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	86.0	87.0					11																	101777891		2199	4293	6492	-	-	-	SO:0001583	missense	0			BC049170	CCDS8312.1	11q22.2	2013-02-06				ENSG00000187151		"""Fibrinogen C domain containing"""	19705	protein-coding gene	gene with protein product		607666				12624729	Standard	NM_178127		Approved		uc001pgl.3	Q86XS5		ENST00000334289.3:c.184G>A	11.37:g.101777891C>T	ENSP00000335255:p.Glu62Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K658|Q86VR9	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E62K	ENST00000334289.3	37	c.184	CCDS8312.1	11	.	.	.	.	.	.	.	.	.	.	C	0.107	-1.144164	0.01728	.	.	ENSG00000187151	ENST00000334289;ENST00000534527	T;T	0.56103	0.48;0.79	5.28	3.25	0.37280	.	0.778059	0.12614	N	0.453647	T	0.35098	0.0920	L	0.44542	1.39	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.26189	-1.0110	10	0.09590	T	0.72	.	1.7772	0.03024	0.1662:0.4904:0.161:0.1824	.	62	Q86XS5	ANGL5_HUMAN	K	62	ENSP00000335255:E62K;ENSP00000433562:E62K	ENSP00000335255:E62K	E	-	1	0	ANGPTL5	101283101	0.389000	0.25205	0.923000	0.36655	0.165000	0.22458	0.500000	0.22562	1.316000	0.45131	0.655000	0.94253	GAG	ANGPTL5	-	NULL	ENSG00000187151		0.264	ANGPTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL5	HGNC	protein_coding	OTTHUMT00000394138.1	129	0.00	0	C	NM_178127		101777891	101777891	-1	no_errors	ENST00000334289	ensembl	human	known	69_37n	missense	34	59.52	50	SNP	0.297	T
ARMC5	79798	genome.wustl.edu	37	16	31471049	31471049	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr16:31471049delC	ENST00000563544.1	+	2	750	c.204delC	c.(202-204)cgcfs	p.R68fs	RP11-452L6.5_ENST00000564629.1_RNA|ARMC5_ENST00000412665.2_5'Flank|ARMC5_ENST00000268314.4_Frame_Shift_Del_p.R68fs|ARMC5_ENST00000457010.2_Frame_Shift_Del_p.R68fs|ARMC5_ENST00000408912.3_Frame_Shift_Del_p.R163fs|ARMC5_ENST00000538189.1_Frame_Shift_Del_p.R100fs			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	68										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GCGGGCTCCGCCCCCTACTCG	0.756																																						dbGAP											0													4.0	7.0	6.0					16																	31471049		1694	3819	5513	-	-	-	SO:0001589	frameshift_variant	0			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.204delC	16.37:g.31471049delC	ENSP00000456877:p.Arg68fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WM9|Q9H7P8|Q9H925	Frame_Shift_Del	DEL	superfamily_ARM-type_fold,superfamily_BTB/POZ_fold,smart_Armadillo,pfscan_Armadillo,pfscan_BTB/POZ-like	p.L165fs	ENST00000563544.1	37	c.489	CCDS45472.1	16																																																																																			ARMC5	-	NULL	ENSG00000140691		0.756	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC5	HGNC	protein_coding	OTTHUMT00000432847.1	25	0.00	0	C	NM_024742		31471049	31471049	+1	no_errors	ENST00000408912	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
ASH1L	55870	genome.wustl.edu	37	1	155448175	155448175	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:155448175C>G	ENST00000368346.3	-	3	5125	c.4486G>C	c.(4486-4488)Gaa>Caa	p.E1496Q	ASH1L_ENST00000392403.3_Missense_Mutation_p.E1496Q			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1496					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.E1496Q(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TGGGGTTGTTCAGAAGAACGG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											121.0	117.0	118.0					1																	155448175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.4486G>C	1.37:g.155448175C>G	ENSP00000357330:p.Glu1496Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.E1496Q	ENST00000368346.3	37	c.4486		1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624667	0.66901	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89810	-2.57;-2.57	5.44	5.44	0.79542	.	0.207763	0.41605	D	0.000844	D	0.86343	0.5910	N	0.19112	0.55	0.80722	D	1	P;D	0.54964	0.948;0.969	P;P	0.55824	0.614;0.785	D	0.87501	0.2433	10	0.52906	T	0.07	.	19.0495	0.93038	0.0:1.0:0.0:0.0	.	1496;1496	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	Q	1496	ENSP00000357330:E1496Q;ENSP00000376204:E1496Q	ENSP00000357330:E1496Q	E	-	1	0	ASH1L	153714799	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.701000	0.61810	2.832000	0.97577	0.655000	0.94253	GAA	ASH1L	-	NULL	ENSG00000116539		0.488	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	315	0.00	0	C	NM_018489		155448175	155448175	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	missense	144	29.27	60	SNP	1.000	G
ASTN1	460	genome.wustl.edu	37	1	176852045	176852045	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:176852045G>A	ENST00000367654.3	-	20	3547	c.3336C>T	c.(3334-3336)ctC>ctT	p.L1112L	ASTN1_ENST00000424564.2_Silent_p.L1104L|ASTN1_ENST00000361833.2_Silent_p.L1104L|ASTN1_ENST00000367657.3_Silent_p.L1104L	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1112	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.L1104L(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGATGGTGGTGAGCTGCTTGT	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											171.0	146.0	155.0					1																	176852045		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3336C>T	1.37:g.176852045G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.L1112	ENST00000367654.3	37	c.3336		1																																																																																			ASTN1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000152092		0.507	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		132	0.00	0	G	NM_004319		176852045	176852045	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	silent	116	13.43	18	SNP	1.000	A
BAZ1B	9031	genome.wustl.edu	37	7	72891207	72891207	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:72891207C>T	ENST00000339594.4	-	7	2922	c.2584G>A	c.(2584-2586)Gaa>Aaa	p.E862K	BAZ1B_ENST00000404251.1_Missense_Mutation_p.E862K	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	862					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)	p.E862K(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				CCTTTCATTTCTCTTTCCTGG	0.413																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)	dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	146.0	147.0					7																	72891207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.2584G>A	7.37:g.72891207C>T	ENSP00000342434:p.Glu862Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.E862K	ENST00000339594.4	37	c.2584	CCDS5549.1	7	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985256	0.35036	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.59906	0.23;0.23	5.63	4.73	0.59995	.	0.155416	0.64402	D	0.000016	T	0.32941	0.0846	N	0.08118	0	0.33054	D	0.533157	B	0.17038	0.02	B	0.16722	0.016	T	0.30001	-0.9993	10	0.07644	T	0.81	-28.6598	12.4115	0.55469	0.0:0.6414:0.3586:0.0	.	862	Q9UIG0	BAZ1B_HUMAN	K	862	ENSP00000342434:E862K;ENSP00000385442:E862K	ENSP00000342434:E862K	E	-	1	0	BAZ1B	72529143	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.667000	0.74451	2.667000	0.90743	0.491000	0.48974	GAA	BAZ1B	-	superfamily_ARM-type_fold	ENSG00000009954		0.413	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	HGNC	protein_coding	OTTHUMT00000252123.4	167	0.00	0	C	NM_032408		72891207	72891207	-1	no_errors	ENST00000339594	ensembl	human	known	69_37n	missense	149	18.03	33	SNP	0.999	T
BCAS2	10286	genome.wustl.edu	37	1	115113329	115113329	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:115113329C>T	ENST00000369541.3	-	5	509	c.462G>A	c.(460-462)caG>caA	p.Q154Q	BCAS2_ENST00000485021.1_5'UTR	NM_005872.2	NP_005863.1	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2	154					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cell junction (GO:0030054)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)		p.Q154Q(1)		biliary_tract(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)	13	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCTTAACTTCTGAAGTTCCT	0.303																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											34.0	28.0	30.0					1																	115113329		2187	4292	6479	-	-	-	SO:0001819	synonymous_variant	0			AB020623	CCDS874.1	1p13.2	2010-01-25			ENSG00000116752	ENSG00000116752			975	protein-coding gene	gene with protein product		605783				9731529, 10403562	Standard	NM_005872		Approved	DAM1, SPF27, Snt309	uc001efa.3	O75934	OTTHUMG00000011898	ENST00000369541.3:c.462G>A	1.37:g.115113329C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FGS0	Silent	SNP	pfam_BCAS2	p.Q154	ENST00000369541.3	37	c.462	CCDS874.1	1																																																																																			BCAS2	-	pfam_BCAS2	ENSG00000116752		0.303	BCAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAS2	HGNC	protein_coding	OTTHUMT00000032871.1	103	0.00	0	C	NM_005872		115113329	115113329	-1	no_errors	ENST00000369541	ensembl	human	known	69_37n	silent	76	37.40	46	SNP	1.000	T
BCR	613	genome.wustl.edu	37	22	23524096	23524097	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr22:23524096_23524097insC	ENST00000305877.8	+	1	1700_1701	c.949_950insC	c.(949-951)tccfs	p.S317fs	BCR_ENST00000398512.5_Frame_Shift_Ins_p.S317fs|BCR_ENST00000359540.3_Frame_Shift_Ins_p.S317fs	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	317	Binding to ABL SH2-domain.|Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CAGGTCCTACTCCCCCCGGAGT	0.653			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																	dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.955dupC	22.37:g.23524102_23524102dupC	ENSP00000303507:p.Ser317fs	Somatic		WXS	Illumina GAIIx	Phase_IV	P78501|Q12842|Q4LE80|Q6NZI3	Frame_Shift_Ins	INS	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_Ca-dep,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.R319fs	ENST00000305877.8	37	c.949_950	CCDS13806.1	22																																																																																			BCR	-	NULL	ENSG00000186716		0.653	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	55	0.00	0	-	NM_004327		23524096	23524097	+1	no_errors	ENST00000305877	ensembl	human	known	69_37n	frame_shift_ins	21	12.50	3	INS	1.000:1.000	C
BPNT1	10380	genome.wustl.edu	37	1	220242756	220242756	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:220242756G>A	ENST00000469520.2	-	6	801	c.352C>T	c.(352-354)Cct>Tct	p.P118S	BPNT1_ENST00000482136.1_5'UTR|BPNT1_ENST00000544404.1_Missense_Mutation_p.P63S|BPNT1_ENST00000322067.7_Missense_Mutation_p.P118S|BPNT1_ENST00000354807.3_Missense_Mutation_p.P118S|BPNT1_ENST00000414869.2_Missense_Mutation_p.P82S			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	118					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)	p.P118S(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		CCATCCAGAGGATCAACCCAG	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	86.0	88.0					1																	220242756		1821	4084	5905	-	-	-	SO:0001583	missense	0			AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.352C>T	1.37:g.220242756G>A	ENSP00000446828:p.Pro118Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Missense_Mutation	SNP	pfam_Inositol_monophosphatase	p.P118S	ENST00000469520.2	37	c.352	CCDS41469.1	1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873930	0.91664	.	.	ENSG00000162813	ENST00000322067;ENST00000469520;ENST00000354807;ENST00000302686;ENST00000544404;ENST00000414869;ENST00000463953;ENST00000498791;ENST00000480959;ENST00000498237	D;D;D;D;D;D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41;-4.41	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.99146	0.9705	H	0.97940	4.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98988	1.0807	10	0.87932	D	0	.	18.6378	0.91384	0.0:0.0:1.0:0.0	.	82;118;118	B4DUS9;A6NF51;O95861	.;.;BPNT1_HUMAN	S	118;118;118;118;63;82;82;82;63;118	ENSP00000318852:P118S;ENSP00000446828:P118S;ENSP00000346862:P118S;ENSP00000444398:P63S;ENSP00000410348:P82S;ENSP00000446953:P82S;ENSP00000446850:P82S;ENSP00000448740:P63S;ENSP00000449883:P118S	ENSP00000307087:P118S	P	-	1	0	BPNT1	218309379	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.554000	0.98121	2.482000	0.83794	0.456000	0.33151	CCT	BPNT1	-	pfam_Inositol_monophosphatase	ENSG00000162813		0.308	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPNT1	HGNC	protein_coding	OTTHUMT00000091137.2	72	0.00	0	G	NM_006085		220242756	220242756	-1	no_errors	ENST00000322067	ensembl	human	known	69_37n	missense	91	12.50	13	SNP	1.000	A
BRD7	29117	genome.wustl.edu	37	16	50357560	50357560	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr16:50357560C>T	ENST00000394688.3	-	12	1540	c.1381G>A	c.(1381-1383)Gat>Aat	p.D461N	BRD7_ENST00000394689.2_Missense_Mutation_p.D461N			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	461					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D461H(1)|p.D461N(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				AGTAAACTATCTGCCATGACA	0.413																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											126.0	106.0	113.0					16																	50357560		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1381G>A	16.37:g.50357560C>T	ENSP00000378180:p.Asp461Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Missense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.D461N	ENST00000394688.3	37	c.1381	CCDS10742.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.384140	0.95967	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	T;T	0.50001	0.76;0.76	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.70422	0.3222	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.984	T	0.70547	-0.4842	10	0.51188	T	0.08	-17.1109	19.6668	0.95895	0.0:1.0:0.0:0.0	.	461;461	Q9NPI1;Q9NPI1-2	BRD7_HUMAN;.	N	461	ENSP00000378180:D461N;ENSP00000378181:D461N	ENSP00000378180:D461N	D	-	1	0	BRD7	48915061	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	7.257000	0.78362	2.650000	0.89964	0.655000	0.94253	GAT	BRD7	-	pfam_DUF3512	ENSG00000166164		0.413	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	HGNC	protein_coding	OTTHUMT00000256874.3	217	0.00	0	C	NM_013263		50357560	50357560	-1	no_errors	ENST00000394689	ensembl	human	known	69_37n	missense	41	72.11	106	SNP	1.000	T
BTBD19	149478	genome.wustl.edu	37	1	45279142	45279142	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:45279142G>A	ENST00000450269.1	+	7	1051	c.712G>A	c.(712-714)Gag>Aag	p.E238K	BTBD19_ENST00000409335.2_Missense_Mutation_p.E200K|BTBD19_ENST00000453418.1_3'UTR	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19	238								p.E238K(2)		breast(1)|endometrium(1)	2						CGCCCTGGAAGAGCAGAACCG	0.716																																						dbGAP											2	Substitution - Missense(2)	breast(2)											26.0	41.0	37.0					1																	45279142		692	1591	2283	-	-	-	SO:0001583	missense	0					1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.712G>A	1.37:g.45279142G>A	ENSP00000395461:p.Glu238Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E384|B7ZC36|B7ZC37	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.E238K	ENST00000450269.1	37	c.712		1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571083	0.28003	.	.	ENSG00000222009	ENST00000450269;ENST00000409335	T;T	0.71934	-0.61;0.86	5.01	5.01	0.66863	.	.	.	.	.	T	0.48370	0.1496	N	0.12182	0.205	0.80722	D	1	B	0.18863	0.031	B	0.09377	0.004	T	0.43015	-0.9417	9	0.17369	T	0.5	-6.7497	9.2908	0.37786	0.0953:0.0:0.9047:0.0	.	238	C9JJ37	BTBDJ_HUMAN	K	238;200	ENSP00000395461:E238K;ENSP00000386506:E200K	ENSP00000386506:E200K	E	+	1	0	BTBD19	45051729	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.662000	0.54510	2.584000	0.87258	0.650000	0.86243	GAG	BTBD19	-	NULL	ENSG00000222009		0.716	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	BTBD19	HGNC	protein_coding		127	0.00	0	G	NM_001136537		45279142	45279142	+1	no_errors	ENST00000450269	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	1.000	A
BTBD9	114781	genome.wustl.edu	37	6	38548069	38548069	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:38548069G>A	ENST00000481247.1	-	5	1110	c.959C>T	c.(958-960)tCc>tTc	p.S320F	BTBD9_ENST00000408958.1_Missense_Mutation_p.S252F|BTBD9_ENST00000419706.2_Missense_Mutation_p.S261F|BTBD9_ENST00000314100.6_Missense_Mutation_p.S252F|BTBD9_ENST00000403056.1_Missense_Mutation_p.S320F	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	320					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)			p.S252F(1)|p.S320F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						CTCGATGCCGGAACGGCAGTC	0.428																																						dbGAP											2	Substitution - Missense(2)	breast(2)											140.0	134.0	136.0					6																	38548069		1899	4118	6017	-	-	-	SO:0001583	missense	0				CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.959C>T	6.37:g.38548069G>A	ENSP00000418751:p.Ser320Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q494V9|Q494W1|Q96M00	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_BTB/POZ_fold,superfamily_Galactose-bd-like,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S320F	ENST00000481247.1	37	c.959	CCDS47418.1	6	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855511	0.51376	.	.	ENSG00000183826	ENST00000314100;ENST00000481247;ENST00000419706;ENST00000403056;ENST00000408958	D;D;T;D;D	0.98296	-4.85;-4.85;-1.04;-4.85;-4.85	5.48	5.48	0.80851	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.217432	0.49305	D	0.000141	D	0.96784	0.8950	L	0.34521	1.04	0.58432	D	0.999999	P;D	0.61697	0.593;0.99	B;P	0.56343	0.257;0.796	D	0.95508	0.8583	10	0.15952	T	0.53	.	19.3387	0.94332	0.0:0.0:1.0:0.0	.	261;320	Q494V9;Q96Q07	.;BTBD9_HUMAN	F	252;320;261;320;252	ENSP00000323408:S252F;ENSP00000418751:S320F;ENSP00000415365:S261F;ENSP00000386121:S320F;ENSP00000386211:S252F	ENSP00000323408:S252F	S	-	2	0	BTBD9	38656047	1.000000	0.71417	0.993000	0.49108	0.673000	0.39480	7.817000	0.86213	2.588000	0.87417	0.655000	0.94253	TCC	BTBD9	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like	ENSG00000183826		0.428	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD9	HGNC	protein_coding	OTTHUMT00000040433.2	142	0.00	0	G	NM_152733		38548069	38548069	-1	no_errors	ENST00000403056	ensembl	human	known	69_37n	missense	96	28.89	39	SNP	0.985	A
C11orf45	219833	genome.wustl.edu	37	11	128773376	128773376	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:128773376delT	ENST00000524878.1	-	3	337	c.167delA	c.(166-168)aacfs	p.N56fs	KCNJ5_ENST00000529694.1_Intron|KCNJ5_ENST00000338350.4_Intron|C11orf45_ENST00000530168.1_5'UTR|C11orf45_ENST00000310799.3_Frame_Shift_Del_p.N56fs			Q8TAV5	CK045_HUMAN	chromosome 11 open reading frame 45	56						extracellular region (GO:0005576)				endometrium(1)|kidney(1)|lung(2)|pancreas(1)|prostate(2)	7	all_hematologic(175;0.0641)	Lung NSC(97;0.00521)|Breast(109;0.00715)|all_lung(97;0.0111)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.00531)|LUSC - Lung squamous cell carcinoma(976;0.0193)|Lung(977;0.0195)		TGAGGAGGTGTTACCCTCACT	0.517																																						dbGAP											0													88.0	76.0	80.0					11																	128773376		2201	4297	6498	-	-	-	SO:0001589	frameshift_variant	0			AK125634	CCDS8478.1	11q24.3	2012-05-30			ENSG00000174370	ENSG00000174370			28584	protein-coding gene	gene with protein product							Standard	NM_001256088		Approved	MGC35558, FLJ43646	uc001qeu.3	Q8TAV5	OTTHUMG00000165796	ENST00000524878.1:c.167delA	11.37:g.128773376delT	ENSP00000431922:p.Asn56fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAD0	Frame_Shift_Del	DEL	NULL	p.N56fs	ENST00000524878.1	37	c.167	CCDS8478.1	11																																																																																			C11orf45	-	NULL	ENSG00000174370		0.517	C11orf45-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	C11orf45	HGNC	protein_coding	OTTHUMT00000386243.1	70	0.00	0	T	NM_145013		128773376	128773376	-1	no_errors	ENST00000310799	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	0.000	-
C15orf39	56905	genome.wustl.edu	37	15	75498915	75498915	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr15:75498915C>T	ENST00000360639.2	+	2	846	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	C15orf39_ENST00000567617.1_Silent_p.L176L|C15orf39_ENST00000394987.4_Silent_p.L176L			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	176						cytoplasm (GO:0005737)		p.L176L(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						ACCCTGCTCTCTGGCCCCAGC	0.627																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											52.0	56.0	54.0					15																	75498915		2197	4295	6492	-	-	-	SO:0001819	synonymous_variant	0			AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.526C>T	15.37:g.75498915C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	NULL	p.S44F	ENST00000360639.2	37	c.131	CCDS10276.1	15																																																																																			C15orf39	-	NULL	ENSG00000167173		0.627	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf39	HGNC	protein_coding	OTTHUMT00000286410.1	68	0.00	0	C	NM_015492		75498915	75498915	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000565074	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.004	T
TOPAZ1	375337	genome.wustl.edu	37	3	44285586	44285586	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:44285586G>A	ENST00000309765.4	+	2	1756	c.1588G>A	c.(1588-1590)Gat>Aat	p.D530N		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	530						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)	p.D530N(2)									TAGGCAAGTTGATGTCCCTAA	0.378																																						dbGAP											2	Substitution - Missense(2)	breast(2)											118.0	94.0	101.0					3																	44285586		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.1588G>A	3.37:g.44285586G>A	ENSP00000310303:p.Asp530Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D530N	ENST00000309765.4	37	c.1588	CCDS46809.1	3	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489565	0.26686	.	.	ENSG00000173769	ENST00000309765	T	0.12361	2.69	5.55	2.4	0.29515	.	0.206019	0.37669	N	0.001993	T	0.08447	0.0210	L	0.32530	0.975	0.28318	N	0.922362	B	0.13594	0.008	B	0.14578	0.011	T	0.12451	-1.0547	10	0.38643	T	0.18	-17.19	3.2808	0.06915	0.2711:0.2218:0.5071:0.0	.	530	Q8N9V7	CC077_HUMAN	N	530	ENSP00000310303:D530N	ENSP00000310303:D530N	D	+	1	0	C3orf77	44260590	0.983000	0.35010	1.000000	0.80357	0.025000	0.11179	0.722000	0.25925	1.348000	0.45733	0.650000	0.86243	GAT	C3orf77	-	NULL	ENSG00000173769		0.378	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf77	HGNC	protein_coding	OTTHUMT00000343247.1	88	0.00	0	G	NM_001145030		44285586	44285586	+1	no_errors	ENST00000309765	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	0.998	A
C5orf60	285679	genome.wustl.edu	37	5	179069426	179069426	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:179069426C>T	ENST00000448248.2	-	5	773	c.748G>A	c.(748-750)Gct>Act	p.A250T	C5orf60_ENST00000506142.1_5'Flank	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	139						integral component of membrane (GO:0016021)		p.A250T(1)		NS(1)|breast(1)|kidney(5)	7						CGTCCAGCAGCGTTGGCACAT	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											172.0	148.0	155.0					5																	179069426		692	1591	2283	-	-	-	SO:0001583	missense	0			BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.748G>A	5.37:g.179069426C>T	ENSP00000404583:p.Ala250Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L488|B7ZM52|B7ZM53	Missense_Mutation	SNP	NULL	p.A250T	ENST00000448248.2	37	c.748	CCDS47353.1	5	.	.	.	.	.	.	.	.	.	.	c	8.348	0.830146	0.16749	.	.	ENSG00000204661	ENST00000448248	T	0.28666	1.6	0.517	0.517	0.17025	.	.	.	.	.	T	0.47303	0.1438	.	.	.	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.67725	0.953;0.953	T	0.25606	-1.0127	7	0.87932	D	0	.	.	.	.	.	254;250	A6NFR6-2;A6NFR6-4	.;.	T	250	ENSP00000404583:A250T	ENSP00000404583:A250T	A	-	1	0	C5orf60	179002032	0.020000	0.18652	0.005000	0.12908	0.004000	0.04260	0.413000	0.21148	0.539000	0.28788	0.306000	0.20318	GCT	C5orf60	-	NULL	ENSG00000204661		0.557	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf60	HGNC	protein_coding	OTTHUMT00000372148.2	243	0.00	0	C	NM_001142306		179069426	179069426	-1	no_errors	ENST00000448248	ensembl	human	known	69_37n	missense	114	38.71	72	SNP	0.006	T
CACNA1C	775	genome.wustl.edu	37	12	2705075	2705075	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:2705075C>T	ENST00000347598.4	+	20	2699	c.2699C>T	c.(2698-2700)aCg>aTg	p.T900M	CACNA1C_ENST00000399655.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399641.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000335762.5_Missense_Mutation_p.T925M|CACNA1C_ENST00000399638.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000327702.7_Missense_Mutation_p.T900M|CACNA1C_ENST00000399634.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399603.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399617.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399644.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399606.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000406454.3_Missense_Mutation_p.T900M|CACNA1C_ENST00000399621.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399595.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000344100.3_Missense_Mutation_p.T900M|CACNA1C_ENST00000399591.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399601.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000402845.3_Missense_Mutation_p.T900M|CACNA1C_ENST00000480911.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399629.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399649.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399597.1_Missense_Mutation_p.T900M|CACNA1C_ENST00000399637.1_Missense_Mutation_p.T900M	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	900					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.T900M(3)|p.T930M(1)|p.T435M(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTCAATGACACGATCTTCACC	0.562																																						dbGAP											5	Substitution - Missense(5)	breast(5)											126.0	127.0	127.0					12																	2705075		2103	4220	6323	-	-	-	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.2699C>T	12.37:g.2705075C>T	ENSP00000266376:p.Thr900Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.T900M	ENST00000347598.4	37	c.2699	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532729	0.64972	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96200	-3.88;-3.88;-3.91;-3.87;-3.87;-3.88;-3.9;-3.79;-3.83;-3.88;-3.78;-3.78;-3.88;-3.93;-3.79;-3.72;-3.94;-3.89;-3.88;-3.91;-3.82;-3.91;-3.94	4.8	3.84	0.44239	.	0.208129	0.49305	D	0.000151	D	0.96476	0.8850	M	0.73962	2.25	0.33482	D	0.587614	D;D;D;D;D;D;D;P;D;P;D;P;D;D;P;D;D;P;D;P;P;D;D;D;P;D	0.76494	0.997;0.983;0.98;0.99;0.986;0.986;0.983;0.947;0.97;0.813;0.986;0.954;0.987;0.99;0.923;0.958;0.999;0.95;0.986;0.95;0.954;0.986;0.97;0.983;0.89;0.964	P;P;P;P;P;P;P;P;P;P;P;P;P;P;B;P;P;P;P;P;P;P;P;P;B;P	0.62382	0.901;0.642;0.508;0.572;0.785;0.785;0.642;0.782;0.498;0.493;0.785;0.454;0.703;0.828;0.266;0.677;0.862;0.594;0.785;0.594;0.454;0.785;0.642;0.721;0.337;0.536	D	0.97014	0.9738	10	0.51188	T	0.08	.	10.4253	0.44373	0.3894:0.6106:0.0:0.0	.	900;897;900;900;900;900;900;900;900;900;900;900;871;900;900;900;900;900;900;900;900;900;900;900;900;900	Q13936-14;Q13936-35;Q13936;E9PDI6;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	M	925;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;900;741	ENSP00000336982:T925M;ENSP00000382563:T900M;ENSP00000437936:T900M;ENSP00000382552:T900M;ENSP00000382547:T900M;ENSP00000382506:T900M;ENSP00000382530:T900M;ENSP00000382546:T900M;ENSP00000382500:T900M;ENSP00000382549:T900M;ENSP00000266376:T900M;ENSP00000382515:T900M;ENSP00000382510:T900M;ENSP00000341092:T900M;ENSP00000382537:T900M;ENSP00000329877:T900M;ENSP00000382557:T900M;ENSP00000385724:T900M;ENSP00000382512:T900M;ENSP00000382542:T900M;ENSP00000382526:T900M;ENSP00000385896:T900M;ENSP00000382504:T900M	ENSP00000323129:T741M	T	+	2	0	CACNA1C	2575336	0.994000	0.37717	0.963000	0.40424	0.850000	0.48378	3.633000	0.54295	2.501000	0.84356	0.462000	0.41574	ACG	CACNA1C	-	NULL	ENSG00000151067		0.562	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	135	0.00	0	C	NM_000719		2705075	2705075	+1	no_errors	ENST00000399634	ensembl	human	known	69_37n	missense	56	35.63	31	SNP	1.000	T
PRIMPOL	201973	genome.wustl.edu	37	4	185593491	185593491	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:185593491G>T	ENST00000314970.6	+	7	1154	c.721G>T	c.(721-723)Gaa>Taa	p.E241*	PRIMPOL_ENST00000503752.1_Nonsense_Mutation_p.E241*|PRIMPOL_ENST00000515774.1_Nonsense_Mutation_p.E112*|PRIMPOL_ENST00000512834.1_Nonsense_Mutation_p.E241*	NM_152683.2	NP_689896	Q96LW4	PRIPO_HUMAN	primase and polymerase (DNA-directed)	241					mitochondrial DNA replication (GO:0006264)|replication fork processing (GO:0031297)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA primase activity (GO:0003896)|DNA-directed DNA polymerase activity (GO:0003887)|manganese ion binding (GO:0030145)	p.E241*(1)									GGCTACAGAGGAAAGCTGGAC	0.443																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											76.0	81.0	80.0					4																	185593491		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057729	CCDS3837.1, CCDS75211.1, CCDS75212.1	4q35.1	2013-09-27	2013-09-27	2013-09-27	ENSG00000164306	ENSG00000164306			26575	protein-coding gene	gene with protein product		615421	"""coiled-coil domain containing 111"""	CCDC111		12477932	Standard	XM_005262814		Approved	FLJ33167	uc003iwk.2	Q96LW4	OTTHUMG00000160495	ENST00000314970.6:c.721G>T	4.37:g.185593491G>T	ENSP00000313816:p.Glu241*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP55|D6RDM1|Q5HYJ9	Nonsense_Mutation	SNP	pfam_DNA_primase_UL52/UL70_Herpvir,pfam_DNA_primase_S	p.E241*	ENST00000314970.6	37	c.721	CCDS3837.1	4	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000880	0.74818	.	.	ENSG00000164306	ENST00000314970;ENST00000515774;ENST00000503752;ENST00000512834	.	.	.	5.39	3.52	0.40303	.	0.536026	0.18959	N	0.126447	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-9.7505	4.3663	0.11227	0.2298:0.34:0.4302:0.0	.	.	.	.	X	241;112;241;241	.	ENSP00000313816:E241X	E	+	1	0	CCDC111	185830485	0.001000	0.12720	0.023000	0.16930	0.002000	0.02628	0.100000	0.15231	1.517000	0.48917	0.555000	0.69702	GAA	CCDC111	-	pfam_DNA_primase_S	ENSG00000164306		0.443	PRIMPOL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC111	HGNC	protein_coding	OTTHUMT00000360827.1	60	0.00	0	G	NM_152683		185593491	185593491	+1	no_errors	ENST00000314970	ensembl	human	known	69_37n	nonsense	18	37.93	11	SNP	0.003	T
SPECC1	92521	genome.wustl.edu	37	17	20224794	20224794	+	IGR	SNP	A	A	G	rs542179283		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:20224794A>G	ENST00000395530.2	+	0	8133				CCDC144CP_ENST00000340196.4_RNA|AC004702.2_ENST00000580225.1_lincRNA|U6_ENST00000517027.1_RNA	NM_001033555.2	NP_001028727.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1						cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GCTGGTGGAAAAACAGCGTCG	0.637																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808		17.37:g.20224794A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	RNA	SNP	-	NULL	ENST00000395530.2	37	NULL	CCDS42281.1	17																																																																																			CCDC144C	-	-	ENSG00000154898		0.637	SPECC1-004	KNOWN	basic|CCDS	protein_coding	CCDC144C	HGNC	protein_coding	OTTHUMT00000132368.3	104	0.95	1	A	NM_152904		20224794	20224794	+1	no_errors	ENST00000340196	ensembl	human	known	69_37n	rna	52	13.33	8	SNP	0.000	G
EFCC1	79825	genome.wustl.edu	37	3	128758634	128758634	+	Silent	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:128758634C>G	ENST00000480450.1	+	8	1740	c.1740C>G	c.(1738-1740)ccC>ccG	p.P580P	EFCC1_ENST00000436022.2_Silent_p.P143P			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	580							calcium ion binding (GO:0005509)	p.P580P(1)|p.P143P(1)									GGAGACAGCCCTCGGCACCAG	0.667																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											52.0	49.0	50.0					3																	128758634		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1740C>G	3.37:g.128758634C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYE2	Silent	SNP	NULL	p.P143	ENST00000480450.1	37	c.429	CCDS3054.2	3																																																																																			CCDC48	-	NULL	ENSG00000114654		0.667	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC48	HGNC	protein_coding	OTTHUMT00000352832.1	38	0.00	0	C	NM_024768		128758634	128758634	+1	no_errors	ENST00000436022	ensembl	human	known	69_37n	silent	14	48.15	13	SNP	0.000	G
CCDC91	55297	genome.wustl.edu	37	12	28603099	28603099	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:28603099G>C	ENST00000545336.1	+	12	1187	c.768G>C	c.(766-768)caG>caC	p.Q256H	CCDC91_ENST00000306172.5_Missense_Mutation_p.Q226H|CCDC91_ENST00000381259.1_Missense_Mutation_p.Q256H|CCDC91_ENST00000381256.1_Missense_Mutation_p.Q220H|CCDC91_ENST00000539107.1_Missense_Mutation_p.Q220H|CCDC91_ENST00000540401.1_3'UTR			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	256	Homodimerization.				protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Q256H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					TGTAGCATCAGAGGCTCCTTG	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	67.0	63.0					12																	28603099		2198	4292	6490	-	-	-	SO:0001583	missense	0			AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.768G>C	12.37:g.28603099G>C	ENSP00000438040:p.Gln256His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Missense_Mutation	SNP	NULL	p.Q256H	ENST00000545336.1	37	c.768	CCDS8716.1	12	.	.	.	.	.	.	.	.	.	.	G	18.92	3.724946	0.68959	.	.	ENSG00000123106	ENST00000540794;ENST00000539107;ENST00000536442;ENST00000545336;ENST00000545737;ENST00000381259;ENST00000381256;ENST00000306172	T;T;T;T;T;T;T;T	0.55930	0.49;0.95;1.18;1.24;1.18;1.24;0.95;1.21	5.98	5.1	0.69264	.	0.000000	0.64402	D	0.000011	T	0.58609	0.2134	N	0.24115	0.695	0.33929	D	0.641804	D;D;D	0.76494	0.994;0.999;0.997	D;D;D	0.85130	0.991;0.997;0.995	T	0.71324	-0.4627	10	0.72032	D	0.01	-12.5418	12.4738	0.55801	0.0766:0.0:0.9234:0.0	.	220;256;226	Q7Z6B0-3;Q7Z6B0;Q7Z6B0-2	.;CCD91_HUMAN;.	H	52;220;256;256;256;256;220;226	ENSP00000441714:Q52H;ENSP00000440513:Q220H;ENSP00000445660:Q256H;ENSP00000438040:Q256H;ENSP00000442544:Q256H;ENSP00000370658:Q256H;ENSP00000370655:Q220H;ENSP00000305075:Q226H	ENSP00000305075:Q226H	Q	+	3	2	CCDC91	28494366	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.587000	0.46128	1.538000	0.49270	0.591000	0.81541	CAG	CCDC91	-	NULL	ENSG00000123106		0.358	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC91	HGNC	protein_coding	OTTHUMT00000402447.1	53	0.00	0	G	NM_018318		28603099	28603099	+1	no_errors	ENST00000381259	ensembl	human	known	69_37n	missense	26	35.00	14	SNP	1.000	C
CD1E	913	genome.wustl.edu	37	1	158326632	158326632	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:158326632G>A	ENST00000368167.3	+	6	1352	c.1113G>A	c.(1111-1113)tgG>tgA	p.W371*	CD1E_ENST00000368165.3_Nonsense_Mutation_p.W281*|CD1E_ENST00000368154.1_Nonsense_Mutation_p.W127*|CD1E_ENST00000368157.1_Nonsense_Mutation_p.W115*|CD1E_ENST00000368166.3_Nonsense_Mutation_p.W170*|CD1E_ENST00000368161.3_3'UTR|CD1E_ENST00000368164.3_3'UTR|CD1E_ENST00000368160.3_Nonsense_Mutation_p.W359*|CD1E_ENST00000368155.3_Nonsense_Mutation_p.W214*|CD1E_ENST00000368163.3_Nonsense_Mutation_p.W304*|CD1E_ENST00000444681.2_Nonsense_Mutation_p.W272*|CD1E_ENST00000368156.1_Nonsense_Mutation_p.W269*|CD1E_ENST00000452291.2_Nonsense_Mutation_p.W182*	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	371					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.W371*(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					AAGTATCGTGGATCAAAAACA	0.433																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											115.0	111.0	112.0					1																	158326632		1923	4131	6054	-	-	-	SO:0001587	stop_gained	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.1113G>A	1.37:g.158326632G>A	ENSP00000357149:p.Trp371*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Nonsense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.W371*	ENST00000368167.3	37	c.1113	CCDS41417.1	1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069041	0.55539	.	.	ENSG00000158488	ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368157;ENST00000368160;ENST00000368156;ENST00000368155;ENST00000368154	.	.	.	4.76	3.84	0.44239	.	0.617011	0.13639	N	0.373107	.	.	.	.	.	.	0.53688	D	0.999978	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3948	8.6395	0.33968	0.1042:0.0:0.8958:0.0	.	.	.	.	X	272;371;182;281;170;304;115;359;269;214;127	.	ENSP00000357136:W127X	W	+	3	0	CD1E	156593256	0.142000	0.22610	0.004000	0.12327	0.008000	0.06430	3.521000	0.53472	1.217000	0.43442	0.655000	0.94253	TGG	CD1E	-	NULL	ENSG00000158488		0.433	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	128	0.00	0	G	NM_030893		158326632	158326632	+1	no_errors	ENST00000368167	ensembl	human	known	69_37n	nonsense	63	47.54	58	SNP	0.004	A
CD200R1L	344807	genome.wustl.edu	37	3	112546390	112546390	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:112546390G>A	ENST00000398214.1	-	3	479	c.254C>T	c.(253-255)aCa>aTa	p.T85I	CD200R1L_ENST00000488794.1_Missense_Mutation_p.T64I|CD200R1L_ENST00000448932.1_Missense_Mutation_p.T64I	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	85	Ig-like V-type.					integral component of membrane (GO:0016021)		p.T85I(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						GGTCTCATTTGTTTCTTTCTT	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											170.0	161.0	164.0					3																	112546390		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.254C>T	3.37:g.112546390G>A	ENSP00000381272:p.Thr85Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6WHB7	Missense_Mutation	SNP	pfam_CD80_C2-set,pfscan_Ig-like	p.T85I	ENST00000398214.1	37	c.254	CCDS43131.1	3	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185322	0.38609	.	.	ENSG00000206531	ENST00000398214;ENST00000488794;ENST00000448932	T;T;T	0.31247	1.5;1.5;1.5	3.99	-7.98	0.01135	Immunoglobulin-like fold (1);	1.710450	0.02524	N	0.092856	T	0.41880	0.1178	L	0.57536	1.79	0.09310	N	1	D	0.89917	1.0	D	0.69307	0.963	T	0.59380	-0.7465	10	0.54805	T	0.06	.	2.9438	0.05839	0.1636:0.4479:0.1434:0.2451	.	85	Q6Q8B3	MO2R2_HUMAN	I	85;64;64	ENSP00000381272:T85I;ENSP00000418413:T64I;ENSP00000415132:T64I	ENSP00000381272:T85I	T	-	2	0	CD200R1L	114029080	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-6.453000	0.00065	-1.884000	0.01119	0.655000	0.94253	ACA	CD200R1L	-	NULL	ENSG00000206531		0.438	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD200R1L	HGNC	protein_coding	OTTHUMT00000354365.1	330	0.00	0	G	NM_001008784		112546390	112546390	-1	no_errors	ENST00000398214	ensembl	human	known	69_37n	missense	299	22.68	88	SNP	0.000	A
CD4	920	genome.wustl.edu	37	12	6923397	6923397	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:6923397G>A	ENST00000011653.4	+	4	562	c.304G>A	c.(304-306)Gaa>Aaa	p.E102K	CD4_ENST00000541982.1_Missense_Mutation_p.E47K|CD4_ENST00000538827.1_3'UTR	NM_000616.4|NM_001195015.2|NM_001195016.2|NM_001195017.2	NP_000607.1|NP_001181944.1|NP_001181945.1|NP_001181946.1	P01730	CD4_HUMAN	CD4 molecule	102	Ig-like V-type.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cytokine production (GO:0001816)|defense response to Gram-negative bacterium (GO:0050829)|entry into host cell (GO:0030260)|enzyme linked receptor protein signaling pathway (GO:0007167)|immune response (GO:0006955)|induction by virus of host cell-cell fusion (GO:0006948)|innate immune response (GO:0045087)|maintenance of protein location in cell (GO:0032507)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase activity (GO:0045860)|protein palmitoleylation (GO:0045234)|regulation of defense response to virus by virus (GO:0050690)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|T cell selection (GO:0045058)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|enzyme binding (GO:0019899)|extracellular matrix structural constituent (GO:0005201)|glycoprotein binding (GO:0001948)|MHC class II protein binding (GO:0042289)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|zinc ion binding (GO:0008270)	p.E102K(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	23		Myeloproliferative disorder(1001;0.0122)			Antithymocyte globulin(DB00098)	TCTTAAGATAGAAGACTCAGA	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	135.0	137.0					12																	6923397		2203	4300	6503	-	-	-	SO:0001583	missense	0			M35160	CCDS8562.1	12p13.31	2013-01-11	2006-03-28		ENSG00000010610	ENSG00000010610		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1678	protein-coding gene	gene with protein product		186940	"""CD4 antigen (p55)"", ""T-cell surface glycoprotein CD4"""				Standard	NM_000616		Approved		uc001qqv.2	P01730	OTTHUMG00000168514	ENST00000011653.4:c.304G>A	12.37:g.6923397G>A	ENSP00000011653:p.Glu102Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R737|D3DUS5|Q4ZGK2|Q5U066|Q9UDE5	Missense_Mutation	SNP	pfam_CD4-extracel,pfam_Ig_C2-set,pfam_Tcell_CD4_Cterm,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,pfam_NK_rcpt_2B4_Ig_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like,prints_Ag_CD4	p.E102K	ENST00000011653.4	37	c.304	CCDS8562.1	12	.	.	.	.	.	.	.	.	.	.	G	10.21	1.286874	0.23478	.	.	ENSG00000010610	ENST00000011653;ENST00000541982	T;T	0.68331	-0.32;-0.32	5.04	-10.1	0.00402	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	1.354690	0.04601	N	0.398577	T	0.58293	0.2112	M	0.69823	2.125	0.09310	N	1	B;B	0.17268	0.021;0.013	B;B	0.26864	0.074;0.039	T	0.33033	-0.9884	10	0.18710	T	0.47	-0.1713	8.0274	0.30444	0.1097:0.1843:0.6071:0.0989	.	47;102	F5H480;P01730	.;CD4_HUMAN	K	102;47	ENSP00000011653:E102K;ENSP00000445167:E47K	ENSP00000011653:E102K	E	+	1	0	CD4	6793658	0.000000	0.05858	0.000000	0.03702	0.132000	0.20833	-0.910000	0.04054	-2.029000	0.00930	0.313000	0.20887	GAA	CD4	-	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,pfam_NK_rcpt_2B4_Ig_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000010610		0.493	CD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD4	HGNC	protein_coding	OTTHUMT00000399978.1	562	0.00	0	G	NM_000616		6923397	6923397	+1	no_errors	ENST00000011653	ensembl	human	known	69_37n	missense	263	15.82	50	SNP	0.000	A
