#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AXDND1	126859	genome.wustl.edu	37	1	179452320	179452320	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr1:179452320T>G	ENST00000367618.3	+	18	2442	c.2055T>G	c.(2053-2055)aaT>aaG	p.N685K	AXDND1_ENST00000457238.2_3'UTR|AL160286.1_ENST00000600581.1_Intron	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	685										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						AGATAGGCAATGAAATTAACA	0.353																																						dbGAP											0													144.0	139.0	141.0					1																	179452320		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2055T>G	1.37:g.179452320T>G	ENSP00000356590:p.Asn685Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.N685K	ENST00000367618.3	37	c.2055	CCDS30948.1	1	.	.	.	.	.	.	.	.	.	.	T	14.09	2.431289	0.43122	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.21361	2.01;2.01	5.23	1.54	0.23209	.	0.608526	0.16150	N	0.227291	T	0.17323	0.0416	L	0.54323	1.7	0.80722	D	1	P;P	0.37781	0.608;0.608	B;B	0.35550	0.205;0.205	T	0.03524	-1.1028	10	0.39692	T	0.17	-1.3292	6.6055	0.22724	0.0:0.3245:0.0:0.6755	.	643;685	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	K	685;643;619	ENSP00000356590:N685K;ENSP00000391716:N619K	ENSP00000353471:N643K	N	+	3	2	AXDND1	177718943	0.394000	0.25246	0.996000	0.52242	0.887000	0.51463	0.167000	0.16602	0.013000	0.14918	0.533000	0.62120	AAT	AXDND1	-	NULL	ENSG00000162779		0.353	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AXDND1	HGNC	protein_coding	OTTHUMT00000085312.1	183	0.00	0	T	NM_144696		179452320	179452320	+1	no_errors	ENST00000367618	ensembl	human	known	69_37n	missense	309	11.46	40	SNP	0.972	G
BARD1	580	genome.wustl.edu	37	2	215657118	215657118	+	Silent	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr2:215657118C>T	ENST00000260947.4	-	3	401	c.267G>A	c.(265-267)ccG>ccA	p.P89P	BARD1_ENST00000449967.2_Intron|BARD1_ENST00000471787.1_Intron	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	89	Interaction with BRCA1.				cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTATCCAGGCCGGGGTGTAAC	0.363									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP											0													134.0	128.0	130.0					2																	215657118		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.267G>A	2.37:g.215657118C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Silent	SNP	pfam_Ankyrin_rpt,pfam_BRCT_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_Ankyrin_rpt,smart_BRCT_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BRCT_dom,pfscan_Znf_RING,prints_Ankyrin_rpt	p.P89	ENST00000260947.4	37	c.267	CCDS2397.1	2																																																																																			BARD1	-	NULL	ENSG00000138376		0.363	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARD1	HGNC	protein_coding	OTTHUMT00000256602.1	128	0.00	0	C	NM_000465		215657118	215657118	-1	no_errors	ENST00000260947	ensembl	human	known	69_37n	silent	176	26.97	65	SNP	1.000	T
C17orf97	400566	genome.wustl.edu	37	17	263606	263606	+	Silent	SNP	C	C	T	rs71369083|rs71145728|rs180817296	byFrequency	TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr17:263606C>T	ENST00000360127.6	+	2	988	c.972C>T	c.(970-972)ggC>ggT	p.G324G	C17orf97_ENST00000571106.1_Intron|AC108004.3_ENST00000466740.2_RNA	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	354	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCTCAAGGGCTTCCACCCCG	0.701																																						dbGAP											0													17.0	21.0	20.0					17																	263606		2191	4284	6475	-	-	-	SO:0001819	synonymous_variant	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.972C>T	17.37:g.263606C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	NULL	p.G324	ENST00000360127.6	37	c.972	CCDS32519.2	17																																																																																			C17orf97	-	NULL	ENSG00000187624		0.701	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	18	0.00	0	C	NM_001013672		263606	263606	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	0.001	T