CDK14	5218	genome.wustl.edu	37	7	90492537	90492537	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:90492537G>A	ENST00000380050.3	+	6	723	c.592G>A	c.(592-594)Gac>Aac	p.D198N	CDK14_ENST00000265741.3_Missense_Mutation_p.D180N|CDK14_ENST00000436577.2_Missense_Mutation_p.D69N|CDK14_ENST00000406263.1_Missense_Mutation_p.D152N			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	198	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.D180N(1)|p.D198N(1)		breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GCTACTTCATGACATCATCCA	0.303																																					GBM(83;1228 1256 8311 16577 31299)	dbGAP											2	Substitution - Missense(2)	breast(2)											106.0	102.0	103.0					7																	90492537		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.592G>A	7.37:g.90492537G>A	ENSP00000369390:p.Asp198Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D198N	ENST00000380050.3	37	c.592		7	.	.	.	.	.	.	.	.	.	.	G	31	5.094288	0.94149	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.01	5.01	0.66863	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68559	0.3014	M	0.69358	2.11	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.996	D;D;D	0.91635	0.979;0.999;0.979	T	0.71859	-0.4465	10	0.72032	D	0.01	-18.6614	18.6829	0.91553	0.0:0.0:1.0:0.0	.	69;180;198	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	N	198;180;152;69	ENSP00000369390:D198N;ENSP00000265741:D180N;ENSP00000385034:D152N;ENSP00000398936:D69N	ENSP00000265741:D180N	D	+	1	0	CDK14	90330473	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.269000	0.95684	2.472000	0.83506	0.650000	0.86243	GAC	CDK14	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000058091		0.303	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	107	0.00	0	G	NM_012395		90492537	90492537	+1	no_errors	ENST00000380050	ensembl	human	known	69_37n	missense	154	18.09	34	SNP	1.000	A
CENPE	1062	genome.wustl.edu	37	4	104064461	104064461	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:104064461C>A	ENST00000265148.3	-	34	5337	c.5248G>T	c.(5248-5250)Gaa>Taa	p.E1750*	CENPE_ENST00000380026.3_Nonsense_Mutation_p.E1725*	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1750					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.E1750*(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTGATATTTCATTTGTTTTC	0.323																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											171.0	161.0	165.0					4																	104064461		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5248G>T	4.37:g.104064461C>A	ENSP00000265148:p.Glu1750*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.E1750*	ENST00000265148.3	37	c.5248	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	43	9.927296	0.99298	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	.	.	.	5.16	3.31	0.37934	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	6.5089	0.22210	0.0:0.719:0.1837:0.0972	.	.	.	.	X	1750;1750;1725	.	ENSP00000265148:E1750X	E	-	1	0	CENPE	104283910	0.018000	0.18449	0.994000	0.49952	0.350000	0.29205	0.748000	0.26305	1.309000	0.44985	0.643000	0.83706	GAA	CENPE	-	NULL	ENSG00000138778		0.323	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		157	0.00	0	C			104064461	104064461	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	nonsense	66	41.07	46	SNP	0.996	A
CEP192	55125	genome.wustl.edu	37	18	13099581	13099581	+	Splice_Site	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr18:13099581G>A	ENST00000325971.8	+	35	6468		c.e35+1		CEP192_ENST00000430049.2_Splice_Site|CEP192_ENST00000506447.1_Splice_Site|CEP192_ENST00000540847.2_Splice_Site			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa						centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.?(2)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGGACAGAAGGTACTTTTAAA	0.338																																						dbGAP											2	Unknown(2)	breast(2)											119.0	116.0	117.0					18																	13099581		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.4875+1G>A	18.37:g.13099581G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Splice_Site	SNP	-	e36+1	ENST00000325971.8	37	c.6663+1		18	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113804	0.77210	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	.	.	.	5.66	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5412	0.67997	0.0718:0.0:0.9282:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CEP192	13089581	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.267000	0.72546	1.374000	0.46228	0.650000	0.86243	.	CEP192	-	-	ENSG00000101639		0.338	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		256	0.00	0	G	NM_032142	Intron	13099581	13099581	+1	no_errors	ENST00000506447	ensembl	human	known	69_37n	splice_site	164	14.58	28	SNP	1.000	A
CHD2	1106	genome.wustl.edu	37	15	93499827	93499827	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr15:93499827C>T	ENST00000394196.4	+	16	3016	c.1948C>T	c.(1948-1950)Cag>Tag	p.Q650*	CHD2_ENST00000557381.1_Nonsense_Mutation_p.Q650*	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	650	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)	p.Q650*(2)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GACCCCTCTTCAGAATTCCCT	0.428																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											99.0	99.0	99.0					15																	93499827		2197	4298	6495	-	-	-	SO:0001587	stop_gained	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1948C>T	15.37:g.93499827C>T	ENSP00000377747:p.Gln650*	Somatic		WXS	Illumina GAIIx	Phase_IV	C6G482|Q96IP5	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Q650*	ENST00000394196.4	37	c.1948	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	C	45	11.792958	0.99603	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	.	.	.	5.52	5.52	0.82312	.	0.000000	0.32533	U	0.005969	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.195	19.4473	0.94852	0.0:1.0:0.0:0.0	.	.	.	.	X	650	.	ENSP00000377747:Q650X	Q	+	1	0	CHD2	91300831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.599000	0.87857	0.563000	0.77884	CAG	CHD2	-	pfam_SNF2_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000173575		0.428	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	204	0.00	0	C	NM_001271		93499827	93499827	+1	no_errors	ENST00000557381	ensembl	human	putative	69_37n	nonsense	102	20.16	26	SNP	1.000	T
CHST1	8534	genome.wustl.edu	37	11	45671732	45671732	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:45671732G>A	ENST00000308064.2	-	4	1412	c.742C>T	c.(742-744)Cgc>Tgc	p.R248C	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	248					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)	p.R248C(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		TACGTGTCGCGGAAGGTCTCG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	56.0	58.0					11																	45671732		2203	4299	6502	-	-	-	SO:0001583	missense	0			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.742C>T	11.37:g.45671732G>A	ENSP00000309270:p.Arg248Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQP2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.R248C	ENST00000308064.2	37	c.742	CCDS7913.1	11	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076341	0.55753	.	.	ENSG00000175264	ENST00000308064	D	0.84370	-1.84	4.89	4.89	0.63831	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.91129	0.7207	M	0.76002	2.32	0.58432	D	0.999999	D	0.89917	1.0	D	0.71414	0.973	D	0.91569	0.5270	10	0.54805	T	0.06	-17.6998	13.8502	0.63492	0.0:0.0:0.8466:0.1534	.	248	O43916	CHST1_HUMAN	C	248	ENSP00000309270:R248C	ENSP00000309270:R248C	R	-	1	0	CHST1	45628308	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	4.026000	0.57232	2.252000	0.74401	0.462000	0.41574	CGC	CHST1	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	ENSG00000175264		0.647	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1	53	0.00	0	G	NM_003654		45671732	45671732	-1	no_errors	ENST00000308064	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	A
CLEC4M	10332	genome.wustl.edu	37	19	7832457	7832457	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:7832457C>G	ENST00000327325.5	+	6	1110	c.992C>G	c.(991-993)tCa>tGa	p.S331*	CLEC4M_ENST00000359059.5_Nonsense_Mutation_p.S264*|CLEC4M_ENST00000357361.2_Intron|CLEC4M_ENST00000597522.1_Intron|CLEC4M_ENST00000596363.1_Intron|CLEC4M_ENST00000248228.4_Nonsense_Mutation_p.S309*|CLEC4M_ENST00000334806.5_Nonsense_Mutation_p.S280*|CLEC4M_ENST00000394122.2_Nonsense_Mutation_p.S319*|CLEC4M_ENST00000596707.1_Nonsense_Mutation_p.S264*|CLEC4M_ENST00000595496.1_Nonsense_Mutation_p.S195*	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	331	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)	p.S331*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						ATGGGACTTTCAGACCTAAAT	0.557																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											127.0	109.0	115.0					19																	7832457		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.992C>G	19.37:g.7832457C>G	ENSP00000316228:p.Ser331*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Nonsense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.S331*	ENST00000327325.5	37	c.992	CCDS12187.1	19	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912404	0.52439	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000248228;ENST00000334806;ENST00000359059	.	.	.	2.42	-0.107	0.13592	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	7.8455	0.29422	0.0:0.4867:0.5133:0.0	.	.	.	.	X	331;319;309;280;264	.	ENSP00000248228:S309X	S	+	2	0	CLEC4M	7738457	0.000000	0.05858	0.005000	0.12908	0.040000	0.13550	-0.111000	0.10807	0.064000	0.16427	0.556000	0.70494	TCA	CLEC4M	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	ENSG00000104938		0.557	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4M	HGNC	protein_coding	OTTHUMT00000461161.1	285	0.00	0	C	NM_014257		7832457	7832457	+1	no_errors	ENST00000327325	ensembl	human	known	69_37n	nonsense	150	12.21	21	SNP	0.007	G
CLK4	57396	genome.wustl.edu	37	5	178050303	178050303	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:178050303C>G	ENST00000316308.4	-	2	283	c.115G>C	c.(115-117)Gag>Cag	p.E39Q	CLK4_ENST00000520957.1_Missense_Mutation_p.E39Q	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	39					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.E39Q(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TGCCTGTTCTCTTGTGTGCTA	0.388																																						dbGAP											2	Substitution - Missense(2)	breast(2)											276.0	249.0	258.0					5																	178050303		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.115G>C	5.37:g.178050303C>G	ENSP00000316948:p.Glu39Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E39Q	ENST00000316308.4	37	c.115	CCDS4437.1	5	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650527	0.87958	.	.	ENSG00000113240	ENST00000316308;ENST00000536763;ENST00000520957	T	0.08282	3.11	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.30823	0.0777	M	0.77616	2.38	0.41925	D	0.990539	D;D;D;D;P	0.89917	0.996;0.976;1.0;0.999;0.813	D;P;D;D;B	0.87578	0.986;0.703;0.998;0.994;0.202	T	0.00747	-1.1583	10	0.59425	D	0.04	.	15.6134	0.76744	0.0:1.0:0.0:0.0	.	39;39;39;39;39	B7Z990;B7ZL31;E7EWJ6;Q4G0Z5;Q9HAZ1	.;.;.;.;CLK4_HUMAN	Q	39	ENSP00000316948:E39Q	ENSP00000316948:E39Q	E	-	1	0	CLK4	177982909	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	4.569000	0.60865	2.766000	0.95052	0.491000	0.48974	GAG	CLK4	-	NULL	ENSG00000113240		0.388	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK4	HGNC	protein_coding	OTTHUMT00000253479.2	179	0.00	0	C			178050303	178050303	-1	no_errors	ENST00000316308	ensembl	human	known	69_37n	missense	174	11.22	22	SNP	1.000	G
CLN5	1203	genome.wustl.edu	37	13	77574712	77574712	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr13:77574712T>C	ENST00000377453.3	+	4	2124	c.832T>C	c.(832-834)Tac>Cac	p.Y278H	FBXL3_ENST00000477982.1_5'Flank	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	229					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)	p.Y278H(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		GTTTGATTCCTACGACTGTTC	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	81.0	81.0					13																	77574712		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.832T>C	13.37:g.77574712T>C	ENSP00000366673:p.Tyr278His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQK7	Missense_Mutation	SNP	NULL	p.Y278H	ENST00000377453.3	37	c.832	CCDS9456.1	13	.	.	.	.	.	.	.	.	.	.	T	22.6	4.307620	0.81247	.	.	ENSG00000102805	ENST00000377453;ENST00000541907;ENST00000535238	D	0.91180	-2.8	5.95	5.95	0.96441	.	0.052692	0.85682	D	0.000000	D	0.94594	0.8258	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.93590	0.6920	10	0.33141	T	0.24	-7.4953	16.4323	0.83853	0.0:0.0:0.0:1.0	.	229	O75503	CLN5_HUMAN	H	278;229;144	ENSP00000366673:Y278H	ENSP00000366673:Y278H	Y	+	1	0	CLN5	76472713	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	8.003000	0.88520	2.281000	0.76405	0.528000	0.53228	TAC	CLN5	-	NULL	ENSG00000102805		0.388	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN5	HGNC	protein_coding	OTTHUMT00000045318.1	111	0.00	0	T	NM_006493		77574712	77574712	+1	no_errors	ENST00000377453	ensembl	human	known	69_37n	missense	65	26.97	24	SNP	1.000	C
CNDP2	55748	genome.wustl.edu	37	18	72178246	72178246	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr18:72178246G>C	ENST00000324262.4	+	6	971	c.655G>C	c.(655-657)Gag>Cag	p.E219Q	CNDP2_ENST00000324301.8_Missense_Mutation_p.E135Q|CNDP2_ENST00000579847.1_Missense_Mutation_p.E219Q	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	219					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.E219Q(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		CTTTTTCATCGAGGTACAGTG	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	76.0	80.0					18																	72178246		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.655G>C	18.37:g.72178246G>C	ENSP00000325548:p.Glu219Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	p.E219Q	ENST00000324262.4	37	c.655	CCDS12006.1	18	.	.	.	.	.	.	.	.	.	.	G	16.49	3.136984	0.56936	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.59638	0.25;0.25	6.08	6.08	0.98989	Peptidase M20, dimerisation (1);	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	M	0.80847	2.515	0.80722	D	1	D;P;P	0.59357	0.985;0.934;0.86	P;P;P	0.62649	0.905;0.618;0.76	T	0.77186	-0.2680	10	0.54805	T	0.06	4.1158	20.6721	0.99693	0.0:0.0:1.0:0.0	.	124;135;219	B4DPF1;Q96KP4-2;Q96KP4	.;.;CNDP2_HUMAN	Q	219;135	ENSP00000325548:E219Q;ENSP00000325756:E135Q	ENSP00000325548:E219Q	E	+	1	0	CNDP2	70329226	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	7.922000	0.87538	2.894000	0.99253	0.591000	0.81541	GAG	CNDP2	-	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	ENSG00000133313		0.498	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNDP2	HGNC	protein_coding	OTTHUMT00000256327.1	120	0.00	0	G	NM_018235		72178246	72178246	+1	no_errors	ENST00000324262	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	1.000	C
COQ6	51004	genome.wustl.edu	37	14	74424951	74424951	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr14:74424951G>T	ENST00000334571.2	+	5	623	c.583G>T	c.(583-585)Gat>Tat	p.D195Y	COQ6_ENST00000238709.4_Missense_Mutation_p.D120Y|COQ6_ENST00000554920.1_Intron|ENTPD5_ENST00000557325.1_3'UTR|COQ6_ENST00000394026.4_Missense_Mutation_p.D170Y	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	195					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)	p.D195Y(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		TACCCTAGGTGATGGCAGCAC	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	93.0	97.0					14																	74424951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.583G>T	14.37:g.74424951G>T	ENSP00000333946:p.Asp195Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Missense_Mutation	SNP	pfam_mOase_FAD-bd,prints_Rng_hydrolase-like,tigrfam_UbQ_biosynth_mOase,tigrfam_Ubi_Hdrxlases	p.D195Y	ENST00000334571.2	37	c.583	CCDS9823.1	14	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412401	0.83340	.	.	ENSG00000119723	ENST00000394026;ENST00000555376;ENST00000238709;ENST00000553462;ENST00000334571;ENST00000556300;ENST00000557584;ENST00000557205;ENST00000554320	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.53	5.53	0.82687	Monooxygenase, FAD-binding (1);	0.143128	0.64402	D	0.000005	T	0.77765	0.4179	M	0.86502	2.82	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.996;1.0;1.0;0.996	D;D;D;D;D;D;D;D	0.81914	0.995;0.994;0.975;0.99;0.957;0.993;0.983;0.957	T	0.80641	-0.1292	10	0.87932	D	0	5.4254	19.6556	0.95837	0.0:0.0:1.0:0.0	.	140;195;140;170;195;120;120;120	B7Z8E9;B7Z357;B7Z262;B7Z3K8;Q9Y2Z9;G3V3A1;G3XA86;Q86U30	.;.;.;.;COQ6_HUMAN;.;.;.	Y	170;120;120;120;195;195;140;140;120	ENSP00000377594:D170Y;ENSP00000238709:D120Y;ENSP00000333946:D195Y;ENSP00000451123:D120Y	ENSP00000238709:D120Y	D	+	1	0	COQ6	73494704	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.315000	0.72853	2.882000	0.98803	0.655000	0.94253	GAT	COQ6	-	pfam_mOase_FAD-bd,tigrfam_UbQ_biosynth_mOase,tigrfam_Ubi_Hdrxlases	ENSG00000119723		0.473	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ6	HGNC	protein_coding	OTTHUMT00000412616.1	106	0.00	0	G			74424951	74424951	+1	no_errors	ENST00000334571	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	T
CORO1C	23603	genome.wustl.edu	37	12	109072151	109072151	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:109072151G>C	ENST00000261401.3	-	3	387	c.215C>G	c.(214-216)tCt>tGt	p.S72C	CORO1C_ENST00000420959.2_Missense_Mutation_p.S125C|CORO1C_ENST00000541050.1_Missense_Mutation_p.S72C|CORO1C_ENST00000549772.1_Missense_Mutation_p.S78C|CORO1C_ENST00000549384.1_Intron|CORO1C_ENST00000421578.2_De_novo_Start_OutOfFrame	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	72					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.S72C(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						TGTAGGGTAAGATTTGTCAAT	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											156.0	117.0	130.0					12																	109072151		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.215C>G	12.37:g.109072151G>C	ENSP00000261401:p.Ser72Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MAP0|A7MAP1|B3KU12|Q9NSK5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S125C	ENST00000261401.3	37	c.374	CCDS9120.1	12	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382950	0.61845	.	.	ENSG00000110880	ENST00000261401;ENST00000541050;ENST00000549772;ENST00000420959;ENST00000547294;ENST00000550032;ENST00000551550;ENST00000546571;ENST00000551044	T;T;T;T;T;T;T;T;T	0.78126	5.04;5.04;5.04;5.04;-0.46;-0.07;-0.66;-0.8;-1.15	5.47	5.47	0.80525	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.049248	0.85682	D	0.000000	T	0.62816	0.2459	N	0.02876	-0.465	0.58432	D	0.999996	B;B;B	0.24368	0.012;0.102;0.016	B;B;B	0.30316	0.078;0.049;0.114	T	0.64028	-0.6503	10	0.72032	D	0.01	-0.4035	19.3197	0.94233	0.0:0.0:1.0:0.0	.	72;125;72	B4DMH3;A7MAP1;Q9ULV4	.;.;COR1C_HUMAN	C	72;72;78;125;72;72;72;72;72	ENSP00000261401:S72C;ENSP00000438341:S72C;ENSP00000447534:S78C;ENSP00000394496:S125C;ENSP00000449330:S72C;ENSP00000447989:S72C;ENSP00000448527:S72C;ENSP00000448195:S72C;ENSP00000447049:S72C	ENSP00000261401:S72C	S	-	2	0	CORO1C	107596280	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.441000	0.97557	2.549000	0.85964	0.491000	0.48974	TCT	CORO1C	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000110880		0.453	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1C	HGNC	protein_coding	OTTHUMT00000403802.1	310	0.00	0	G	NM_014325		109072151	109072151	-1	no_errors	ENST00000420959	ensembl	human	known	69_37n	missense	414	22.92	124	SNP	1.000	C
CPSF4	10898	genome.wustl.edu	37	7	99049996	99049996	+	Missense_Mutation	SNP	G	G	A	rs200506342		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:99049996G>A	ENST00000292476.5	+	6	513	c.503G>A	c.(502-504)cGa>cAa	p.R168Q	ATP5J2-PTCD1_ENST00000413834.1_Intron|PTCD1_ENST00000555673.1_Intron|CPSF4_ENST00000451876.1_Missense_Mutation_p.R136Q|CPSF4_ENST00000436336.2_Missense_Mutation_p.R168Q|CPSF4_ENST00000471455.1_3'UTR|CPSF4_ENST00000441580.1_Missense_Mutation_p.R115Q|ATP5J2_ENST00000466753.1_Intron|ATP5J2-PTCD1_ENST00000437572.1_Intron			O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4, 30kDa	168					modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA processing (GO:0006397)|viral life cycle (GO:0019058)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R168Q(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(5)	14	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					ACCAGCCCTCGATTTGAACTG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											139.0	143.0	142.0					7																	99049996		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5664.1, CCDS47652.1	7q22	2007-10-18	2002-08-29		ENSG00000160917	ENSG00000160917			2327	protein-coding gene	gene with protein product		603052	"""cleavage and polyadenylation specific factor 4, 30kD subunit"""			9651582, 9224719	Standard	NM_006693		Approved	NAR, CPSF30	uc003uqj.3	O95639	OTTHUMG00000154599	ENST00000292476.5:c.503G>A	7.37:g.99049996G>A	ENSP00000292476:p.Arg168Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5S8|Q6FGE6|Q86TF8|Q9BTW6	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCCH,smart_Znf_CCHC,pfscan_Znf_CCHC	p.R168Q	ENST00000292476.5	37	c.503	CCDS5664.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.640169|5.640169	0.96693|0.96693	.|.	.|.	ENSG00000160917|ENSG00000160917	ENST00000452047|ENST00000436336;ENST00000451876;ENST00000292476;ENST00000441580	T|T;T;T;T	0.32515|0.40225	1.45|1.04;1.04;1.04;1.04	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Zinc finger, CCCH-type (3);	.|0.058993	.|0.64402	.|D	.|0.000002	T|T	0.60183|0.60183	0.2249|0.2249	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.69078	.|0.997;0.96;0.95;0.96	.|P;P;P;P	.|0.60415	.|0.874;0.674;0.541;0.578	T|T	0.57335|0.57335	-0.7829|-0.7829	6|9	.|.	.|.	.|.	-4.0296|-4.0296	19.4582|19.4582	0.94904|0.94904	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|115;168;168;168	.|B7Z7B0;O95639-3;O95639;O95639-2	.|.;.;CPSF4_HUMAN;.	N|Q	104|168;136;168;115	ENSP00000392584:D104N|ENSP00000395311:R168Q;ENSP00000396060:R136Q;ENSP00000292476:R168Q;ENSP00000402224:R115Q	.|.	D|R	+|+	1|2	0|0	CPSF4|CPSF4	98887932|98887932	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.930000|8.930000	0.92872|0.92872	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	GAT|CGA	CPSF4	-	pfam_Znf_CCCH,smart_Znf_CCCH	ENSG00000160917		0.592	CPSF4-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPSF4	HGNC	protein_coding	OTTHUMT00000336254.1	61	0.00	0	G			99049996	99049996	+1	no_errors	ENST00000292476	ensembl	human	known	69_37n	missense	27	51.79	29	SNP	1.000	A
CRIM1	51232	genome.wustl.edu	37	2	36668460	36668460	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:36668460G>A	ENST00000280527.2	+	3	932	c.565G>A	c.(565-567)Gaa>Aaa	p.E189K		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	189					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.E189K(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				ACGTTGTCCTGAAGATTCTGT	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	94.0	97.0					2																	36668460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.565G>A	2.37:g.36668460G>A	ENSP00000280527:p.Glu189Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	pfam_VWF_C,pfam_Prot_inh_I15_antistasin-like,superfamily_Prot_inh_I14/15_hirudin/antisn,smart_IGFBP-like,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	p.E189K	ENST00000280527.2	37	c.565	CCDS1783.1	2	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040271	0.93630	.	.	ENSG00000150938	ENST00000280527;ENST00000426856	T	0.04706	3.57	4.81	4.81	0.61882	.	0.201099	0.41605	D	0.000849	T	0.09202	0.0227	L	0.54323	1.7	0.54753	D	0.99998	P	0.43750	0.816	B	0.43809	0.432	T	0.10965	-1.0607	10	0.41790	T	0.15	-12.9293	17.0663	0.86559	0.0:0.0:1.0:0.0	.	189	Q9NZV1	CRIM1_HUMAN	K	189;81	ENSP00000280527:E189K	ENSP00000280527:E189K	E	+	1	0	CRIM1	36521964	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.869000	0.75521	2.480000	0.83734	0.650000	0.86243	GAA	CRIM1	-	NULL	ENSG00000150938		0.547	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIM1	HGNC	protein_coding	OTTHUMT00000216878.2	228	0.00	0	G	NM_016441		36668460	36668460	+1	no_errors	ENST00000280527	ensembl	human	known	69_37n	missense	151	22.84	45	SNP	1.000	A
CSNK1A1L	122011	genome.wustl.edu	37	13	37678900	37678900	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr13:37678900C>T	ENST00000379800.3	-	1	903	c.494G>A	c.(493-495)aGa>aAa	p.R165K		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R165K(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		CCTGTTGTCTCTGTACTTTTT	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											222.0	204.0	210.0					13																	37678900		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.494G>A	13.37:g.37678900C>T	ENSP00000369126:p.Arg165Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2N2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R165K	ENST00000379800.3	37	c.494	CCDS9363.1	13	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137213	0.56936	.	.	ENSG00000180138	ENST00000379800	T	0.05996	3.36	1.08	1.08	0.20341	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.08846	0.0219	M	0.73598	2.24	0.39362	D	0.965939	B	0.34290	0.447	B	0.34779	0.189	T	0.10965	-1.0607	10	0.56958	D	0.05	.	7.9927	0.30250	0.0:1.0:0.0:0.0	.	165	Q8N752	KC1AL_HUMAN	K	165	ENSP00000369126:R165K	ENSP00000369126:R165K	R	-	2	0	CSNK1A1L	36576900	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.366000	0.66122	0.871000	0.35750	0.561000	0.74099	AGA	CSNK1A1L	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000180138		0.433	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1A1L	HGNC	protein_coding	OTTHUMT00000044563.1	252	0.00	0	C	NM_145203		37678900	37678900	-1	no_errors	ENST00000379800	ensembl	human	known	69_37n	missense	139	18.97	33	SNP	1.000	T
CYFIP2	26999	genome.wustl.edu	37	5	156746888	156746888	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:156746888G>A	ENST00000521420.1	+	13	1488	c.1397G>A	c.(1396-1398)cGt>cAt	p.R466H	CYFIP2_ENST00000541131.1_Missense_Mutation_p.R417H|CYFIP2_ENST00000377576.3_Missense_Mutation_p.R492H|CYFIP2_ENST00000318218.6_Missense_Mutation_p.R492H|CYFIP2_ENST00000522463.1_Missense_Mutation_p.R296H|CYFIP2_ENST00000435847.2_Missense_Mutation_p.R166H|CYFIP2_ENST00000347377.6_Missense_Mutation_p.R492H|CYFIP2_ENST00000442283.2_5'UTR					cytoplasmic FMR1 interacting protein 2									p.R492H(3)		breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTGACGCTGCGTGAGCCCCTG	0.577																																						dbGAP											3	Substitution - Missense(3)	breast(3)											150.0	155.0	153.0					5																	156746888		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.1397G>A	5.37:g.156746888G>A	ENSP00000430904:p.Arg466His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.R492H	ENST00000521420.1	37	c.1475		5	.	.	.	.	.	.	.	.	.	.	G	36	5.740373	0.96873	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87;1.87	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.59088	0.2168	M	0.84433	2.695	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.996	D;D;D;D;D;D	0.78314	0.953;0.982;0.991;0.984;0.919;0.957	T	0.61637	-0.7022	10	0.66056	D	0.02	-15.4723	20.428	0.99075	0.0:0.0:1.0:0.0	.	356;296;466;492;492;492	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	H	492;296;466;492;492;417;166	ENSP00000325817:R492H;ENSP00000428009:R296H;ENSP00000430904:R466H;ENSP00000313567:R492H;ENSP00000366799:R492H;ENSP00000444645:R417H;ENSP00000403793:R166H	ENSP00000325817:R492H	R	+	2	0	CYFIP2	156679466	1.000000	0.71417	0.969000	0.41365	0.914000	0.54420	9.814000	0.99346	2.837000	0.97791	0.655000	0.94253	CGT	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.577	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	196	0.00	0	G	NM_001037332		156746888	156746888	+1	no_errors	ENST00000318218	ensembl	human	known	69_37n	missense	93	18.97	22	SNP	1.000	A
CYP26B1	56603	genome.wustl.edu	37	2	72371232	72371233	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:72371232_72371233insC	ENST00000001146.2	-	2	517_518	c.314_315insG	c.(313-315)atcfs	p.I105fs	CYP26B1_ENST00000412253.1_5'Flank|CYP26B1_ENST00000546307.1_Intron	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	105					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						CGCCCATGAGGATCTTGCGCAC	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.314_315insG	2.37:g.72371232_72371233insC	ENSP00000001146:p.Ile105fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Frame_Shift_Ins	INS	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B,prints_Cyt_P450	p.I105fs	ENST00000001146.2	37	c.315_314	CCDS1919.1	2																																																																																			CYP26B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000003137		0.624	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP26B1	HGNC	protein_coding	OTTHUMT00000251969.1	57	0.00	0	-	NM_019885		72371232	72371233	-1	no_errors	ENST00000001146	ensembl	human	known	69_37n	frame_shift_ins	34	32.00	16	INS	1.000:1.000	C
DAK	26007	genome.wustl.edu	37	11	61111640	61111640	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:61111640G>C	ENST00000394900.3	+	13	1364	c.1135G>C	c.(1135-1137)Gaa>Caa	p.E379Q		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	379	DhaL. {ECO:0000255|PROSITE- ProRule:PRU00813}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)	p.E379Q(1)		NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						GCTGGTGCTGGAACGGGTGTG	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											62.0	57.0	59.0					11																	61111640		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.1135G>C	11.37:g.61111640G>C	ENSP00000378360:p.Glu379Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	pfam_Dak1,pfam_Dak2,superfamily_Dak2,tigrfam_DhaK_ATP	p.E379Q	ENST00000394900.3	37	c.1135	CCDS8003.1	11	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665277	0.29604	.	.	ENSG00000149476	ENST00000394900;ENST00000529479	T;T	0.31769	1.49;1.48	6.08	5.12	0.69794	Dak phosphatase (2);	0.380283	0.30742	N	0.008966	T	0.21387	0.0515	N	0.14661	0.345	0.26620	N	0.972661	B;B	0.10296	0.002;0.003	B;B	0.11329	0.003;0.006	T	0.07712	-1.0758	10	0.29301	T	0.29	-19.9719	17.9948	0.89179	0.0:0.1889:0.8111:0.0	.	379;379	Q2L9C1;Q3LXA3	.;DHAK_HUMAN	Q	379;378	ENSP00000378360:E379Q;ENSP00000432539:E378Q	ENSP00000378360:E379Q	E	+	1	0	DAK	60868216	1.000000	0.71417	0.992000	0.48379	0.149000	0.21700	3.737000	0.55060	2.894000	0.99253	0.655000	0.94253	GAA	DAK	-	superfamily_Dak2,tigrfam_DhaK_ATP	ENSG00000149476		0.637	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAK	HGNC	protein_coding	OTTHUMT00000394425.4	50	0.00	0	G	NM_015533		61111640	61111640	+1	no_errors	ENST00000394900	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.963	C
DHX57	90957	genome.wustl.edu	37	2	39053665	39053665	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:39053665C>G	ENST00000295373.6	-	15	2932	c.2806G>C	c.(2806-2808)Gaa>Caa	p.E936Q		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	936	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E936Q(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TACCTCTTTTCTTTCATTTTC	0.403																																					Melanoma(191;1090 2095 4375 23729 47341)	dbGAP											1	Substitution - Missense(1)	breast(1)											159.0	144.0	149.0					2																	39053665		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.2806G>C	2.37:g.39053665C>G	ENSP00000295373:p.Glu936Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	pfam_RWD-domain,pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Znf_CCCH,superfamily_UBA-like,superfamily_UBQ-conjugating_enzyme/RWD,smart_Znf_CCCH,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E936Q	ENST00000295373.6	37	c.2806	CCDS1800.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.1|27.1	4.799805|4.799805	0.90538|0.90538	.|.	.|.	ENSG00000163214|ENSG00000163214	ENST00000295373|ENST00000452978	T|.	0.02552|.	4.25|.	5.23|5.23	5.23|5.23	0.72850|0.72850	Helicase, C-terminal (3);|.	0.000000|.	0.56097|.	D|.	0.000039|.	T|T	0.68274|0.68274	0.2983|0.2983	L|L	0.48174|0.48174	1.505|1.505	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.988|.	D;D|.	0.87578|.	0.998;0.951|.	T|T	0.65257|0.65257	-0.6212|-0.6212	10|5	0.62326|.	D|.	0.03|.	.|.	17.7875|17.7875	0.88542|0.88542	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	936;328|.	Q6P158;Q59G60|.	DHX57_HUMAN;.|.	Q|T	936|259	ENSP00000295373:E936Q|.	ENSP00000295373:E936Q|.	E|R	-|-	1|2	0|0	DHX57|DHX57	38907169|38907169	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.711000|7.711000	0.84669|0.84669	2.432000|2.432000	0.82394|0.82394	0.563000|0.563000	0.77884|0.77884	GAA|AGA	DHX57	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000163214		0.403	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX57	HGNC	protein_coding	OTTHUMT00000219940.2	100	0.00	0	C	NM_145646		39053665	39053665	-1	no_errors	ENST00000295373	ensembl	human	known	69_37n	missense	125	16.00	24	SNP	1.000	G
DIAPH2	1730	genome.wustl.edu	37	X	96369847	96369847	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:96369847G>A	ENST00000324765.8	+	21	2819	c.2472G>A	c.(2470-2472)ctG>ctA	p.L824L	DIAPH2_ENST00000373049.4_Silent_p.L824L|DIAPH2_ENST00000373061.3_Silent_p.L824L|DIAPH2_ENST00000355827.4_Silent_p.L824L|DIAPH2_ENST00000373054.4_Silent_p.L820L			O60879	DIAP2_HUMAN	diaphanous-related formin 2	824	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.L824L(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						GTGAAGAACTGAAGAAAAGTG	0.388																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											106.0	91.0	96.0					X																	96369847		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2472G>A	X.37:g.96369847G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Silent	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.L824	ENST00000324765.8	37	c.2472	CCDS14467.1	X																																																																																			DIAPH2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000147202		0.388	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	98	0.00	0	G	NM_006729, NM_007309		96369847	96369847	+1	no_errors	ENST00000324765	ensembl	human	known	69_37n	silent	88	16.67	18	SNP	0.996	A
DLGAP4	22839	genome.wustl.edu	37	20	35128690	35128690	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr20:35128690G>A	ENST00000373907.2	+	9	2387	c.2188G>A	c.(2188-2190)Gag>Aag	p.E730K	DLGAP4_ENST00000373913.3_Missense_Mutation_p.E727K|DLGAP4_ENST00000401952.2_Missense_Mutation_p.E727K|DLGAP4_ENST00000339266.5_Missense_Mutation_p.E730K|DLGAP4_ENST00000340491.4_Missense_Mutation_p.E191K|DLGAP4_ENST00000475894.1_3'UTR			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	730					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)		p.E727K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				TAAGTCATCTGAGAGGAGCCT	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	85.0	88.0					20																	35128690		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.2188G>A	20.37:g.35128690G>A	ENSP00000363014:p.Glu730Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	pfam_GKAP	p.E730K	ENST00000373907.2	37	c.2188		20	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561284	0.65538	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266;ENST00000340491	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.24	5.24	0.73138	.	0.310960	0.35585	N	0.003119	T	0.39332	0.1074	L	0.36672	1.1	0.54753	D	0.999989	B;B;P;B	0.44659	0.4;0.008;0.84;0.035	B;B;P;B	0.46339	0.233;0.006;0.513;0.028	T	0.30995	-0.9959	10	0.72032	D	0.01	.	17.8286	0.88673	0.0:0.0:1.0:0.0	.	36;191;730;727	F8WF49;Q9Y2H0-3;Q9Y2H0;Q9Y2H0-1	.;.;DLGP4_HUMAN;.	K	727;727;730;730;191	ENSP00000363023:E727K;ENSP00000384954:E727K;ENSP00000363014:E730K;ENSP00000341633:E730K;ENSP00000345700:E191K	ENSP00000341633:E730K	E	+	1	0	DLGAP4	34562104	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.908000	0.92640	2.448000	0.82819	0.650000	0.86243	GAG	DLGAP4	-	pfam_GKAP	ENSG00000080845		0.602	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	98	0.00	0	G	NM_014902		35128690	35128690	+1	no_errors	ENST00000339266	ensembl	human	known	69_37n	missense	44	50.00	44	SNP	1.000	A
DNAH2	146754	genome.wustl.edu	37	17	7734627	7734627	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:7734627G>C	ENST00000572933.1	+	80	13914	c.12454G>C	c.(12454-12456)Gag>Cag	p.E4152Q	DNAH2_ENST00000389173.2_Missense_Mutation_p.E4152Q			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	4152					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E4152Q(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GACCCGGGAAGAGAAGGTAAA	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	79.0	76.0					17																	7734627		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.12454G>C	17.37:g.7734627G>C	ENSP00000458355:p.Glu4152Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.E4152Q	ENST00000572933.1	37	c.12454	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	18.76	3.691887	0.68271	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.10477	2.87	5.83	5.83	0.93111	Dynein heavy chain (1);	0.315682	0.32836	N	0.005597	T	0.16342	0.0393	L	0.45581	1.43	0.80722	D	1	B;B	0.22211	0.053;0.066	B;B	0.32211	0.087;0.142	T	0.02391	-1.1166	10	0.51188	T	0.08	.	18.8761	0.92337	0.0:0.0:1.0:0.0	.	4113;4152	Q9P225-2;Q9P225	.;DYH2_HUMAN	Q	4113;4152	ENSP00000373825:E4152Q	ENSP00000353818:E4113Q	E	+	1	0	DNAH2	7675352	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.835000	0.92100	2.762000	0.94881	0.655000	0.94253	GAG	DNAH2	-	pfam_Dynein_heavy	ENSG00000183914		0.562	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	74	0.00	0	G	NM_020877		7734627	7734627	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	C
DNHD1	144132	genome.wustl.edu	37	11	6585612	6585612	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:6585612C>T	ENST00000527990.2	+	30	10334	c.10334C>T	c.(10333-10335)tCa>tTa	p.S3445L	DNHD1_ENST00000254579.6_Missense_Mutation_p.S3445L			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3445					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.S3445L(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTCCTATGTTCAGCTGCCATC	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	117.0	120.0					11																	6585612		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.10334C>T	11.37:g.6585612C>T	ENSP00000436180:p.Ser3445Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.S3445L	ENST00000527990.2	37	c.10334	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297134	0.60086	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000529821	T;T	0.76060	-0.99;-0.99	4.23	4.23	0.50019	Dynein heavy chain, coiled coil stalk (1);	.	.	.	.	T	0.69726	0.3143	N	0.08118	0	0.33858	D	0.633483	P	0.52170	0.951	P	0.56648	0.803	T	0.80395	-0.1400	9	0.72032	D	0.01	.	15.5353	0.75998	0.0:1.0:0.0:0.0	.	3445	Q96M86	DNHD1_HUMAN	L	3445;3445;26	ENSP00000254579:S3445L;ENSP00000436180:S3445L	ENSP00000254579:S3445L	S	+	2	0	DNHD1	6542188	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	4.152000	0.58111	2.192000	0.70111	0.313000	0.20887	TCA	DNHD1	-	NULL	ENSG00000179532		0.577	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	195	0.00	0	C	NM_144666		6585612	6585612	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	missense	53	39.77	35	SNP	1.000	T
DNM1P46	196968	genome.wustl.edu	37	15	100340179	100340179	+	RNA	DEL	G	G	-	rs200037202	byFrequency	TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr15:100340179delG	ENST00000341853.1	-	0	747					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										GTGTCTTCTCGTTCCCACGCG	0.617																																						dbGAP											0													16.0	17.0	17.0					15																	100340179		1390	3429	4819	-	-	-			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340179delG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCN3	RNA	DEL	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.617	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	12	0.00	0	G	NR_003260		100340179	100340179	-1	no_errors	ENST00000341853	ensembl	human	known	69_37n	rna	9	30.77	4	DEL	0.957	-
DOCK11	139818	genome.wustl.edu	37	X	117752671	117752671	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:117752671G>A	ENST00000276202.7	+	31	3514	c.3451G>A	c.(3451-3453)Gac>Aac	p.D1151N	DOCK11_ENST00000276204.6_Missense_Mutation_p.D1151N	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1151					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D1151N(1)		breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						ACATGCATTTGACACAAGATA	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	57.0	60.0					X																	117752671		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3451G>A	X.37:g.117752671G>A	ENSP00000276202:p.Asp1151Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D1151N	ENST00000276202.7	37	c.3451	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	32	5.132987	0.94517	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	D;D	0.97041	-4.22;-4.22	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.98957	0.9645	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.985;0.989	D	0.99525	1.0959	10	0.87932	D	0	-36.8809	18.9958	0.92812	0.0:0.0:1.0:0.0	.	1151;1151	A6NIW2;Q5JSL3	.;DOC11_HUMAN	N	1151	ENSP00000276204:D1151N;ENSP00000276202:D1151N	ENSP00000276202:D1151N	D	+	1	0	DOCK11	117636699	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.087000	0.94110	2.521000	0.84997	0.544000	0.68410	GAC	DOCK11	-	NULL	ENSG00000147251		0.348	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	51	0.00	0	G	NM_144658		117752671	117752671	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	44	33.82	23	SNP	1.000	A
DPP3	10072	genome.wustl.edu	37	11	66264824	66264824	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:66264824G>A	ENST00000360510.2	+	16	1819	c.1754G>A	c.(1753-1755)gGa>gAa	p.G585E	DPP3_ENST00000453114.1_Missense_Mutation_p.G585E|DPP3_ENST00000531863.1_Missense_Mutation_p.G605E|DPP3_ENST00000541961.1_Missense_Mutation_p.G585E|DPP3_ENST00000530165.1_Missense_Mutation_p.G555E|DPP3_ENST00000532677.1_Missense_Mutation_p.G604E			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	585					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G585E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						GCTGGCGAGGGACTCGTTACC	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	56.0	56.0					11																	66264824		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1754G>A	11.37:g.66264824G>A	ENSP00000353701:p.Gly585Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	pirsf_Pept_49_dipeptidyl-pept-3_euk	p.G585E	ENST00000360510.2	37	c.1754	CCDS8141.1	11	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681418	0.68042	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807	T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97	5.85	5.85	0.93711	.	0.148161	0.64402	D	0.000010	T	0.25494	0.0620	L	0.52759	1.655	0.53688	D	0.999975	P;B	0.38504	0.634;0.312	B;B	0.43018	0.391;0.405	T	0.01169	-1.1430	10	0.54805	T	0.06	.	10.9891	0.47539	0.084:0.0:0.916:0.0	.	604;585	G3V1D3;Q9NY33	.;DPP3_HUMAN	E	605;604;585;585;585;555;483	ENSP00000432782:G605E;ENSP00000435284:G604E;ENSP00000353701:G585E;ENSP00000389943:G585E;ENSP00000440502:G585E;ENSP00000436941:G555E	ENSP00000353701:G585E	G	+	2	0	DPP3	66021400	1.000000	0.71417	0.998000	0.56505	0.465000	0.32709	5.666000	0.68059	2.767000	0.95098	0.655000	0.94253	GGA	DPP3	-	pirsf_Pept_49_dipeptidyl-pept-3_euk	ENSG00000254986		0.622	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP3	HGNC	protein_coding	OTTHUMT00000393424.2	51	0.00	0	G			66264824	66264824	+1	no_errors	ENST00000360510	ensembl	human	known	69_37n	missense	12	71.43	30	SNP	1.000	A
DTHD1	401124	genome.wustl.edu	37	4	36310067	36310067	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:36310067G>A	ENST00000456874.2	+	6	1730	c.1672G>A	c.(1672-1674)Gaa>Aaa	p.E558K	DTHD1_ENST00000507598.1_Missense_Mutation_p.E598K|DTHD1_ENST00000357504.3_Missense_Mutation_p.E393K|RP11-431M7.2_ENST00000504344.1_RNA	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	558					signal transduction (GO:0007165)			p.E558K(1)|p.E393K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						CCAAGTTCGAGAAGGAGAACA	0.383																																						dbGAP											2	Substitution - Missense(2)	breast(2)											67.0	58.0	61.0					4																	36310067		692	1591	2283	-	-	-	SO:0001583	missense	0			AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.1672G>A	4.37:g.36310067G>A	ENSP00000401597:p.Glu558Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK4|B4E2N7	Missense_Mutation	SNP	pfam_Death,superfamily_DEATH-like,pfscan_Death	p.E558K	ENST00000456874.2	37	c.1672	CCDS54754.1	4	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385120	0.82792	.	.	ENSG00000197057	ENST00000357504;ENST00000507598;ENST00000456874	T;T;T	0.78003	-1.14;-1.14;-1.14	4.8	4.8	0.61643	.	0.186184	0.49305	D	0.000142	D	0.86414	0.5927	M	0.71581	2.175	0.41829	D	0.990069	D	0.76494	0.999	D	0.68621	0.959	D	0.87823	0.2639	10	0.72032	D	0.01	-20.7426	15.545	0.76090	0.0:0.1379:0.8621:0.0	.	393	Q6ZMT9-2	.	K	393;598;558	ENSP00000350103:E393K;ENSP00000424426:E598K;ENSP00000401597:E558K	ENSP00000350103:E393K	E	+	1	0	DTHD1	35986462	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.157000	0.64911	2.670000	0.90874	0.655000	0.94253	GAA	DTHD1	-	NULL	ENSG00000197057		0.383	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DTHD1	HGNC	protein_coding		122	0.00	0	G	NM_001136536		36310067	36310067	+1	no_errors	ENST00000456874	ensembl	human	known	69_37n	missense	94	10.48	11	SNP	1.000	A
DUSP26	78986	genome.wustl.edu	37	8	33449726	33449726	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr8:33449726C>G	ENST00000256261.4	-	4	958	c.441G>C	c.(439-441)aaG>aaC	p.K147N	DUSP26_ENST00000523956.1_Missense_Mutation_p.K147N	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	147	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)	p.K147N(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		GCACCAGGATCTTCCCTGAGA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	55.0	62.0					8																	33449726		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.441G>C	8.37:g.33449726C>G	ENSP00000256261:p.Lys147Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSV8|Q9BTW0	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP_famA,prints_Atypical_DUSP	p.K147N	ENST00000256261.4	37	c.441	CCDS6092.1	8	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895061	0.72639	.	.	ENSG00000133878	ENST00000256261;ENST00000523956	T;T	0.61392	0.11;0.11	4.54	4.54	0.55810	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.308380	0.38548	N	0.001655	T	0.59998	0.2235	L	0.55213	1.73	0.39645	D	0.970387	P	0.37500	0.597	B	0.42343	0.384	T	0.67193	-0.5732	10	0.59425	D	0.04	-26.0918	17.2453	0.87026	0.0:1.0:0.0:0.0	.	147	Q9BV47	DUS26_HUMAN	N	147	ENSP00000256261:K147N;ENSP00000429176:K147N	ENSP00000256261:K147N	K	-	3	2	DUSP26	33569268	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.500000	0.45381	2.234000	0.73211	0.549000	0.68633	AAG	DUSP26	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000133878		0.602	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP26	HGNC	protein_coding	OTTHUMT00000376564.1	88	0.00	0	C	NM_024025		33449726	33449726	-1	no_errors	ENST00000256261	ensembl	human	known	69_37n	missense	28	50.00	28	SNP	1.000	G
EBF1	1879	genome.wustl.edu	37	5	158135082	158135082	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:158135082G>C	ENST00000313708.6	-	15	1931	c.1649C>G	c.(1648-1650)tCa>tGa	p.S550*	EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Nonsense_Mutation_p.S519*|EBF1_ENST00000517373.1_Nonsense_Mutation_p.S482*	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	550	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S550*(1)	HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTTCACGGCTGAGACCATGTT	0.607			T	HMGA2	lipoma																																	dbGAP		Dom	yes		5	5q34	1879	early B-cell factor 1		M	1	Substitution - Nonsense(1)	breast(1)											83.0	76.0	78.0					5																	158135082		2198	4297	6495	-	-	-	SO:0001587	stop_gained	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1649C>G	5.37:g.158135082G>C	ENSP00000322898:p.Ser550*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW11	Nonsense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,superfamily_HLH_DNA-bd,smart_IPT_TIG_rcpt	p.S550*	ENST00000313708.6	37	c.1649	CCDS4343.1	5	.	.	.	.	.	.	.	.	.	.	G	42	9.459226	0.99177	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	.	.	.	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-3.5047	18.5127	0.90923	0.0:0.0:1.0:0.0	.	.	.	.	X	550;550;519;482	.	ENSP00000322898:S550X	S	-	2	0	EBF1	158067660	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.476000	0.97823	2.368000	0.80403	0.561000	0.74099	TCA	EBF1	-	NULL	ENSG00000164330		0.607	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	300	0.00	0	G	NM_024007		158135082	158135082	-1	no_errors	ENST00000313708	ensembl	human	known	69_37n	nonsense	165	41.34	117	SNP	1.000	C
EIF4B	1975	genome.wustl.edu	37	12	53413733	53413733	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:53413733G>C	ENST00000262056.9	+	4	726	c.400G>C	c.(400-402)Gag>Cag	p.E134Q	EIF4B_ENST00000420463.3_Missense_Mutation_p.E134Q|EIF4B_ENST00000416762.3_Intron|RP11-983P16.4_ENST00000552905.1_RNA|RP11-983P16.4_ENST00000549388.1_RNA|EIF4B_ENST00000551527.1_3'UTR	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	134	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)	p.E134Q(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						CAGCAATCCAGAGAGGTTGAA	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	93.0	95.0					12																	53413733		1851	4087	5938	-	-	-	SO:0001583	missense	0			X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.400G>C	12.37:g.53413733G>C	ENSP00000262056:p.Glu134Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E134Q	ENST00000262056.9	37	c.400	CCDS41788.1	12	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958846	0.53400	.	.	ENSG00000063046	ENST00000262056;ENST00000551002;ENST00000420463;ENST00000430205;ENST00000549481;ENST00000552490	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	4.61	4.61	0.57282	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.166576	0.50627	D	0.000101	T	0.22820	0.0551	N	0.03903	-0.33	0.80722	D	1	B;B	0.19706	0.004;0.038	B;B	0.18561	0.007;0.022	T	0.06427	-1.0827	10	0.26408	T	0.33	.	16.8783	0.86058	0.0:0.0:1.0:0.0	.	134;134	E7EX17;P23588	.;IF4B_HUMAN	Q	134;88;134;134;134;134	ENSP00000262056:E134Q;ENSP00000447192:E88Q;ENSP00000388806:E134Q;ENSP00000449746:E134Q;ENSP00000450324:E134Q	ENSP00000262056:E134Q	E	+	1	0	EIF4B	51700000	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.493000	0.81493	2.484000	0.83849	0.460000	0.39030	GAG	EIF4B	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000063046		0.423	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4B	HGNC	protein_coding	OTTHUMT00000404852.2	185	0.00	0	G	NM_001417		53413733	53413733	+1	no_errors	ENST00000262056	ensembl	human	known	69_37n	missense	118	11.28	15	SNP	1.000	C
ELANE	1991	genome.wustl.edu	37	19	853386	853386	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:853386G>A	ENST00000590230.1	+	4	490	c.349G>A	c.(349-351)Gac>Aac	p.D117N	ELANE_ENST00000263621.1_Missense_Mutation_p.D117N			P08246	ELNE_HUMAN	elastase, neutrophil expressed	117	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute inflammatory response to antigenic stimulus (GO:0002438)|cellular calcium ion homeostasis (GO:0006874)|collagen catabolic process (GO:0030574)|defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of chemotaxis (GO:0050922)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil mediated killing of fungus (GO:0070947)|phagocytosis (GO:0006909)|positive regulation of immune response (GO:0050778)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)|response to UV (GO:0009411)|response to yeast (GO:0001878)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|transcriptional repressor complex (GO:0017053)	cytokine binding (GO:0019955)|endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|RNA polymerase II transcription corepressor activity (GO:0001106)|serine-type endopeptidase activity (GO:0004252)	p.D117N(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(1)|lung(4)|pancreas(1)	13					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CTTGCTCAACGACATCGTGAT	0.711																																						dbGAP											1	Substitution - Missense(1)	breast(1)											21.0	20.0	20.0					19																	853386		2169	4243	6412	-	-	-	SO:0001583	missense	0				CCDS12045.1	19p13.3	2014-09-17	2009-05-05	2009-05-05	ENSG00000197561	ENSG00000197561	3.4.21.37		3309	protein-coding gene	gene with protein product	"""neutrophil elastase"", ""leukocyte elastase"", ""medullasin"""	130130	"""elastase 2, neutrophil"""	ELA2		2902087	Standard	XM_005259517		Approved	NE, HNE, HLE	uc002lqb.3	P08246		ENST00000590230.1:c.349G>A	19.37:g.853386G>A	ENSP00000466090:p.Asp117Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	P09649|Q6B0D9|Q6LDP5	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.D117N	ENST00000590230.1	37	c.349	CCDS12045.1	19	.	.	.	.	.	.	.	.	.	.	g	15.96	2.987286	0.53934	.	.	ENSG00000197561	ENST00000263621	D	0.98747	-5.11	4.02	4.02	0.46733	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.39985	U	0.001218	D	0.99171	0.9713	M	0.92784	3.345	0.49130	D	0.999757	D	0.76494	0.999	D	0.68765	0.96	D	0.98900	1.0776	10	0.87932	D	0	.	12.3684	0.55242	0.0:0.0:1.0:0.0	.	117	P08246	ELNE_HUMAN	N	117	ENSP00000263621:D117N	ENSP00000263621:D117N	D	+	1	0	ELANE	804386	0.999000	0.42202	0.939000	0.37840	0.128000	0.20619	3.421000	0.52742	2.191000	0.70037	0.550000	0.68814	GAC	ELANE	-	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000197561		0.711	ELANE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELANE	HGNC	protein_coding	OTTHUMT00000457890.2	15	0.00	0	G	NM_001972		853386	853386	+1	no_errors	ENST00000263621	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.978	A
ELL	8178	genome.wustl.edu	37	19	18576723	18576723	+	Missense_Mutation	SNP	G	G	C	rs571175168		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:18576723G>C	ENST00000262809.4	-	3	260	c.189C>G	c.(187-189)atC>atG	p.I63M	ELL_ENST00000596124.3_De_novo_Start_InFrame	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	63					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)	p.I63M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		GGGGGATGGAGATGTGCTGCG	0.657			T	MLL	AL																																	dbGAP		Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	1	Substitution - Missense(1)	breast(1)											24.0	26.0	26.0					19																	18576723		2200	4296	6496	-	-	-	SO:0001583	missense	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.189C>G	19.37:g.18576723G>C	ENSP00000262809:p.Ile63Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.I63M	ENST00000262809.4	37	c.189	CCDS12380.1	19	.	.	.	.	.	.	.	.	.	.	g	15.38	2.815037	0.50527	.	.	ENSG00000105656	ENST00000262809	T	0.41758	0.99	3.82	3.82	0.43975	.	0.049681	0.85682	D	0.000000	T	0.60830	0.2299	M	0.78916	2.43	0.46749	D	0.999183	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.62609	-0.6818	10	0.51188	T	0.08	7.8164	8.8444	0.35162	0.1041:0.0:0.8959:0.0	.	7;63	Q59HG4;P55199	.;ELL_HUMAN	M	63	ENSP00000262809:I63M	ENSP00000262809:I63M	I	-	3	3	ELL	18437723	1.000000	0.71417	0.989000	0.46669	0.896000	0.52359	4.713000	0.61895	1.974000	0.57490	0.479000	0.44913	ATC	ELL	-	pfam_RNA_pol_II_elong_fac_ELL	ENSG00000105656		0.657	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	HGNC	protein_coding	OTTHUMT00000466362.1	57	0.00	0	G	NM_006532		18576723	18576723	-1	no_errors	ENST00000262809	ensembl	human	known	69_37n	missense	9	41.18	7	SNP	0.965	C
ERGIC3	51614	genome.wustl.edu	37	20	34136356	34136357	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr20:34136356_34136357insA	ENST00000348547.2	+	6	633_634	c.556_557insA	c.(556-558)ggcfs	p.G186fs	ERGIC3_ENST00000279052.6_Frame_Shift_Ins_p.G186fs|ERGIC3_ENST00000482338.1_3'UTR|ERGIC3_ENST00000447986.1_Frame_Shift_Ins_p.G186fs|ERGIC3_ENST00000357394.4_Frame_Shift_Ins_p.G186fs	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	186					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.G186S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			CCGGCGAGAGGGCTTCAGCCAG	0.53																																						dbGAP											1	Substitution - Missense(1)	prostate(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	Exception_encountered	20.37:g.34136356_34136357insA	ENSP00000341358:p.Gly186fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Frame_Shift_Ins	INS	pfam_DUF1692	p.G186fs	ENST00000348547.2	37	c.556_557	CCDS13257.1	20																																																																																			ERGIC3	-	pfam_DUF1692	ENSG00000125991		0.530	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC3	HGNC	protein_coding	OTTHUMT00000078880.2	104	0.00	0	-	NM_015966		34136356	34136357	+1	no_errors	ENST00000447986	ensembl	human	known	69_37n	frame_shift_ins	90	35.25	49	INS	1.000:1.000	A
EPB41L1	2036	genome.wustl.edu	37	20	34807721	34807721	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr20:34807721C>T	ENST00000338074.2	+	19	2555	c.2394C>T	c.(2392-2394)gcC>gcT	p.A798A	EPB41L1_ENST00000373946.3_Silent_p.A618A|EPB41L1_ENST00000202028.5_Silent_p.A696A|EPB41L1_ENST00000373941.1_Silent_p.A797A|EPB41L1_ENST00000441639.1_Silent_p.A696A|EPB41L1_ENST00000373950.2_Silent_p.A689A	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	798	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.A798A(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CCTACGGCGCCACTGCGGAAA	0.612																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											113.0	97.0	103.0					20																	34807721		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.2394C>T	20.37:g.34807721C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	pfam_Band_4.1_C,pfam_SAB	p.P226L	ENST00000338074.2	37	c.677	CCDS13271.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.69|10.69	1.421058|1.421058	0.25639|0.25639	.|.	.|.	ENSG00000088367|ENSG00000088367	ENST00000397315|ENST00000451082;ENST00000432603	.|.	.|.	.|.	4.46|4.46	4.46|4.46	0.54185|0.54185	.|.	.|.	.|.	.|.	.|.	T|T	0.71542|0.71542	0.3352|0.3352	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.71361|0.71361	-0.4616|-0.4616	5|4	0.87932|.	D|.	0|.	.|.	16.2789|16.2789	0.82658|0.82658	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	Y|L	773|226;36	.|.	ENSP00000380482:H773Y|.	H|P	+|+	1|2	0|0	EPB41L1|EPB41L1	34271135|34271135	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.579000|4.579000	0.60936|0.60936	2.324000|2.324000	0.78689|0.78689	0.462000|0.462000	0.41574|0.41574	CAC|CCA	EPB41L1	-	pfam_Band_4.1_C	ENSG00000088367		0.612	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	302	0.00	0	C	NM_012156		34807721	34807721	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451082	ensembl	human	novel	69_37n	missense	133	42.17	97	SNP	1.000	T
FAM161B	145483	genome.wustl.edu	37	14	74412991	74412991	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr14:74412991C>T	ENST00000534936.1	-	2	477	c.372G>A	c.(370-372)ctG>ctA	p.L124L	FAM161B_ENST00000286544.3_Silent_p.L187L			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	124								p.L124L(1)|p.L187L(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						TGCCTTACCTCAGAGCCTGCG	0.552																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											64.0	69.0	67.0					14																	74412991		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.372G>A	14.37:g.74412991C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z882|J3KNA2	Silent	SNP	pfam_UPF0564	p.L187	ENST00000534936.1	37	c.561		14																																																																																			FAM161B	-	NULL	ENSG00000156050		0.552	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	FAM161B	HGNC	protein_coding		112	0.00	0	C	NM_152445		74412991	74412991	-1	no_errors	ENST00000286544	ensembl	human	known	69_37n	silent	33	35.29	18	SNP	0.006	T
FAM171A1	221061	genome.wustl.edu	37	10	15255199	15255199	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr10:15255199C>G	ENST00000378116.4	-	8	2394	c.2388G>C	c.(2386-2388)caG>caC	p.Q796H	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	796						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.Q796H(2)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CGCTACCACTCTGTTCCACGT	0.622																																						dbGAP											2	Substitution - Missense(2)	breast(2)											70.0	55.0	60.0					10																	15255199		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2388G>C	10.37:g.15255199C>G	ENSP00000367356:p.Gln796His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.Q796H	ENST00000378116.4	37	c.2388	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184988	0.38609	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.32272	1.46	5.25	-6.42	0.01932	.	0.696585	0.15037	N	0.284062	T	0.25419	0.0618	L	0.54323	1.7	0.28401	N	0.918633	P	0.43938	0.822	B	0.44315	0.446	T	0.12656	-1.0539	10	0.46703	T	0.11	-3.9457	8.2206	0.31539	0.0:0.1176:0.3129:0.5695	.	796	Q5VUB5	F1711_HUMAN	H	796;795	ENSP00000367356:Q796H	ENSP00000367356:Q796H	Q	-	3	2	FAM171A1	15295205	0.997000	0.39634	0.642000	0.29436	0.946000	0.59487	0.351000	0.20096	-1.128000	0.02922	0.563000	0.77884	CAG	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.622	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	59	0.00	0	C	XM_167709		15255199	15255199	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.526	G
FAM171A1	221061	genome.wustl.edu	37	10	15255691	15255691	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr10:15255691C>A	ENST00000378116.4	-	8	1902	c.1896G>T	c.(1894-1896)caG>caT	p.Q632H	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	632						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.Q632H(2)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GGGGCTGGATCTGTGAGGACG	0.622																																						dbGAP											2	Substitution - Missense(2)	breast(2)											52.0	61.0	58.0					10																	15255691		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1896G>T	10.37:g.15255691C>A	ENSP00000367356:p.Gln632His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.Q632H	ENST00000378116.4	37	c.1896	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	C	7.176	0.588581	0.13812	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.39056	1.1	5.25	4.33	0.51752	.	0.258172	0.40144	N	0.001169	T	0.37128	0.0992	L	0.45698	1.435	0.53688	D	0.999979	B	0.25272	0.122	B	0.25759	0.063	T	0.13602	-1.0503	10	0.23302	T	0.38	-20.7935	15.118	0.72419	0.1425:0.8575:0.0:0.0	.	632	Q5VUB5	F1711_HUMAN	H	632;631	ENSP00000367356:Q632H	ENSP00000367356:Q632H	Q	-	3	2	FAM171A1	15295697	1.000000	0.71417	0.823000	0.32752	0.120000	0.20174	2.473000	0.45145	1.397000	0.46682	0.563000	0.77884	CAG	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.622	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	96	0.00	0	C	XM_167709		15255691	15255691	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	1.000	A
FAM208A	23272	genome.wustl.edu	37	3	56667593	56667593	+	Missense_Mutation	SNP	C	C	T	rs200064504	byFrequency	TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:56667593C>T	ENST00000493960.2	-	18	3236	c.3226G>A	c.(3226-3228)Gag>Aag	p.E1076K	FAM208A_ENST00000431842.2_Missense_Mutation_p.E639K|FAM208A_ENST00000355628.5_Missense_Mutation_p.E1015K	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1076							poly(A) RNA binding (GO:0044822)	p.E639K(1)|p.E1015K(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TCTACAAACTCCTGCACACCA	0.408													C|||	2	0.000399361	0.0	0.0	5008	,	,		20290	0.0		0.002	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	breast(2)											89.0	97.0	94.0					3																	56667593		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3226G>A	3.37:g.56667593C>T	ENSP00000417509:p.Glu1076Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.E1015K	ENST00000493960.2	37	c.3043	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982709	0.74474	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.14766	2.48;2.69;2.69	5.71	4.78	0.61160	.	0.076070	0.56097	D	0.000033	T	0.30262	0.0759	L	0.61218	1.895	0.35682	D	0.814187	D;D;D;D	0.62365	0.984;0.986;0.984;0.991	P;P;P;P	0.58820	0.846;0.84;0.757;0.703	T	0.19943	-1.0290	10	0.66056	D	0.02	-15.2053	15.0524	0.71885	0.0:0.7426:0.2574:0.0	.	1076;1015;639;1076	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	K	639;1076;1015	ENSP00000399410:E639K;ENSP00000417509:E1076K;ENSP00000347845:E1015K	ENSP00000347845:E1015K	E	-	1	0	C3orf63	56642633	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.368000	0.44222	2.861000	0.98227	0.650000	0.86243	GAG	FAM208A	-	NULL	ENSG00000163946		0.408	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	102	0.00	0	C	NM_015224		56667593	56667593	-1	no_errors	ENST00000355628	ensembl	human	known	69_37n	missense	23	36.11	13	SNP	1.000	T
FAM47C	442444	genome.wustl.edu	37	X	37026644	37026644	+	Missense_Mutation	SNP	G	G	T	rs371622737		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:37026644G>T	ENST00000358047.3	+	1	213	c.161G>T	c.(160-162)gGc>gTc	p.G54V		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	54								p.G54V(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GTGACGGAGGGCATGGACGAC	0.547																																						dbGAP											2	Substitution - Missense(2)	breast(2)											65.0	58.0	61.0					X																	37026644		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.161G>T	X.37:g.37026644G>T	ENSP00000367913:p.Gly54Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU46	Missense_Mutation	SNP	NULL	p.G54V	ENST00000358047.3	37	c.161	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401943	0.25291	.	.	ENSG00000198173	ENST00000358047	T	0.25250	1.81	0.502	0.502	0.16932	.	.	.	.	.	T	0.48003	0.1476	M	0.83223	2.63	0.19300	N	0.999973	D	0.67145	0.996	D	0.69142	0.962	T	0.25363	-1.0134	8	0.87932	D	0	.	.	.	.	.	54	Q5HY64	FA47C_HUMAN	V	54	ENSP00000367913:G54V	ENSP00000367913:G54V	G	+	2	0	FAM47C	36936565	0.022000	0.18835	0.002000	0.10522	0.008000	0.06430	1.100000	0.31025	0.479000	0.27511	0.292000	0.19580	GGC	FAM47C	-	NULL	ENSG00000198173		0.547	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	301	0.00	0	G	NM_001013736		37026644	37026644	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	119	32.00	56	SNP	0.002	T
FAM71E2	284418	genome.wustl.edu	37	19	55870549	55870549	+	Missense_Mutation	SNP	C	C	A	rs571886910		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:55870549C>A	ENST00000424985.3	-	9	1880	c.1687G>T	c.(1687-1689)Gat>Tat	p.D563Y	CTD-2105E13.6_ENST00000591954.3_Silent_p.A112A	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	563								p.D219Y(1)|p.D563Y(1)|p.D563N(1)|p.D219N(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						ACGTCAAAATCGCCAGGGAGC	0.622																																						dbGAP											4	Substitution - Missense(4)	NS(2)|breast(2)											11.0	11.0	11.0					19																	55870549		690	1591	2281	-	-	-	SO:0001583	missense	0			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.1687G>T	19.37:g.55870549C>A	ENSP00000398617:p.Asp563Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8ND99	Missense_Mutation	SNP	pfam_DUF3699	p.D563Y	ENST00000424985.3	37	c.1687		19	.	.	.	.	.	.	.	.	.	.	N	8.355	0.831833	0.16820	.	.	ENSG00000180043	ENST00000424985	T	0.25085	1.82	2.93	-5.86	0.02304	.	.	.	.	.	T	0.12092	0.0294	N	0.14661	0.345	0.09310	N	1	B	0.32382	0.368	B	0.29353	0.101	T	0.19549	-1.0302	9	0.59425	D	0.04	.	8.4005	0.32583	0.0:0.5099:0.2296:0.2605	.	563	Q8N5Q1	F71E2_HUMAN	Y	563	ENSP00000398617:D563Y	ENSP00000398617:D563Y	D	-	1	0	FAM71E2	60562361	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.127000	0.01315	-2.460000	0.00537	-1.358000	0.01219	GAT	FAM71E2	-	NULL	ENSG00000180043		0.622	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	FAM71E2	HGNC	protein_coding	OTTHUMT00000409063.4	29	0.00	0	C	NM_001145402		55870549	55870549	-1	no_errors	ENST00000424985	ensembl	human	novel	69_37n	missense	7	41.67	5	SNP	0.000	A
FBN1	2200	genome.wustl.edu	37	15	48787333	48787333	+	Silent	SNP	G	G	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr15:48787333G>T	ENST00000316623.5	-	22	3119	c.2664C>A	c.(2662-2664)acC>acA	p.T888T		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	888	TB 4.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T888T(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CTTGGCATAGGGTGCACGGGC	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											58.0	50.0	53.0					15																	48787333		2197	4296	6493	-	-	-	SO:0001819	synonymous_variant	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.2664C>A	15.37:g.48787333G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.T888	ENST00000316623.5	37	c.2664	CCDS32232.1	15																																																																																			FBN1	-	pfam_TB_dom,superfamily_TB_dom,pirsf_Fibrillin	ENSG00000166147		0.498	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	101	0.00	0	G			48787333	48787333	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	silent	59	27.71	23	SNP	0.008	T
FLG	2312	genome.wustl.edu	37	1	152282641	152282641	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:152282641G>C	ENST00000368799.1	-	3	4756	c.4721C>G	c.(4720-4722)tCa>tGa	p.S1574*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1574	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S1574*(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCCACCTGTGAGTGTCTAGA	0.577									Ichthyosis																													dbGAP											1	Substitution - Nonsense(1)	breast(1)											170.0	182.0	178.0					1																	152282641		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4721C>G	1.37:g.152282641G>C	ENSP00000357789:p.Ser1574*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S1574*	ENST00000368799.1	37	c.4721	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.265599	0.98732	.	.	ENSG00000143631	ENST00000368799	.	.	.	2.24	2.24	0.28232	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	7.9916	0.30244	0.0:0.0:1.0:0.0	.	.	.	.	X	1574	.	ENSP00000357789:S1574X	S	-	2	0	FLG	150549265	0.001000	0.12720	0.001000	0.08648	0.037000	0.13140	0.739000	0.26173	1.259000	0.44117	0.485000	0.47835	TCA	FLG	-	pfam_Filaggrin	ENSG00000143631		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	170	0.00	0	G	NM_002016		152282641	152282641	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	nonsense	100	24.44	33	SNP	0.002	C
FLG	2312	genome.wustl.edu	37	1	152282818	152282818	+	Nonsense_Mutation	SNP	G	G	C	rs180768115	byFrequency	TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:152282818G>C	ENST00000368799.1	-	3	4579	c.4544C>G	c.(4543-4545)tCa>tGa	p.S1515*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1515	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S1515*(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGGTACCCTGAGTGTCCAGA	0.567									Ichthyosis																													dbGAP											1	Substitution - Nonsense(1)	breast(1)											332.0	315.0	321.0					1																	152282818		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4544C>G	1.37:g.152282818G>C	ENSP00000357789:p.Ser1515*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S1515*	ENST00000368799.1	37	c.4544	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.614191	0.98390	.	.	ENSG00000143631	ENST00000368799	.	.	.	2.45	1.51	0.23008	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	5.1484	0.14996	0.1784:0.0:0.8216:0.0	.	.	.	.	X	1515	.	ENSP00000357789:S1515X	S	-	2	0	FLG	150549442	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	0.630000	0.24553	0.379000	0.24794	-0.350000	0.07774	TCA	FLG	-	NULL	ENSG00000143631		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	202	0.00	0	G	NM_002016		152282818	152282818	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	nonsense	124	27.49	47	SNP	0.001	C
FMO4	2329	genome.wustl.edu	37	1	171306533	171306533	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:171306533G>C	ENST00000367749.3	+	9	1549	c.1219G>C	c.(1219-1221)Gag>Cag	p.E407Q		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	407					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.E407Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					ATTGATGATGGAGGCTACTGA	0.358																																					Pancreas(24;816 862 7754 7993 32832)	dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	100.0	102.0					1																	171306533		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.1219G>C	1.37:g.171306533G>C	ENSP00000356723:p.Glu407Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XR0	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_4,prints_Flavin_mOase_1,prints_Flavin_mOase_3	p.E407Q	ENST00000367749.3	37	c.1219	CCDS1295.1	1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.344885	0.24426	.	.	ENSG00000076258	ENST00000367749	T	0.58060	0.36	4.85	3.93	0.45458	.	0.339515	0.32175	N	0.006475	T	0.47728	0.1461	M	0.66506	2.035	0.22940	N	0.998539	P	0.34724	0.465	P	0.48770	0.589	T	0.41070	-0.9529	10	0.51188	T	0.08	-9.0465	9.5252	0.39160	0.0989:0.0:0.9011:0.0	.	407	P31512	FMO4_HUMAN	Q	407	ENSP00000356723:E407Q	ENSP00000356723:E407Q	E	+	1	0	FMO4	169573157	0.506000	0.26139	0.820000	0.32676	0.104000	0.19210	2.611000	0.46334	2.210000	0.71456	0.655000	0.94253	GAG	FMO4	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000076258		0.358	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO4	HGNC	protein_coding	OTTHUMT00000086223.1	440	0.00	0	G	NM_002022		171306533	171306533	+1	no_errors	ENST00000367749	ensembl	human	known	69_37n	missense	628	17.89	137	SNP	0.596	C
GBA3	57733	genome.wustl.edu	37	4	22749339	22749339	+	RNA	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:22749339C>T	ENST00000503442.1	+	0	377				GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)	p.S236L(1)		breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GATCCCAACTCAGTGTCTGAC	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	142.0	142.0					4																	22749339		1901	4110	6011	-	-	-			0			AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22749339C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Missense_Mutation	SNP	NULL	p.S236L	ENST00000503442.1	37	c.707		4																																																																																			GBA3	-	NULL	ENSG00000249948		0.428	GBA3-003	KNOWN	basic	polymorphic_pseudogene	GBA3	HGNC	polymorphic_pseudogene	OTTHUMT00000360620.2	199	0.00	0	C			22749339	22749339	+1	pseudogene	ENST00000508166	ensembl	human	known	69_37n	missense	127	13.01	19	SNP	0.658	T
FRYL	285527	genome.wustl.edu	37	4	48597671	48597671	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:48597671C>T	ENST00000503238.1	-	12	1183	c.1184G>A	c.(1183-1185)cGa>cAa	p.R395Q	FRYL_ENST00000537810.1_Missense_Mutation_p.R395Q|FRYL_ENST00000506685.1_Missense_Mutation_p.R101Q|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507711.1_Missense_Mutation_p.R395Q|FRYL_ENST00000358350.4_Missense_Mutation_p.R395Q			O94915	FRYL_HUMAN	FRY-like	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.R395Q(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AACCACACTTCGTGAGCCTTT	0.378																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|breast(1)											90.0	80.0	83.0					4																	48597671		1866	4099	5965	-	-	-	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1184G>A	4.37:g.48597671C>T	ENSP00000426064:p.Arg395Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R395Q	ENST00000503238.1	37	c.1184	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	C	37	6.164329	0.97338	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.07	5.97	5.97	0.96955	Armadillo-type fold (1);	0.000000	0.64402	U	0.000002	D	0.83266	0.5217	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.77557	0.968;0.99	T	0.82973	-0.0191	10	0.56958	D	0.05	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	395;395	F2Z2S2;O94915	.;FRYL_HUMAN	Q	395;395;395;395;101	ENSP00000426064:R395Q;ENSP00000351113:R395Q;ENSP00000441114:R395Q;ENSP00000421584:R395Q	ENSP00000351113:R395Q	R	-	2	0	FRYL	48292428	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.818000	0.86416	2.834000	0.97654	0.650000	0.86243	CGA	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.378	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	78	0.00	0	C			48597671	48597671	-1	no_errors	ENST00000358350	ensembl	human	known	69_37n	missense	106	24.29	34	SNP	1.000	T
GHRL	51738	genome.wustl.edu	37	3	10331475	10331475	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:10331475C>T	ENST00000335542.8	-	4	1066	c.196G>A	c.(196-198)Gaa>Aaa	p.E66K	GHRL_ENST00000450603.1_Missense_Mutation_p.E66K|GHRL_ENST00000437422.2_Missense_Mutation_p.E54K|GHRL_ENST00000449238.2_Missense_Mutation_p.E53K|GHRL_ENST00000457360.1_Missense_Mutation_p.E66K|GHRL_ENST00000449554.2_Missense_Mutation_p.E65K|GHRLOS_ENST00000605105.1_RNA|GHRL_ENST00000287656.7_Missense_Mutation_p.E65K|GHRLOS_ENST00000439539.3_RNA|GHRL_ENST00000429122.1_Missense_Mutation_p.E66K|GHRLOS_ENST00000605014.1_RNA|GHRLOS_ENST00000603771.1_RNA|GHRL_ENST00000476283.1_5'UTR|GHRL_ENST00000439975.2_Intron|GHRL_ENST00000446937.2_Intron|GHRL_ENST00000422159.1_Missense_Mutation_p.E66K|GHRL_ENST00000430179.1_Missense_Mutation_p.E65K			Q9UBU3	GHRL_HUMAN	ghrelin/obestatin prepropeptide	66					actin polymerization or depolymerization (GO:0008154)|activation of MAPK activity (GO:0000187)|adult feeding behavior (GO:0008343)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|cortisol secretion (GO:0043400)|decidualization (GO:0046697)|dendrite development (GO:0016358)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|glucose metabolic process (GO:0006006)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of locomotion (GO:0040013)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of synapse assembly (GO:0051965)|regulation of cell proliferation (GO:0042127)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to estrogen (GO:0043627)|response to hormone (GO:0009725)	axon (GO:0030424)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|ghrelin receptor binding (GO:0031768)|growth hormone-releasing hormone activity (GO:0016608)|protein tyrosine kinase activator activity (GO:0030296)	p.E66K(1)		breast(2)|large_intestine(1)|lung(1)|ovary(1)	5						TCTGCCCCTTCTGCTTGACCT	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											156.0	162.0	160.0					3																	10331475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF296558	CCDS33700.1, CCDS46747.1, CCDS46748.1, CCDS46749.1, CCDS46750.1	3p26-p25	2013-02-26	2008-07-02		ENSG00000157017	ENSG00000157017		"""Endogenous ligands"""	18129	protein-coding gene	gene with protein product	"""prepro-appetite regulatory hormone"""	605353	"""ghrelin, growth hormone secretagogue receptor ligand"""			10930375, 10604470, 16284174	Standard	NR_024133		Approved	MTLRP, ghrelin, obestatin	uc010hdj.2	Q9UBU3	OTTHUMG00000155360	ENST00000335542.8:c.196G>A	3.37:g.10331475C>T	ENSP00000335074:p.Glu66Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8CF34|A8CF38|A8CF42|A8DN29|A8DN30|Q86YP8|Q8TAT9|Q9H3R3	Missense_Mutation	SNP	pfam_Motilin_assoc,pfam_Motilin_ghrelin,prints_Preproghrelin	p.E66K	ENST00000335542.8	37	c.196	CCDS33700.1	3	.	.	.	.	.	.	.	.	.	.	C	10.65	1.409396	0.25378	.	.	ENSG00000157017	ENST00000335542;ENST00000430179;ENST00000450603;ENST00000449554;ENST00000422159;ENST00000449238;ENST00000437422;ENST00000287656;ENST00000457360;ENST00000429122	T;T;T;T;T;T;T;T;T;T	0.55588	1.32;1.32;1.32;1.32;0.51;1.32;1.32;1.32;1.32;1.32	4.3	3.42	0.39159	Motilin/ghrelin-associated peptide (1);	0.225948	0.30771	N	0.008915	T	0.56978	0.2022	M	0.78801	2.425	0.09310	N	0.999996	P;P;P;P;P	0.43938	0.642;0.822;0.805;0.649;0.58	B;B;P;B;B	0.45753	0.199;0.173;0.492;0.23;0.14	T	0.52917	-0.8511	10	0.48119	T	0.1	-3.3356	10.014	0.42003	0.0:0.7944:0.2056:0.0	.	53;54;66;65;66	Q9UBU3-4;Q9UBU3-3;Q9UBU3;Q9UBU3-2;Q86YP8	.;.;GHRL_HUMAN;.;.	K	66;65;66;65;66;53;54;65;66;66	ENSP00000335074:E66K;ENSP00000399922:E65K;ENSP00000389192:E66K;ENSP00000415521:E65K;ENSP00000405464:E66K;ENSP00000388145:E53K;ENSP00000416768:E54K;ENSP00000287656:E65K;ENSP00000391406:E66K;ENSP00000414819:E66K	ENSP00000287656:E65K	E	-	1	0	GHRL	10306475	0.000000	0.05858	0.016000	0.15963	0.071000	0.16799	0.515000	0.22801	1.023000	0.39654	0.563000	0.77884	GAA	GHRL	-	pfam_Motilin_assoc	ENSG00000157017		0.622	GHRL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GHRL	HGNC	protein_coding	OTTHUMT00000339625.1	193	0.00	0	C	NM_016362		10331475	10331475	-1	no_errors	ENST00000335542	ensembl	human	known	69_37n	missense	70	26.80	26	SNP	0.075	T
GON4L	54856	genome.wustl.edu	37	1	155783569	155783569	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:155783569G>A	ENST00000368331.1	-	10	1356	c.1308C>T	c.(1306-1308)atC>atT	p.I436I	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Silent_p.I436I|GON4L_ENST00000271883.5_Silent_p.I436I|GON4L_ENST00000361040.5_Silent_p.I436I	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	436					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.I436I(3)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TGATGTGCCTGATGGCTGGTG	0.473																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											52.0	49.0	50.0					1																	155783569		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1308C>T	1.37:g.155783569G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.I436	ENST00000368331.1	37	c.1308		1																																																																																			GON4L	-	NULL	ENSG00000116580		0.473	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		82	0.00	0	G	NM_032292		155783569	155783569	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	silent	54	22.86	16	SNP	0.443	A
GPATCH1	55094	genome.wustl.edu	37	19	33602733	33602733	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:33602733G>A	ENST00000170564.2	+	12	2003	c.1689G>A	c.(1687-1689)tcG>tcA	p.S563S		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	563					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)	p.S563S(1)		breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					CTTCCCATTCGACCTTGTCCT	0.592																																					Pancreas(67;88 1713 4567 18227)	dbGAP											1	Substitution - coding silent(1)	breast(1)											127.0	107.0	114.0					19																	33602733		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.1689G>A	19.37:g.33602733G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IZV6|Q8N3B7|Q9NW94	Silent	SNP	pfam_DUF1604,pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	p.S563	ENST00000170564.2	37	c.1689	CCDS12428.1	19																																																																																			GPATCH1	-	NULL	ENSG00000076650		0.592	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH1	HGNC	protein_coding	OTTHUMT00000450834.1	56	0.00	0	G	NM_018025		33602733	33602733	+1	no_errors	ENST00000170564	ensembl	human	known	69_37n	silent	20	61.54	32	SNP	0.481	A
GPRC5A	9052	genome.wustl.edu	37	12	13065406	13065406	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:13065406C>A	ENST00000014914.5	+	4	1897	c.1007C>A	c.(1006-1008)tCc>tAc	p.S336Y	GPRC5A_ENST00000542056.1_3'UTR	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	336					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S336Y(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	AAGGAATTCTCCATCCCACGG	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	144.0	144.0					12																	13065406		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.1007C>A	12.37:g.13065406C>A	ENSP00000014914:p.Ser336Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV45|O95357	Missense_Mutation	SNP	pfam_GPCR_3_C	p.S336Y	ENST00000014914.5	37	c.1007	CCDS8657.1	12	.	.	.	.	.	.	.	.	.	.	C	7.540	0.660529	0.14645	.	.	ENSG00000013588	ENST00000014914	T	0.18960	2.18	4.74	4.74	0.60224	.	0.177665	0.40728	N	0.001027	T	0.31451	0.0797	L	0.36672	1.1	0.43988	D	0.99668	D	0.89917	1.0	D	0.85130	0.997	T	0.03175	-1.1064	10	0.02654	T	1	-24.5726	15.915	0.79508	0.0:1.0:0.0:0.0	.	336	Q8NFJ5	RAI3_HUMAN	Y	336	ENSP00000014914:S336Y	ENSP00000014914:S336Y	S	+	2	0	GPRC5A	12956673	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	4.599000	0.61076	2.184000	0.69523	0.491000	0.48974	TCC	GPRC5A	-	NULL	ENSG00000013588		0.517	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5A	HGNC	protein_coding	OTTHUMT00000400682.1	123	0.00	0	C			13065406	13065406	+1	no_errors	ENST00000014914	ensembl	human	known	69_37n	missense	110	13.39	17	SNP	1.000	A
GRIA4	2893	genome.wustl.edu	37	11	105781241	105781241	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:105781241G>C	ENST00000530497.1	+	9	1239	c.1239G>C	c.(1237-1239)gaG>gaC	p.E413D	GRIA4_ENST00000393125.2_Missense_Mutation_p.E413D|GRIA4_ENST00000282499.5_Missense_Mutation_p.E413D|GRIA4_ENST00000393127.2_Missense_Mutation_p.E413D|GRIA4_ENST00000428631.2_Missense_Mutation_p.E413D|GRIA4_ENST00000525187.1_Missense_Mutation_p.E413D			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	413					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.E413D(3)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		CTGCTATTGAGAACAGAACAG	0.423																																						dbGAP											3	Substitution - Missense(3)	breast(3)											255.0	199.0	218.0					11																	105781241		2202	4299	6501	-	-	-	SO:0001583	missense	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1239G>C	11.37:g.105781241G>C	ENSP00000435775:p.Glu413Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XE8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E413D	ENST00000530497.1	37	c.1239	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	G	16.20	3.057263	0.55325	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	T;T;T;T;T;T	0.18502	2.21;2.74;2.59;2.21;2.74;2.59	6.08	0.227	0.15359	.	0.000000	0.64402	D	0.000002	T	0.35970	0.0950	M	0.77486	2.375	0.53005	D	0.99996	B;D;B	0.69078	0.192;0.997;0.369	B;D;B	0.65010	0.168;0.931;0.111	T	0.17837	-1.0356	10	0.56958	D	0.05	.	11.3056	0.49334	0.367:0.0:0.633:0.0	.	413;413;413	P48058;G3V164;Q86XE8	GRIA4_HUMAN;.;.	D	413	ENSP00000376833:E413D;ENSP00000282499:E413D;ENSP00000376835:E413D;ENSP00000415551:E413D;ENSP00000435775:E413D;ENSP00000432180:E413D	ENSP00000282499:E413D	E	+	3	2	GRIA4	105286451	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	1.735000	0.38176	0.122000	0.18314	-0.229000	0.12294	GAG	GRIA4	-	NULL	ENSG00000152578		0.423	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	150	0.00	0	G			105781241	105781241	+1	no_errors	ENST00000282499	ensembl	human	known	69_37n	missense	39	64.22	70	SNP	0.998	C