BRIP1	83990	genome.wustl.edu	37	17	59821953	59821953	+	Splice_Site	SNP	C	C	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr17:59821953C>G	ENST00000259008.2	-	15	2365		c.e15-1		BRIP1_ENST00000577598.1_Splice_Site	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						TTTCTAATAACTAAAGAGGGG	0.343			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0													79.0	86.0	84.0					17																	59821953		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.2098-1G>C	17.37:g.59821953C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJE2|Q8NCI5	Splice_Site	SNP	-	e14-1	ENST00000259008.2	37	c.2098-1	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544049	0.65198	.	.	ENSG00000136492	ENST00000259008	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6672	0.91495	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRIP1	57176735	1.000000	0.71417	0.968000	0.41197	0.682000	0.39822	7.300000	0.78841	2.641000	0.89580	0.585000	0.79938	.	BRIP1	-	-	ENSG00000136492		0.343	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	299	0.00	0	C	NM_032043	Intron	59821953	59821953	-1	no_errors	ENST00000259008	ensembl	human	known	69_37n	splice_site	104	23.53	32	SNP	1.000	G
CACNA2D4	93589	genome.wustl.edu	37	12	1949960	1949960	+	Silent	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr12:1949960C>T	ENST00000382722.5	-	26	2858	c.2496G>A	c.(2494-2496)gtG>gtA	p.V832V	CACNA2D4_ENST00000585732.1_Silent_p.V693V|CACNA2D4_ENST00000586184.1_Silent_p.V832V|CACNA2D4_ENST00000587995.1_Silent_p.V807V|CACNA2D4_ENST00000585708.1_Silent_p.V768V|CACNA2D4_ENST00000588077.1_Silent_p.V768V	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	832					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TGCTTGCCGTCACCACCATGG	0.597																																					Colon(2;101 179 21030 23310 28141)	dbGAP											0													79.0	85.0	83.0					12																	1949960		2124	4234	6358	-	-	-	SO:0001819	synonymous_variant	0			AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2496G>A	12.37:g.1949960C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	NULL	p.D113N	ENST00000382722.5	37	c.337	CCDS44785.1	12																																																																																			CACNA2D4	-	NULL	ENSG00000151062		0.597	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CACNA2D4	HGNC	protein_coding	OTTHUMT00000398230.2	33	0.00	0	C			1949960	1949960	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000537784	ensembl	human	known	69_37n	missense	37	65.74	71	SNP	0.763	T
CRIPAK	285464	genome.wustl.edu	37	4	1388375	1388376	+	Frame_Shift_Ins	INS	-	-	CA	rs533172496|rs530731346|rs373032956	byFrequency	TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr4:1388375_1388376insCA	ENST00000324803.4	+	1	3036_3037	c.76_77insCA	c.(76-78)tcafs	p.S26fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	26					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCGCCTGCTCATGTGCCCAT	0.639														782	0.15615	0.1952	0.1412	5008	,	,		17889	0.0278		0.2286	False		,,,				2504	0.1718					dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.77_78dupCA	4.37:g.1388376_1388377dupCA	ENSP00000323978:p.Ser26fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Frame_Shift_Ins	INS	smart_Post-SET_dom	p.C27fs	ENST00000324803.4	37	c.76_77	CCDS3349.1	4																																																																																			CRIPAK	-	NULL	ENSG00000179979		0.639	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	41	0.00	0	-	NM_175918		1388375	1388376	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	frame_shift_ins	139	16.27	27	INS	0.039:0.487	CA
CRIPAK	285464	genome.wustl.edu	37	4	1388622	1388623	+	Frame_Shift_Ins	INS	-	-	CA	rs79704405|rs540461234|rs558358960	byFrequency	TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr4:1388622_1388623insCA	ENST00000324803.4	+	1	3283_3284	c.323_324insCA	c.(322-327)ctcacgfs	p.LT108fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	108					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L108H(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCGCCTGCTCACGTGCCCAT	0.668														506	0.101038	0.0567	0.1427	5008	,	,		19207	0.0169		0.1759	False		,,,				2504	0.1411					dbGAP											1	Substitution - Missense(1)	pancreas(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.324_325dupCA	4.37:g.1388623_1388624dupCA	ENSP00000323978:p.Leu108fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Frame_Shift_Ins	INS	smart_Post-SET_dom	p.C110fs	ENST00000324803.4	37	c.323_324	CCDS3349.1	4																																																																																			CRIPAK	-	smart_Post-SET_dom	ENSG00000179979		0.668	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	17	0.00	0	-	NM_175918		1388622	1388623	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	frame_shift_ins	53	18.46	12	INS	0.001:0.028	CA