GRM3	2913	genome.wustl.edu	37	7	86415715	86415715	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:86415715G>C	ENST00000361669.2	+	3	1706	c.607G>C	c.(607-609)Gag>Cag	p.E203Q	GRM3_ENST00000439827.1_Missense_Mutation_p.E203Q|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000536043.1_Missense_Mutation_p.E75Q|GRM3_ENST00000546348.1_Intron|AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000394720.2_Missense_Mutation_p.E201Q	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	203					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.E203Q(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AGCCATGGCTGAGATCTTGCG	0.582																																					GBM(52;969 1098 3139 52280)	dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	91.0	96.0					7																	86415715		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.607G>C	7.37:g.86415715G>C	ENSP00000355316:p.Glu203Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.E203Q	ENST00000361669.2	37	c.607	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679145	0.88542	.	.	ENSG00000198822	ENST00000361669;ENST00000454217;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	5.72	5.72	0.89469	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89729	0.6799	L	0.52823	1.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.988;0.996	D	0.90095	0.4180	10	0.87932	D	0	.	18.8634	0.92281	0.0:0.0:1.0:0.0	.	75;203;203	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	Q	203;75;75;203;201	ENSP00000355316:E203Q;ENSP00000405427:E75Q;ENSP00000441407:E75Q;ENSP00000398767:E203Q;ENSP00000378209:E201Q	ENSP00000355316:E203Q	E	+	1	0	GRM3	86253651	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.756000	0.98918	2.711000	0.92665	0.655000	0.94253	GAG	GRM3	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3	ENSG00000198822		0.582	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	113	0.00	0	G			86415715	86415715	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	missense	50	35.06	27	SNP	1.000	C
GYPB	2994	genome.wustl.edu	37	4	144922404	144922404	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:144922404C>T	ENST00000502664.1	-	2	121	c.70G>A	c.(70-72)Gag>Aag	p.E24K	GYPB_ENST00000510196.2_5'UTR|GYPB_ENST00000283126.7_Missense_Mutation_p.E24K|GYPB_ENST00000513128.1_Intron|GYPB_ENST00000429670.2_Missense_Mutation_p.E24K|RP11-673E1.4_ENST00000506982.1_RNA	NM_002100.4	NP_002091	P06028	GLPB_HUMAN	glycophorin B (MNS blood group)	24						integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.E24K(2)		breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					ATTGCCACCTCAGTGGTACTT	0.368																																						dbGAP											2	Substitution - Missense(2)	breast(2)											157.0	193.0	181.0					4																	144922404		2196	4300	6496	-	-	-	SO:0001583	missense	0				CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000502664.1:c.70G>A	4.37:g.144922404C>T	ENSP00000427690:p.Glu24Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	pfam_Glycophorin	p.E24K	ENST00000502664.1	37	c.70	CCDS54809.1	4	.	.	.	.	.	.	.	.	.	.	C	5.851	0.341249	0.11069	.	.	ENSG00000250361	ENST00000283126;ENST00000502664;ENST00000429670	T;T;T	0.14516	2.5;2.5;3.39	1.55	0.676	0.17958	.	.	.	.	.	T	0.06962	0.0177	.	.	.	0.09310	N	1	B	0.31100	0.308	B	0.22386	0.039	T	0.34153	-0.9840	8	0.34782	T	0.22	.	3.8931	0.09127	0.0:0.763:0.0:0.237	.	24	E2QBW7	.	K	24	ENSP00000283126:E24K;ENSP00000427690:E24K;ENSP00000394200:E24K	ENSP00000283126:E24K	E	-	1	0	GYPB	145141854	0.000000	0.05858	0.020000	0.16555	0.028000	0.11728	-0.717000	0.04986	0.240000	0.21263	0.134000	0.15878	GAG	GYPB	-	pfam_Glycophorin	ENSG00000250361		0.368	GYPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYPB	HGNC	protein_coding	OTTHUMT00000364791.1	372	0.00	0	C	NM_002100		144922404	144922404	-1	no_errors	ENST00000283126	ensembl	human	known	69_37n	missense	303	14.04	50	SNP	0.020	T
MROH1	727957	genome.wustl.edu	37	8	145245695	145245695	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr8:145245695delC	ENST00000528919.1	+	7	692	c.571delC	c.(571-573)cgcfs	p.R191fs	MROH1_ENST00000326134.5_Frame_Shift_Del_p.R191fs|MROH1_ENST00000534366.1_Frame_Shift_Del_p.R191fs|MROH1_ENST00000423230.2_Frame_Shift_Del_p.R191fs|MROH1_ENST00000398656.4_Frame_Shift_Del_p.R191fs	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1	191																	AGCTCTGCAGCGCTTCAGCGA	0.607																																						dbGAP											0													81.0	87.0	85.0					8																	145245695		2080	4206	6286	-	-	-	SO:0001589	frameshift_variant	0				CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.571delC	8.37:g.145245695delC	ENSP00000435565:p.Arg191fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Frame_Shift_Del	DEL	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.R191fs	ENST00000528919.1	37	c.571	CCDS47938.1	8																																																																																			HEATR7A	-	superfamily_ARM-type_fold	ENSG00000179832		0.607	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HEATR7A	HGNC	protein_coding	OTTHUMT00000386183.1	42	0.00	0	C	NM_032450		145245695	145245695	+1	no_errors	ENST00000326134	ensembl	human	known	69_37n	frame_shift_del	20	35.48	11	DEL	1.000	-
HIST1H2AJ	8331	genome.wustl.edu	37	6	27782387	27782387	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:27782387G>A	ENST00000333151.3	-	1	220	c.132C>T	c.(130-132)gtC>gtT	p.V44V	HIST1H2BM_ENST00000359465.4_5'Flank	NM_021066.2	NP_066544.1	Q99878	H2A1J_HUMAN	histone cluster 1, H2aj	44						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V44V(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(2)	11						CTCCAGCACCGACCCGCTCCG	0.672																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											11.0	15.0	14.0					6																	27782387		2030	4108	6138	-	-	-	SO:0001819	synonymous_variant	0			Z83736	CCDS4628.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000182611	ENSG00000276368		"""Histones / Replication-dependent"""	4727	protein-coding gene	gene with protein product		602791	"""H2A histone family, member E"", ""histone 1, H2aj"""	H2AFE		9439656, 12408966	Standard	NM_021066		Approved	H2A/E	uc003njn.1	Q99878	OTTHUMG00000014486	ENST00000333151.3:c.132C>T	6.37:g.27782387G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUU6|Q5JXQ5	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.V44	ENST00000333151.3	37	c.132	CCDS4628.1	6																																																																																			HIST1H2AJ	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000182611		0.672	HIST1H2AJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AJ	HGNC	protein_coding	OTTHUMT00000040154.1	95	0.00	0	G	NM_021066		27782387	27782387	-1	no_errors	ENST00000333151	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	0.631	A
IFNA13	3447	genome.wustl.edu	37	9	21367456	21367456	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr9:21367456C>T	ENST00000449498.1	-	1	619	c.554G>A	c.(553-555)aGa>aAa	p.R185K		NM_006900.3	NP_008831.3	P01562	IFNA1_HUMAN	interferon, alpha 13	184					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.R184K(1)		breast(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CCTCCTTAATCTTTCTTGCAA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	144.0	147.0					9																	21367456		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6505.2	9p22	2010-12-10			ENSG00000233816	ENSG00000233816		"""Interferons"""	5419	protein-coding gene	gene with protein product		147578				1385305	Standard	NM_006900		Approved		uc003zpa.2	P01562	OTTHUMG00000019675	ENST00000449498.1:c.554G>A	9.37:g.21367456C>T	ENSP00000394494:p.Arg185Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D4Q9M8|Q14605|Q2M1L8|Q52LB8|Q5VYQ2|Q7M4Q1|Q8WZ68|Q9UMJ3	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.R185K	ENST00000449498.1	37	c.554	CCDS6505.2	9	.	.	.	.	.	.	.	.	.	.	C	12.27	1.889105	0.33348	.	.	ENSG00000233816	ENST00000449498	T	0.03745	3.82	2.46	-0.799	0.10901	.	0.802693	0.11446	N	0.563268	T	0.03739	0.0106	L	0.43598	1.365	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37709	-0.9694	10	0.54805	T	0.06	.	6.5907	0.22646	0.0:0.588:0.0:0.412	.	185	E9PB07	.	K	185	ENSP00000394494:R185K	ENSP00000394494:R185K	R	-	2	0	IFNA13	21357456	0.000000	0.05858	0.039000	0.18376	0.674000	0.39518	0.103000	0.15292	-0.052000	0.13311	0.313000	0.20887	AGA	IFNA13	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core	ENSG00000233816		0.408	IFNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA13	HGNC	protein_coding	OTTHUMT00000051904.2	147	0.00	0	C	NM_006900		21367456	21367456	-1	no_errors	ENST00000449498	ensembl	human	known	69_37n	missense	24	44.19	19	SNP	0.045	T
INSC	387755	genome.wustl.edu	37	11	15170708	15170708	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:15170708G>A	ENST00000379554.3	+	2	175	c.129G>A	c.(127-129)caG>caA	p.Q43Q	INSC_ENST00000530161.1_5'UTR|INSC_ENST00000424273.1_5'UTR|INSC_ENST00000525218.1_5'UTR|INSC_ENST00000379556.3_5'UTR|INSC_ENST00000528567.1_5'UTR	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	43					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						CTTTGCTGCAGATTGGGATCA	0.577																																						dbGAP											0													65.0	66.0	65.0					11																	15170708		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.129G>A	11.37:g.15170708G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Silent	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.Q43	ENST00000379554.3	37	c.129	CCDS41621.1	11																																																																																			INSC	-	NULL	ENSG00000188487		0.577	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSC	HGNC	protein_coding	OTTHUMT00000386590.1	23	0.00	0	G	NM_001031853		15170708	15170708	+1	no_errors	ENST00000379554	ensembl	human	known	69_37n	silent	14	48.15	13	SNP	0.999	A
INSL5	10022	genome.wustl.edu	37	1	67263791	67263791	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:67263791T>A	ENST00000304526.2	-	2	347	c.313A>T	c.(313-315)Aag>Tag	p.K105*		NM_005478.4	NP_005469.2	Q9Y5Q6	INSL5_HUMAN	insulin-like 5	105						extracellular region (GO:0005576)		p.K105*(1)		breast(2)|endometrium(1)|lung(5)	8						TTCTTTGACTTCCAAAGCTCT	0.458																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											122.0	111.0	115.0					1																	67263791		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF133816	CCDS634.1	1p31.3	2013-02-26			ENSG00000172410	ENSG00000172410		"""Endogenous ligands"""	6088	protein-coding gene	gene with protein product	"""prepro-INSL5"""	606413				10458910	Standard	NM_005478		Approved		uc001dcw.3	Q9Y5Q6	OTTHUMG00000009164	ENST00000304526.2:c.313A>T	1.37:g.67263791T>A	ENSP00000302724:p.Lys105*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIY4|Q5VYD8	Nonsense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like	p.K105*	ENST00000304526.2	37	c.313	CCDS634.1	1	.	.	.	.	.	.	.	.	.	.	T	12.08	1.829881	0.32329	.	.	ENSG00000172410	ENST00000304526	.	.	.	4.26	-0.284	0.12870	.	1.514230	0.04639	N	0.405043	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-7.5378	3.6944	0.08358	0.0:0.4604:0.1871:0.3524	.	.	.	.	X	105	.	ENSP00000302724:K105X	K	-	1	0	INSL5	67036379	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.477000	0.06583	-0.188000	0.10499	-0.345000	0.07892	AAG	INSL5	-	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like	ENSG00000172410		0.458	INSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSL5	HGNC	protein_coding	OTTHUMT00000025403.1	165	0.00	0	T	NM_005478		67263791	67263791	-1	no_errors	ENST00000304526	ensembl	human	known	69_37n	nonsense	121	29.48	51	SNP	0.000	A
INTS9	55756	genome.wustl.edu	37	8	28627432	28627432	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr8:28627432C>T	ENST00000521022.1	-	16	1855	c.1774G>A	c.(1774-1776)Gag>Aag	p.E592K	INTS9_ENST00000521777.1_Missense_Mutation_p.E568K|INTS9_ENST00000397363.4_Missense_Mutation_p.E486K|INTS9_ENST00000416984.2_Missense_Mutation_p.E571K	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	592					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)		p.E592K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		ACGAACTGCTCCACAGGGATG	0.607											OREG0018682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	100.0	111.0					8																	28627432		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.1774G>A	8.37:g.28627432C>T	ENSP00000429065:p.Glu592Lys	Somatic	803	WXS	Illumina GAIIx	Phase_IV	B7Z560|B7Z6M5|O00224|Q8TB16	Nonsense_Mutation	SNP	NULL	p.W65*	ENST00000521022.1	37	c.195	CCDS34873.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.4|22.4	4.282312|4.282312	0.80692|0.80692	.|.	.|.	ENSG00000104299|ENSG00000104299	ENST00000521022;ENST00000416984;ENST00000541706;ENST00000521777;ENST00000397363|ENST00000517383	T;T;T;T|.	0.46451|.	0.89;0.87;0.88;0.89|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.157294|.	0.56097|.	D|.	0.000028|.	T|.	0.72342|.	0.3448|.	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	B;B|.	0.20550|.	0.046;0.026|.	B;B|.	0.30716|.	0.069;0.119|.	T|.	0.67917|.	-0.5546|.	10|.	0.36615|.	T|.	0.2|.	-17.9198|-17.9198	19.8045|19.8045	0.96525|0.96525	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	571;592|.	B7Z6M5;Q9NV88|.	.;INT9_HUMAN|.	K|X	592;571;436;568;486|65	ENSP00000429065:E592K;ENSP00000398208:E571K;ENSP00000430943:E568K;ENSP00000380520:E486K|.	ENSP00000380520:E486K|.	E|W	-|-	1|3	0|0	INTS9|INTS9	28683351|28683351	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.847000|0.847000	0.48162|0.48162	7.558000|7.558000	0.82253|0.82253	2.676000|2.676000	0.91093|0.91093	0.655000|0.655000	0.94253|0.94253	GAG|TGG	INTS9	-	NULL	ENSG00000104299		0.607	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS9	HGNC	protein_coding	OTTHUMT00000376846.1	126	0.00	0	C	NM_018250		28627432	28627432	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000517383	ensembl	human	novel	69_37n	nonsense	38	28.30	15	SNP	1.000	T
INTU	27152	genome.wustl.edu	37	4	128554244	128554244	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:128554244G>A	ENST00000335251.6	+	1	158	c.55G>A	c.(55-57)Gac>Aac	p.D19N	INTU_ENST00000296461.5_Missense_Mutation_p.D19N	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	19					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.D19N(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						GCTCCCTGGAGACCCCTCTTC	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											67.0	65.0	66.0					4																	128554244		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.55G>A	4.37:g.128554244G>A	ENSP00000334003:p.Asp19Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D19N	ENST00000335251.6	37	c.55	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	G	7.048	0.563863	0.13498	.	.	ENSG00000164066	ENST00000335251;ENST00000296461	T	0.46063	0.88	4.03	3.2	0.36748	.	0.557433	0.17334	N	0.178018	T	0.32704	0.0838	L	0.40543	1.245	0.09310	N	1	B	0.34290	0.447	B	0.35114	0.196	T	0.20538	-1.0272	10	0.51188	T	0.08	-1.988	8.0074	0.30334	0.109:0.0:0.891:0.0	.	19	Q9ULD6	PDZD6_HUMAN	N	19	ENSP00000296461:D19N	ENSP00000296461:D19N	D	+	1	0	INTU	128773694	0.012000	0.17670	0.017000	0.16124	0.024000	0.10985	1.286000	0.33273	1.295000	0.44724	-0.137000	0.14449	GAC	INTU	-	NULL	ENSG00000164066		0.502	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	HGNC	protein_coding	OTTHUMT00000364147.2	88	0.00	0	G	XM_371707		128554244	128554244	+1	no_errors	ENST00000335251	ensembl	human	known	69_37n	missense	25	48.00	24	SNP	0.021	A
IQSEC2	23096	genome.wustl.edu	37	X	53276287	53276287	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:53276287G>A	ENST00000375368.5	-	7	2783	c.2583C>T	c.(2581-2583)ctC>ctT	p.L861L	IQSEC2_ENST00000375365.2_Silent_p.L666L|IQSEC2_ENST00000396435.3_Silent_p.L871L			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	861	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.L868L(1)|p.L871L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ACTGGCGCACGAGGGCTGGGT	0.567																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											132.0	83.0	99.0					X																	53276287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2583C>T	X.37:g.53276287G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.L871	ENST00000375368.5	37	c.2613		X																																																																																			IQSEC2	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000124313		0.567	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		199	0.50	1	G	XM_291345		53276287	53276287	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	silent	74	22.11	21	SNP	0.580	A
ITGAV	3685	genome.wustl.edu	37	2	187511517	187511517	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:187511517G>A	ENST00000261023.3	+	13	1538	c.1264G>A	c.(1264-1266)Gaa>Aaa	p.E422K	ITGAV_ENST00000433736.2_Missense_Mutation_p.E376K|ITGAV_ENST00000374907.3_Missense_Mutation_p.E386K|AC017101.10_ENST00000453665.1_RNA	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	422					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)	p.E422K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	TCAAATCCTTGAAGGGCAGTG	0.433																																					Melanoma(58;108 1995 6081)	dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	72.0	72.0					2																	187511517		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1264G>A	2.37:g.187511517G>A	ENSP00000261023:p.Glu422Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E422K	ENST00000261023.3	37	c.1264	CCDS2292.1	2	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444257	0.43429	.	.	ENSG00000138448	ENST00000544640;ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.22743	1.94;1.94;1.94	5.38	2.33	0.28932	.	0.386442	0.31415	N	0.007699	T	0.19127	0.0459	L	0.38692	1.165	0.39998	D	0.97512	B;B;B	0.14438	0.004;0.009;0.01	B;B;B	0.10450	0.003;0.005;0.003	T	0.09840	-1.0656	10	0.62326	D	0.03	.	16.066	0.80870	0.0:0.3771:0.6229:0.0	.	376;386;422	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	K	422;422;386;376	ENSP00000261023:E422K;ENSP00000364042:E386K;ENSP00000404291:E376K	ENSP00000261023:E422K	E	+	1	0	ITGAV	187219762	0.996000	0.38824	0.388000	0.26195	0.889000	0.51656	2.496000	0.45346	0.589000	0.29677	0.561000	0.74099	GAA	ITGAV	-	smart_Int_alpha_beta-p	ENSG00000138448		0.433	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	193	0.00	0	G	NM_002210		187511517	187511517	+1	no_errors	ENST00000261023	ensembl	human	known	69_37n	missense	90	28.00	35	SNP	0.486	A
ITGB1BP2	26548	genome.wustl.edu	37	X	70524437	70524437	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:70524437C>A	ENST00000373829.3	+	10	872	c.799C>A	c.(799-801)Cag>Aag	p.Q267K	ITGB1BP2_ENST00000465388.1_3'UTR|ITGB1BP2_ENST00000538820.1_Missense_Mutation_p.Q249K	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2	267	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.Q267K(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					GTTCCAAGCACAGATGAAGCT	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	94.0	103.0					X																	70524437		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.799C>A	X.37:g.70524437C>A	ENSP00000362935:p.Gln267Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32N04|Q549J7	Missense_Mutation	SNP	pfam_CHORD,pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.Q267K	ENST00000373829.3	37	c.799	CCDS14411.1	X	.	.	.	.	.	.	.	.	.	.	C	8.505	0.865220	0.17250	.	.	ENSG00000147166	ENST00000373829;ENST00000538820	T;T	0.13196	2.61;2.61	5.11	5.11	0.69529	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.311378	0.35235	N	0.003360	T	0.09379	0.0231	N	0.19112	0.55	0.41290	D	0.986973	P;P	0.42757	0.789;0.625	B;B	0.41088	0.347;0.258	T	0.30238	-0.9985	10	0.12430	T	0.62	-7.7727	12.5622	0.56288	0.0:1.0:0.0:0.0	.	249;267	Q32N04;Q9UKP3	.;ITBP2_HUMAN	K	267;249	ENSP00000362935:Q267K;ENSP00000440289:Q249K	ENSP00000362935:Q267K	Q	+	1	0	ITGB1BP2	70441162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.790000	0.38734	2.359000	0.80004	0.513000	0.50165	CAG	ITGB1BP2	-	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	ENSG00000147166		0.493	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB1BP2	HGNC	protein_coding	OTTHUMT00000057126.1	341	0.00	0	C	NM_012278		70524437	70524437	+1	no_errors	ENST00000373829	ensembl	human	known	69_37n	missense	200	28.47	80	SNP	1.000	A
ITPR2	3709	genome.wustl.edu	37	12	26551828	26551828	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:26551828C>T	ENST00000381340.3	-	54	8093	c.7677G>A	c.(7675-7677)aaG>aaA	p.K2559K	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2559					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.K2559K(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AACAAGTTGTCTTTAGAATTT	0.333																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											101.0	90.0	94.0					12																	26551828		1809	4079	5888	-	-	-	SO:0001819	synonymous_variant	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7677G>A	12.37:g.26551828C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O94773	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.K2559	ENST00000381340.3	37	c.7677	CCDS41764.1	12																																																																																			ITPR2	-	NULL	ENSG00000123104		0.333	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	193	0.00	0	C	NM_002223		26551828	26551828	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	silent	210	22.22	60	SNP	1.000	T
ITPR2	3709	genome.wustl.edu	37	12	26568266	26568266	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:26568266C>T	ENST00000381340.3	-	51	7692	c.7276G>A	c.(7276-7278)Gat>Aat	p.D2426N	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2426					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.D2426N(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTCAGCCTATCAACTTCCATA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											112.0	107.0	108.0					12																	26568266		1851	4091	5942	-	-	-	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7276G>A	12.37:g.26568266C>T	ENSP00000370744:p.Asp2426Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.D2426N	ENST00000381340.3	37	c.7276	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063360	0.76187	.	.	ENSG00000123104	ENST00000381340	D	0.98531	-4.98	5.08	4.18	0.49190	Ion transport (1);	0.053337	0.64402	D	0.000001	D	0.98855	0.9613	M	0.84683	2.71	0.80722	D	1	D	0.56287	0.975	D	0.65573	0.936	D	0.99513	1.0956	10	0.66056	D	0.02	.	15.6205	0.76802	0.0:0.8622:0.1378:0.0	.	2426	Q14571	ITPR2_HUMAN	N	2426	ENSP00000370744:D2426N	ENSP00000370744:D2426N	D	-	1	0	ITPR2	26459533	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.910000	0.69931	1.343000	0.45638	0.591000	0.81541	GAT	ITPR2	-	pfam_Ion_trans_dom	ENSG00000123104		0.413	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	155	0.00	0	C	NM_002223		26568266	26568266	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	missense	120	27.71	46	SNP	1.000	T
KCTD3	51133	genome.wustl.edu	37	1	215785242	215785242	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:215785242G>C	ENST00000259154.4	+	15	1835	c.1541G>C	c.(1540-1542)aGa>aCa	p.R514T		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	514					protein homooligomerization (GO:0051260)			p.R514T(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		CTATTTGTAAGACTCTCATCG	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	85.0	84.0					1																	215785242		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.1541G>C	1.37:g.215785242G>C	ENSP00000259154:p.Arg514Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.R514T	ENST00000259154.4	37	c.1541	CCDS1515.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.5|27.5	4.840513|4.840513	0.91197|0.91197	.|.	.|.	ENSG00000136636|ENSG00000136636	ENST00000452413|ENST00000259154;ENST00000366946	.|T	.|0.52526	.|0.66	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71134|0.71134	0.3304|0.3304	M|M	0.77820|0.77820	2.39|2.39	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.996;0.999;0.999;0.999	T|T	0.73421|0.73421	-0.3988|-0.3988	5|10	.|0.62326	.|D	.|0.03	-33.9312|-33.9312	18.5499|18.5499	0.91060|0.91060	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|266;266;514;514	.|B7ZAF7;B4DJX2;Q9Y597-2;Q9Y597	.|.;.;.;KCTD3_HUMAN	N|T	145|514;166	.|ENSP00000259154:R514T	.|ENSP00000259154:R514T	K|R	+|+	3|2	2|0	KCTD3|KCTD3	213851865|213851865	1.000000|1.000000	0.71417|0.71417	0.838000|0.838000	0.33150|0.33150	0.986000|0.986000	0.74619|0.74619	9.397000|9.397000	0.97276|0.97276	2.616000|2.616000	0.88540|0.88540	0.467000|0.467000	0.42956|0.42956	AAG|AGA	KCTD3	-	NULL	ENSG00000136636		0.343	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	81	0.00	0	G	NM_016121		215785242	215785242	+1	no_errors	ENST00000259154	ensembl	human	known	69_37n	missense	260	13.86	42	SNP	0.997	C
KDM4E	390245	genome.wustl.edu	37	11	94758974	94758974	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:94758974C>T	ENST00000450979.2	+	1	553	c.253C>T	c.(253-255)Caa>Taa	p.Q85*		NM_001161630.1	NP_001155102.1	B2RXH2	KDM4E_HUMAN	lysine (K)-specific demethylase 4E	85					histone H3-K9 demethylation (GO:0033169)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.Q85*(2)		breast(1)|endometrium(7)|kidney(1)|lung(3)	12						TGTGTTTACTCAATACCATAA	0.463																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											20.0	19.0	19.0					11																	94758974		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			BC157851	CCDS44713.1	11q21	2012-03-30	2012-03-28	2012-03-28		ENSG00000235268		"""Chromatin-modifying enzymes / K-demethylases"""	37098	protein-coding gene	gene with protein product			"""lysine (K)-specific demethylase 4D-like"""	KDM4DL		21076780	Standard	NM_001161630		Approved	JMJD2E	uc010ruf.1	B2RXH2		ENST00000450979.2:c.253C>T	11.37:g.94758974C>T	ENSP00000397239:p.Gln85*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,smart_TF_JmjN,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom	p.Q85*	ENST00000450979.2	37	c.253	CCDS44713.1	11	.	.	.	.	.	.	.	.	.	.	c	37	6.011398	0.97200	.	.	ENSG00000235268	ENST00000450979	.	.	.	2.18	2.18	0.27775	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-14.2464	10.4356	0.44433	0.0:1.0:0.0:0.0	.	.	.	.	X	85	.	ENSP00000397239:Q85X	Q	+	1	0	KDM4DL	94398622	1.000000	0.71417	0.969000	0.41365	0.798000	0.45092	5.126000	0.64721	1.543000	0.49345	0.455000	0.32223	CAA	KDM4E	-	NULL	ENSG00000235268		0.463	KDM4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4E	HGNC	protein_coding	OTTHUMT00000396649.1	63	0.00	0	C	NM_001161630		94758974	94758974	+1	no_errors	ENST00000450979	ensembl	human	known	69_37n	nonsense	14	54.84	17	SNP	1.000	T
GSE1	23199	genome.wustl.edu	37	16	85699765	85699765	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr16:85699765G>A	ENST00000253458.7	+	13	3118	c.2942G>A	c.(2941-2943)gGa>gAa	p.G981E	GSE1_ENST00000393243.1_Missense_Mutation_p.G908E|GSE1_ENST00000405402.2_Missense_Mutation_p.G877E	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	981								p.G981E(1)									GAGGCCCCTGGAGGCAAAAAG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	35.0	35.0					16																	85699765		2198	4300	6498	-	-	-	SO:0001583	missense	0			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.2942G>A	16.37:g.85699765G>A	ENSP00000253458:p.Gly981Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	pfam_DUF3736	p.G981E	ENST00000253458.7	37	c.2942	CCDS10952.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.17|11.17	1.560180|1.560180	0.27827|0.27827	.|.	.|.	ENSG00000131149|ENSG00000131149	ENST00000412692;ENST00000438180|ENST00000405402;ENST00000253458;ENST00000393243	.|T;T;T	.|0.28666	.|1.6;1.6;1.6	5.37|5.37	3.26|3.26	0.37387|0.37387	.|.	.|0.849117	.|0.10619	.|N	.|0.653561	T|T	0.25531|0.25531	0.0621|0.0621	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|D;P;P;P	.|0.56521	.|0.976;0.839;0.839;0.859	.|B;P;P;P	.|0.46543	.|0.401;0.52;0.52;0.468	T|T	0.19063|0.19063	-1.0317|-1.0317	5|10	.|0.44086	.|T	.|0.13	-32.3534|-32.3534	14.4721|14.4721	0.67523|0.67523	0.0:0.5309:0.4691:0.0|0.0:0.5309:0.4691:0.0	.|.	.|744;877;908;981	.|Q59GZ0;Q14687-2;Q14687-3;Q14687	.|.;.;.;GSE1_HUMAN	K|E	750;183|877;981;908	.|ENSP00000384839:G877E;ENSP00000253458:G981E;ENSP00000376934:G908E	.|ENSP00000253458:G981E	E|G	+|+	1|2	0|0	KIAA0182|KIAA0182	84257266|84257266	0.016000|0.016000	0.18221|0.18221	0.918000|0.918000	0.36340|0.36340	0.954000|0.954000	0.61252|0.61252	2.102000|2.102000	0.41796|0.41796	1.244000|1.244000	0.43870|0.43870	0.561000|0.561000	0.74099|0.74099	GAG|GGA	KIAA0182	-	NULL	ENSG00000131149		0.632	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA0182	HGNC	protein_coding	OTTHUMT00000325527.1	24	0.00	0	G	NM_014615		85699765	85699765	+1	no_errors	ENST00000253458	ensembl	human	known	69_37n	missense	1	90.00	9	SNP	0.012	A
KIAA1033	23325	genome.wustl.edu	37	12	105531752	105531752	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:105531752C>T	ENST00000332180.5	+	15	1502	c.1415C>T	c.(1414-1416)tCa>tTa	p.S472L		NM_015275.1	NP_056090.1			KIAA1033									p.S472L(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						ACCAAAACCTCAGTTAAGGCA	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	85.0	86.0					12																	105531752		1842	4086	5928	-	-	-	SO:0001583	missense	0			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.1415C>T	12.37:g.105531752C>T	ENSP00000328062:p.Ser472Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S472L	ENST00000332180.5	37	c.1415	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907702	0.72868	.	.	ENSG00000136051	ENST00000332180	T	0.31769	1.48	5.63	5.63	0.86233	.	0.058451	0.64402	D	0.000001	T	0.29945	0.0749	L	0.50333	1.59	0.80722	D	1	P;P	0.41848	0.763;0.763	B;B	0.33960	0.173;0.173	T	0.05305	-1.0893	10	0.37606	T	0.19	.	20.0401	0.97581	0.0:1.0:0.0:0.0	.	473;472	B7ZKT9;Q2M389	.;WASH7_HUMAN	L	472	ENSP00000328062:S472L	ENSP00000328062:S472L	S	+	2	0	KIAA1033	104055882	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.758000	0.85224	2.805000	0.96524	0.655000	0.94253	TCA	KIAA1033	-	NULL	ENSG00000136051		0.363	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4	70	0.00	0	C	NM_015275		105531752	105531752	+1	no_errors	ENST00000332180	ensembl	human	known	69_37n	missense	114	18.44	26	SNP	1.000	T
KIAA1279	26128	genome.wustl.edu	37	10	70776092	70776092	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr10:70776092G>C	ENST00000361983.4	+	7	1888	c.1786G>C	c.(1786-1788)Gag>Cag	p.E596Q		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	596					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)	p.E596Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						AATAGAAGTTGAGCTAGAACT	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	56.0	56.0					10																	70776092		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.1786G>C	10.37:g.70776092G>C	ENSP00000354848:p.Glu596Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	pfam_KBP	p.E596Q	ENST00000361983.4	37	c.1786	CCDS7284.1	10	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528215	0.85706	.	.	ENSG00000198954	ENST00000361983	T	0.59224	0.28	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.76062	0.3935	M	0.67700	2.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76038	-0.3105	10	0.54805	T	0.06	-18.5629	19.6895	0.95993	0.0:0.0:1.0:0.0	.	596	Q96EK5	KBP_HUMAN	Q	596	ENSP00000354848:E596Q	ENSP00000354848:E596Q	E	+	1	0	KIAA1279	70446098	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.771000	0.98977	2.644000	0.89710	0.591000	0.81541	GAG	KIAA1279	-	pfam_KBP	ENSG00000198954		0.383	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1279	HGNC	protein_coding	OTTHUMT00000048370.1	140	0.00	0	G	NM_015634		70776092	70776092	+1	no_errors	ENST00000361983	ensembl	human	known	69_37n	missense	67	43.22	51	SNP	1.000	C
KIF1B	23095	genome.wustl.edu	37	1	10412697	10412697	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:10412697C>T	ENST00000377086.1	+	38	4160	c.3958C>T	c.(3958-3960)Cgg>Tgg	p.R1320W	KIF1B_ENST00000377081.1_Missense_Mutation_p.R1320W|KIF1B_ENST00000263934.6_Missense_Mutation_p.R1274W|KIF1B_ENST00000465635.1_3'UTR			O60333	KIF1B_HUMAN	kinesin family member 1B	1320					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.R1274W(1)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGGTCGTATTCGGAATAAGCC	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											176.0	173.0	174.0					1																	10412697		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3958C>T	1.37:g.10412697C>T	ENSP00000366290:p.Arg1320Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1274W	ENST00000377086.1	37	c.3820		1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799773	0.70567	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;D;D	0.81659	-1.42;-1.52;-1.52	5.76	3.3	0.37823	.	0.000000	0.85682	D	0.000000	D	0.90160	0.6925	M	0.88640	2.97	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;1.0;1.0;0.999;0.954;0.992	D	0.91329	0.5088	10	0.87932	D	0	.	12.5383	0.56154	0.5943:0.4057:0.0:0.0	.	1306;1280;1320;1294;1320;1274	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	W	1320;1274;1320;1320	ENSP00000263934:R1274W;ENSP00000366290:R1320W;ENSP00000366284:R1320W	ENSP00000263934:R1274W	R	+	1	2	KIF1B	10335284	0.994000	0.37717	0.999000	0.59377	0.983000	0.72400	1.158000	0.31737	1.004000	0.39156	-0.266000	0.10368	CGG	KIF1B	-	pfam_Kinesin-like	ENSG00000054523		0.398	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	390	0.26	1	C			10412697	10412697	+1	no_errors	ENST00000263934	ensembl	human	known	69_37n	missense	264	27.07	98	SNP	0.998	T
KRT222	125113	genome.wustl.edu	37	17	38816288	38816288	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:38816288C>T	ENST00000476049.1	-	3	438	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K	KRT222_ENST00000394052.3_Missense_Mutation_p.E133K			Q8N1A0	KT222_HUMAN	keratin 222	133						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.E133K(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(2)|skin(1)	15						ATTTCTTGTTCCAGCCTCATC	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											273.0	240.0	251.0					17																	38816288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092967	CCDS11371.1	17q21.2	2013-06-25	2009-08-25	2009-08-25	ENSG00000213424	ENSG00000213424		"""-"""	28695	protein-coding gene	gene with protein product			"""keratin 222 pseudogene"""	KRT222P		16831889	Standard	NM_152349		Approved	KA21, MGC45562	uc002hvc.2	Q8N1A0	OTTHUMG00000133374	ENST00000476049.1:c.397G>A	17.37:g.38816288C>T	ENSP00000463483:p.Glu133Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z368	Missense_Mutation	SNP	pfam_F,prints_Keratin_I	p.E133K	ENST00000476049.1	37	c.397	CCDS11371.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.796245	0.96952	.	.	ENSG00000213424	ENST00000394049;ENST00000394052	D	0.91945	-2.94	5.82	5.82	0.92795	Filament (1);	0.000000	0.64402	U	0.000003	D	0.97155	0.9070	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.97400	0.9995	10	0.87932	D	0	-14.9457	20.1086	0.97902	0.0:1.0:0.0:0.0	.	93;133	Q8N1A0-2;Q8N1A0	.;KT222_HUMAN	K	93;133	ENSP00000377616:E133K	ENSP00000377613:E93K	E	-	1	0	KRT222	36069814	1.000000	0.71417	0.997000	0.53966	0.960000	0.62799	7.487000	0.81328	2.756000	0.94617	0.563000	0.77884	GAA	KRT222	-	pfam_F	ENSG00000213424		0.438	KRT222-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	KRT222	HGNC	protein_coding	OTTHUMT00000447539.1	306	0.00	0	C	NM_152349		38816288	38816288	-1	no_errors	ENST00000394052	ensembl	human	known	69_37n	missense	27	78.57	99	SNP	1.000	T
LANCL1	10314	genome.wustl.edu	37	2	211301071	211301071	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:211301071C>T	ENST00000443314.1	-	7	1261	c.919G>A	c.(919-921)Gat>Aat	p.D307N	LANCL1_ENST00000441020.3_Missense_Mutation_p.D307N|AC007970.1_ENST00000420418.1_RNA|LANCL1_ENST00000431941.2_Missense_Mutation_p.D307N|AC007970.1_ENST00000433296.1_RNA|LANCL1_ENST00000233714.4_Missense_Mutation_p.D307N|LANCL1_ENST00000450366.2_Missense_Mutation_p.D307N			O43813	LANC1_HUMAN	LanC lantibiotic synthetase component C-like 1 (bacterial)	307					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|G-protein coupled receptor activity (GO:0004930)|glutathione binding (GO:0043295)|low-density lipoprotein particle receptor binding (GO:0050750)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.D307N(1)		breast(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		CAGATCACATCAGCACACTGA	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											220.0	186.0	197.0					2																	211301071		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11395	CCDS2392.1	2q33-q35	2008-05-23	2001-12-04		ENSG00000115365	ENSG00000115365			6508	protein-coding gene	gene with protein product		604155	"""LanC (bacterial lantibiotic synthetase component C)-like 1"""	GPR69A		9512664	Standard	NM_001136574		Approved	p40	uc010zjh.2	O43813	OTTHUMG00000132991	ENST00000443314.1:c.919G>A	2.37:g.211301071C>T	ENSP00000388713:p.Asp307Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_LANC-like,superfamily_6-hairpin_glycosidase-like,prints_LanC-like_prot_euk,prints_LANC-like	p.D307N	ENST00000443314.1	37	c.919	CCDS2392.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354694	0.82243	.	.	ENSG00000115365	ENST00000443314;ENST00000441020;ENST00000450366;ENST00000233714;ENST00000431941	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	5.94	5.94	0.96194	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.138042	0.64402	D	0.000004	T	0.49949	0.1587	M	0.76170	2.325	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.46803	-0.9165	10	0.72032	D	0.01	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	307	O43813	LANC1_HUMAN	N	307	ENSP00000388713:D307N;ENSP00000393323:D307N;ENSP00000393597:D307N;ENSP00000233714:D307N;ENSP00000397646:D307N	ENSP00000233714:D307N	D	-	1	0	LANCL1	211009316	1.000000	0.71417	0.239000	0.24122	0.987000	0.75469	5.783000	0.68982	2.820000	0.97059	0.650000	0.86243	GAT	LANCL1	-	pfam_LANC-like,superfamily_6-hairpin_glycosidase-like,prints_LanC-like_prot_euk	ENSG00000115365		0.453	LANCL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LANCL1	HGNC	protein_coding	OTTHUMT00000336817.1	131	0.00	0	C	NM_006055		211301071	211301071	-1	no_errors	ENST00000233714	ensembl	human	known	69_37n	missense	45	34.78	24	SNP	0.998	T
LTK	4058	genome.wustl.edu	37	15	41797650	41797650	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr15:41797650C>T	ENST00000263800.6	-	14	1872	c.1776G>A	c.(1774-1776)ctG>ctA	p.L592L	LTK_ENST00000561619.1_Silent_p.L290L|LTK_ENST00000453182.2_Silent_p.L462L|LTK_ENST00000355166.5_Silent_p.L531L	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	592	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L592L(1)|p.L531L(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CTCCAGACATCAGTTCCAGCA	0.592										TSP Lung(18;0.14)																												dbGAP											2	Substitution - coding silent(2)	breast(2)											48.0	52.0	50.0					15																	41797650		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1776G>A	15.37:g.41797650C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNJ8|B4DL89|E9PFX4	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L592	ENST00000263800.6	37	c.1776	CCDS10077.1	15																																																																																			LTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000062524		0.592	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2	92	0.00	0	C			41797650	41797650	-1	no_errors	ENST00000263800	ensembl	human	known	69_37n	silent	34	29.17	14	SNP	1.000	T
C7orf55-LUC7L2	100996928	genome.wustl.edu	37	7	139094321	139094321	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:139094321G>A	ENST00000354926.4	+	7	1054	c.700G>A	c.(700-702)Gag>Aag	p.E234K	C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.E231K|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.E233K|LUC7L2_ENST00000541515.3_Missense_Mutation_p.E300K	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough									p.E234K(1)									AGTCGTAGCTGAGAAGCAGGA	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											41.0	39.0	40.0					7																	139094321		1836	4089	5925	-	-	-	SO:0001583	missense	0				CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.700G>A	7.37:g.139094321G>A	ENSP00000347005:p.Glu234Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_LUC7-rel	p.E300K	ENST00000354926.4	37	c.898	CCDS43656.1	7	.	.	.	.	.	.	.	.	.	.	G	18.29	3.592388	0.66219	.	.	ENSG00000146963	ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.50001	1.57;1.57;1.57;0.76	4.89	4.89	0.63831	.	0.203469	0.50627	D	0.000106	T	0.39733	0.1089	L	0.39633	1.23	0.36654	D	0.877532	B;B;B;B	0.26708	0.157;0.033;0.003;0.009	B;B;B;B	0.25759	0.063;0.042;0.015;0.025	T	0.37430	-0.9706	9	0.11485	T	0.65	-9.36	18.4229	0.90597	0.0:0.0:1.0:0.0	.	300;231;233;234	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	K	231;300;234;234;233	ENSP00000441604:E231K;ENSP00000440222:E300K;ENSP00000347005:E234K;ENSP00000263545:E233K	ENSP00000263545:E233K	E	+	1	0	LUC7L2	138744861	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.095000	0.76952	2.396000	0.81511	0.544000	0.68410	GAG	LUC7L2	-	pfam_LUC7-rel	ENSG00000146963		0.388	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LUC7L2	HGNC	protein_coding	OTTHUMT00000323618.2	53	0.00	0	G			139094321	139094321	+1	no_errors	ENST00000541515	ensembl	human	known	69_37n	missense	53	30.77	24	SNP	1.000	A
LYPD5	284348	genome.wustl.edu	37	19	44302730	44302730	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:44302730C>T	ENST00000377950.3	-	4	474	c.394G>A	c.(394-396)Ggc>Agc	p.G132S	AC115522.3_ENST00000595680.1_lincRNA|LYPD5_ENST00000594013.1_Missense_Mutation_p.G89S|LYPD5_ENST00000414615.2_Missense_Mutation_p.G89S	NM_001031749.2	NP_001026919.2	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5	132						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.G89S(1)|p.G132S(1)		breast(3)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	8		Prostate(69;0.0352)				CACTCGGCGCCGCTGAGCGTC	0.667																																						dbGAP											2	Substitution - Missense(2)	breast(2)											59.0	54.0	55.0					19																	44302730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055031	CCDS12631.1, CCDS46096.1	19q13.31	2008-02-05				ENSG00000159871			26397	protein-coding gene	gene with protein product						12477932	Standard	NM_182573		Approved	FLJ30469	uc002oxm.4	Q6UWN5		ENST00000377950.3:c.394G>A	19.37:g.44302730C>T	ENSP00000367185:p.Gly132Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PEX9|Q96DR2	Missense_Mutation	SNP	pfam_LY6_UPAR	p.G132S	ENST00000377950.3	37	c.394	CCDS46096.1	19	.	.	.	.	.	.	.	.	.	.	C	19.71	3.877958	0.72294	.	.	ENSG00000159871	ENST00000377950;ENST00000414615	T;T	0.70516	-0.49;-0.49	4.25	4.25	0.50352	.	0.323407	0.22442	N	0.060001	T	0.76471	0.3992	L	0.34521	1.04	0.35535	D	0.802609	D	0.89917	1.0	D	0.87578	0.998	T	0.83003	-0.0176	10	0.72032	D	0.01	-34.0209	14.1664	0.65480	0.0:1.0:0.0:0.0	.	132	Q6UWN5	LYPD5_HUMAN	S	132;89	ENSP00000367185:G132S;ENSP00000408433:G89S	ENSP00000367185:G132S	G	-	1	0	LYPD5	48994570	1.000000	0.71417	1.000000	0.80357	0.246000	0.25737	3.826000	0.55738	2.196000	0.70406	0.561000	0.74099	GGC	LYPD5	-	NULL	ENSG00000159871		0.667	LYPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD5	HGNC	protein_coding	OTTHUMT00000463611.1	158	0.00	0	C	NM_182573		44302730	44302730	-1	no_errors	ENST00000377950	ensembl	human	known	69_37n	missense	61	28.74	25	SNP	1.000	T
MAB21L2	10586	genome.wustl.edu	37	4	151504703	151504703	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:151504703C>G	ENST00000317605.4	+	1	1627	c.522C>G	c.(520-522)ttC>ttG	p.F174L	LRBA_ENST00000507224.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000510413.1_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	174					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.F174L(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		CTCCGGCGTTCAAGTGCACCG	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	66.0	66.0					4																	151504703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.522C>G	4.37:g.151504703C>G	ENSP00000324701:p.Phe174Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP37|Q9HBA7	Missense_Mutation	SNP	pfam_Mab-21_dom,pfscan_Ricin_B_lectin	p.F174L	ENST00000317605.4	37	c.522	CCDS3774.1	4	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637574	0.67130	.	.	ENSG00000181541	ENST00000317605	T	0.08008	3.14	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.25938	0.0632	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.03728	-1.1009	10	0.12103	T	0.63	-19.8956	19.4978	0.95081	0.0:1.0:0.0:0.0	.	174	Q9Y586	MB212_HUMAN	L	174	ENSP00000324701:F174L	ENSP00000324701:F174L	F	+	3	2	MAB21L2	151724153	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.960000	0.63673	2.608000	0.88229	0.462000	0.41574	TTC	MAB21L2	-	pfam_Mab-21_dom	ENSG00000181541		0.627	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L2	HGNC	protein_coding	OTTHUMT00000364937.1	91	0.00	0	C	NM_006439		151504703	151504703	+1	no_errors	ENST00000317605	ensembl	human	known	69_37n	missense	10	50.00	11	SNP	1.000	G
MAB21L2	10586	genome.wustl.edu	37	4	151504936	151504936	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:151504936C>T	ENST00000317605.4	+	1	1860	c.755C>T	c.(754-756)tCa>tTa	p.S252L	LRBA_ENST00000507224.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000510413.1_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	252					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.S252L(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		AAGTGCCTCTCAGTGCTGAAG	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											40.0	42.0	41.0					4																	151504936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.755C>T	4.37:g.151504936C>T	ENSP00000324701:p.Ser252Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP37|Q9HBA7	Missense_Mutation	SNP	pfam_Mab-21_dom,pfscan_Ricin_B_lectin	p.S252L	ENST00000317605.4	37	c.755	CCDS3774.1	4	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391933	0.83011	.	.	ENSG00000181541	ENST00000317605	T	0.08720	3.06	5.55	5.55	0.83447	Ricin B lectin (1);	0.146062	0.47455	D	0.000222	T	0.24736	0.0600	M	0.83312	2.635	0.80722	D	1	D	0.53745	0.962	P	0.54210	0.745	T	0.12708	-1.0537	10	0.12766	T	0.61	-8.4519	19.4978	0.95081	0.0:1.0:0.0:0.0	.	252	Q9Y586	MB212_HUMAN	L	252	ENSP00000324701:S252L	ENSP00000324701:S252L	S	+	2	0	MAB21L2	151724386	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.003000	0.70701	2.608000	0.88229	0.462000	0.41574	TCA	MAB21L2	-	pfam_Mab-21_dom,pfscan_Ricin_B_lectin	ENSG00000181541		0.632	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L2	HGNC	protein_coding	OTTHUMT00000364937.1	74	0.00	0	C	NM_006439		151504936	151504936	+1	no_errors	ENST00000317605	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	1.000	T
MAP2	4133	genome.wustl.edu	37	2	210559707	210559707	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:210559707A>G	ENST00000360351.4	+	7	3319	c.2813A>G	c.(2812-2814)cAt>cGt	p.H938R	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.H934R|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	938					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.H938R(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GCATCCGCGCATATCTCTGGT	0.438																																					Pancreas(27;423 979 28787 29963)	dbGAP											1	Substitution - Missense(1)	breast(1)											90.0	94.0	92.0					2																	210559707		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2813A>G	2.37:g.210559707A>G	ENSP00000353508:p.His938Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.H938R	ENST00000360351.4	37	c.2813	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	A	12.16	1.855112	0.32791	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.16897	2.31;2.31	5.76	-8.11	0.01082	MAP2/Tau projection (1);	1.114800	0.06757	N	0.781038	T	0.11965	0.0291	L	0.36672	1.1	0.09310	N	1	B;B	0.24317	0.082;0.101	B;B	0.22152	0.023;0.038	T	0.35226	-0.9797	10	0.41790	T	0.15	1.7018	11.0404	0.47827	0.2653:0.6014:0.0591:0.0742	.	934;938	P11137-3;P11137	.;MAP2_HUMAN	R	938;934	ENSP00000353508:H938R;ENSP00000392164:H934R	ENSP00000353508:H938R	H	+	2	0	MAP2	210267952	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.362000	0.07602	-1.173000	0.02758	-1.107000	0.02091	CAT	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.438	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	139	0.00	0	A	NM_001039538		210559707	210559707	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	63	33.68	32	SNP	0.000	G
MEI1	150365	genome.wustl.edu	37	22	42174744	42174744	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr22:42174744C>T	ENST00000401548.3	+	22	2783	c.2743C>T	c.(2743-2745)Ctc>Ttc	p.L915F	MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000540880.1_Missense_Mutation_p.P239L|MEI1_ENST00000400107.1_Intron	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GCTGAGCCTCCTCTCCCTGAT	0.577																																						dbGAP											0													62.0	64.0	64.0					22																	42174744		2121	4239	6360	-	-	-	SO:0001583	missense	0			AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.2743C>T	22.37:g.42174744C>T	ENSP00000384115:p.Leu915Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L915F	ENST00000401548.3	37	c.2743	CCDS46718.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.07|14.07	2.425558|2.425558	0.43020|0.43020	.|.	.|.	ENSG00000167077|ENSG00000167077	ENST00000401548;ENST00000419798|ENST00000540880	T|T	0.74106|0.55760	-0.81|0.5	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.127670|.	0.53938|.	D|.	0.000052|.	T|T	0.65913|0.65913	0.2737|0.2737	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.999|.	D;D;D|.	0.87578|.	0.998;0.998;0.998|.	T|T	0.68985|0.68985	-0.5265|-0.5265	10|7	0.66056|0.87932	D|D	0.02|0	-12.372|-12.372	15.8048|15.8048	0.78491|0.78491	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	158;283;915|.	Q5TIA1-5;Q5TIA1-2;Q5TIA1|.	.;.;MEI1_HUMAN|.	F|L	915;25|239	ENSP00000384115:L915F|ENSP00000437436:P239L	ENSP00000384115:L915F|ENSP00000437436:P239L	L|P	+|+	1|2	0|0	MEI1|MEI1	40504690|40504690	0.964000|0.964000	0.33143|0.33143	0.995000|0.995000	0.50966|0.50966	0.983000|0.983000	0.72400|0.72400	2.215000|2.215000	0.42862|0.42862	2.546000|2.546000	0.85860|0.85860	0.561000|0.561000	0.74099|0.74099	CTC|CCT	MEI1	-	NULL	ENSG00000167077		0.577	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	HGNC	protein_coding	OTTHUMT00000074937.3	108	0.00	0	C	NM_152513		42174744	42174744	+1	no_errors	ENST00000401548	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	T
METTL21C	196541	genome.wustl.edu	37	13	103343293	103343293	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr13:103343293G>C	ENST00000267273.6	-	2	157	c.152C>G	c.(151-153)tCt>tGt	p.S51C		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	51					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)	p.S51C(1)		breast(1)|large_intestine(3)|lung(2)|skin(1)	7						GCTATGAAGAGATGGTTCTAT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	132.0	135.0					13																	103343293		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.152C>G	13.37:g.103343293G>C	ENSP00000267273:p.Ser51Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.S51C	ENST00000267273.6	37	c.152	CCDS32003.1	13	.	.	.	.	.	.	.	.	.	.	G	8.403	0.842336	0.16963	.	.	ENSG00000139780	ENST00000267273	T	0.15487	2.42	6.16	5.31	0.75309	.	0.508636	0.23093	N	0.052003	T	0.13114	0.0318	L	0.27053	0.805	0.24920	N	0.991985	B	0.11235	0.004	B	0.08055	0.003	T	0.15122	-1.0448	10	0.37606	T	0.19	-0.4932	11.9848	0.53140	0.0671:0.1231:0.8098:0.0	.	51	Q5VZV1	MT21C_HUMAN	C	51	ENSP00000267273:S51C	ENSP00000267273:S51C	S	-	2	0	METTL21C	102141294	0.676000	0.27567	0.234000	0.24042	0.248000	0.25809	2.470000	0.45119	1.592000	0.50018	0.650000	0.86243	TCT	METTL21C	-	NULL	ENSG00000139780		0.393	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21C	HGNC	protein_coding	OTTHUMT00000045682.2	137	0.00	0	G	NM_001010977		103343293	103343293	-1	no_errors	ENST00000267273	ensembl	human	known	69_37n	missense	50	50.00	51	SNP	0.571	C
MIER1	57708	genome.wustl.edu	37	1	67450308	67450308	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:67450308G>C	ENST00000355356.3	+	13	1413	c.1264G>C	c.(1264-1266)Gaa>Caa	p.E422Q	MIER1_ENST00000355977.6_Intron|MIER1_ENST00000371014.1_Intron|MIER1_ENST00000371018.3_Missense_Mutation_p.E439Q|MIER1_ENST00000357692.2_Missense_Mutation_p.E439Q|MIER1_ENST00000371016.1_Intron|MIER1_ENST00000401042.3_Intron|MIER1_ENST00000401041.1_Missense_Mutation_p.E475Q	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator	422					positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.E422Q(1)|p.E475Q(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						AGTAAAAGTTGAAGGGTTACA	0.338																																						dbGAP											2	Substitution - Missense(2)	breast(2)											111.0	106.0	107.0					1																	67450308		1826	4083	5909	-	-	-	SO:0001583	missense	0				CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194	ENST00000355356.3:c.1264G>C	1.37:g.67450308G>C	ENSP00000347514:p.Glu422Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.E475Q	ENST00000355356.3	37	c.1423	CCDS41348.1	1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776335	0.49786	.	.	ENSG00000198160	ENST00000371017;ENST00000371018;ENST00000357692;ENST00000401041;ENST00000355356	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	5.69	5.69	0.88448	.	0.273316	0.41194	D	0.000934	T	0.29223	0.0727	N	0.19112	0.55	0.80722	D	1	B;B;B;B;B	0.23377	0.001;0.035;0.051;0.084;0.051	B;B;B;B;B	0.21917	0.002;0.025;0.016;0.037;0.03	T	0.11131	-1.0600	10	0.17369	T	0.5	-18.9867	18.3852	0.90464	0.0:0.0:1.0:0.0	.	439;422;446;439;475	Q32NC4;Q8N108-3;Q8N108;Q8N108-10;Q5TAD5	.;.;MIER1_HUMAN;.;.	Q	443;439;439;475;422	ENSP00000360057:E439Q;ENSP00000350321:E439Q;ENSP00000383820:E475Q;ENSP00000347514:E422Q	ENSP00000347514:E422Q	E	+	1	0	MIER1	67222896	1.000000	0.71417	0.880000	0.34516	0.958000	0.62258	6.780000	0.75063	2.857000	0.98124	0.650000	0.86243	GAA	MIER1	-	NULL	ENSG00000198160		0.338	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MIER1	HGNC	protein_coding	OTTHUMT00000025491.2	47	0.00	0	G	NM_020948		67450308	67450308	+1	no_errors	ENST00000401041	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	0.995	C
MLLT10	8028	genome.wustl.edu	37	10	21962492	21962492	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr10:21962492C>T	ENST00000307729.7	+	11	1443	c.1265C>T	c.(1264-1266)tCa>tTa	p.S422L	MLLT10_ENST00000377059.3_Missense_Mutation_p.S422L|MLLT10_ENST00000446906.2_Missense_Mutation_p.S422L|MLLT10_ENST00000377072.3_Missense_Mutation_p.S422L			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	422	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S422L(2)		NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GGCCTCCCTTCAACCTCAGCT	0.453			T	"""MLL, PICALM, CDK6"""	AL																																	dbGAP		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	2	Substitution - Missense(2)	breast(2)											166.0	184.0	178.0					10																	21962492		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1265C>T	10.37:g.21962492C>T	ENSP00000307411:p.Ser422Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S422L	ENST00000307729.7	37	c.1265	CCDS55708.1	10	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133098	0.37630	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059	T;T;T;T	0.15603	2.41;2.41;2.44;2.41	5.65	3.28	0.37604	.	0.429812	0.25759	N	0.028499	T	0.15522	0.0374	L	0.47716	1.5	0.37989	D	0.933863	B;B;B;B	0.21905	0.034;0.02;0.002;0.062	B;B;B;B	0.18561	0.022;0.01;0.004;0.013	T	0.05419	-1.0886	10	0.72032	D	0.01	.	9.1527	0.36973	0.0:0.7603:0.1309:0.1088	.	268;422;422;422	F5H541;E9PBP4;Q5VX90;P55197	.;.;.;AF10_HUMAN	L	422;422;422;268;422	ENSP00000366272:S422L;ENSP00000401406:S422L;ENSP00000307411:S422L;ENSP00000366258:S422L	ENSP00000307411:S422L	S	+	2	0	MLLT10	22002498	0.998000	0.40836	0.983000	0.44433	0.988000	0.76386	3.337000	0.52120	0.454000	0.26884	0.585000	0.79938	TCA	MLLT10	-	NULL	ENSG00000078403		0.453	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	HGNC	protein_coding	OTTHUMT00000047136.1	171	0.00	0	C			21962492	21962492	+1	no_errors	ENST00000307729	ensembl	human	known	69_37n	missense	149	41.80	107	SNP	0.997	T
MUC12	10071	genome.wustl.edu	37	7	100645498	100645499	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:100645498_100645499insCA	ENST00000379442.3	+	5	12083_12084	c.12083_12084insCA	c.(12082-12087)cccagcfs	p.S4029fs	MUC12_ENST00000536621.1_Frame_Shift_Ins_p.S3886fs			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4029	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACTACCTTTCCCAGCAGCTCAG	0.579																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12084_12085dupCA	7.37:g.100645499_100645500dupCA	ENSP00000368755:p.Ser4029fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Frame_Shift_Ins	INS	pfam_SEA	p.S4029fs	ENST00000379442.3	37	c.12083_12084		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.579	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	57	0.00	0	-	XM_379904		100645498	100645499	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	frame_shift_ins	16	11.11	2	INS	0.020:0.029	CA
MYCBP2	23077	genome.wustl.edu	37	13	77651360	77651360	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr13:77651360G>A	ENST00000544440.2	-	67	11550	c.11533C>T	c.(11533-11535)Cag>Tag	p.Q3845*	MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2_ENST00000407578.2_Nonsense_Mutation_p.Q3883*|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2-AS1_ENST00000596342.1_RNA|MYCBP2_ENST00000357337.6_Nonsense_Mutation_p.Q3845*					MYC binding protein 2, E3 ubiquitin protein ligase									p.Q3883*(1)|p.Q3845*(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GCTGAAATCTGGCCAGCTATT	0.438																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											112.0	98.0	103.0					13																	77651360		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.11533C>T	13.37:g.77651360G>A	ENSP00000444596:p.Gln3845*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,prints_Reg_chr_condens,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens	p.Q3883*	ENST00000544440.2	37	c.11647		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.951311|5.951311	0.97139|0.97139	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000429715|ENST00000357337;ENST00000407578;ENST00000544440	.|.	.|.	.|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.73369|.	0.3578|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.69899|.	-0.5020|.	3|.	.|0.33141	.|T	.|0.24	.|.	19.2343|19.2343	0.93851|0.93851	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	268|3845;3883;3845	.|.	.|ENSP00000349892:Q3845X	P|Q	-|-	2|1	0|0	MYCBP2|MYCBP2	76549361|76549361	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	9.420000|9.420000	0.97426|0.97426	2.605000|2.605000	0.88082|0.88082	0.585000|0.585000	0.79938|0.79938	CCA|CAG	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.438	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	186	0.00	0	G	NM_015057		77651360	77651360	-1	no_errors	ENST00000407578	ensembl	human	known	69_37n	nonsense	97	27.07	36	SNP	1.000	A
MYO5A	4644	genome.wustl.edu	37	15	52662392	52662392	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr15:52662392C>G	ENST00000399231.3	-	22	3283	c.3040G>C	c.(3040-3042)Gat>Cat	p.D1014H	MYO5A_ENST00000553916.1_Missense_Mutation_p.D1014H|MYO5A_ENST00000399233.2_Missense_Mutation_p.D1014H|MYO5A_ENST00000356338.6_Missense_Mutation_p.D1014H|MYO5A_ENST00000358212.6_Missense_Mutation_p.D1014H	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1014					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.D1014H(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TTGTATCGATCTGCATGTTCC	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											221.0	205.0	210.0					15																	52662392		1961	4136	6097	-	-	-	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3040G>C	15.37:g.52662392C>G	ENSP00000382177:p.Asp1014His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1014H	ENST00000399231.3	37	c.3040	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283116	0.40394	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22	5.49	3.6	0.41247	.	0.285739	0.39909	N	0.001227	T	0.09992	0.0245	N	0.08118	0	0.37240	D	0.906071	B;P	0.36315	0.002;0.547	B;B	0.38616	0.01;0.277	T	0.27839	-1.0062	10	0.49607	T	0.09	.	10.7996	0.46480	0.0:0.7968:0.1324:0.0708	.	1014;1014	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	H	1014;548;1014;1014;1014;644;1014	ENSP00000382177:D1014H;ENSP00000382179:D1014H;ENSP00000348693:D1014H;ENSP00000350945:D1014H;ENSP00000451109:D1014H	ENSP00000348693:D1014H	D	-	1	0	MYO5A	50449684	0.995000	0.38212	0.997000	0.53966	0.749000	0.42624	0.629000	0.24538	1.314000	0.45095	-0.150000	0.13652	GAT	MYO5A	-	NULL	ENSG00000197535		0.473	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	244	0.00	0	C	NM_000259		52662392	52662392	-1	no_errors	ENST00000358212	ensembl	human	known	69_37n	missense	91	51.60	97	SNP	0.985	G
ICE2	79664	genome.wustl.edu	37	15	60741569	60741569	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr15:60741569C>G	ENST00000261520.4	-	10	1831	c.1597G>C	c.(1597-1599)Gat>Cat	p.D533H	NARG2_ENST00000439632.1_Missense_Mutation_p.D396H	NM_024611.4	NP_078887.2												p.D533H(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						TGTAATATATCTATAGTCATA	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	55.0	54.0					15																	60741569		2203	4297	6500	-	-	-	SO:0001583	missense	0																														ENST00000261520.4:c.1597G>C	15.37:g.60741569C>G	ENSP00000261520:p.Asp533His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NARG2_C	p.D533H	ENST00000261520.4	37	c.1597	CCDS10176.1	15	.	.	.	.	.	.	.	.	.	.	C	1.498	-0.552788	0.03996	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.43	3.44	0.39384	.	0.653792	0.14959	N	0.288443	T	0.22704	0.0548	N	0.19112	0.55	0.09310	N	1	D;B	0.52996	0.957;0.001	P;B	0.46718	0.525;0.003	T	0.04855	-1.0922	9	0.44086	T	0.13	-6.9562	7.1601	0.25659	0.1296:0.6646:0.1279:0.0779	.	201;533	B3KXT2;Q659A1	.;NARG2_HUMAN	H	533;396	.	ENSP00000261520:D533H	D	-	1	0	NARG2	58528861	0.003000	0.15002	0.002000	0.10522	0.000000	0.00434	0.858000	0.27845	0.675000	0.31264	-0.810000	0.03169	GAT	NARG2	-	NULL	ENSG00000128915		0.333	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARG2	HGNC	protein_coding	OTTHUMT00000256136.1	70	0.00	0	C			60741569	60741569	-1	no_errors	ENST00000261520	ensembl	human	known	69_37n	missense	66	19.51	16	SNP	0.000	G
NAV1	89796	genome.wustl.edu	37	1	201751421	201751421	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:201751421C>T	ENST00000367296.4	+	6	2201	c.1781C>T	c.(1780-1782)tCg>tTg	p.S594L	NAV1_ENST00000295624.6_Missense_Mutation_p.S594L|NAV1_ENST00000367302.1_Missense_Mutation_p.S607L|NAV1_ENST00000367295.1_Missense_Mutation_p.S203L|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367297.4_Missense_Mutation_p.S594L|NAV1_ENST00000367300.3_Missense_Mutation_p.S594L	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	594					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.S594L(1)		breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						AAGCCCCCCTCGGGCATTGCT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											62.0	66.0	65.0					1																	201751421		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.1781C>T	1.37:g.201751421C>T	ENSP00000356265:p.Ser594Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	smart_AAA+_ATPase	p.S594L	ENST00000367296.4	37	c.1781	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	C	34	5.355747	0.95854	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000391966;ENST00000367295	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	L	0.60845	1.875	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	0.997;1.0;0.975;0.996	T	0.63892	-0.6534	10	0.72032	D	0.01	-12.5534	19.6713	0.95912	0.0:1.0:0.0:0.0	.	203;594;102;594	Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.;NAV1_HUMAN;.;.	L	607;594;594;594;594;102;203	ENSP00000356271:S607L;ENSP00000356265:S594L;ENSP00000295624:S594L;ENSP00000356266:S594L;ENSP00000356269:S594L;ENSP00000356264:S203L	ENSP00000295624:S594L	S	+	2	0	NAV1	200018044	1.000000	0.71417	0.983000	0.44433	0.932000	0.56968	7.745000	0.85046	2.755000	0.94549	0.655000	0.94253	TCG	NAV1	-	NULL	ENSG00000134369		0.582	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	207	0.00	0	C	NM_020443		201751421	201751421	+1	no_errors	ENST00000367296	ensembl	human	known	69_37n	missense	147	16.85	30	SNP	1.000	T
NDUFV2	4729	genome.wustl.edu	37	18	9122601	9122601	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr18:9122601C>G	ENST00000318388.6	+	5	505	c.391C>G	c.(391-393)Cac>Gac	p.H131D	NDUFV2_ENST00000400033.1_Missense_Mutation_p.H134D|RP11-143J12.2_ENST00000582375.1_RNA|RP11-21J18.1_ENST00000579126.1_RNA|NDUFV2_ENST00000465096.1_3'UTR|RP11-143J12.2_ENST00000583081.1_RNA	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	131					cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.H131D(1)		breast(1)|lung(4)|ovary(1)|stomach(1)	7						TGGAAAGTATCACATTCAGGT	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											121.0	109.0	113.0					18																	9122601		2203	4300	6503	-	-	-	SO:0001583	missense	0			X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.391C>G	18.37:g.9122601C>G	ENSP00000327268:p.His131Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BV41	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_24kDa_su,superfamily_Thioredoxin-like_fold,tigrfam_NADH_UbQ_OxRdtase_24kDa_su	p.H131D	ENST00000318388.6	37	c.391	CCDS11842.1	18	.	.	.	.	.	.	.	.	.	.	C	26.4	4.729727	0.89390	.	.	ENSG00000178127	ENST00000318388;ENST00000400033	T;T	0.46819	0.86;0.86	5.93	5.93	0.95920	Thioredoxin-like fold (2);	0.087715	0.85682	D	0.000000	T	0.74366	0.3707	M	0.90145	3.09	0.80722	D	1	D	0.53151	0.958	P	0.61070	0.883	T	0.78165	-0.2310	10	0.66056	D	0.02	-13.8045	20.3397	0.98756	0.0:1.0:0.0:0.0	.	131	P19404	NDUV2_HUMAN	D	131;134	ENSP00000327268:H131D;ENSP00000382908:H134D	ENSP00000327268:H131D	H	+	1	0	NDUFV2	9112601	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.681000	0.68175	2.803000	0.96430	0.585000	0.79938	CAC	NDUFV2	-	pfam_NADH_UbQ_OxRdtase_24kDa_su,superfamily_Thioredoxin-like_fold,tigrfam_NADH_UbQ_OxRdtase_24kDa_su	ENSG00000178127		0.378	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFV2	HGNC	protein_coding	OTTHUMT00000254475.2	134	0.74	1	C	NM_021074		9122601	9122601	+1	no_errors	ENST00000318388	ensembl	human	known	69_37n	missense	65	29.35	27	SNP	1.000	G
NHSL2	340527	genome.wustl.edu	37	X	71358848	71358848	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:71358848C>A	ENST00000373677.1	+	2	1614	c.352C>A	c.(352-354)Ctg>Atg	p.L118M	NHSL2_ENST00000540800.1_Missense_Mutation_p.L484M|NHSL2_ENST00000535692.1_Missense_Mutation_p.L118M|NHSL2_ENST00000510661.1_Missense_Mutation_p.L253M			Q5HYW2	NHSL2_HUMAN	NHS-like 2	118								p.L484M(1)|p.L115M(1)		NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					GACCTCGAGGCTGGAGACAGG	0.597																																						dbGAP											2	Substitution - Missense(2)	breast(2)											13.0	11.0	12.0					X																	71358848		2197	4286	6483	-	-	-	SO:0001583	missense	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.352C>A	X.37:g.71358848C>A	ENSP00000362781:p.Leu118Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN94	Missense_Mutation	SNP	NULL	p.L484M	ENST00000373677.1	37	c.1450		X	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410718	0.25465	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.52983	1.27;0.69;0.64;0.69	5.82	4.04	0.47022	.	0.300277	0.27595	N	0.018672	T	0.37019	0.0988	L	0.51422	1.61	0.23524	N	0.997499	P;B;B	0.40431	0.717;0.208;0.208	B;B;B	0.37198	0.243;0.117;0.117	T	0.39251	-0.9623	10	0.66056	D	0.02	-1.6392	4.8843	0.13696	0.1721:0.6499:0.0:0.1781	.	484;253;118	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	M	484;118;253;118	ENSP00000444617:L484M;ENSP00000362781:L118M;ENSP00000424079:L253M;ENSP00000444914:L118M	ENSP00000362781:L118M	L	+	1	2	NHSL2	71275573	0.001000	0.12720	0.883000	0.34634	0.430000	0.31655	0.299000	0.19138	0.588000	0.29660	0.600000	0.82982	CTG	NHSL2	-	NULL	ENSG00000204131		0.597	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	79	0.00	0	C	NM_001013627		71358848	71358848	+1	no_errors	ENST00000540800	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.990	A
NIN	51199	genome.wustl.edu	37	14	51223742	51223742	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr14:51223742G>A	ENST00000382041.3	-	18	4196	c.4006C>T	c.(4006-4008)Cag>Tag	p.Q1336*	NIN_ENST00000389868.3_Intron|NIN_ENST00000324330.9_Nonsense_Mutation_p.Q1336*|NIN_ENST00000245441.5_Nonsense_Mutation_p.Q1336*|NIN_ENST00000530997.2_Nonsense_Mutation_p.Q1336*|NIN_ENST00000382043.4_Intron|NIN_ENST00000453196.1_Nonsense_Mutation_p.Q1336*	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1336					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.Q1336*(2)|p.Q1342*(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					ACGCTTTCCTGAAGCTTCTCA	0.453			T	PDGFRB	MPD																																	dbGAP		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	3	Substitution - Nonsense(3)	breast(3)											72.0	71.0	71.0					14																	51223742		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4006C>T	14.37:g.51223742G>A	ENSP00000371472:p.Gln1336*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Nonsense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_HAND_2	p.Q1336*	ENST00000382041.3	37	c.4006	CCDS32079.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.753770|8.753770	0.98941|0.98941	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196|ENST00000530997;ENST00000389869;ENST00000530853	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.337403|.	0.31554|.	N|.	0.007443|.	.|T	.|0.67776	.|0.2929	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68622	.|-0.5360	.|3	0.19147|.	T|.	0.46|.	-2.4249|-2.4249	15.1959|15.1959	0.73088|0.73088	0.0:0.2487:0.7513:0.0|0.0:0.2487:0.7513:0.0	.|.	.|.	.|.	.|.	X|L	1336;1319;1342;1336;1336;1336|826	.|.	ENSP00000245441:Q1336X|.	Q|S	-|-	1|2	0|0	NIN|NIN	50293492|50293492	0.862000|0.862000	0.29867|0.29867	0.050000|0.050000	0.19076|0.19076	0.222000|0.222000	0.24845|0.24845	2.671000|2.671000	0.46842|0.46842	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CAG|TCA	NIN	-	NULL	ENSG00000100503		0.453	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	199	0.50	1	G	NM_182946		51223742	51223742	-1	no_errors	ENST00000245441	ensembl	human	known	69_37n	nonsense	119	16.20	23	SNP	0.607	A
NLRC3	197358	genome.wustl.edu	37	16	3592723	3592723	+	RNA	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr16:3592723G>C	ENST00000301749.7	-	0	3397				LA16c-390H2.4_ENST00000573820.1_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.L1044V(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTTACCTTCAGAGCATTTGCC	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	58.0	58.0					16																	3592723		1920	4139	6059	-	-	-			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3592723G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.L1044V	ENST00000301749.7	37	c.3130		16	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895194	0.52121	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.61859	0.07;0.07;0.07	6.03	2.96	0.34315	.	0.000000	0.64402	D	0.000013	T	0.71160	0.3307	M	0.85542	2.76	0.21256	N	0.999746	P	0.41710	0.76	P	0.54401	0.751	T	0.64219	-0.6459	10	0.87932	D	0	.	8.9108	0.35552	0.2363:0.0:0.7637:0.0	.	1044	C9JLH9	.	V	998;969;1044	ENSP00000301749:L998V;ENSP00000352039:L969V;ENSP00000414415:L1044V	ENSP00000301749:L998V	L	-	1	2	NLRC3	3532724	0.928000	0.31464	0.855000	0.33649	0.530000	0.34684	1.209000	0.32357	0.415000	0.25817	-0.136000	0.14681	CTG	NLRC3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000167984		0.547	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		105	0.00	0	G	NM_178844		3592723	3592723	-1	no_errors	ENST00000448023	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	0.984	C
NR2C2	7182	genome.wustl.edu	37	3	15055260	15055260	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:15055260C>T	ENST00000425241.1	+	3	599	c.237C>T	c.(235-237)ttC>ttT	p.F79F	NR2C2_ENST00000323373.6_Silent_p.F98F|NR2C2_ENST00000393102.3_Silent_p.F79F|NR2C2_ENST00000406272.2_Silent_p.F79F			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	79					cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.F98F(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AACTCATATTCACCACCTCAG	0.527																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	80.0	85.0					3																	15055260		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.237C>T	3.37:g.15055260C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3H5|B6ZGT8|P55092	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.F98	ENST00000425241.1	37	c.294		3																																																																																			NR2C2	-	NULL	ENSG00000177463		0.527	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	NR2C2	HGNC	protein_coding	OTTHUMT00000340729.1	177	0.00	0	C	NM_003298		15055260	15055260	+1	no_errors	ENST00000323373	ensembl	human	known	69_37n	silent	234	43.65	182	SNP	1.000	T
OFD1	8481	genome.wustl.edu	37	X	13785326	13785326	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:13785326G>C	ENST00000340096.6	+	20	3007	c.2680G>C	c.(2680-2682)Gaa>Caa	p.E894Q	OFD1_ENST00000380567.1_Missense_Mutation_p.E754Q|OFD1_ENST00000380550.3_Missense_Mutation_p.E854Q|OFD1_ENST00000490265.1_3'UTR	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	894	Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)	p.E894Q(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						AAGGCAGAGAGAAGAAAGAAG	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											135.0	137.0	136.0					X																	13785326		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.2680G>C	X.37:g.13785326G>C	ENSP00000344314:p.Glu894Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	superfamily_Lipoprotein_6,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.E894Q	ENST00000340096.6	37	c.2680	CCDS14157.1	X	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308186	0.60305	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.98178	-2.23;-4.77;-2.56	5.56	4.69	0.59074	.	0.254372	0.38663	N	0.001605	D	0.96750	0.8939	M	0.64997	1.995	0.80722	D	1	P;P;P;P;P	0.46912	0.732;0.732;0.886;0.732;0.732	B;B;B;B;B	0.42245	0.26;0.26;0.381;0.26;0.26	D	0.94965	0.8112	10	0.33940	T	0.23	-5.6064	12.7363	0.57225	0.0:0.1612:0.8388:0.0	.	894;854;562;754;894	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	Q	854;894;754	ENSP00000369923:E854Q;ENSP00000344314:E894Q;ENSP00000369941:E754Q	ENSP00000344314:E894Q	E	+	1	0	OFD1	13695247	1.000000	0.71417	0.249000	0.24280	0.909000	0.53808	3.384000	0.52478	1.094000	0.41399	0.494000	0.49563	GAA	OFD1	-	NULL	ENSG00000046651		0.358	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	HGNC	protein_coding	OTTHUMT00000055808.1	577	0.00	0	G	NM_003611		13785326	13785326	+1	no_errors	ENST00000340096	ensembl	human	known	69_37n	missense	906	12.75	133	SNP	0.914	C
OR2J2	26707	genome.wustl.edu	37	6	29141422	29141422	+	Frame_Shift_Del	DEL	A	A	-	rs556940268|rs201438710	byFrequency	TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:29141422delA	ENST00000377167.2	+	1	112	c.10delA	c.(10-12)aaafs	p.K5fs		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						AATGATGATTAAAAAAAATGC	0.358													AAAAAAAA|AAAAAAAA|AAAAAAA|deletion	21	0.00419329	0.0144	0.0014	5008	,	,		19015	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													105.0	102.0	103.0					6																	29141422		1836	4079	5915	-	-	-	SO:0001589	frameshift_variant	0				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.10delA	6.37:g.29141422delA	ENSP00000366372:p.Lys5fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N6fs	ENST00000377167.2	37	c.10	CCDS43434.1	6																																																																																			OR2J2	-	NULL	ENSG00000204700		0.358	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J2	HGNC	protein_coding	OTTHUMT00000076131.2	110	0.00	0	A			29141422	29141422	+1	no_errors	ENST00000377167	ensembl	human	known	69_37n	frame_shift_del	100	20.16	26	DEL	0.000	-
OR4K14	122740	genome.wustl.edu	37	14	20483041	20483041	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr14:20483041G>T	ENST00000305045.2	-	1	311	c.312C>A	c.(310-312)ttC>ttA	p.F104L		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F104L(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TAAAGTGCAAGAAGAAGATTT	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	100.0	101.0					14																	20483041		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.312C>A	14.37:g.20483041G>T	ENSP00000305011:p.Phe104Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEU1|Q96R71	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F104L	ENST00000305045.2	37	c.312	CCDS32027.1	14	.	.	.	.	.	.	.	.	.	.	.	11.25	1.583219	0.28268	.	.	ENSG00000169484	ENST00000305045	T	0.00495	6.99	4.04	0.795	0.18643	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000282	T	0.00384	0.0012	L	0.39898	1.24	0.23421	N	0.997719	B	0.11235	0.004	B	0.17979	0.02	T	0.47535	-0.9110	10	0.48119	T	0.1	.	3.8886	0.09110	0.305:0.0:0.5164:0.1786	.	104	Q8NGD5	OR4KE_HUMAN	L	104	ENSP00000305011:F104L	ENSP00000305011:F104L	F	-	3	2	OR4K14	19552881	0.000000	0.05858	0.998000	0.56505	0.990000	0.78478	-0.880000	0.04183	0.337000	0.23665	0.505000	0.49811	TTC	OR4K14	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000169484		0.458	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K14	HGNC	protein_coding	OTTHUMT00000410343.1	94	0.00	0	G			20483041	20483041	-1	no_errors	ENST00000305045	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	0.846	T
OSBP2	23762	genome.wustl.edu	37	22	31289974	31289974	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr22:31289974G>A	ENST00000332585.6	+	12	2465	c.2361G>A	c.(2359-2361)aaG>aaA	p.K787K	OSBP2_ENST00000446658.2_Silent_p.K786K|OSBP2_ENST00000437268.2_Silent_p.K529K|OSBP2_ENST00000535268.1_Silent_p.K331K|OSBP2_ENST00000403222.3_Silent_p.K621K|OSBP2_ENST00000496575.1_3'UTR|OSBP2_ENST00000401475.1_Silent_p.K420K|OSBP2_ENST00000382310.3_Silent_p.K738K|OSBP2_ENST00000407373.1_Silent_p.K614K	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	787					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)	p.K787K(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						TGCTGTGGAAGAAGTACCCGC	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											20.0	23.0	22.0					22																	31289974		2028	4180	6208	-	-	-	SO:0001819	synonymous_variant	0				CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.2361G>A	22.37:g.31289974G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	pfam_Oxysterol-bd	p.R459K	ENST00000332585.6	37	c.1376	CCDS43002.1	22	.	.	.	.	.	.	.	.	.	.	G	7.935	0.741491	0.15642	.	.	ENSG00000184792	ENST00000431368	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	T	0.74596	0.3737	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73630	-0.3922	4	.	.	.	-0.8167	18.4769	0.90797	0.0:0.0:1.0:0.0	.	.	.	.	K	459	.	.	R	+	2	0	OSBP2	29619974	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.787000	0.62432	2.458000	0.83093	0.561000	0.74099	AGA	OSBP2	-	pfam_Oxysterol-bd	ENSG00000184792		0.607	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBP2	HGNC	protein_coding	OTTHUMT00000321547.2	59	0.00	0	G	NM_030758		31289974	31289974	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000431368	ensembl	human	novel	69_37n	missense	14	64.10	25	SNP	1.000	A
P2RX2	22953	genome.wustl.edu	37	12	133198305	133198305	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:133198305C>T	ENST00000389110.3	+	11	1200	c.1163C>T	c.(1162-1164)tCa>tTa	p.S388L	P2RX2_ENST00000350048.5_Missense_Mutation_p.S364L|P2RX2_ENST00000343948.4_Missense_Mutation_p.S414L|P2RX2_ENST00000351222.4_Missense_Mutation_p.S296L|P2RX2_ENST00000449132.2_Intron|P2RX2_ENST00000348800.5_Intron|P2RX2_ENST00000352418.4_Missense_Mutation_p.S316L	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	388					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)	p.S414L(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		AGCCACCCCTCAGGTAGCTGG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											67.0	65.0	66.0					12																	133198305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.1163C>T	12.37:g.133198305C>T	ENSP00000373762:p.Ser388Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.S414L	ENST00000389110.3	37	c.1241	CCDS31931.1	12	.	.	.	.	.	.	.	.	.	.	C	9.633	1.137045	0.21123	.	.	ENSG00000187848	ENST00000389110;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222	T;T;T;T;T	0.06371	3.61;3.31;3.31;3.46;3.33	4.4	3.49	0.39957	.	2.094200	0.02546	N	0.095158	T	0.08088	0.0202	L	0.51422	1.61	0.09310	N	0.999999	P;B;B;B;P	0.37276	0.589;0.372;0.241;0.372;0.491	B;B;B;B;B	0.31946	0.121;0.114;0.037;0.083;0.138	T	0.35919	-0.9769	10	0.30854	T	0.27	2.8215	7.0791	0.25221	0.2124:0.6076:0.1801:0.0	.	296;316;364;414;388	Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9	.;.;.;.;P2RX2_HUMAN	L	388;414;316;364;296	ENSP00000373762:S388L;ENSP00000343339:S414L;ENSP00000341419:S316L;ENSP00000343904:S364L;ENSP00000344502:S296L	ENSP00000343339:S414L	S	+	2	0	P2RX2	131708378	0.001000	0.12720	0.061000	0.19648	0.311000	0.27955	0.915000	0.28638	1.029000	0.39812	0.462000	0.41574	TCA	P2RX2	-	NULL	ENSG00000187848		0.592	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	HGNC	protein_coding	OTTHUMT00000397542.1	53	0.00	0	C			133198305	133198305	+1	no_errors	ENST00000343948	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.003	T
PAAF1	80227	genome.wustl.edu	37	11	73611344	73611344	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:73611344G>A	ENST00000310571.3	+	6	464	c.411G>A	c.(409-411)gtG>gtA	p.V137V	PAAF1_ENST00000544552.1_Silent_p.V120V|PAAF1_ENST00000536003.1_Silent_p.V120V|PAAF1_ENST00000543079.1_Intron|PAAF1_ENST00000376384.5_Silent_p.V120V|PAAF1_ENST00000535604.1_Silent_p.V22V|PAAF1_ENST00000541951.1_Silent_p.V22V|PAAF1_ENST00000544909.1_Silent_p.V138V	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	137					viral process (GO:0016032)	proteasome complex (GO:0000502)		p.V137V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					TGTTTGATGTGAATTGTTGCA	0.458																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											239.0	219.0	226.0					11																	73611344		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.411G>A	11.37:g.73611344G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V137	ENST00000310571.3	37	c.411	CCDS8226.1	11																																																																																			PAAF1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000175575		0.458	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAAF1	HGNC	protein_coding	OTTHUMT00000397885.1	239	0.00	0	G	NM_025155		73611344	73611344	+1	no_errors	ENST00000310571	ensembl	human	known	69_37n	silent	162	18.59	37	SNP	1.000	A
PABPC3	5042	genome.wustl.edu	37	13	25671591	25671591	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr13:25671591C>G	ENST00000281589.3	+	1	1292	c.1255C>G	c.(1255-1257)Cct>Gct	p.P419A		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	419					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.P419A(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		ATACTATCCTCCTAGCCAAAT	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											166.0	161.0	162.0					13																	25671591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1255C>G	13.37:g.25671591C>G	ENSP00000281589:p.Pro419Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHV0|Q9H086	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.P419A	ENST00000281589.3	37	c.1255	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	C	5.590	0.293596	0.10567	.	.	ENSG00000151846	ENST00000281589	T	0.32515	1.45	0.875	-0.112	0.13572	.	0.503507	0.15951	U	0.236719	T	0.17238	0.0414	N	0.21097	0.63	0.25161	N	0.990352	B	0.02656	0.0	B	0.06405	0.002	T	0.15263	-1.0443	10	0.44086	T	0.13	.	6.5594	0.22478	0.0:0.697:0.303:0.0	.	419	Q9H361	PABP3_HUMAN	A	419	ENSP00000281589:P419A	ENSP00000281589:P419A	P	+	1	0	PABPC3	24569591	0.999000	0.42202	0.741000	0.31004	0.066000	0.16364	0.803000	0.27083	-0.082000	0.12640	-0.802000	0.03209	CCT	PABPC3	-	tigrfam_PABP_1234	ENSG00000151846		0.537	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	262	0.00	0	C	NM_030979		25671591	25671591	+1	no_errors	ENST00000281589	ensembl	human	known	69_37n	missense	146	14.62	25	SNP	0.982	G
PACS1	55690	genome.wustl.edu	37	11	66006688	66006688	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:66006688G>A	ENST00000320580.4	+	21	2402	c.2369G>A	c.(2368-2370)cGa>cAa	p.R790Q	PACS1_ENST00000529757.1_Missense_Mutation_p.R326Q|PACS1_ENST00000524815.1_5'Flank	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	790					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.R790Q(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						GGCCTGAGCCGAGACGCCACG	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	92.0	98.0					11																	66006688		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.2369G>A	11.37:g.66006688G>A	ENSP00000316454:p.Arg790Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.R790Q	ENST00000320580.4	37	c.2369	CCDS8129.1	11	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003316	0.54254	.	.	ENSG00000175115	ENST00000320580;ENST00000529757	T;T	0.50548	0.74;0.74	4.94	4.94	0.65067	.	0.220091	0.36002	N	0.002853	T	0.32615	0.0835	N	0.25647	0.755	0.80722	D	1	B	0.24576	0.106	B	0.19148	0.024	T	0.10776	-1.0615	10	0.30854	T	0.27	-6.3698	10.9304	0.47215	0.0879:0.0:0.9121:0.0	.	790	Q6VY07	PACS1_HUMAN	Q	790;326	ENSP00000316454:R790Q;ENSP00000432858:R326Q	ENSP00000316454:R790Q	R	+	2	0	PACS1	65763264	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	5.412000	0.66392	2.461000	0.83175	0.555000	0.69702	CGA	PACS1	-	pfam_Phosphofurin_acidic_CS-1	ENSG00000175115		0.642	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACS1	HGNC	protein_coding	OTTHUMT00000391690.2	159	0.00	0	G	NM_018026		66006688	66006688	+1	no_errors	ENST00000320580	ensembl	human	known	69_37n	missense	92	10.68	11	SNP	1.000	A
PARP4	143	genome.wustl.edu	37	13	25064849	25064849	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr13:25064849C>T	ENST00000381989.3	-	10	1276	c.1171G>A	c.(1171-1173)Gaa>Aaa	p.E391K		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	391	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.E391K(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CTGAGAAATTCTTCAGTATTC	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	131.0	132.0					13																	25064849		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1171G>A	13.37:g.25064849C>T	ENSP00000371419:p.Glu391Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.E391K	ENST00000381989.3	37	c.1171	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	C	27.6	4.850348	0.91277	.	.	ENSG00000102699	ENST00000381989	T	0.19394	2.15	4.84	4.84	0.62591	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	U	0.000000	T	0.53061	0.1773	M	0.88512	2.96	0.44780	D	0.99778	D	0.76494	0.999	D	0.87578	0.998	T	0.62091	-0.6927	10	0.72032	D	0.01	-21.985	15.4707	0.75439	0.0:1.0:0.0:0.0	.	391	Q9UKK3	PARP4_HUMAN	K	391	ENSP00000371419:E391K	ENSP00000371419:E391K	E	-	1	0	PARP4	23962849	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.582000	0.60957	2.502000	0.84385	0.544000	0.68410	GAA	PARP4	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000102699		0.388	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	154	0.00	0	C	NM_006437		25064849	25064849	-1	no_errors	ENST00000381989	ensembl	human	known	69_37n	missense	128	33.33	64	SNP	1.000	T
PCDHA4	56144	genome.wustl.edu	37	5	140186860	140186860	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:140186860C>G	ENST00000530339.1	+	1	88	c.88C>G	c.(88-90)Cag>Gag	p.Q30E	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.Q30E|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.Q30E	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	30	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.Q30E(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGAACGGTCAGCTCCACTA	0.642																																						dbGAP											2	Substitution - Missense(2)	breast(2)											62.0	68.0	66.0					5																	140186860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.88C>G	5.37:g.140186860C>G	ENSP00000435300:p.Gln30Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Q30E	ENST00000530339.1	37	c.88	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	c	17.88	3.497054	0.64186	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.30981	1.51;1.51;1.51	4.77	4.77	0.60923	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.38720	U	0.001595	T	0.55970	0.1954	M	0.82630	2.6	0.25462	N	0.987909	P;D;P	0.59767	0.754;0.986;0.898	B;P;P	0.58721	0.393;0.844;0.453	T	0.56390	-0.7987	10	0.87932	D	0	.	18.1589	0.89702	0.0:1.0:0.0:0.0	.	30;30;30	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	E	30	ENSP00000423470:Q30E;ENSP00000349344:Q30E;ENSP00000435300:Q30E	ENSP00000349344:Q30E	Q	+	1	0	PCDHA4	140167044	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.097000	0.57741	2.373000	0.80994	0.467000	0.42956	CAG	PCDHA4	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000204967		0.642	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	58	0.00	0	C	NM_018907		140186860	140186860	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	0.998	G
PCDHA4	56144	genome.wustl.edu	37	5	140187308	140187308	+	Missense_Mutation	SNP	C	C	T	rs369564705		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:140187308C>T	ENST00000530339.1	+	1	536	c.536C>T	c.(535-537)tCt>tTt	p.S179F	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.S179F|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.S179F	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S179F(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAATACTTTTCTCTGGAAAAA	0.483																																						dbGAP											2	Substitution - Missense(2)	breast(2)											46.0	54.0	51.0					5																	140187308		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.536C>T	5.37:g.140187308C>T	ENSP00000435300:p.Ser179Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S179F	ENST00000530339.1	37	c.536	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	c	6.806	0.517765	0.13005	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.54279	0.58;0.58;0.58	4.62	3.72	0.42706	Cadherin (4);Cadherin-like (1);	0.209057	0.23537	U	0.047109	T	0.53722	0.1814	M	0.78285	2.405	0.09310	N	1	B;B;B	0.22146	0.009;0.038;0.065	B;B;B	0.29267	0.013;0.1;0.1	T	0.52056	-0.8626	10	0.49607	T	0.09	.	10.092	0.42453	0.0:0.8377:0.0:0.1623	.	179;179;179	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	F	179	ENSP00000423470:S179F;ENSP00000349344:S179F;ENSP00000435300:S179F	ENSP00000349344:S179F	S	+	2	0	PCDHA4	140167492	0.000000	0.05858	0.913000	0.36048	0.830000	0.47004	-0.311000	0.08124	2.284000	0.76573	0.563000	0.77884	TCT	PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.483	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	72	0.00	0	C	NM_018907		140187308	140187308	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	missense	31	17.95	7	SNP	0.033	T
PCDHA4	56144	genome.wustl.edu	37	5	140188699	140188700	+	Missense_Mutation	DNP	CC	CC	GT	rs17844284		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:140188699_140188700CC>GT	ENST00000530339.1	+	1	1927_1928	c.1927_1928CC>GT	c.(1927-1929)CCg>GTg	p.P643V	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.P643V|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.P643V	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	643	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGGACGCTCCGCGCCACCGC	0.688																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		Exception_encountered	5.37:g.140188699_140188700delinsGT	ENSP00000435300:p.Pro643Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P643A|p.P643L	ENST00000530339.1	37	c.1927|c.1928	CCDS54916.1	5																																																																																			PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.688	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	83	0.00	0	C	NM_018907		140188699|140188700	140188699|140188700	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	missense	61|59	18.67|18.92	14	SNP	0.001|0.005	G|T
PCLO	27445	genome.wustl.edu	37	7	82390716	82390716	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:82390716C>T	ENST00000333891.9	-	23	15438	c.15101G>A	c.(15100-15102)aGa>aAa	p.R5034K		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.R5034K(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGTAATATTTCTGCATTGGAG	0.323																																						dbGAP											2	Substitution - Missense(2)	breast(2)											116.0	104.0	108.0					7																	82390716		1804	4053	5857	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15101G>A	7.37:g.82390716C>T	ENSP00000334319:p.Arg5034Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.R5034K	ENST00000333891.9	37	c.15101	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	17.96	3.517229	0.64634	.	.	ENSG00000186472	ENST00000333891	T	0.67345	-0.26	5.33	5.33	0.75918	.	0.000000	0.43260	U	0.000582	T	0.71298	0.3323	N	0.12920	0.275	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.77319	-0.2632	10	0.87932	D	0	.	19.0274	0.92937	0.0:1.0:0.0:0.0	.	5034	Q9Y6V0-5	.	K	5034	ENSP00000334319:R5034K	ENSP00000334319:R5034K	R	-	2	0	PCLO	82228652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.470000	0.83445	0.650000	0.86243	AGA	PCLO	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000186472		0.323	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	139	0.00	0	C	NM_014510		82390716	82390716	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	177	20.54	46	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	77	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	53	45.71	48	SNP	1.000	G
PIK3R1	5295	genome.wustl.edu	37	5	67586647	67586647	+	Intron	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:67586647G>C	ENST00000521381.1	+	8	1532				PIK3R1_ENST00000521657.1_Intron|PIK3R1_ENST00000274335.5_Intron|PIK3R1_ENST00000336483.5_Missense_Mutation_p.E31Q|PIK3R1_ENST00000320694.8_Intron|PIK3R1_ENST00000396611.1_Intron|PIK3R1_ENST00000523872.1_5'Flank	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.E31Q(1)|p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	GTTTTATATAGAAATGGACCC	0.338			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																												dbGAP		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	3	Substitution - Missense(1)|Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)|breast(1)											88.0	93.0	91.0					5																	67586647		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.917-1440G>C	5.37:g.67586647G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	pfam_SH2,superfamily_Guanylate-bd_C,smart_SH2,pfscan_SH2,prints_PI3kinase_P85,prints_SH2	p.E31Q	ENST00000521381.1	37	c.91	CCDS3993.1	5	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263391	0.59431	.	.	ENSG00000145675	ENST00000336483	D	0.81579	-1.51	4.91	4.91	0.64330	.	.	.	.	.	T	0.74711	0.3752	.	.	.	0.80722	D	1	P	0.42039	0.769	B	0.37267	0.245	T	0.75657	-0.3242	8	0.35671	T	0.21	.	18.2918	0.90133	0.0:0.0:1.0:0.0	.	31	P27986-2	.	Q	31	ENSP00000338554:E31Q	ENSP00000338554:E31Q	E	+	1	0	PIK3R1	67622403	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.674000	0.83992	2.551000	0.86045	0.561000	0.74099	GAA	PIK3R1	-	NULL	ENSG00000145675		0.338	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	105	0.00	0	G	NM_181504		67586647	67586647	+1	no_errors	ENST00000336483	ensembl	human	known	69_37n	missense	60	18.67	14	SNP	1.000	C
PLCL2	23228	genome.wustl.edu	37	3	17109478	17109478	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:17109478T>C	ENST00000418129.2	+	5	3212	c.2747T>C	c.(2746-2748)aTa>aCa	p.I916T	PLCL2_ENST00000432376.1_Missense_Mutation_p.I916T|PLCL2_ENST00000396755.2_Missense_Mutation_p.I916T	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	1042					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.I916T(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						TTGCACAGCATAGGCACCAAG	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	140.0	140.0					3																	17109478		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2747T>C	3.37:g.17109478T>C	ENSP00000409637:p.Ile916Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.I916T	ENST00000418129.2	37	c.2747	CCDS33713.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.82|15.82	2.945677|2.945677	0.53079|0.53079	.|.	.|.	ENSG00000154822|ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376|ENST00000419842	T;T;T|.	0.18016|.	2.25;2.24;2.25|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.105223|.	0.64402|.	D|.	0.000008|.	T|.	0.71151|.	0.3306|.	.|.	.|.	.|.	0.50813|0.50813	D|D	0.99989|0.99989	B|.	0.18310|.	0.027|.	B|.	0.16722|.	0.016|.	T|.	0.70342|.	-0.4898|.	9|.	0.56958|.	D|.	0.05|.	.|.	14.756|14.756	0.69564|0.69564	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1042|.	Q9UPR0|.	PLCL2_HUMAN|.	T|Q	916;1043;916;916|660	ENSP00000409637:I916T;ENSP00000379979:I916T;ENSP00000412836:I916T|.	ENSP00000285094:I1043T|.	I|X	+|+	2|1	0|0	PLCL2|PLCL2	17084482|17084482	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.998000|0.998000	0.95712|0.95712	7.514000|7.514000	0.81750|0.81750	2.136000|2.136000	0.66102|0.66102	0.459000|0.459000	0.35465|0.35465	ATA|TAG	PLCL2	-	NULL	ENSG00000154822		0.363	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	81	0.00	0	T			17109478	17109478	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	missense	50	38.27	31	SNP	0.997	C
PLS3	5358	genome.wustl.edu	37	X	114868366	114868366	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:114868366G>C	ENST00000420625.2	+	6	689	c.555G>C	c.(553-555)aaG>aaC	p.K185N	PLS3_ENST00000289290.3_Missense_Mutation_p.K140N|PLS3_ENST00000539310.1_Missense_Mutation_p.K140N|PLS3_ENST00000537301.1_Missense_Mutation_p.K163N|PLS3_ENST00000355899.3_Missense_Mutation_p.K185N	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	185	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.K185N(1)		NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						CAATCAACAAGAAGAAACTTA	0.363																																					Colon(160;1047 1864 8490 12969 29601)	dbGAP											1	Substitution - Missense(1)	breast(1)											225.0	196.0	206.0					X																	114868366		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.555G>C	X.37:g.114868366G>C	ENSP00000398945:p.Lys185Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.K185N	ENST00000420625.2	37	c.555	CCDS14568.1	X	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148535	0.78001	.	.	ENSG00000102024	ENST00000355899;ENST00000537301;ENST00000289290;ENST00000420625;ENST00000539310	D;D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66;-3.66	5.45	3.67	0.42095	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.96436	0.8837	M	0.80746	2.51	0.80722	D	1	D;P;P	0.63046	0.992;0.954;0.908	D;P;P	0.65987	0.94;0.71;0.599	D	0.95477	0.8557	10	0.87932	D	0	0.0246	9.9023	0.41355	0.1715:0.0:0.8285:0.0	.	158;163;185	B4DPW9;B4DGB4;P13797	.;.;PLST_HUMAN	N	185;163;140;185;140	ENSP00000348163:K185N;ENSP00000445105:K163N;ENSP00000289290:K140N;ENSP00000398945:K185N;ENSP00000445339:K140N	ENSP00000289290:K140N	K	+	3	2	PLS3	114774622	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.259000	0.51515	0.489000	0.27749	0.594000	0.82650	AAG	PLS3	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000102024		0.363	PLS3-201	KNOWN	basic|CCDS	protein_coding	PLS3	HGNC	protein_coding	OTTHUMT00000057976.2	166	0.00	0	G			114868366	114868366	+1	no_errors	ENST00000355899	ensembl	human	known	69_37n	missense	106	25.87	37	SNP	1.000	C
PLS3	5358	genome.wustl.edu	37	X	114869259	114869259	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:114869259G>A	ENST00000420625.2	+	7	783	c.649G>A	c.(649-651)Gaa>Aaa	p.E217K	PLS3_ENST00000289290.3_Missense_Mutation_p.E172K|PLS3_ENST00000539310.1_Missense_Mutation_p.E172K|PLS3_ENST00000537301.1_Missense_Mutation_p.E195K|PLS3_ENST00000355899.3_Missense_Mutation_p.E217K	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	217	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.E217K(1)		NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						CATTGGTGCAGAAGATTTGAG	0.448																																					Colon(160;1047 1864 8490 12969 29601)	dbGAP											1	Substitution - Missense(1)	breast(1)											233.0	196.0	208.0					X																	114869259		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.649G>A	X.37:g.114869259G>A	ENSP00000398945:p.Glu217Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.E217K	ENST00000420625.2	37	c.649	CCDS14568.1	X	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448147	0.43429	.	.	ENSG00000102024	ENST00000355899;ENST00000537301;ENST00000289290;ENST00000420625;ENST00000539310	D;D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99;-3.99	4.93	4.93	0.64822	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.187068	0.46442	D	0.000288	D	0.95589	0.8566	M	0.78285	2.405	0.80722	D	1	B;B;B	0.27380	0.177;0.081;0.041	B;B;B	0.32289	0.143;0.068;0.099	D	0.94353	0.7581	10	0.19147	T	0.46	-16.3028	15.8045	0.78483	0.0:0.0:1.0:0.0	.	190;195;217	B4DPW9;B4DGB4;P13797	.;.;PLST_HUMAN	K	217;195;172;217;172	ENSP00000348163:E217K;ENSP00000445105:E195K;ENSP00000289290:E172K;ENSP00000398945:E217K;ENSP00000445339:E172K	ENSP00000289290:E172K	E	+	1	0	PLS3	114775515	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.617000	0.61204	2.026000	0.59711	0.594000	0.82650	GAA	PLS3	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000102024		0.448	PLS3-201	KNOWN	basic|CCDS	protein_coding	PLS3	HGNC	protein_coding	OTTHUMT00000057976.2	195	0.00	0	G			114869259	114869259	+1	no_errors	ENST00000355899	ensembl	human	known	69_37n	missense	121	25.77	42	SNP	0.987	A
PLXNA4	91584	genome.wustl.edu	37	7	131925880	131925880	+	Missense_Mutation	SNP	C	C	T	rs542202891		TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:131925880C>T	ENST00000359827.3	-	5	2511	c.1549G>A	c.(1549-1551)Ggc>Agc	p.G517S	PLXNA4_ENST00000321063.4_Missense_Mutation_p.G517S			Q9HCM2	PLXA4_HUMAN	plexin A4	517	PSI 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.G517S(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AGGCACTCGCCGCAGCTCTGA	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		19529	0.0		0.001	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	breast(2)											42.0	49.0	46.0					7																	131925880		2134	4274	6408	-	-	-	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1549G>A	7.37:g.131925880C>T	ENSP00000352882:p.Gly517Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.G517S	ENST00000359827.3	37	c.1549	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	6.977	0.550222	0.13374	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.15487	2.42;2.42	5.23	-0.0174	0.13968	.	0.148751	0.64402	N	0.000016	T	0.06142	0.0159	N	0.10707	0.03	0.36557	D	0.872211	B	0.09022	0.002	B	0.09377	0.004	T	0.44345	-0.9334	10	0.06236	T	0.91	.	9.0015	0.36085	0.0:0.256:0.0:0.744	.	517	Q9HCM2	PLXA4_HUMAN	S	517	ENSP00000323194:G517S;ENSP00000352882:G517S	ENSP00000323194:G517S	G	-	1	0	PLXNA4	131576420	0.001000	0.12720	0.404000	0.26397	0.994000	0.84299	0.044000	0.13992	-0.274000	0.09232	0.561000	0.74099	GGC	PLXNA4	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000221866		0.597	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	210	0.47	1	C	NM_181775		131925880	131925880	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	missense	102	49.02	100	SNP	0.997	T
PREP	5550	genome.wustl.edu	37	6	105726196	105726196	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:105726196G>C	ENST00000369110.3	-	15	2148	c.1956C>G	c.(1954-1956)ttC>ttG	p.F652L	RP3-355L5.4_ENST00000452363.1_RNA	NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	652					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.F652L(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	GGGTGGCAATGAACTTCAGGG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	88.0	91.0					6																	105726196		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.1956C>G	6.37:g.105726196G>C	ENSP00000358106:p.Phe652Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6D4	Missense_Mutation	SNP	pfam_Peptidase_S9A_B_C_N,pfam_Peptidase_S9,superfamily_Peptidase_S9A_B_C_N,prints_Peptidase_S9A	p.F652L	ENST00000369110.3	37	c.1956	CCDS5053.1	6	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569695	0.45798	.	.	ENSG00000085377	ENST00000369110	T	0.28255	1.62	5.87	5.87	0.94306	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.046192	0.85682	D	0.000000	T	0.09555	0.0235	N	0.13371	0.34	0.58432	D	0.999997	B	0.14012	0.009	B	0.18263	0.021	T	0.08371	-1.0725	10	0.35671	T	0.21	-25.9109	11.5307	0.50607	0.1378:0.0:0.8622:0.0	.	652	P48147	PPCE_HUMAN	L	652	ENSP00000358106:F652L	ENSP00000358106:F652L	F	-	3	2	PREP	105832889	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.334000	0.52097	2.774000	0.95407	0.650000	0.86243	TTC	PREP	-	pfam_Peptidase_S9,prints_Peptidase_S9A	ENSG00000085377		0.592	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREP	HGNC	protein_coding	OTTHUMT00000041658.1	250	0.00	0	G			105726196	105726196	-1	no_errors	ENST00000369110	ensembl	human	known	69_37n	missense	20	80.00	84	SNP	1.000	C
PTPN22	26191	genome.wustl.edu	37	1	114376945	114376945	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:114376945G>T	ENST00000359785.5	-	15	2146	c.2011C>A	c.(2011-2013)Ctt>Att	p.L671I	PTPN22_ENST00000538253.1_Missense_Mutation_p.L427I|PTPN22_ENST00000525799.1_Missense_Mutation_p.L544I|PTPN22_ENST00000528414.1_Missense_Mutation_p.L616I|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000420377.2_Missense_Mutation_p.L671I	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	671					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)	p.L671I(1)		NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGGTCTAAGTATCACAGAG	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	118.0	120.0					1																	114376945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.2011C>A	1.37:g.114376945G>T	ENSP00000352833:p.Leu671Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L671I	ENST00000359785.5	37	c.2011	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968843	0.53614	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	6.04	4.05	0.47172	.	0.285799	0.25813	N	0.028122	T	0.39172	0.1068	M	0.67953	2.075	0.25741	N	0.985163	P;D;P;P;D;P	0.58268	0.944;0.982;0.908;0.908;0.979;0.926	P;P;B;P;P;P	0.56563	0.572;0.473;0.437;0.449;0.801;0.554	T	0.28996	-1.0026	10	0.39692	T	0.17	.	4.6517	0.12598	0.1761:0.0:0.6483:0.1755	.	427;544;671;616;671;671	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	I	671;616;427;671;544;671	ENSP00000352833:L671I;ENSP00000435176:L616I;ENSP00000439372:L427I;ENSP00000388229:L671I;ENSP00000432674:L544I	ENSP00000346621:L671I	L	-	1	0	PTPN22	114178468	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	1.076000	0.30729	1.539000	0.49286	0.561000	0.74099	CTT	PTPN22	-	pirsf_Non-rcpt_Tyr_Pase_8/22	ENSG00000134242		0.353	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	104	0.00	0	G	NM_015967		114376945	114376945	-1	no_errors	ENST00000359785	ensembl	human	known	69_37n	missense	63	42.86	48	SNP	0.988	T
RAB36	9609	genome.wustl.edu	37	22	23503156	23503156	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr22:23503156G>A	ENST00000263116.2	+	10	948	c.908G>A	c.(907-909)cGg>cAg	p.R303Q	RAB36_ENST00000341989.4_Missense_Mutation_p.R281Q	NM_004914.2	NP_004905.2	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	303					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)	p.R303Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		AGCAGTGCCCGGCTCCAGGTC	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	68.0	73.0					22																	23503156		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023061	CCDS13805.1	22q11.22	2008-06-11			ENSG00000100228	ENSG00000100228		"""RAB, member RAS oncogene"""	9775	protein-coding gene	gene with protein product		605662				9920784, 10591208	Standard	NM_004914		Approved		uc002zwv.1	O95755	OTTHUMG00000150601	ENST00000263116.2:c.908G>A	22.37:g.23503156G>A	ENSP00000263116:p.Arg303Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M390|Q7Z4A9|Q9UHP5	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R303Q	ENST00000263116.2	37	c.908	CCDS13805.1	22	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896694	0.33535	.	.	ENSG00000100228	ENST00000263116;ENST00000341989	T;T	0.63255	-0.03;0.36	5.67	-3.35	0.04928	.	0.631756	0.13881	N	0.356350	T	0.39733	0.1089	L	0.29908	0.895	0.09310	N	1	B;B	0.21381	0.055;0.024	B;B	0.12837	0.008;0.006	T	0.19321	-1.0309	10	0.21540	T	0.41	-7.0973	6.4222	0.21750	0.4599:0.2231:0.317:0.0	.	281;303	O95755-2;O95755	.;RAB36_HUMAN	Q	303;281	ENSP00000263116:R303Q;ENSP00000343494:R281Q	ENSP00000263116:R303Q	R	+	2	0	RAB36	21833156	0.000000	0.05858	0.002000	0.10522	0.430000	0.31655	-0.223000	0.09177	-0.354000	0.08212	-0.345000	0.07892	CGG	RAB36	-	smart_Ran_GTPase	ENSG00000100228		0.622	RAB36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB36	HGNC	protein_coding	OTTHUMT00000319046.1	34	0.00	0	G	NM_004914		23503156	23503156	+1	no_errors	ENST00000263116	ensembl	human	known	69_37n	missense	6	64.71	11	SNP	0.004	A
RBM42	79171	genome.wustl.edu	37	19	36124592	36124592	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:36124592G>C	ENST00000262633.4	+	7	793	c.688G>C	c.(688-690)Gag>Cag	p.E230Q	RBM42_ENST00000589559.1_Missense_Mutation_p.E201Q|RBM42_ENST00000592202.1_Missense_Mutation_p.E176Q|RBM42_ENST00000588161.1_Missense_Mutation_p.E200Q|RBM42_ENST00000589871.1_Missense_Mutation_p.E208Q|RBM42_ENST00000586618.1_Intron|RBM42_ENST00000360475.4_Missense_Mutation_p.E201Q	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	230	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E230Q(1)		breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCCACAGGAAGAGCCAGCAGC	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											12.0	17.0	16.0					19																	36124592		2186	4279	6465	-	-	-	SO:0001583	missense	0			BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.688G>C	19.37:g.36124592G>C	ENSP00000262633:p.Glu230Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00320|Q8N5R7|Q9BU66	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E230Q	ENST00000262633.4	37	c.688	CCDS12468.1	19	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967412	0.53507	.	.	ENSG00000126254	ENST00000262633;ENST00000360475	T;T	0.06068	3.35;3.4	5.01	5.01	0.66863	.	0.288790	0.39475	N	0.001356	T	0.05318	0.0141	N	0.19112	0.55	0.30287	N	0.790785	P;P;P;P	0.38800	0.648;0.648;0.648;0.516	B;B;B;B	0.38616	0.277;0.277;0.277;0.143	T	0.24225	-1.0166	10	0.24483	T	0.36	-21.4641	13.6913	0.62547	0.0:0.0:1.0:0.0	.	196;201;200;230	Q9BTD8-4;Q9BTD8-3;Q9BTD8-2;Q9BTD8	.;.;.;RBM42_HUMAN	Q	230;201	ENSP00000262633:E230Q;ENSP00000353663:E201Q	ENSP00000262633:E230Q	E	+	1	0	RBM42	40816432	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	4.965000	0.63708	2.604000	0.88044	0.650000	0.86243	GAG	RBM42	-	NULL	ENSG00000126254		0.632	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM42	HGNC	protein_coding	OTTHUMT00000459057.2	130	0.00	0	G	NM_024321		36124592	36124592	+1	no_errors	ENST00000262633	ensembl	human	known	69_37n	missense	33	28.26	13	SNP	1.000	C
RBM44	375316	genome.wustl.edu	37	2	238726892	238726892	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:238726892C>T	ENST00000409864.1	+	3	1587	c.1333C>T	c.(1333-1335)Cac>Tac	p.H445Y	RBM44_ENST00000444524.2_Intron|RBM44_ENST00000316997.4_Missense_Mutation_p.H445Y			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	444						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.H445Y(2)		breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		AACATGCTTTCACAATATAGG	0.388																																						dbGAP											2	Substitution - Missense(2)	breast(2)											69.0	65.0	66.0					2																	238726892		1918	4119	6037	-	-	-	SO:0001583	missense	0			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.1333C>T	2.37:g.238726892C>T	ENSP00000386727:p.His445Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUW3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H445Y	ENST00000409864.1	37	c.1333	CCDS46554.1	2	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.266854	0.00259	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.23950	1.88;1.88	5.86	1.4	0.22301	.	1.295080	0.05050	N	0.477943	T	0.21062	0.0507	M	0.63428	1.95	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.30880	-0.9963	10	0.05959	T	0.93	0.1412	2.538	0.04719	0.1751:0.5157:0.1227:0.1866	.	444	Q6ZP01	RBM44_HUMAN	Y	445	ENSP00000321179:H445Y;ENSP00000386727:H445Y	ENSP00000321179:H445Y	H	+	1	0	RBM44	238391631	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.439000	0.21575	0.325000	0.23359	0.591000	0.81541	CAC	RBM44	-	NULL	ENSG00000177483		0.388	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM44	HGNC	protein_coding	OTTHUMT00000328733.2	34	0.00	0	C	NM_001080504		238726892	238726892	+1	no_errors	ENST00000316997	ensembl	human	known	69_37n	missense	35	23.40	11	SNP	0.000	T
RCBTB2	1102	genome.wustl.edu	37	13	49086299	49086299	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr13:49086299C>G	ENST00000344532.3	-	8	951	c.528G>C	c.(526-528)tgG>tgC	p.W176C	RCBTB2_ENST00000481144.1_5'UTR|RCBTB2_ENST00000544904.1_Missense_Mutation_p.W152C|RCBTB2_ENST00000544492.1_Intron|RCBTB2_ENST00000430805.2_Missense_Mutation_p.W181C	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	176					positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.W176C(1)		breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TATTATAACCCCAGGCAAATA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	88.0	90.0					13																	49086299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.528G>C	13.37:g.49086299C>G	ENSP00000345144:p.Trp176Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDW8	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.W181C	ENST00000344532.3	37	c.543	CCDS9411.1	13	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325784	0.81580	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544904	D;D;D	0.92348	-3.02;-3.02;-3.02	5.58	5.58	0.84498	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.96734	0.8934	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;0.985	D;D;D;D	0.91635	0.999;0.957;0.999;0.929	D	0.96869	0.9638	10	0.66056	D	0.02	.	19.5654	0.95390	0.0:1.0:0.0:0.0	.	152;181;180;176	B4DPP7;B4DWG0;B3KVB1;O95199	.;.;.;RCBT2_HUMAN	C	176;180;181;181;152	ENSP00000345144:W176C;ENSP00000389910:W181C;ENSP00000443904:W152C	ENSP00000345144:W176C	W	-	3	0	RCBTB2	47984300	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.403000	0.79983	2.641000	0.89580	0.585000	0.79938	TGG	RCBTB2	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	ENSG00000136161		0.408	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCBTB2	HGNC	protein_coding	OTTHUMT00000044888.2	168	0.00	0	C	NM_001268		49086299	49086299	-1	no_errors	ENST00000430805	ensembl	human	known	69_37n	missense	73	27.45	28	SNP	1.000	G
REP15	387849	genome.wustl.edu	37	12	27850132	27850132	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:27850132G>T	ENST00000310791.2	+	1	705	c.637G>T	c.(637-639)Gag>Tag	p.E213*	RP11-1060J15.4_ENST00000542660.1_RNA|RP11-1060J15.4_ENST00000536317.1_RNA|RP11-1060J15.4_ENST00000536922.1_RNA	NM_001029874.1	NP_001025045.1	Q6BDI9	REP15_HUMAN	RAB15 effector protein	213					receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	endosome membrane (GO:0010008)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)		p.E213*(1)		breast(1)|cervix(1)|large_intestine(2)|lung(4)|ovary(1)	9	Lung SC(9;0.0873)					GTTCATCAAAGAGCTGCTCAG	0.478																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											104.0	107.0	106.0					12																	27850132		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC140921	CCDS31762.1	12p11.22	2010-09-02			ENSG00000174236	ENSG00000174236			33748	protein-coding gene	gene with protein product		610848				16195351	Standard	NM_001029874		Approved	RAB15EP	uc001rig.1	Q6BDI9		ENST00000310791.2:c.637G>T	12.37:g.27850132G>T	ENSP00000310335:p.Glu213*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU16	Nonsense_Mutation	SNP	NULL	p.E213*	ENST00000310791.2	37	c.637	CCDS31762.1	12	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452080	0.84209	.	.	ENSG00000174236	ENST00000310791	.	.	.	4.91	3.04	0.35103	.	0.184887	0.37095	N	0.002244	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-4.8054	15.0227	0.71643	0.0:0.2691:0.7309:0.0	.	.	.	.	X	213	.	ENSP00000310335:E213X	E	+	1	0	REP15	27741399	1.000000	0.71417	0.987000	0.45799	0.787000	0.44495	3.803000	0.55560	0.633000	0.30452	0.655000	0.94253	GAG	REP15	-	NULL	ENSG00000174236		0.478	REP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REP15	HGNC	protein_coding	OTTHUMT00000402894.1	144	0.00	0	G	NM_001029874		27850132	27850132	+1	no_errors	ENST00000310791	ensembl	human	known	69_37n	nonsense	98	26.87	36	SNP	0.998	T
RORC	6097	genome.wustl.edu	37	1	151787669	151787669	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:151787669C>T	ENST00000318247.6	-	5	638	c.531G>A	c.(529-531)ctG>ctA	p.L177L	RORC_ENST00000480719.1_5'Flank|RORC_ENST00000392697.3_Silent_p.L231L|RORC_ENST00000356728.6_Silent_p.L156L	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	177	Hinge. {ECO:0000255}.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.L177L(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTGAGGCTTTCAGGAGGCCAG	0.637																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											26.0	27.0	26.0					1																	151787669		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.531G>A	1.37:g.151787669C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZR9|Q8N5V7|Q8NCY8	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.L231	ENST00000318247.6	37	c.693	CCDS1004.1	1																																																																																			RORC	-	NULL	ENSG00000143365		0.637	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RORC	HGNC	protein_coding	OTTHUMT00000036626.1	85	0.00	0	C			151787669	151787669	-1	no_errors	ENST00000392697	ensembl	human	known	69_37n	silent	23	34.29	12	SNP	0.084	T
RPL36	25873	genome.wustl.edu	37	19	5691557	5691557	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:5691557C>G	ENST00000577222.1	+	6	787	c.243C>G	c.(241-243)atC>atG	p.I81M	RPL36_ENST00000394580.2_Missense_Mutation_p.I81M|RPL36_ENST00000579649.1_Missense_Mutation_p.I81M|RPL36_ENST00000347512.3_Missense_Mutation_p.I81M|RPL36_ENST00000579446.1_3'UTR			Q9Y3U8	RL36_HUMAN	ribosomal protein L36	81					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.I81M(1)		breast(1)|upper_aerodigestive_tract(1)	2						GGACGCACATCCGCGCCAAGA	0.682											OREG0025183	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											16.0	19.0	18.0					19																	5691557		2199	4290	6489	-	-	-	SO:0001583	missense	0				CCDS12147.1	19p13.2	2011-04-06				ENSG00000130255		"""L ribosomal proteins"""	13631	protein-coding gene	gene with protein product							Standard	NM_033643		Approved	DKFZp566B023, L36	uc002mcv.3	Q9Y3U8		ENST00000577222.1:c.243C>G	19.37:g.5691557C>G	ENSP00000464342:p.Ile81Met	Somatic	628	WXS	Illumina GAIIx	Phase_IV	B2R4Y1|D6W634|Q6FIG1|Q9UQF6	Missense_Mutation	SNP	pfam_Ribosomal_L36e	p.I81M	ENST00000577222.1	37	c.243	CCDS12147.1	19	.	.	.	.	.	.	.	.	.	.	C	9.753	1.168130	0.21621	.	.	ENSG00000130255	ENST00000347512;ENST00000394580	T;T	0.44881	0.91;0.91	4.03	4.03	0.46877	.	0.000000	0.85682	U	0.000000	T	0.40886	0.1135	M	0.66439	2.03	0.58432	D	0.999996	P	0.36837	0.571	B	0.39152	0.292	T	0.38972	-0.9636	10	0.49607	T	0.09	.	7.7631	0.28963	0.0:0.8831:0.0:0.1169	.	81	Q9Y3U8	RL36_HUMAN	M	81	ENSP00000252543:I81M;ENSP00000378081:I81M	ENSP00000252543:I81M	I	+	3	3	RPL36	5642557	0.996000	0.38824	1.000000	0.80357	0.136000	0.21042	0.489000	0.22387	1.797000	0.52628	0.456000	0.33151	ATC	RPL36	-	pfam_Ribosomal_L36e	ENSG00000130255		0.682	RPL36-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	RPL36	HGNC	protein_coding	OTTHUMT00000442561.1	33	0.00	0	C	NM_015414		5691557	5691557	+1	no_errors	ENST00000347512	ensembl	human	known	69_37n	missense	3	76.92	10	SNP	1.000	G
RPS6KB2	6199	genome.wustl.edu	37	11	67202530	67202530	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:67202530C>G	ENST00000312629.5	+	15	1384	c.1339C>G	c.(1339-1341)Cta>Gta	p.L447V	AP003419.16_ENST00000535922.1_RNA	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	447	Pro-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)	p.L447V(2)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			GGAGCTAcctctacctccact	0.677																																						dbGAP											2	Substitution - Missense(2)	breast(2)											21.0	30.0	27.0					11																	67202530		1926	4122	6048	-	-	-	SO:0001583	missense	0			AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.1339C>G	11.37:g.67202530C>G	ENSP00000308413:p.Leu447Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase,pfscan_Prot_kinase_cat_dom	p.L447V	ENST00000312629.5	37	c.1339	CCDS41677.1	11	.	.	.	.	.	.	.	.	.	.	C	10.40	1.339396	0.24339	.	.	ENSG00000175634	ENST00000312629	T	0.66995	-0.24	4.41	1.4	0.22301	.	0.409611	0.19495	N	0.112873	T	0.36799	0.0980	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04708	-1.0932	10	0.13470	T	0.59	.	4.4471	0.11602	0.0:0.6088:0.1846:0.2066	.	447	Q9UBS0	KS6B2_HUMAN	V	447	ENSP00000308413:L447V	ENSP00000308413:L447V	L	+	1	2	RPS6KB2	66959106	0.007000	0.16637	0.913000	0.36048	0.706000	0.40770	1.174000	0.31932	0.113000	0.18004	0.462000	0.41574	CTA	RPS6KB2	-	pirsf_Ribosomal_S6_kinase	ENSG00000175634		0.677	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KB2	HGNC	protein_coding	OTTHUMT00000395508.1	23	0.00	0	C	NM_003952		67202530	67202530	+1	no_errors	ENST00000312629	ensembl	human	known	69_37n	missense	4	73.33	11	SNP	0.870	G
RRP9	9136	genome.wustl.edu	37	3	51969486	51969487	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:51969486_51969487insGG	ENST00000232888.6	-	10	915_916	c.842_843insCC	c.(841-843)ggafs	p.G281fs		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	281					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CGTCCTGGTGTCCGAAGCTAGA	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.842_843insCC	3.37:g.51969486_51969487insGG	ENSP00000232888:p.Gly281fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R996|Q8IZ30	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q283fs	ENST00000232888.6	37	c.843_842	CCDS2837.1	3																																																																																			RRP9	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000114767		0.629	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP9	HGNC	protein_coding	OTTHUMT00000346637.1	242	0.00	0	-	NM_004704		51969486	51969487	-1	no_errors	ENST00000232888	ensembl	human	known	69_37n	frame_shift_ins	73	51.66	78	INS	0.981:1.000	GG
SAGE1	55511	genome.wustl.edu	37	X	134994976	134994976	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:134994976A>T	ENST00000370709.3	+	19	2635	c.2635A>T	c.(2635-2637)Att>Ttt	p.I879F	SAGE1_ENST00000324447.3_Missense_Mutation_p.I879F|SAGE1_ENST00000537770.1_Missense_Mutation_p.I503F|SAGE1_ENST00000535938.1_Missense_Mutation_p.I879F			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	879						nucleus (GO:0005634)		p.I879F(1)		breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					AGTTGTCTTAATTCAGCAACT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	47.0	49.0					X																	134994976		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2635A>T	X.37:g.134994976A>T	ENSP00000359743:p.Ile879Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JNW0	Missense_Mutation	SNP	NULL	p.I879F	ENST00000370709.3	37	c.2635	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	A	12.41	1.928365	0.34002	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.50548	0.74;0.74;0.77;0.74	2.15	2.15	0.27550	.	0.058516	0.64402	U	0.000004	T	0.61912	0.2385	M	0.73598	2.24	0.36575	D	0.873223	D;D	0.69078	0.997;0.997	D;D	0.75484	0.98;0.986	T	0.65948	-0.6044	10	0.46703	T	0.11	.	7.305	0.26443	1.0:0.0:0.0:0.0	.	503;879	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	F	879;879;503;879	ENSP00000323191:I879F;ENSP00000445959:I879F;ENSP00000438276:I503F;ENSP00000359743:I879F	ENSP00000323191:I879F	I	+	1	0	SAGE1	134822642	1.000000	0.71417	0.179000	0.23059	0.296000	0.27459	4.705000	0.61838	0.862000	0.35528	0.150000	0.16122	ATT	SAGE1	-	NULL	ENSG00000181433		0.363	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	54	0.00	0	A	NM_018666		134994976	134994976	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	missense	34	35.85	19	SNP	0.985	T
SCRN1	9805	genome.wustl.edu	37	7	29963714	29963714	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:29963714C>T	ENST00000426154.1	-	8	1280	c.1104G>A	c.(1102-1104)ctG>ctA	p.L368L	SCRN1_ENST00000416113.2_Silent_p.L194L|SCRN1_ENST00000409497.1_Silent_p.L368L|SCRN1_ENST00000242059.5_Silent_p.L368L|SCRN1_ENST00000425819.2_Silent_p.L300L|SCRN1_ENST00000434476.2_Silent_p.L388L	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	368					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)	p.L388L(1)|p.L368L(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						TGGTGCTCCTCAGCTTGCGAC	0.582																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											73.0	67.0	69.0					7																	29963714		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.1104G>A	7.37:g.29963714C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Silent	SNP	pfam_Peptidase_C69	p.L388	ENST00000426154.1	37	c.1164	CCDS5422.1	7																																																																																			SCRN1	-	NULL	ENSG00000136193		0.582	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN1	HGNC	protein_coding	OTTHUMT00000214231.2	49	0.00	0	C	NM_014766		29963714	29963714	-1	no_errors	ENST00000434476	ensembl	human	known	69_37n	silent	38	22.45	11	SNP	0.998	T
SCUBE2	57758	genome.wustl.edu	37	11	9088307	9088307	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:9088307C>T	ENST00000309263.3	-	6	769	c.697G>A	c.(697-699)Gat>Aat	p.D233N	SCUBE2_ENST00000450649.2_Missense_Mutation_p.D233N|SCUBE2_ENST00000457346.2_Missense_Mutation_p.D233N|RP11-467K18.2_ENST00000521394.2_RNA|SCUBE2_ENST00000520467.1_Missense_Mutation_p.D233N			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	233	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.D233N(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		TCTGGGCCATCGGCTGTATCG	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	80.0	97.0					11																	9088307		2201	4296	6497	-	-	-	SO:0001583	missense	0			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.697G>A	11.37:g.9088307C>T	ENSP00000310658:p.Asp233Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_CUB,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.D233N	ENST00000309263.3	37	c.697		11	.	.	.	.	.	.	.	.	.	.	C	8.277	0.814703	0.16607	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	5.95	4.03	0.46877	Epidermal growth factor-like (1);	0.597033	0.19245	N	0.119076	T	0.62454	0.2429	N	0.01250	-0.93	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.52381	-0.8583	10	0.18276	T	0.48	.	4.9865	0.14192	0.0:0.5401:0.1512:0.3087	.	233;233;233	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	N	233	ENSP00000390481:D233N;ENSP00000310658:D233N;ENSP00000415187:D233N;ENSP00000429969:D233N	ENSP00000310658:D233N	D	-	1	0	SCUBE2	9044883	0.000000	0.05858	0.182000	0.23118	0.967000	0.64934	-0.078000	0.11375	1.438000	0.47492	0.655000	0.94253	GAT	SCUBE2	-	smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000175356		0.527	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	SCUBE2	HGNC	protein_coding	OTTHUMT00000385812.2	101	0.00	0	C	NM_020974		9088307	9088307	-1	no_errors	ENST00000457346	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	0.044	T
SETBP1	26040	genome.wustl.edu	37	18	42533287	42533287	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr18:42533287G>A	ENST00000282030.5	+	4	4278	c.3982G>A	c.(3982-3984)Gac>Aac	p.D1328N		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1328						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D1328N(1)|p.D1274N(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAGTTCTTATGACTCCTCCAT	0.453									Schinzel-Giedion syndrome																													dbGAP											2	Substitution - Missense(2)	breast(2)											88.0	84.0	85.0					18																	42533287		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3982G>A	18.37:g.42533287G>A	ENSP00000282030:p.Asp1328Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.D1328N	ENST00000282030.5	37	c.3982	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510371	0.64522	.	.	ENSG00000152217	ENST00000282030	T	0.68479	-0.33	6.17	6.17	0.99709	.	0.258451	0.42172	D	0.000759	T	0.61009	0.2313	L	0.27053	0.805	0.37573	D	0.919498	B	0.34329	0.449	B	0.38106	0.265	T	0.58831	-0.7567	10	0.29301	T	0.29	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1328	Q9Y6X0	SETBP_HUMAN	N	1328	ENSP00000282030:D1328N	ENSP00000282030:D1328N	D	+	1	0	SETBP1	40787285	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	5.869000	0.69613	2.941000	0.99782	0.655000	0.94253	GAC	SETBP1	-	NULL	ENSG00000152217		0.453	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	225	0.00	0	G	NM_001130110		42533287	42533287	+1	no_errors	ENST00000282030	ensembl	human	known	69_37n	missense	143	20.11	36	SNP	1.000	A
SETDB1	9869	genome.wustl.edu	37	1	150921914	150921914	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:150921914C>A	ENST00000271640.5	+	12	1683	c.1493C>A	c.(1492-1494)tCt>tAt	p.S498Y	SETDB1_ENST00000368969.4_Missense_Mutation_p.S498Y|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	498					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.S498Y(1)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CGACCAGGATCTGTGGGCTCT	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	145.0	146.0					1																	150921914		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1493C>A	1.37:g.150921914C>A	ENSP00000271640:p.Ser498Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.S498Y	ENST00000271640.5	37	c.1493	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498752	0.85069	.	.	ENSG00000143379	ENST00000271640;ENST00000534805;ENST00000368969;ENST00000498193	D;T;D;T	0.89617	-2.54;1.28;-2.54;0.93	4.86	4.86	0.63082	.	0.126361	0.56097	D	0.000028	D	0.89030	0.6599	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.69078	0.976;0.997;0.997;0.995	P;D;D;D	0.78314	0.648;0.991;0.991;0.979	D	0.91076	0.4896	10	0.72032	D	0.01	.	17.7929	0.88561	0.0:1.0:0.0:0.0	.	498;499;498;498	E9PRF4;E9PQM8;Q15047-3;Q15047	.;.;.;SETB1_HUMAN	Y	498;499;498;498	ENSP00000271640:S498Y;ENSP00000436148:S499Y;ENSP00000357965:S498Y;ENSP00000432348:S498Y	ENSP00000271640:S498Y	S	+	2	0	SETDB1	149188538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.079000	0.64431	2.528000	0.85240	0.561000	0.74099	TCT	SETDB1	-	NULL	ENSG00000143379		0.498	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	217	0.00	0	C			150921914	150921914	+1	no_errors	ENST00000271640	ensembl	human	known	69_37n	missense	128	21.47	35	SNP	1.000	A
SEZ6	124925	genome.wustl.edu	37	17	27308921	27308921	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:27308921C>T	ENST00000317338.12	-	2	620	c.192G>A	c.(190-192)ttG>ttA	p.L64L	PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000360295.9_Silent_p.L64L|SEZ6_ENST00000335960.6_Silent_p.L64L|SEZ6_ENST00000442608.3_Silent_p.L64L			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	64					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.L64L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			TGAGCAGCTTCAAGGTGGGGG	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											48.0	53.0	51.0					17																	27308921		2089	4229	6318	-	-	-	SO:0001819	synonymous_variant	0			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.192G>A	17.37:g.27308921C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_CUB,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.L64	ENST00000317338.12	37	c.192	CCDS45639.1	17																																																																																			SEZ6	-	NULL	ENSG00000063015		0.607	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	HGNC	protein_coding	OTTHUMT00000397475.3	211	0.00	0	C			27308921	27308921	-1	no_errors	ENST00000317338	ensembl	human	known	69_37n	silent	54	25.00	18	SNP	1.000	T
SH2D3A	10045	genome.wustl.edu	37	19	6754088	6754088	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:6754088C>T	ENST00000245908.6	-	8	1628	c.1359G>A	c.(1357-1359)ctG>ctA	p.L453L	SH2D3A_ENST00000599563.1_5'Flank|SH2D3A_ENST00000437152.3_Silent_p.L360L|CTD-3128G10.6_ENST00000594056.1_RNA	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	453					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)	p.L453L(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						GAGCCCGCATCAGCGGCTTCA	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											27.0	34.0	32.0					19																	6754088		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.1359G>A	19.37:g.6754088C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9R6|B4DRS7|Q9Y2X4	Silent	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,prints_SH2	p.L453	ENST00000245908.6	37	c.1359	CCDS12173.1	19																																																																																			SH2D3A	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25	ENSG00000125731		0.607	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D3A	HGNC	protein_coding	OTTHUMT00000458016.1	74	0.00	0	C	NM_005490		6754088	6754088	-1	no_errors	ENST00000245908	ensembl	human	known	69_37n	silent	44	20.00	11	SNP	1.000	T
SHANK2	22941	genome.wustl.edu	37	11	70805676	70805676	+	Silent	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:70805676G>C	ENST00000338508.4	-	5	650	c.651C>G	c.(649-651)ctC>ctG	p.L217L				Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	0					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.L217L(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CACCATTTTTGAGAGCTTTGA	0.532																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											106.0	95.0	98.0					11																	70805676		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000338508.4:c.651C>G	11.37:g.70805676G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S20*	ENST00000338508.4	37	c.59		11	.	.	.	.	.	.	.	.	.	.	G	7.365	0.625670	0.14257	.	.	ENSG00000162105	ENST00000458632	.	.	.	3.79	2.82	0.32997	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6954	0.28592	0.0:0.3352:0.5252:0.1396	.	.	.	.	X	20	.	.	S	-	2	0	SHANK2	70483324	0.783000	0.28701	0.674000	0.29902	0.764000	0.43329	1.185000	0.32065	1.929000	0.55896	0.549000	0.68633	TCA	SHANK2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000162105		0.532	SHANK2-201	KNOWN	basic|appris_principal	protein_coding	SHANK2	HGNC	protein_coding		136	0.00	0	G	NM_012309		70805676	70805676	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458632	ensembl	human	novel	69_37n	nonsense	68	39.82	45	SNP	0.995	C
SIK3	23387	genome.wustl.edu	37	11	116730052	116730052	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:116730052C>T	ENST00000292055.4	-	19	2411	c.2376G>A	c.(2374-2376)ctG>ctA	p.L792L	SIK3_ENST00000488337.1_5'UTR|SIK3_ENST00000375288.1_Silent_p.L187L|SIK3_ENST00000375300.1_Silent_p.L850L|SIK3_ENST00000542607.1_Silent_p.L792L|SIK3_ENST00000446921.2_Silent_p.L850L|SIK3_ENST00000434315.2_Silent_p.L691L	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	792	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.L898L(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GGGTGGCCATCAGGTTGGTAC	0.612																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											116.0	86.0	96.0					11																	116730052		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2376G>A	11.37:g.116730052C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.D892N	ENST00000292055.4	37	c.2674	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	C	2.461	-0.324085	0.05350	.	.	ENSG00000160584	ENST00000445177;ENST00000446921	.	.	.	5.34	1.35	0.21983	.	.	.	.	.	T	0.52141	0.1716	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42481	-0.9449	4	.	.	.	.	5.6817	0.17780	0.0:0.513:0.1323:0.3547	.	.	.	.	N	892;815	.	.	D	-	1	0	SIK3	116235262	0.979000	0.34478	1.000000	0.80357	0.334000	0.28698	0.137000	0.15995	0.624000	0.30286	-0.258000	0.10820	GAT	SIK3	-	NULL	ENSG00000160584		0.612	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		127	0.00	0	C	NM_025164		116730052	116730052	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445177	ensembl	human	novel	69_37n	missense	17	67.92	36	SNP	0.976	T
SIPA1L3	23094	genome.wustl.edu	37	19	38655162	38655162	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:38655162C>G	ENST00000222345.6	+	15	4333	c.3824C>G	c.(3823-3825)tCc>tGc	p.S1275C		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1275					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)	p.S1275C(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			AACACCCTCTCCAGCAACGCA	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	84.0	86.0					19																	38655162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3824C>G	19.37:g.38655162C>G	ENSP00000222345:p.Ser1275Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TV87	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.S1275C	ENST00000222345.6	37	c.3824	CCDS33007.1	19	.	.	.	.	.	.	.	.	.	.	C	23.2	4.384284	0.82792	.	.	ENSG00000105738	ENST00000222345	T	0.59638	0.25	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.73644	0.3613	M	0.68952	2.095	0.58432	D	0.999996	D	0.89917	1.0	D	0.79108	0.992	T	0.76192	-0.3049	10	0.52906	T	0.07	-33.2025	16.0588	0.80822	0.0:1.0:0.0:0.0	.	1275	O60292	SI1L3_HUMAN	C	1275	ENSP00000222345:S1275C	ENSP00000222345:S1275C	S	+	2	0	SIPA1L3	43347002	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.475000	0.81041	2.055000	0.61198	0.650000	0.86243	TCC	SIPA1L3	-	NULL	ENSG00000105738		0.612	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	HGNC	protein_coding	OTTHUMT00000156294.2	81	0.00	0	C	XM_032278		38655162	38655162	+1	no_errors	ENST00000222345	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	1.000	G
SLC41A1	254428	genome.wustl.edu	37	1	205767101	205767101	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:205767101C>T	ENST00000367137.3	-	7	1937	c.923G>A	c.(922-924)cGa>cAa	p.R308Q	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	308					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GGCTGGACTTCGTCGGGCCAG	0.587																																						dbGAP											0													77.0	74.0	75.0					1																	205767101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.923G>A	1.37:g.205767101C>T	ENSP00000356105:p.Arg308Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	pfam_MgtE_Mg_transptr_membr	p.R308Q	ENST00000367137.3	37	c.923	CCDS30988.1	1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093039	0.36952	.	.	ENSG00000133065	ENST00000367137	T	0.33216	1.42	5.73	4.72	0.59763	.	0.194211	0.49916	N	0.000134	T	0.20088	0.0483	N	0.21545	0.675	0.37505	D	0.916922	B	0.10296	0.003	B	0.14023	0.01	T	0.10359	-1.0633	10	0.19147	T	0.46	-2.1448	11.6321	0.51181	0.0:0.841:0.0:0.159	.	308	Q8IVJ1	S41A1_HUMAN	Q	308	ENSP00000356105:R308Q	ENSP00000356105:R308Q	R	-	2	0	SLC41A1	204033724	0.998000	0.40836	0.995000	0.50966	0.980000	0.70556	0.998000	0.29744	1.256000	0.44068	0.563000	0.77884	CGA	SLC41A1	-	NULL	ENSG00000133065		0.587	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A1	HGNC	protein_coding	OTTHUMT00000087731.1	130	0.76	1	C			205767101	205767101	-1	no_errors	ENST00000367137	ensembl	human	known	69_37n	missense	123	16.22	24	SNP	1.000	T
SLC44A1	23446	genome.wustl.edu	37	9	108123558	108123558	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr9:108123558G>C	ENST00000374720.3	+	8	1094	c.847G>C	c.(847-849)Gaa>Caa	p.E283Q	SLC44A1_ENST00000374724.1_Missense_Mutation_p.E283Q|SLC44A1_ENST00000343170.7_Missense_Mutation_p.E75Q|SLC44A1_ENST00000374723.1_Missense_Mutation_p.E283Q	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	283					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)	p.E283Q(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	TCAGATAGCTGAAGACAATCT	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											143.0	134.0	137.0					9																	108123558		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.847G>C	9.37:g.108123558G>C	ENSP00000363852:p.Glu283Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.E283Q	ENST00000374720.3	37	c.847	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570118	0.28003	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.18960	3.04;3.04;3.04;2.18	5.9	5.9	0.94986	.	0.403496	0.32041	N	0.006671	T	0.10852	0.0265	N	0.14661	0.345	0.29947	N	0.820528	B;B;B	0.24823	0.043;0.043;0.112	B;B;B	0.25614	0.062;0.062;0.01	T	0.22591	-1.0212	10	0.12766	T	0.61	-9.3938	7.7514	0.28898	0.19:0.0:0.81:0.0	.	283;283;283	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	Q	283;283;283;75	ENSP00000363855:E283Q;ENSP00000363852:E283Q;ENSP00000363856:E283Q;ENSP00000341856:E75Q	ENSP00000341856:E75Q	E	+	1	0	SLC44A1	107163379	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.054000	0.41335	2.806000	0.96561	0.655000	0.94253	GAA	SLC44A1	-	NULL	ENSG00000070214		0.458	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	HGNC	protein_coding	OTTHUMT00000053500.1	125	0.00	0	G	NM_080546		108123558	108123558	+1	no_errors	ENST00000374720	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	C
SLC4A5	57835	genome.wustl.edu	37	2	74462323	74462323	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:74462323C>T	ENST00000377634.4	-	22	2737	c.2338G>A	c.(2338-2340)Gac>Aac	p.D780N	SLC4A5_ENST00000358683.4_Intron|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000394019.2_Missense_Mutation_p.D780N|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.D780N|SLC4A5_ENST00000423644.1_Missense_Mutation_p.D780N|SLC4A5_ENST00000346834.4_Missense_Mutation_p.D780N|SLC4A5_ENST00000357822.5_Missense_Mutation_p.D780N|SLC4A5_ENST00000359484.4_Intron					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.D780N(2)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						ATGGAAAAGTCAGCCACCAGG	0.532																																						dbGAP											2	Substitution - Missense(2)	breast(2)											94.0	80.0	85.0					2																	74462323		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.2338G>A	2.37:g.74462323C>T	ENSP00000366861:p.Asp780Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.D780N	ENST00000377634.4	37	c.2338	CCDS1936.1	2	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020102	0.93462	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000423644;ENST00000357822;ENST00000377632;ENST00000377634	D;D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16;-2.16	4.8	4.8	0.61643	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94026	0.8086	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.99;1.0;0.997	D	0.94735	0.7913	10	0.87932	D	0	.	15.7804	0.78255	0.0:1.0:0.0:0.0	.	780;780;780	Q9BY07-4;Q9BY07;Q9BY07-3	.;S4A5_HUMAN;.	N	780	ENSP00000377587:D780N;ENSP00000251768:D780N;ENSP00000395804:D780N;ENSP00000350475:D780N;ENSP00000366859:D780N;ENSP00000366861:D780N	ENSP00000251768:D780N	D	-	1	0	SLC4A5	74315831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.544000	0.82117	2.673000	0.90976	0.650000	0.86243	GAC	SLC4A5	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	ENSG00000188687		0.532	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A5	HGNC	protein_coding	OTTHUMT00000206583.3	275	0.00	0	C			74462323	74462323	-1	no_errors	ENST00000357822	ensembl	human	known	69_37n	missense	198	21.43	54	SNP	1.000	T
SLC4A7	9497	genome.wustl.edu	37	3	27424666	27424666	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:27424666G>C	ENST00000295736.5	-	24	3611	c.3541C>G	c.(3541-3543)Cca>Gca	p.P1181A	SLC4A7_ENST00000435667.2_Missense_Mutation_p.P1066A|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000445684.1_Missense_Mutation_p.P1177A|SLC4A7_ENST00000454389.1_Missense_Mutation_p.P1190A|SLC4A7_ENST00000455077.1_Missense_Mutation_p.P1062A|SLC4A7_ENST00000388777.4_Missense_Mutation_p.P731A|SLC4A7_ENST00000440156.1_Missense_Mutation_p.P1177A|SLC4A7_ENST00000446700.1_Missense_Mutation_p.P1173A|SLC4A7_ENST00000437179.1_Missense_Mutation_p.P1062A|SLC4A7_ENST00000428386.1_Missense_Mutation_p.P1057A	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1181					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.P1181A(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	GCCTTGACTGGAATTTGCAAG	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	111.0	113.0					3																	27424666		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3541C>G	3.37:g.27424666G>C	ENSP00000295736:p.Pro1181Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.P1190A	ENST00000295736.5	37	c.3568	CCDS33721.1	3	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436715	0.43224	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777	D;T;T;T;T;T;T;T;T;T;D	0.81579	-1.51;-1.2;-1.21;-1.27;-1.34;-1.21;-1.27;-1.25;-1.27;-1.25;-1.51	5.41	4.53	0.55603	.	0.058440	0.64402	D	0.000002	T	0.80071	0.4556	L	0.43152	1.355	0.80722	D	1	P;B;P;P;P;P;P;P;B	0.51653	0.777;0.212;0.947;0.93;0.638;0.624;0.51;0.777;0.035	B;B;P;P;B;B;B;B;B	0.49887	0.391;0.114;0.471;0.625;0.23;0.167;0.228;0.391;0.01	T	0.81502	-0.0904	10	0.62326	D	0.03	.	13.8093	0.63252	0.0748:0.0:0.9252:0.0	.	1177;1062;1173;1177;1190;731;1057;1181;1062	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	A	732;1181;1057;1190;1177;1062;1173;1062;1177;1066;731	ENSP00000411031:P732A;ENSP00000295736:P1181A;ENSP00000416368:P1057A;ENSP00000390394:P1190A;ENSP00000414797:P1177A;ENSP00000394252:P1062A;ENSP00000406605:P1173A;ENSP00000407382:P1062A;ENSP00000406804:P1177A;ENSP00000395336:P1066A;ENSP00000373429:P731A	ENSP00000295736:P1181A	P	-	1	0	SLC4A7	27399670	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	6.980000	0.76160	1.264000	0.44198	-0.145000	0.13849	CCA	SLC4A7	-	NULL	ENSG00000033867		0.358	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2	81	0.00	0	G	NM_003615		27424666	27424666	-1	no_errors	ENST00000454389	ensembl	human	known	69_37n	missense	55	50.00	55	SNP	1.000	C
SLC4A9	83697	genome.wustl.edu	37	5	139743671	139743672	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:139743671_139743672insT	ENST00000230993.6	+	10	1394_1395	c.1359_1360insT	c.(1360-1362)gctfs	p.A454fs	SLC4A9_ENST00000507527.1_Frame_Shift_Ins_p.A454fs|SLC4A9_ENST00000432095.2_Frame_Shift_Ins_p.A419fs|SLC4A9_ENST00000506757.2_Frame_Shift_Ins_p.A430fs|SLC4A9_ENST00000506545.1_Frame_Shift_Ins_p.A430fs	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	454	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACAGCAGTGGCTGGAGCTGC	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	Exception_encountered	5.37:g.139743671_139743672insT	ENSP00000230993:p.Ala454fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Frame_Shift_Ins	INS	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.A453fs	ENST00000230993.6	37	c.1359_1360	CCDS58973.1	5																																																																																			SLC4A9	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000113073		0.609	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	SLC4A9	HGNC	protein_coding	OTTHUMT00000372823.1	88	0.00	0	-	NM_031467		139743671	139743672	+1	no_errors	ENST00000230993	ensembl	human	known	69_37n	frame_shift_ins	44	37.14	26	INS	0.004:0.006	T
SLC4A9	83697	genome.wustl.edu	37	5	139743675	139743676	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:139743675_139743676insGT	ENST00000230993.6	+	10	1398_1399	c.1363_1364insGT	c.(1363-1365)ggafs	p.G455fs	SLC4A9_ENST00000507527.1_Frame_Shift_Ins_p.G455fs|SLC4A9_ENST00000432095.2_Frame_Shift_Ins_p.G420fs|SLC4A9_ENST00000506757.2_Frame_Shift_Ins_p.G431fs|SLC4A9_ENST00000506545.1_Frame_Shift_Ins_p.G431fs	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	455	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCAGTGGCTGGAGCTGCCTTC	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	Exception_encountered	5.37:g.139743675_139743676insGT	ENSP00000230993:p.Gly455fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Frame_Shift_Ins	INS	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.A456fs	ENST00000230993.6	37	c.1363_1364	CCDS58973.1	5																																																																																			SLC4A9	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000113073		0.604	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	SLC4A9	HGNC	protein_coding	OTTHUMT00000372823.1	91	0.00	0	-	NM_031467		139743675	139743676	+1	no_errors	ENST00000230993	ensembl	human	known	69_37n	frame_shift_ins	45	36.62	26	INS	1.000:1.000	GT
SLFN14	342618	genome.wustl.edu	37	17	33885048	33885048	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:33885048A>G	ENST00000415846.3	-	1	69	c.34T>C	c.(34-36)Tat>Cat	p.Y12H		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	12							ATP binding (GO:0005524)	p.Y12H(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ACCTCAGGATACGGCATTTCA	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											56.0	43.0	47.0					17																	33885048		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.34T>C	17.37:g.33885048A>G	ENSP00000391101:p.Tyr12His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTW9	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.Y12H	ENST00000415846.3	37	c.34	CCDS45650.1	17	.	.	.	.	.	.	.	.	.	.	A	17.88	3.497513	0.64186	.	.	ENSG00000236320	ENST00000415846	T	0.02369	4.32	4.38	4.38	0.52667	.	.	.	.	.	T	0.15262	0.0368	M	0.83384	2.64	0.09310	N	1	D	0.76494	0.999	D	0.83275	0.996	T	0.03034	-1.1080	9	0.87932	D	0	-11.1983	10.1765	0.42941	1.0:0.0:0.0:0.0	.	12	P0C7P3	SLN14_HUMAN	H	12	ENSP00000391101:Y12H	ENSP00000391101:Y12H	Y	-	1	0	SLFN14	30909161	0.998000	0.40836	0.020000	0.16555	0.009000	0.06853	5.116000	0.64661	1.955000	0.56771	0.533000	0.62120	TAT	SLFN14	-	NULL	ENSG00000236320		0.398	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN14	HGNC	protein_coding	OTTHUMT00000448928.1	79	0.00	0	A	NM_001129820		33885048	33885048	-1	no_errors	ENST00000415846	ensembl	human	known	69_37n	missense	8	77.78	28	SNP	0.011	G
SMG7	9887	genome.wustl.edu	37	1	183511387	183511387	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:183511387G>A	ENST00000347615.2	+	14	1711	c.1592G>A	c.(1591-1593)cGa>cAa	p.R531Q	SMG7_ENST00000456731.2_Missense_Mutation_p.R489Q|SMG7_ENST00000515829.2_Missense_Mutation_p.R531Q|SMG7_ENST00000367537.3_Missense_Mutation_p.R560Q|SMG7_ENST00000508461.1_Missense_Mutation_p.R489Q|SMG7_ENST00000507469.1_Missense_Mutation_p.R531Q	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	531					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.R531Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						TCTACAAGCCGAAATTTAAGC	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											141.0	144.0	143.0					1																	183511387		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1592G>A	1.37:g.183511387G>A	ENSP00000340766:p.Arg531Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	pfam_EST1	p.R531Q	ENST00000347615.2	37	c.1592	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.666348	0.67814	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35;0.35;0.35	5.06	5.06	0.68205	.	1.007660	0.07982	N	0.985718	T	0.40423	0.1116	N	0.24115	0.695	0.46478	D	0.999062	D;P;P;P;P;P	0.54772	0.968;0.921;0.804;0.876;0.913;0.921	B;B;B;B;B;B	0.35039	0.194;0.14;0.085;0.176;0.121;0.14	T	0.50923	-0.8770	10	0.30854	T	0.27	-9.1164	18.7923	0.91978	0.0:0.0:1.0:0.0	.	489;560;489;531;531;531	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	Q	489;560;489;489;531;531;531	ENSP00000407629:R489Q;ENSP00000356507:R560Q;ENSP00000426915:R489Q;ENSP00000388390:R489Q;ENSP00000340766:R531Q;ENSP00000425133:R531Q;ENSP00000421358:R531Q	ENSP00000340766:R531Q	R	+	2	0	SMG7	181778010	1.000000	0.71417	0.962000	0.40283	0.996000	0.88848	5.221000	0.65272	2.491000	0.84063	0.655000	0.94253	CGA	SMG7	-	NULL	ENSG00000116698		0.443	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1	91	0.00	0	G	NM_014837		183511387	183511387	+1	no_errors	ENST00000507469	ensembl	human	known	69_37n	missense	147	18.23	33	SNP	0.999	A
SNF8	11267	genome.wustl.edu	37	17	47022045	47022045	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:47022045C>G	ENST00000502492.1	-	1	434	c.52G>C	c.(52-54)Gag>Cag	p.E18Q	SNF8_ENST00000290330.3_Missense_Mutation_p.E18Q			Q96H20	SNF8_HUMAN	SNF8, ESCRT-II complex subunit	18					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E18Q(1)		breast(1)|endometrium(1)|lung(1)	3						CTGCTCACCTCTGCAAGTTTC	0.677																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	136.0	133.0					17																	47022045		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156102	CCDS11541.1	17q21.32	2013-06-05	2013-06-05		ENSG00000159210	ENSG00000159210			17028	protein-coding gene	gene with protein product		610904	"""SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)"""			10419521, 15329733	Standard	NM_007241		Approved	EAP30, VPS22, Dot3	uc002ioj.3	Q96H20	OTTHUMG00000160569	ENST00000502492.1:c.52G>C	17.37:g.47022045C>G	ENSP00000421380:p.Glu18Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXY3|Q9UN50	Missense_Mutation	SNP	pfam_EAP30,pirsf_ESCRT-2_cplx_Snf8	p.E18Q	ENST00000502492.1	37	c.52	CCDS11541.1	17	.	.	.	.	.	.	.	.	.	.	C	17.41	3.381597	0.61845	.	.	ENSG00000159210	ENST00000502492;ENST00000290330;ENST00000510558	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.42245	0.1194	N	0.12527	0.23	0.80722	D	1	B;B	0.31153	0.264;0.31	B;B	0.27887	0.05;0.084	T	0.49173	-0.8967	9	0.87932	D	0	-27.2163	18.004	0.89204	0.0:1.0:0.0:0.0	.	18;18	Q96H20-2;Q96H20	.;SNF8_HUMAN	Q	18	.	ENSP00000290330:E18Q	E	-	1	0	SNF8	44377044	1.000000	0.71417	0.989000	0.46669	0.671000	0.39405	6.867000	0.75511	2.565000	0.86533	0.561000	0.74099	GAG	SNF8	-	pfam_EAP30,pirsf_ESCRT-2_cplx_Snf8	ENSG00000159210		0.677	SNF8-001	KNOWN	basic|CCDS	protein_coding	SNF8	HGNC	protein_coding	OTTHUMT00000361172.1	49	0.00	0	C	NM_007241		47022045	47022045	-1	no_errors	ENST00000502492	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	1.000	G
SPAG6	9576	genome.wustl.edu	37	10	22678164	22678164	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr10:22678164C>T	ENST00000376624.3	+	7	1070	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W	SPAG6_ENST00000376601.1_Intron|SPAG6_ENST00000376603.2_Missense_Mutation_p.R386W|SPAG6_ENST00000313311.6_Missense_Mutation_p.R310W|SPAG6_ENST00000538630.1_Missense_Mutation_p.R285W|RP11-301N24.3_ENST00000422675.1_RNA	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	310					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.R310W(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						AGGGAACACACGGCTGCCTGG	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											189.0	158.0	168.0					10																	22678164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.928C>T	10.37:g.22678164C>T	ENSP00000365811:p.Arg310Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold,smart_Armadillo	p.R386W	ENST00000376624.3	37	c.1156	CCDS7139.1	10	.	.	.	.	.	.	.	.	.	.	C	17.65	3.441818	0.63067	.	.	ENSG00000077327	ENST00000376624;ENST00000376603;ENST00000538630;ENST00000313311	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.47	-3.59	0.04583	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84252	0.5431	M	0.86740	2.835	0.38724	D	0.953518	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.76575	0.952;0.988;0.979;0.965	D	0.84042	0.0365	10	0.87932	D	0	-16.1145	11.9819	0.53125	0.347:0.5898:0.0632:0.0	.	285;386;310;310	B4DXZ4;O75602-3;O75602-2;O75602	.;.;.;SPAG6_HUMAN	W	310;386;285;310	ENSP00000365811:R310W;ENSP00000365788:R386W;ENSP00000441325:R285W;ENSP00000323599:R310W	ENSP00000323599:R310W	R	+	1	2	SPAG6	22718170	0.374000	0.25081	0.002000	0.10522	0.964000	0.63967	1.060000	0.30530	-0.977000	0.03537	-0.271000	0.10264	CGG	SPAG6	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000077327		0.478	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG6	HGNC	protein_coding	OTTHUMT00000047187.1	199	0.00	0	C			22678164	22678164	+1	no_errors	ENST00000376603	ensembl	human	known	69_37n	missense	129	46.94	115	SNP	0.127	T
SPEF2	79925	genome.wustl.edu	37	5	35814583	35814583	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr5:35814583C>T	ENST00000356031.3	+	37	5551	c.5397C>T	c.(5395-5397)ctC>ctT	p.L1799L	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_Silent_p.L596L	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1799					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)		p.L1799L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAATAATTCTCCAAAGGAGTG	0.294																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	52.0	53.0					5																	35814583		1809	4068	5877	-	-	-	SO:0001819	synonymous_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.5397C>T	5.37:g.35814583C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.L1799	ENST00000356031.3	37	c.5397	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.294	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	96	0.00	0	C	NM_144722		35814583	35814583	+1	no_errors	ENST00000356031	ensembl	human	known	69_37n	silent	156	17.02	32	SNP	0.993	T
SPIB	6689	genome.wustl.edu	37	19	50931497	50931497	+	Silent	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:50931497C>A	ENST00000595883.1	+	6	718	c.693C>A	c.(691-693)ctC>ctA	p.L231L	SPIB_ENST00000596074.1_3'UTR|CTD-2545M3.6_ENST00000599632.1_Missense_Mutation_p.P366T|SPIB_ENST00000439922.2_Silent_p.L140L|SPIB_ENST00000270632.7_3'UTR	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	231					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L231L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CGCGCGCCCTCCGAAACTACG	0.657																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											28.0	23.0	25.0					19																	50931497		2172	4249	6421	-	-	-	SO:0001819	synonymous_variant	0				CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.693C>A	19.37:g.50931497C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9C9|B4DUG6|Q15359	Silent	SNP	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.L231	ENST00000595883.1	37	c.693	CCDS33080.1	19																																																																																			SPIB	-	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	ENSG00000142539		0.657	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIB	HGNC	protein_coding	OTTHUMT00000464744.1	46	0.00	0	C	NM_003121		50931497	50931497	+1	no_errors	ENST00000270632	ensembl	human	known	69_37n	silent	14	36.36	8	SNP	1.000	A
SPIN2A	54466	genome.wustl.edu	37	X	57162736	57162736	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chrX:57162736G>A	ENST00000374908.1	-	1	694	c.295C>T	c.(295-297)Cac>Tac	p.H99Y	SPIN2A_ENST00000374906.3_Missense_Mutation_p.H99Y			Q99865	SPI2A_HUMAN	spindlin family, member 2A	99					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)		p.H99Y(1)		breast(1)|kidney(1)|ovary(1)	3						TCATCTCTGTGAAGTTCCAGT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											16.0	15.0	16.0					X																	57162736		2188	4257	6445	-	-	-	SO:0001583	missense	0			Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.295C>T	X.37:g.57162736G>A	ENSP00000364043:p.His99Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75650|Q6IPW2|Q9UJJ0	Missense_Mutation	SNP	pfam_Spin_Ssty	p.H99Y	ENST00000374908.1	37	c.295	CCDS35312.1	X	.	.	.	.	.	.	.	.	.	.	.	6.091	0.385002	0.11524	.	.	ENSG00000147059	ENST00000374908;ENST00000374906	T;T	0.40756	1.02;1.02	2.5	1.59	0.23543	.	0.128811	0.53938	D	0.000049	T	0.23094	0.0558	N	0.17872	0.535	0.31769	N	0.632352	B	0.02656	0.0	B	0.04013	0.001	T	0.16482	-1.0401	10	0.23302	T	0.38	-9.831	7.8208	0.29286	0.0:0.0:0.751:0.249	.	99	Q99865	SPI2A_HUMAN	Y	99	ENSP00000364043:H99Y;ENSP00000364041:H99Y	ENSP00000364041:H99Y	H	-	1	0	SPIN2A	57179461	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	2.558000	0.45879	0.451000	0.26802	0.422000	0.28245	CAC	SPIN2A	-	pfam_Spin_Ssty	ENSG00000147059		0.423	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN2A	HGNC	protein_coding	OTTHUMT00000058915.1	74	0.00	0	G	NM_019003		57162736	57162736	-1	no_errors	ENST00000374906	ensembl	human	known	69_37n	missense	61	26.51	22	SNP	1.000	A
SRGAP1	57522	genome.wustl.edu	37	12	64488742	64488742	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr12:64488742G>A	ENST00000355086.3	+	13	2094	c.1570G>A	c.(1570-1572)Gaa>Aaa	p.E524K	SRGAP1_ENST00000543397.1_Missense_Mutation_p.E461K|SRGAP1_ENST00000357825.3_Missense_Mutation_p.E501K|RP11-196H14.2_ENST00000535594.1_RNA	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	524	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.E524K(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CCTCATTGTGGAAAGCTGTAT	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											144.0	141.0	142.0					12																	64488742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1570G>A	12.37:g.64488742G>A	ENSP00000347198:p.Glu524Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E524K	ENST00000355086.3	37	c.1570	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	G	31	5.089297	0.94100	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.19105	2.17;2.17;2.17	5.05	5.05	0.67936	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.36002	U	0.002860	T	0.34454	0.0898	L	0.35593	1.075	0.80722	D	1	D;P	0.56287	0.975;0.938	P;P	0.62885	0.908;0.851	T	0.02042	-1.1224	9	.	.	.	.	18.7778	0.91918	0.0:0.0:1.0:0.0	.	524;461	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	K	524;501;461	ENSP00000347198:E524K;ENSP00000350480:E501K;ENSP00000437948:E461K	.	E	+	1	0	SRGAP1	62775009	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.793000	0.85851	2.506000	0.84524	0.460000	0.39030	GAA	SRGAP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000196935		0.368	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	106	0.00	0	G			64488742	64488742	+1	no_errors	ENST00000355086	ensembl	human	known	69_37n	missense	106	25.35	36	SNP	1.000	A
SVEP1	79987	genome.wustl.edu	37	9	113168448	113168448	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr9:113168448C>T	ENST00000401783.2	-	38	9768	c.9432G>A	c.(9430-9432)gtG>gtA	p.V3144V	SVEP1_ENST00000297826.5_Silent_p.V1070V|SVEP1_ENST00000374469.1_Silent_p.V3121V	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3144	Sushi 29. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ACCTGAGTTTCACTTCACTTT	0.498																																						dbGAP											0													81.0	84.0	83.0					9																	113168448		1944	4162	6106	-	-	-	SO:0001819	synonymous_variant	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.9432G>A	9.37:g.113168448C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.V3144	ENST00000401783.2	37	c.9432	CCDS48004.1	9																																																																																			SVEP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.498	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		48	0.00	0	C			113168448	113168448	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	silent	4	80.00	20	SNP	0.853	T
SYCE3	644186	genome.wustl.edu	37	22	50989788	50989789	+	Missense_Mutation	DNP	GG	GG	AC			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr22:50989788_50989789GG>AC	ENST00000406915.3	-	3	199_200	c.152_153CC>GT	c.(151-153)aCC>aGT	p.T51S	SYCE3_ENST00000402753.1_Missense_Mutation_p.T51S	NM_001123225.1	NP_001116697.1	A1L190	SYCE3_HUMAN	synaptonemal complex central element protein 3	51					positive regulation of apoptotic process (GO:0043065)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|chromosome (GO:0005694)|nucleus (GO:0005634)				endometrium(1)|kidney(1)	2						GCGTAGGGTTGGTGCGCATCAC	0.609																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS46733.1	22q13.33	2011-10-05	2011-10-05	2011-10-05	ENSG00000217442	ENSG00000217442			35245	protein-coding gene	gene with protein product	"""testis highly expressed protein 2"""	615775	"""chromosome 22 open reading frame 41"""	C22orf41		21637789	Standard	NM_001123225		Approved		uc010hbe.3	A1L190	OTTHUMG00000150273	ENST00000406915.3:c.152_153delinsAC	22.37:g.50989788_50989789delinsAC	ENSP00000385480:p.Thr51Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Silent|Missense_Mutation	SNP	NULL	p.T51|p.T51S	ENST00000406915.3	37	c.153|c.152	CCDS46733.1	22																																																																																			SYCE3	-	NULL	ENSG00000217442		0.609	SYCE3-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	SYCE3	HGNC	protein_coding	OTTHUMT00000317660.1	17	0.00	0	G	NM_001123225		50989788|50989789	50989788|50989789	-1	no_errors	ENST00000402753	ensembl	human	putative	69_37n	silent|missense	14	39.13|33.33	9|7	SNP	1.000	A|C
TAAR5	9038	genome.wustl.edu	37	6	132910300	132910300	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:132910300C>G	ENST00000258034.2	-	1	577	c.526G>C	c.(526-528)Gag>Cag	p.E176Q		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	176					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)	p.E176Q(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		AGCCTTGTCTCTACCACATCT	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	54.0	54.0					6																	132910300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.526G>C	6.37:g.132910300C>G	ENSP00000258034:p.Glu176Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Trace_amine_rcpt	p.E176Q	ENST00000258034.2	37	c.526	CCDS5156.1	6	.	.	.	.	.	.	.	.	.	.	C	5.950	0.359349	0.11239	.	.	ENSG00000135569	ENST00000258034	T	0.72282	-0.64	5.5	3.72	0.42706	GPCR, rhodopsin-like superfamily (1);	0.463570	0.20934	N	0.083058	T	0.39600	0.1084	L	0.33485	1.01	0.09310	N	1	B	0.30973	0.302	B	0.35073	0.195	T	0.30822	-0.9965	10	0.14252	T	0.57	-4.5184	12.2258	0.54459	0.0:0.8617:0.0:0.1383	.	176	O14804	TAAR5_HUMAN	Q	176	ENSP00000258034:E176Q	ENSP00000258034:E176Q	E	-	1	0	TAAR5	132951993	0.000000	0.05858	0.004000	0.12327	0.645000	0.38454	0.381000	0.20619	0.873000	0.35799	0.655000	0.94253	GAG	TAAR5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000135569		0.527	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR5	HGNC	protein_coding	OTTHUMT00000042257.1	169	0.00	0	C	NM_003967		132910300	132910300	-1	no_errors	ENST00000258034	ensembl	human	known	69_37n	missense	50	65.03	93	SNP	0.101	G
TGS1	96764	genome.wustl.edu	37	8	56699303	56699303	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr8:56699303G>C	ENST00000260129.5	+	4	1323	c.846G>C	c.(844-846)aaG>aaC	p.K282N		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	282					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)	p.K282N(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			CTGATGACAAGAACGATGAAA	0.378																																					Esophageal Squamous(34;275 823 4842 34837 48447)	dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	115.0	117.0					8																	56699303		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.846G>C	8.37:g.56699303G>C	ENSP00000260129:p.Lys282Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.K282N	ENST00000260129.5	37	c.846	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	G	8.548	0.874796	0.17395	.	.	ENSG00000137574	ENST00000260129	T	0.10288	2.89	5.71	2.88	0.33553	.	0.882745	0.09887	N	0.742877	T	0.10423	0.0255	L	0.57536	1.79	0.09310	N	1	B;B	0.31125	0.001;0.309	B;B	0.21917	0.001;0.037	T	0.37079	-0.9721	10	0.19147	T	0.46	-1.7153	7.6085	0.28115	0.0663:0.1205:0.6881:0.125	.	282;282	B2RBJ7;Q96RS0	.;TGS1_HUMAN	N	282	ENSP00000260129:K282N	ENSP00000260129:K282N	K	+	3	2	TGS1	56861857	0.001000	0.12720	0.004000	0.12327	0.129000	0.20672	0.268000	0.18571	0.312000	0.23038	0.655000	0.94253	AAG	TGS1	-	NULL	ENSG00000137574		0.378	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	132	0.00	0	G	NM_024831		56699303	56699303	+1	no_errors	ENST00000260129	ensembl	human	known	69_37n	missense	108	15.62	20	SNP	0.060	C
TIMM22	29928	genome.wustl.edu	37	17	904307	904307	+	Silent	SNP	G	G	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:904307G>C	ENST00000327158.4	+	4	590	c.564G>C	c.(562-564)gcG>gcC	p.A188A		NM_013337.2	NP_037469.2	Q9Y584	TIM22_HUMAN	translocase of inner mitochondrial membrane 22 homolog (yeast)	188					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial inner membrane (GO:0045039)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	protein channel activity (GO:0015266)	p.A188A(1)		breast(2)|endometrium(2)|large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)	7				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TCTCTGCTGCGATTGATTATT	0.527																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											287.0	260.0	269.0					17																	904307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF155330	CCDS32521.1	17p13	2008-02-05	2003-07-22			ENSG00000177370			17317	protein-coding gene	gene with protein product		607251	"""testis-expressed sequence 4"""	TEX4			Standard	NM_013337		Approved		uc002fsc.3	Q9Y584		ENST00000327158.4:c.564G>C	17.37:g.904307G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NWI8	Silent	SNP	pfam_Tim17/Tim22/Tim23/PMP24	p.A188	ENST00000327158.4	37	c.564	CCDS32521.1	17																																																																																			TIMM22	-	pfam_Tim17/Tim22/Tim23/PMP24	ENSG00000177370		0.527	TIMM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM22	HGNC	protein_coding	OTTHUMT00000450107.2	122	0.00	0	G	NM_013337		904307	904307	+1	no_errors	ENST00000327158	ensembl	human	known	69_37n	silent	56	30.86	25	SNP	0.970	C
TLN1	7094	genome.wustl.edu	37	9	35720063	35720063	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr9:35720063C>G	ENST00000314888.9	-	13	1790	c.1437G>C	c.(1435-1437)caG>caC	p.Q479H	TLN1_ENST00000540444.1_Missense_Mutation_p.Q479H	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	479					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.Q479H(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTCGGTGCATCTGGCCGCTGG	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	55.0	56.0					9																	35720063		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.1437G>C	9.37:g.35720063C>G	ENSP00000316029:p.Gln479His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.Q479H	ENST00000314888.9	37	c.1437	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912702	0.52439	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.71103	-0.53;-0.54	5.97	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.72630	0.3484	M	0.82323	2.585	0.80722	D	1	B	0.32620	0.378	B	0.28232	0.087	T	0.77078	-0.2721	10	0.87932	D	0	-14.8802	16.0865	0.81056	0.0:0.9261:0.0:0.0739	.	479	Q9Y490	TLN1_HUMAN	H	479	ENSP00000316029:Q479H;ENSP00000442981:Q479H	ENSP00000316029:Q479H	Q	-	3	2	TLN1	35710063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.077000	0.57598	2.836000	0.97738	0.655000	0.94253	CAG	TLN1	-	NULL	ENSG00000137076		0.637	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	227	0.00	0	C	NM_006289		35720063	35720063	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	missense	15	85.15	86	SNP	1.000	G
TM9SF3	56889	genome.wustl.edu	37	10	98311022	98311022	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr10:98311022C>T	ENST00000371142.4	-	7	1155	c.939G>A	c.(937-939)atG>atA	p.M313I	TM9SF3_ENST00000490192.1_5'UTR	NM_020123.3	NP_064508.3	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3	313						integral component of membrane (GO:0016021)		p.M313I(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)	15		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		AATCTTCTATCATTGCAACAA	0.318																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	138.0	138.0					10																	98311022		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF160213, AF269150	CCDS7450.1	10q24.2	2006-04-12			ENSG00000077147	ENSG00000077147			21529	protein-coding gene	gene with protein product						11530251, 11595169	Standard	NM_020123		Approved	SMBP	uc001kmm.4	Q9HD45	OTTHUMG00000018834	ENST00000371142.4:c.939G>A	10.37:g.98311022C>T	ENSP00000360184:p.Met313Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TB57|Q6UWE7|Q9NWL8|Q9P0G9|Q9UHW8	Missense_Mutation	SNP	pfam_EMP70	p.M313I	ENST00000371142.4	37	c.939	CCDS7450.1	10	.	.	.	.	.	.	.	.	.	.	C	7.732	0.699473	0.15106	.	.	ENSG00000077147	ENST00000371142	T	0.38887	1.11	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.15349	0.0370	N	0.00750	-1.22	0.58432	D	0.999999	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30736	-0.9968	10	0.02654	T	1	-16.9883	18.0329	0.89290	0.0:1.0:0.0:0.0	.	245;313	Q8WUB5;Q9HD45	.;TM9S3_HUMAN	I	313	ENSP00000360184:M313I	ENSP00000360184:M313I	M	-	3	0	TM9SF3	98301012	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.787000	0.69013	2.518000	0.84900	0.650000	0.86243	ATG	TM9SF3	-	pfam_EMP70	ENSG00000077147		0.318	TM9SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF3	HGNC	protein_coding	OTTHUMT00000049610.2	225	0.44	1	C	NM_020123		98311022	98311022	-1	no_errors	ENST00000371142	ensembl	human	known	69_37n	missense	114	32.75	56	SNP	1.000	T
TMCO4	255104	genome.wustl.edu	37	1	20097810	20097810	+	Silent	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:20097810C>A	ENST00000294543.6	-	5	586	c.345G>T	c.(343-345)gtG>gtT	p.V115V	TMCO4_ENST00000375127.1_Silent_p.V115V|TMCO4_ENST00000375122.2_Silent_p.V115V	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	115						integral component of membrane (GO:0016021)		p.V115V(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CCTGAGTGATCACCGTCGGGT	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											122.0	126.0	124.0					1																	20097810		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.345G>T	1.37:g.20097810C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Silent	SNP	pfam_DUF726,pfam_DUF900_hydrolase	p.V115	ENST00000294543.6	37	c.345	CCDS198.1	1																																																																																			TMCO4	-	NULL	ENSG00000162542		0.488	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	HGNC	protein_coding	OTTHUMT00000007658.1	104	0.00	0	C	NM_181719		20097810	20097810	-1	no_errors	ENST00000294543	ensembl	human	known	69_37n	silent	61	18.67	14	SNP	0.043	A
TMEM63B	55362	genome.wustl.edu	37	6	44122458	44122458	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:44122458delA	ENST00000259746.9	+	24	2520	c.2337delA	c.(2335-2337)tcafs	p.S779fs	TMEM63B_ENST00000323267.6_Frame_Shift_Del_p.S779fs			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	779					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)	p.E780fs*28(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			TGCAGGACTCAGAGGTGGACG	0.607																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											49.0	49.0	49.0					6																	44122458		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.2337delA	6.37:g.44122458delA	ENSP00000259746:p.Ser779fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Frame_Shift_Del	DEL	pfam_DUF221	p.E780fs	ENST00000259746.9	37	c.2337	CCDS34461.1	6																																																																																			TMEM63B	-	NULL	ENSG00000137216		0.607	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	55	0.00	0	A	XM_166410		44122458	44122458	+1	no_errors	ENST00000259746	ensembl	human	known	69_37n	frame_shift_del	4	73.33	11	DEL	1.000	-
TMEM63B	55362	genome.wustl.edu	37	6	44122461	44122461	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:44122461delG	ENST00000259746.9	+	24	2523	c.2340delG	c.(2338-2340)gagfs	p.E780fs	TMEM63B_ENST00000323267.6_Frame_Shift_Del_p.E780fs			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	780					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)	p.V781fs*27(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			AGGACTCAGAGGTGGACGGGG	0.607																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											49.0	50.0	49.0					6																	44122461		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.2340delG	6.37:g.44122461delG	ENSP00000259746:p.Glu780fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Frame_Shift_Del	DEL	pfam_DUF221	p.V781fs	ENST00000259746.9	37	c.2340	CCDS34461.1	6																																																																																			TMEM63B	-	NULL	ENSG00000137216		0.607	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	50	0.00	0	G	XM_166410		44122461	44122461	+1	no_errors	ENST00000259746	ensembl	human	known	69_37n	frame_shift_del	4	73.33	11	DEL	0.960	-
TNIP2	79155	genome.wustl.edu	37	4	2747221	2747221	+	Silent	SNP	A	A	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:2747221A>T	ENST00000315423.7	-	3	695	c.609T>A	c.(607-609)atT>atA	p.I203I	TNIP2_ENST00000503235.1_Silent_p.I203I|TNIP2_ENST00000505186.1_5'UTR|TNIP2_ENST00000510267.1_Silent_p.I96I	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2									p.I203I(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCAACTTCTCAATAACACTCT	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											136.0	118.0	124.0					4																	2747221		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.609T>A	4.37:g.2747221A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_EABR	p.I203	ENST00000315423.7	37	c.609	CCDS3362.1	4																																																																																			TNIP2	-	NULL	ENSG00000168884		0.453	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP2	HGNC	protein_coding	OTTHUMT00000206589.5	194	0.00	0	A	NM_024309		2747221	2747221	-1	no_errors	ENST00000315423	ensembl	human	known	69_37n	silent	88	22.61	26	SNP	0.000	T
TOE1	114034	genome.wustl.edu	37	1	45807208	45807208	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:45807208G>A	ENST00000372090.5	+	4	883	c.300G>A	c.(298-300)ctG>ctA	p.L100L	MUTYH_ENST00000448481.1_5'Flank|MUTYH_ENST00000488731.2_5'Flank|TOE1_ENST00000539779.1_Intron|MUTYH_ENST00000531105.1_5'Flank|TOE1_ENST00000495703.1_3'UTR|MUTYH_ENST00000456914.2_5'Flank|MUTYH_ENST00000450313.1_5'Flank|MUTYH_ENST00000372115.3_5'Flank|MUTYH_ENST00000372110.3_5'Flank|MUTYH_ENST00000372104.1_5'Flank|MUTYH_ENST00000372098.3_5'Flank|MUTYH_ENST00000528013.2_5'Flank|MUTYH_ENST00000528332.2_5'Flank|MUTYH_ENST00000529984.1_5'Flank|TESK2_ENST00000486676.1_5'Flank|MUTYH_ENST00000372100.5_5'Flank|MUTYH_ENST00000355498.2_5'Flank|MUTYH_ENST00000354383.6_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	100						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.L100L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					TCCTTTCCCTGGGCCTCGCCT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											65.0	62.0	63.0					1																	45807208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.300G>A	1.37:g.45807208G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEM6|Q6IA35|Q8IWN5|Q9H846	Silent	SNP	pfam_RNase_CAF1,pfam_Znf_CCCH,superfamily_RNaseH-like_dom	p.L100	ENST00000372090.5	37	c.300	CCDS521.1	1																																																																																			TOE1	-	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	ENSG00000132773		0.572	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOE1	HGNC	protein_coding	OTTHUMT00000020517.1	128	0.00	0	G	NM_025077		45807208	45807208	+1	no_errors	ENST00000372090	ensembl	human	known	69_37n	silent	46	29.23	19	SNP	1.000	A
TOPORS	10210	genome.wustl.edu	37	9	32543678	32543678	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr9:32543678G>A	ENST00000360538.2	-	3	961	c.845C>T	c.(844-846)tCa>tTa	p.S282L	TOPORS_ENST00000379858.1_Missense_Mutation_p.S217L	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	282	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S282L(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		AAATTCAGCTGAAATATCCCT	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	64.0	62.0					9																	32543678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.845C>T	9.37:g.32543678G>A	ENSP00000353735:p.Ser282Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S282L	ENST00000360538.2	37	c.845	CCDS6527.1	9	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741624	0.49151	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.22539	1.95;1.98	5.93	5.03	0.67393	.	0.000000	0.41823	D	0.000810	T	0.30885	0.0779	M	0.79805	2.47	0.54753	D	0.999985	B	0.23735	0.09	B	0.25506	0.061	T	0.13361	-1.0512	10	0.87932	D	0	-15.9011	14.2231	0.65841	0.0728:0.0:0.9272:0.0	.	282	Q9NS56	TOPRS_HUMAN	L	282;217	ENSP00000353735:S282L;ENSP00000369187:S217L	ENSP00000353735:S282L	S	-	2	0	TOPORS	32533678	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.439000	0.97543	1.511000	0.48818	-0.150000	0.13652	TCA	TOPORS	-	NULL	ENSG00000197579		0.383	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS	HGNC	protein_coding	OTTHUMT00000052007.1	49	0.00	0	G	NM_005802		32543678	32543678	-1	no_errors	ENST00000360538	ensembl	human	known	69_37n	missense	2	92.86	26	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000413465.2_Missense_Mutation_p.C238Y|TP53_ENST00000420246.2_Missense_Mutation_p.C238Y|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	GRCh37	CM034930	TP53	M							132.0	103.0	113.0					17																	7577568		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	17.37:g.7577568C>T	ENSP00000269305:p.Cys238Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238Y	ENST00000269305.4	37	c.713	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	232	0.00	0	C	NM_000546		7577568	7577568	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	23	76.77	76	SNP	1.000	T
TRIM71	131405	genome.wustl.edu	37	3	32932211	32932211	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:32932211C>A	ENST00000383763.5	+	4	1578	c.1515C>A	c.(1513-1515)ttC>ttA	p.F505L		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	505					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F505L(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGCCTCCTTCACAGTCATTG	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											48.0	51.0	50.0					3																	32932211		2078	4202	6280	-	-	-	SO:0001583	missense	0				CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1515C>A	3.37:g.32932211C>A	ENSP00000373272:p.Phe505Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.F505L	ENST00000383763.5	37	c.1515	CCDS43060.1	3	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348877	0.41599	.	.	ENSG00000206557	ENST00000383763	D	0.93307	-3.2	5.9	2.13	0.27403	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94202	0.8139	M	0.84219	2.685	0.58432	D	0.999995	D	0.56746	0.977	P	0.57152	0.814	D	0.92343	0.5883	10	0.08179	T	0.78	-34.448	10.2335	0.43268	0.0:0.7279:0.0:0.2721	.	505	Q2Q1W2	LIN41_HUMAN	L	505	ENSP00000373272:F505L	ENSP00000373272:F505L	F	+	3	2	TRIM71	32907215	1.000000	0.71417	0.999000	0.59377	0.718000	0.41266	2.071000	0.41500	0.854000	0.35336	-0.145000	0.13849	TTC	TRIM71	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000206557		0.602	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM71	HGNC	protein_coding	OTTHUMT00000341565.3	47	0.00	0	C	NM_001039111		32932211	32932211	+1	no_errors	ENST00000383763	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	A
TRMT2A	27037	genome.wustl.edu	37	22	20102205	20102205	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr22:20102205C>G	ENST00000252136.7	-	7	1513	c.1125G>C	c.(1123-1125)aaG>aaC	p.K375N	TRMT2A_ENST00000404751.3_Missense_Mutation_p.K375N|RANBP1_ENST00000430524.1_5'Flank|RANBP1_ENST00000402752.1_5'Flank|TRMT2A_ENST00000439169.2_Missense_Mutation_p.K375N|TRMT2A_ENST00000492988.1_Splice_Site|RANBP1_ENST00000331821.3_5'Flank|TRMT2A_ENST00000403707.3_Missense_Mutation_p.K375N|AC006547.8_ENST00000412713.1_RNA	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	Q8IZ69	TRM2A_HUMAN	tRNA methyltransferase 2 homolog A (S. cerevisiae)	375					RNA processing (GO:0006396)		nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)	p.K375N(1)		breast(2)|endometrium(2)|lung(5)	9						GGCTAGGAGTCTTTCTGTGGG	0.652																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	76.0	76.0					22																	20102205		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017184	CCDS13774.1, CCDS58793.1	22q11.21	2014-02-12	2012-06-12		ENSG00000099899	ENSG00000099899			24974	protein-coding gene	gene with protein product	"""HpaII tiny fragments locus 9C"""	611151				9417108, 18075473	Standard	NM_022727		Approved	HTF9C	uc002zrl.2	Q8IZ69	OTTHUMG00000150454	ENST00000252136.7:c.1125G>C	22.37:g.20102205C>G	ENSP00000252136:p.Lys375Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX25|Q32P57|Q96ME6|Q9H732	Splice_Site	SNP	-	NULL	ENST00000252136.7	37	c.NULL	CCDS13774.1	22	.	.	.	.	.	.	.	.	.	.	C	15.81	2.942937	0.53079	.	.	ENSG00000099899	ENST00000252136;ENST00000403707;ENST00000404751;ENST00000439169	T;T;T	0.46063	0.88;0.88;0.89	4.35	3.33	0.38152	.	0.102688	0.64402	D	0.000003	T	0.31702	0.0805	L	0.46157	1.445	0.42308	D	0.992202	B;B;B	0.32918	0.149;0.39;0.034	B;B;B	0.29176	0.032;0.099;0.014	T	0.14172	-1.0482	10	0.48119	T	0.1	-41.3476	7.7335	0.28799	0.0:0.7558:0.0:0.2442	.	375;375;375	F2Z2W7;Q8IZ69-2;Q8IZ69	.;.;TRM2A_HUMAN	N	375	ENSP00000252136:K375N;ENSP00000385807:K375N;ENSP00000395738:K375N	ENSP00000252136:K375N	K	-	3	2	TRMT2A	18482205	0.977000	0.34250	1.000000	0.80357	0.967000	0.64934	0.149000	0.16243	1.054000	0.40438	0.561000	0.74099	AAG	TRMT2A	-	-	ENSG00000099899		0.652	TRMT2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT2A	HGNC	protein_coding	OTTHUMT00000318168.3	40	0.00	0	C	NM_022727		20102205	20102205	-1	no_errors	ENST00000492988	ensembl	human	known	69_37n	splice_site	14	36.36	8	SNP	1.000	G
TRPM8	79054	genome.wustl.edu	37	2	234891970	234891970	+	Intron	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:234891970C>T	ENST00000324695.4	+	20	2801				TRPM8_ENST00000433712.2_Intron	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8						calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GAAGCACGCGCGTGAAACGGA	0.512																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2761+102C>T	2.37:g.234891970C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.R128C	ENST00000324695.4	37	c.382	CCDS33407.1	2																																																																																			TRPM8	-	NULL	ENSG00000144481		0.512	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	HGNC	protein_coding	OTTHUMT00000131005.4	74	0.00	0	C	NM_024080		234891970	234891970	+1	no_start_codon	ENST00000439148	ensembl	human	known	69_37n	missense	16	33.33	8	SNP	0.000	T
TRPV2	51393	genome.wustl.edu	37	17	16327010	16327010	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr17:16327010C>T	ENST00000338560.7	+	5	1252	c.853C>T	c.(853-855)Cag>Tag	p.Q285*	TRPV2_ENST00000577397.1_Intron	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	285	Required for interaction with SLC50A1. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)	p.Q285*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CCCTACCGTGCAGCTTGAGGA	0.607																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											65.0	63.0	64.0					17																	16327010		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.853C>T	17.37:g.16327010C>T	ENSP00000342222:p.Gln285*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NML2|A8K0Z0|Q9Y670	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	p.Q285*	ENST00000338560.7	37	c.853	CCDS32576.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.092557|6.092557	0.97276|0.97276	.|.	.|.	ENSG00000187688|ENSG00000187688	ENST00000455666|ENST00000338560	.|.	.|.	.|.	6.17|6.17	0.0891|0.0891	0.14457|0.14457	.|.	.|0.255070	.|0.45361	.|D	.|0.000376	T|.	0.13927|.	0.0337|.	.|.	.|.	.|.	0.32129|0.32129	N|N	0.586973|0.586973	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35574|.	-0.9783|.	4|.	.|0.02654	.|T	.|1	-14.0311|-14.0311	4.8874|4.8874	0.13710|0.13710	0.5427:0.282:0.0983:0.077|0.5427:0.282:0.0983:0.077	.|.	.|.	.|.	.|.	V|X	242|285	.|.	.|ENSP00000342222:Q285X	A|Q	+|+	2|1	0|0	TRPV2|TRPV2	16267735|16267735	0.656000|0.656000	0.27385|0.27385	0.837000|0.837000	0.33122|0.33122	0.518000|0.518000	0.34316|0.34316	1.212000|1.212000	0.32394|0.32394	0.132000|0.132000	0.18615|0.18615	0.655000|0.655000	0.94253|0.94253	GCA|CAG	TRPV2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000187688		0.607	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	HGNC	protein_coding	OTTHUMT00000130464.2	100	0.00	0	C	NM_016113		16327010	16327010	+1	no_errors	ENST00000338560	ensembl	human	known	69_37n	nonsense	43	24.56	14	SNP	0.557	T
TSHZ1	10194	genome.wustl.edu	37	18	72998610	72998610	+	Silent	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr18:72998610C>G	ENST00000580243.1	+	2	1596	c.1248C>G	c.(1246-1248)ctC>ctG	p.L416L	TSHZ1_ENST00000322038.5_Silent_p.L371L			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	416					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L371L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		CGCAGATCCTCAAGTGCATGG	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											72.0	72.0	72.0					18																	72998610		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1248C>G	18.37:g.72998610C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O60534|Q4LE29|Q53EU4	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.L416	ENST00000580243.1	37	c.1248		18																																																																																			TSHZ1	-	smart_Znf_C2H2-like	ENSG00000179981		0.597	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	141	0.00	0	C	NM_005786		72998610	72998610	+1	no_errors	ENST00000580243	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	1.000	G
TTC21A	199223	genome.wustl.edu	37	3	39156150	39156150	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:39156150G>A	ENST00000431162.2	+	6	767	c.633G>A	c.(631-633)ggG>ggA	p.G211G	TTC21A_ENST00000301819.6_Silent_p.G211G|TTC21A_ENST00000440121.1_Silent_p.G170G			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	211								p.G211G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TGACTTCAGGGAGCTTCCTGC	0.542																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											115.0	114.0	114.0					3																	39156150		2038	4181	6219	-	-	-	SO:0001819	synonymous_variant	0			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.633G>A	3.37:g.39156150G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	NULL	p.E78K	ENST00000431162.2	37	c.232	CCDS46800.1	3																																																																																			TTC21A	-	NULL	ENSG00000168026		0.542	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC21A	HGNC	protein_coding	OTTHUMT00000377829.1	93	0.00	0	G	NM_145755		39156150	39156150	+1	no_errors	ENST00000431559	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	0.000	A
UGT1A1	54658	genome.wustl.edu	37	2	234669446	234669446	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr2:234669446C>T	ENST00000608383.1	+	1	513	c.513C>T	c.(511-513)ttC>ttT	p.F171F	UGT1A6_ENST00000373424.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A1_ENST00000360418.3_Silent_p.F171F|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A8_ENST00000305208.5_Silent_p.F171F|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A5_ENST00000373414.3_Intron			P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	171			Missing (in CN2). {ECO:0000269|PubMed:17229650}.		acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)	p.F171F(1)		breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	CTGTATTCTTCTTGCATGCAC	0.557																																						dbGAP											1	Substitution - coding silent(1)	breast(1)	GRCh37	CD931056	UGT1A1	D							153.0	142.0	146.0					2																	234669446		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000608383.1:c.513C>T	2.37:g.234669446C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJC3|B8K286	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.F171	ENST00000608383.1	37	c.513	CCDS2510.1	2																																																																																			UGT1A1	-	pfam_UDP_glucos_trans	ENSG00000241635		0.557	UGT1A1-203	KNOWN	basic|CCDS	protein_coding	UGT1A1	HGNC	protein_coding		134	0.00	0	C			234669446	234669446	+1	no_errors	ENST00000305208	ensembl	human	known	69_37n	silent	52	26.76	19	SNP	0.481	T
XPC	7508	genome.wustl.edu	37	3	14190368	14190368	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr3:14190368C>T	ENST00000285021.7	-	12	2410	c.2196G>A	c.(2194-2196)ctG>ctA	p.L732L	XPC_ENST00000449060.2_Silent_p.L695L|AC093495.4_ENST00000428681.3_RNA|AC093495.4_ENST00000420253.1_RNA	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	732	DNA-binding; preference for heteroduplex DNA.|Interaction with RAD23B.|Minimal sensor domain involved in damage recognition.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.L732L(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGTAGCCAAACAGGCCCAGGT	0.607			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Substitution - coding silent(1)	breast(1)											53.0	59.0	57.0					3																	14190368		1971	4151	6122	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.2196G>A	3.37:g.14190368C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Silent	SNP	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.L732	ENST00000285021.7	37	c.2196	CCDS46763.1	3																																																																																			XPC	-	pfam_Rad4_beta-hairpin_dom2,tigrfam_DNA_repair_Rad4_subgr	ENSG00000154767		0.607	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	HGNC	protein_coding	OTTHUMT00000340517.3	218	0.00	0	C	NM_004628		14190368	14190368	-1	no_errors	ENST00000285021	ensembl	human	known	69_37n	silent	78	18.75	18	SNP	0.997	T
ZBTB3	79842	genome.wustl.edu	37	11	62520830	62520830	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:62520830C>T	ENST00000394807.3	-	2	582	c.457G>A	c.(457-459)Gcc>Acc	p.A153T		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A153T(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						AAGTAGCTGGCAGCTGCCAGC	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	83.0	82.0					11																	62520830		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.457G>A	11.37:g.62520830C>T	ENSP00000378286:p.Ala153Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A153T	ENST00000394807.3	37	c.457	CCDS8034.1	11	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710792	0.89112	.	.	ENSG00000185670	ENST00000394807;ENST00000527994	D;D	0.87650	-2.28;-2.28	5.74	5.74	0.90152	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.95341	0.8488	M	0.93978	3.48	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	D	0.96111	0.9077	10	0.87932	D	0	.	17.4202	0.87513	0.0:1.0:0.0:0.0	.	153	Q9H5J0	ZBTB3_HUMAN	T	153;103	ENSP00000378286:A153T;ENSP00000432731:A103T	ENSP00000378286:A153T	A	-	1	0	ZBTB3	62277406	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.700000	0.92200	0.561000	0.74099	GCC	ZBTB3	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000185670		0.572	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB3	HGNC	protein_coding	OTTHUMT00000395342.1	61	0.00	0	C	NM_024784		62520830	62520830	-1	no_errors	ENST00000394807	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	1.000	T
ZBTB16	7704	genome.wustl.edu	37	11	113935256	113935256	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr11:113935256G>A	ENST00000335953.4	+	2	1614	c.1234G>A	c.(1234-1236)Gag>Aag	p.E412K	ZBTB16_ENST00000392996.2_Missense_Mutation_p.E412K	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	412					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E412K(1)		central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GTGTGGGGTCGAGCTTCCTGA	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											78.0	73.0	75.0					11																	113935256		2201	4296	6497	-	-	-	SO:0001583	missense	0			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1234G>A	11.37:g.113935256G>A	ENSP00000338157:p.Glu412Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAL4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E412K	ENST00000335953.4	37	c.1234	CCDS8367.1	11	.	.	.	.	.	.	.	.	.	.	G	15.20	2.764412	0.49574	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.09630	2.96;2.96	5.2	5.2	0.72013	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.104317	0.64402	D	0.000004	T	0.07007	0.0178	L	0.27053	0.805	0.54753	D	0.999987	P;P	0.44044	0.685;0.825	B;B	0.32677	0.089;0.15	T	0.27905	-1.0060	10	0.40728	T	0.16	-10.8894	12.2689	0.54695	0.0773:0.0:0.9227:0.0	.	412;417	Q05516;Q59H43	ZBT16_HUMAN;.	K	412;412;289	ENSP00000338157:E412K;ENSP00000376721:E412K	ENSP00000309507:E289K	E	+	1	0	ZBTB16	113440466	1.000000	0.71417	0.975000	0.42487	0.995000	0.86356	6.172000	0.71932	2.700000	0.92200	0.563000	0.77884	GAG	ZBTB16	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000109906		0.627	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1	102	0.00	0	G	NM_006006		113935256	113935256	+1	no_errors	ENST00000335953	ensembl	human	known	69_37n	missense	6	68.42	13	SNP	0.999	A
ZBTB49	166793	genome.wustl.edu	37	4	4301738	4301738	+	Silent	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr4:4301738C>T	ENST00000337872.4	+	2	187	c.66C>T	c.(64-66)ggC>ggT	p.G22G	ZBTB49_ENST00000538529.1_5'UTR|ZBTB49_ENST00000355834.3_Silent_p.G22G	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	22					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G22G(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						GAATCCAAGGCCTGCTTTGTG	0.473																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											178.0	164.0	168.0					4																	4301738		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.66C>T	4.37:g.4301738C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q59FJ4|Q5EBN0|Q8TB80	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G22	ENST00000337872.4	37	c.66	CCDS3375.1	4																																																																																			ZBTB49	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold	ENSG00000168826		0.473	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB49	HGNC	protein_coding	OTTHUMT00000206688.3	194	0.00	0	C	NM_145291		4301738	4301738	+1	no_errors	ENST00000337872	ensembl	human	known	69_37n	silent	172	19.07	41	SNP	0.995	T
ZEB1	6935	genome.wustl.edu	37	10	31815999	31815999	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr10:31815999G>A	ENST00000320985.10	+	9	3292	c.3182G>A	c.(3181-3183)gGg>gAg	p.G1061E	ZEB1_ENST00000361642.5_Missense_Mutation_p.G1062E|ZEB1_ENST00000542815.3_Missense_Mutation_p.G994E|ZEB1_ENST00000560721.2_Missense_Mutation_p.G1041E|ZEB1_ENST00000446923.2_Missense_Mutation_p.G1045E			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	1061	Glu-rich (acidic).				cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.G1061E(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				aaaccacaaggggatgaggaa	0.443																																					Ovarian(40;423 959 14296 36701 49589)	dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	94.0	93.0					10																	31815999		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.3182G>A	10.37:g.31815999G>A	ENSP00000319248:p.Gly1061Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.G1062E	ENST00000320985.10	37	c.3185	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	G	3.495	-0.102942	0.06967	.	.	ENSG00000148516	ENST00000542879;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T	0.12984	2.94;2.63;2.67;2.63;2.68	5.38	-1.84	0.07809	.	2.186940	0.02233	N	0.065022	T	0.06600	0.0169	N	0.24115	0.695	0.25961	N	0.982625	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.001;0.001;0.001	T	0.18650	-1.0330	10	0.02654	T	1	0.0512	0.2729	0.00234	0.3647:0.146:0.1946:0.2947	.	994;1045;1041;1062;1061	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	E	843;1062;1056;994;1061;1041;952;1045	ENSP00000444282:G843E;ENSP00000354487:G1062E;ENSP00000444891:G994E;ENSP00000319248:G1061E;ENSP00000391612:G1045E	ENSP00000319248:G1061E	G	+	2	0	ZEB1	31856005	0.893000	0.30496	0.152000	0.22495	0.910000	0.53928	0.350000	0.20079	-0.003000	0.14444	0.650000	0.86243	GGG	ZEB1	-	NULL	ENSG00000148516		0.443	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2	802	0.00	0	G	NM_030751		31815999	31815999	+1	no_errors	ENST00000361642	ensembl	human	known	69_37n	missense	494	42.51	366	SNP	0.970	A
ZMYM4	9202	genome.wustl.edu	37	1	35835660	35835660	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:35835660C>T	ENST00000314607.6	+	6	951	c.871C>T	c.(871-873)Caa>Taa	p.Q291*	ZMYM4_ENST00000373297.2_Nonsense_Mutation_p.Q291*|ZMYM4_ENST00000482131.1_3'UTR	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	291					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Q291*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCAAAAAACTCAAGAGGGGGA	0.353																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											69.0	69.0	69.0					1																	35835660		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.871C>T	1.37:g.35835660C>T	ENSP00000322915:p.Gln291*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Nonsense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH	p.Q291*	ENST00000314607.6	37	c.871	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.02|19.02	3.745210|3.745210	0.69418|0.69418	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	.|.	.|.	.|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.308175|.	0.30501|.	N|.	0.009486|.	.|T	.|0.63402	.|0.2508	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69176	.|-0.5214	.|3	0.40728|.	T|.	0.16|.	-10.7763|-10.7763	12.9489|12.9489	0.58388|0.58388	0.0:0.926:0.0:0.074|0.0:0.926:0.0:0.074	.|.	.|.	.|.	.|.	X|L	291|39	.|.	ENSP00000322915:Q291X|.	Q|S	+|+	1|2	0|0	ZMYM4|ZMYM4	35608247|35608247	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.761000|3.761000	0.55242|0.55242	2.652000|2.652000	0.90054|0.90054	0.591000|0.591000	0.81541|0.81541	CAA|TCA	ZMYM4	-	NULL	ENSG00000146463		0.353	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3	138	0.00	0	C	NM_005095		35835660	35835660	+1	no_errors	ENST00000314607	ensembl	human	known	69_37n	nonsense	74	22.92	22	SNP	1.000	T
ZNF184	7738	genome.wustl.edu	37	6	27419990	27419990	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr6:27419990C>T	ENST00000211936.6	-	6	1632	c.1348G>A	c.(1348-1350)Gaa>Aaa	p.E450K	ZNF184_ENST00000377419.1_Missense_Mutation_p.E450K	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	450					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E450K(1)		breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TTTCCACATTCTGCACAATCA	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	85.0	86.0					6																	27419990		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1348G>A	6.37:g.27419990C>T	ENSP00000211936:p.Glu450Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E450K	ENST00000211936.6	37	c.1348	CCDS4624.1	6	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843765	0.71488	.	.	ENSG00000096654	ENST00000211936;ENST00000377419	T;T	0.07327	3.2;3.2	5.27	5.27	0.74061	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000112	T	0.03915	0.0110	L	0.35793	1.09	0.26750	N	0.970217	P	0.39060	0.657	B	0.36719	0.231	T	0.20672	-1.0268	10	0.49607	T	0.09	.	16.4094	0.83703	0.0:1.0:0.0:0.0	.	450	Q99676	ZN184_HUMAN	K	450	ENSP00000211936:E450K;ENSP00000366636:E450K	ENSP00000211936:E450K	E	-	1	0	ZNF184	27527969	0.000000	0.05858	0.979000	0.43373	0.997000	0.91878	-0.128000	0.10531	2.744000	0.94065	0.655000	0.94253	GAA	ZNF184	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000096654		0.418	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF184	HGNC	protein_coding	OTTHUMT00000040146.1	111	0.00	0	C	NM_007149		27419990	27419990	-1	no_errors	ENST00000211936	ensembl	human	known	69_37n	missense	93	24.39	30	SNP	0.508	T
ZNF492	57615	genome.wustl.edu	37	19	22847909	22847909	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:22847909G>A	ENST00000456783.2	+	4	1682	c.1438G>A	c.(1438-1440)Gaa>Aaa	p.E480K	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E480K(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				CTACAAGTGTGAAGAATGTGG	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	39.0	35.0					19																	22847909		2028	4248	6276	-	-	-	SO:0001583	missense	0			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.1438G>A	19.37:g.22847909G>A	ENSP00000413660:p.Glu480Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08EI7|Q08EI8	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E480K	ENST00000456783.2	37	c.1438	CCDS46032.1	19	.	.	.	.	.	.	.	.	.	.	.	4.964	0.179152	0.09443	.	.	ENSG00000229676	ENST00000456783	T	0.06608	3.28	1.12	-0.302	0.12796	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03434	0.0099	N	0.16066	0.365	0.09310	N	1	B	0.27316	0.175	B	0.33339	0.162	T	0.47169	-0.9138	9	0.25106	T	0.35	.	1.3867	0.02242	0.3425:0.0:0.312:0.3455	.	480	Q9P255	ZN492_HUMAN	K	480	ENSP00000413660:E480K	ENSP00000413660:E480K	E	+	1	0	ZNF492	22639749	0.000000	0.05858	0.343000	0.25615	0.351000	0.29236	-3.498000	0.00451	0.269000	0.21961	0.274000	0.19336	GAA	ZNF492	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000229676		0.383	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF492	HGNC	protein_coding	OTTHUMT00000464581.1	61	0.00	0	G	NM_020855		22847909	22847909	+1	no_errors	ENST00000456783	ensembl	human	known	69_37n	missense	38	37.70	23	SNP	0.151	A
ZNF536	9745	genome.wustl.edu	37	19	31039333	31039334	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:31039333_31039334insC	ENST00000355537.3	+	4	2954_2955	c.2807_2808insC	c.(2806-2811)atgaagfs	p.MK936fs		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	936					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.M936fs*8(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GAGAAGGACATGAAGGACAAAG	0.515																																						dbGAP											1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		Exception_encountered	19.37:g.31039333_31039334insC	ENSP00000347730:p.Met936fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M936fs	ENST00000355537.3	37	c.2807_2808	CCDS32984.1	19																																																																																			ZNF536	-	NULL	ENSG00000198597		0.515	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	60	0.00	0	-	NM_014717		31039333	31039334	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	frame_shift_ins	22	29.03	9	INS	0.055:0.880	C
ZNF534	147658	genome.wustl.edu	37	19	52942228	52942228	+	Silent	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:52942228G>A	ENST00000332323.6	+	4	1615	c.1554G>A	c.(1552-1554)caG>caA	p.Q518Q	ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Silent_p.Q505Q	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q518Q(1)		central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						TCTTCCGTCAGAATTCACACC	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											53.0	49.0	50.0					19																	52942228		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1554G>A	19.37:g.52942228G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76KX9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q518	ENST00000332323.6	37	c.1554	CCDS46165.1	19																																																																																			ZNF534	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198633		0.423	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000460877.1	146	0.00	0	G	NM_182512		52942228	52942228	+1	no_errors	ENST00000332323	ensembl	human	known	69_37n	silent	69	37.84	42	SNP	0.000	A
ZNF805	390980	genome.wustl.edu	37	19	57764450	57764450	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:57764450G>A	ENST00000414468.2	+	4	263	c.263G>A	c.(262-264)gGa>gAa	p.G88E	ZNF805_ENST00000354309.4_5'UTR|ZNF805_ENST00000535550.1_5'UTR	NM_001023563.3	NP_001018857.2	Q5CZA5	ZN805_HUMAN	zinc finger protein 805	88					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G88E(1)		breast(1)|endometrium(3)|kidney(3)|lung(1)|stomach(1)	9						GGTGACAAAGGAAAACCCAAG	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	79.0	81.0					19																	57764450		692	1591	2283	-	-	-	SO:0001583	missense	0			AF024708	CCDS46207.1, CCDS46208.1	19q13.43	2013-01-08			ENSG00000204524	ENSG00000204524		"""Zinc fingers, C2H2-type"", ""-"""	23272	protein-coding gene	gene with protein product							Standard	NM_001023563		Approved		uc010ygt.2	Q5CZA5		ENST00000414468.2:c.263G>A	19.37:g.57764450G>A	ENSP00000412999:p.Gly88Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNM5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G88E	ENST00000414468.2	37	c.263	CCDS46207.1	19	.	.	.	.	.	.	.	.	.	.	G	0.224	-1.026348	0.02045	.	.	ENSG00000204524	ENST00000414468	T	0.25414	1.8	4.06	-2.62	0.06152	.	.	.	.	.	T	0.15003	0.0362	L	0.43152	1.355	0.09310	N	0.999996	B	0.11235	0.004	B	0.09377	0.004	T	0.39099	-0.9630	9	0.09843	T	0.71	.	4.5269	0.11986	0.0957:0.4856:0.2804:0.1383	.	88	Q5CZA5	ZN805_HUMAN	E	88	ENSP00000412999:G88E	ENSP00000412999:G88E	G	+	2	0	ZNF805	62456262	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.407000	0.07178	-0.259000	0.09432	-0.274000	0.10170	GGA	ZNF805	-	NULL	ENSG00000204524		0.418	ZNF805-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF805	HGNC	protein_coding	OTTHUMT00000465722.1	154	0.00	0	G	NM_001023563		57764450	57764450	+1	no_errors	ENST00000414468	ensembl	human	known	69_37n	missense	40	61.82	68	SNP	0.001	A
ZNF549	256051	genome.wustl.edu	37	19	58050005	58050005	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr19:58050005C>G	ENST00000376233.3	+	4	1814	c.1633C>G	c.(1633-1635)Ctt>Gtt	p.L545V	ZNF549_ENST00000240719.3_Missense_Mutation_p.L532V|ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L532V(1)|p.L545V(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAAAAGACTTCTTGAGCACCA	0.443																																						dbGAP											2	Substitution - Missense(2)	breast(2)											67.0	70.0	69.0					19																	58050005		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.1633C>G	19.37:g.58050005C>G	ENSP00000365407:p.Leu545Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L545V	ENST00000376233.3	37	c.1633	CCDS56106.1	19	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792761	0.31685	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.07800	3.16;3.16	2.6	-5.19	0.02832	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03053	0.0090	N	0.11106	0.095	0.09310	N	1	B;B	0.15719	0.007;0.014	B;B	0.20955	0.011;0.032	T	0.42816	-0.9429	9	0.24483	T	0.36	.	0.6373	0.00804	0.4314:0.1847:0.1199:0.264	.	545;532	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	V	532;545	ENSP00000240719:L532V;ENSP00000365407:L545V	ENSP00000240719:L532V	L	+	1	0	ZNF549	62741817	0.000000	0.05858	0.000000	0.03702	0.963000	0.63663	-4.123000	0.00290	-1.695000	0.01423	0.585000	0.79938	CTT	ZNF549	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000121406		0.443	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF549	HGNC	protein_coding	OTTHUMT00000466780.1	158	0.00	0	C	NM_153263		58050005	58050005	+1	no_errors	ENST00000376233	ensembl	human	known	69_37n	missense	81	14.74	14	SNP	0.000	G
ZNF862	643641	genome.wustl.edu	37	7	149558908	149558908	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr7:149558908delG	ENST00000223210.4	+	7	2904	c.2659delG	c.(2659-2661)gggfs	p.G887fs	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	887					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.E890fs*23(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						TCACCAGGCAGGGCCCAAAGA	0.612																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											34.0	37.0	36.0					7																	149558908		2089	4209	6298	-	-	-	SO:0001589	frameshift_variant	0			AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.2659delG	7.37:g.149558908delG	ENSP00000223210:p.Gly887fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUL8	Frame_Shift_Del	DEL	pfam_Krueppel-associated_box,pfam_HATC,superfamily_Krueppel-associated_box,superfamily_RNaseH-like_dom,smart_Krueppel-associated_box,smart_Znf_TTF,pfscan_Krueppel-associated_box	p.E890fs	ENST00000223210.4	37	c.2659	CCDS47741.1	7																																																																																			ZNF862	-	NULL	ENSG00000106479		0.612	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF862	HGNC	protein_coding	OTTHUMT00000350165.1	66	0.00	0	G	NM_001099220		149558908	149558908	+1	no_errors	ENST00000223210	ensembl	human	known	69_37n	frame_shift_del	15	44.83	13	DEL	0.975	-
ZYG11A	440590	genome.wustl.edu	37	1	53323171	53323171	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:53323171G>A	ENST00000371528.1	+	3	906	c.758G>A	c.(757-759)aGa>aAa	p.R253K	ZYG11A_ENST00000371532.1_Intron	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	253								p.R253K(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						GCAGTCATTAGAGAACTTAAA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	93.0	100.0					1																	53323171		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.758G>A	1.37:g.53323171G>A	ENSP00000360583:p.Arg253Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCK5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R253K	ENST00000371528.1	37	c.758	CCDS44148.1	1	.	.	.	.	.	.	.	.	.	.	G	8.444	0.851426	0.17034	.	.	ENSG00000203995	ENST00000371528	T	0.07444	3.19	5.5	3.64	0.41730	.	0.200128	0.50627	N	0.000113	T	0.09379	0.0231	M	0.66939	2.045	0.36709	D	0.880552	B	0.10296	0.003	B	0.15484	0.013	T	0.16247	-1.0409	10	0.05959	T	0.93	-0.1654	11.8286	0.52282	0.1417:0.0:0.8583:0.0	.	253	Q6WRX3	ZY11A_HUMAN	K	253	ENSP00000360583:R253K	ENSP00000360583:R253K	R	+	2	0	ZYG11A	53095759	1.000000	0.71417	0.011000	0.14972	0.874000	0.50279	5.016000	0.64041	0.690000	0.31570	0.563000	0.77884	AGA	ZYG11A	-	NULL	ENSG00000203995		0.408	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	50	0.00	0	G	NM_001004339		53323171	53323171	+1	no_errors	ENST00000371528	ensembl	human	known	69_37n	missense	18	60.87	28	SNP	1.000	A
ZYG11A	440590	genome.wustl.edu	37	1	53347220	53347220	+	Silent	SNP	C	C	G			TCGA-A8-A06Q-01A-11W-A050-09	TCGA-A8-A06Q-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	473d5422-978a-48be-be32-2b7516d6d2d5	c66176ec-6088-430c-a3f3-3c03ba2b5b1a	g.chr1:53347220C>G	ENST00000371528.1	+	11	1975	c.1827C>G	c.(1825-1827)ctC>ctG	p.L609L	RP4-631H13.2_ENST00000446786.2_RNA|ZYG11A_ENST00000371532.1_Silent_p.L267L	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	609								p.L609L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						ACAGTTTACTCTGTAGCAGGG	0.478																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											163.0	136.0	144.0					1																	53347220		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.1827C>G	1.37:g.53347220C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCK5	Silent	SNP	superfamily_ARM-type_fold	p.L609	ENST00000371528.1	37	c.1827	CCDS44148.1	1																																																																																			ZYG11A	-	superfamily_ARM-type_fold	ENSG00000203995		0.478	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	184	0.00	0	C	NM_001004339		53347220	53347220	+1	no_errors	ENST00000371528	ensembl	human	known	69_37n	silent	73	56.80	96	SNP	0.529	G