CUL4B	8450	genome.wustl.edu	37	X	119694135	119694135	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chrX:119694135G>C	ENST00000404115.3	-	3	814	c.413C>G	c.(412-414)tCc>tGc	p.S138C	CUL4B_ENST00000336592.6_Missense_Mutation_p.S125C|CUL4B_ENST00000371322.5_Missense_Mutation_p.S120C	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	138	Ser-rich.				cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						ggaggaggaggaTTCCTCAGC	0.478																																						dbGAP											0													69.0	62.0	64.0					X																	119694135		2203	4300	6503	-	-	-	SO:0001583	missense	0			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.413C>G	X.37:g.119694135G>C	ENSP00000384109:p.Ser138Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.S138C	ENST00000404115.3	37	c.413	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933522	0.73442	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	T;T;T	0.71579	-0.55;-0.55;-0.58	5.66	5.66	0.87406	.	0.155857	0.64402	D	0.000018	T	0.74253	0.3692	L	0.46157	1.445	0.58432	D	0.999998	P;P	0.44195	0.736;0.828	B;P	0.50617	0.443;0.646	T	0.71935	-0.4442	9	.	.	.	-6.5183	17.6407	0.88135	0.0:0.0:1.0:0.0	.	138;120	Q13620;Q13620-1	CUL4B_HUMAN;.	C	120;125;138	ENSP00000360373:S120C;ENSP00000338919:S125C;ENSP00000384109:S138C	.	S	-	2	0	CUL4B	119578163	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	7.395000	0.79876	2.382000	0.81193	0.523000	0.50628	TCC	CUL4B	-	NULL	ENSG00000158290		0.478	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	48	0.00	0	G	NM_003588		119694135	119694135	-1	no_errors	ENST00000404115	ensembl	human	known	69_37n	missense	102	15.00	18	SNP	0.998	C
DHTKD1	55526	genome.wustl.edu	37	10	12136161	12136161	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr10:12136161C>T	ENST00000263035.4	+	7	1311	c.1249C>T	c.(1249-1251)Cgc>Tgc	p.R417C	DHTKD1_ENST00000465617.1_3'UTR	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	417					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R417C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TGAATACCAACGCCAGTTCCG	0.522																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											171.0	137.0	148.0					10																	12136161		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.1249C>T	10.37:g.12136161C>T	ENSP00000263035:p.Arg417Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_DH_E1,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.R417C	ENST00000263035.4	37	c.1249	CCDS7087.1	10	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835151	0.71373	.	.	ENSG00000181192	ENST00000263035;ENST00000415935	T;D	0.96427	2.16;-4.01	4.73	4.73	0.59995	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.97266	0.9106	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.97577	1.0108	10	0.72032	D	0.01	-10.05	12.7958	0.57558	0.1636:0.8364:0.0:0.0	.	417	Q96HY7	DHTK1_HUMAN	C	417;115	ENSP00000263035:R417C;ENSP00000400625:R115C	ENSP00000263035:R417C	R	+	1	0	DHTKD1	12176167	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	4.547000	0.60712	2.187000	0.69744	0.491000	0.48974	CGC	DHTKD1	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000181192		0.522	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	HGNC	protein_coding	OTTHUMT00000046777.1	44	0.00	0	C	NM_018706		12136161	12136161	+1	no_errors	ENST00000263035	ensembl	human	known	69_37n	missense	131	46.99	117	SNP	1.000	T
DIS3L	115752	genome.wustl.edu	37	15	66618592	66618592	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr15:66618592G>A	ENST00000319212.4	+	12	2141	c.2091G>A	c.(2089-2091)tgG>tgA	p.W697*	DIS3L_ENST00000319194.5_Nonsense_Mutation_p.W614*|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	697					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AAAAGATCTGGGAGAGCTTCC	0.552																																						dbGAP											0													73.0	74.0	74.0					15																	66618592		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2091G>A	15.37:g.66618592G>A	ENSP00000321711:p.Trp697*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1N8|Q8WTU9|Q96CM7	Nonsense_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.W697*	ENST00000319212.4	37	c.2091	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	G	38	7.148152	0.98096	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	.	.	.	5.4	3.49	0.39957	.	0.350668	0.35040	N	0.003485	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-7.0771	10.4164	0.44325	0.0733:0.4127:0.5141:0.0	.	.	.	.	X	614;697	.	ENSP00000321583:W614X	W	+	3	0	DIS3L	64405646	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.305000	0.33493	0.611000	0.30052	0.462000	0.41574	TGG	DIS3L	-	pfam_RNase_II/R,smart_RNase_II/R	ENSG00000166938		0.552	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2	100	0.00	0	G	NM_133375		66618592	66618592	+1	no_errors	ENST00000319212	ensembl	human	known	69_37n	nonsense	57	12.31	8	SNP	0.999	A
DNA2	1763	genome.wustl.edu	37	10	70218891	70218891	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr10:70218891G>A	ENST00000358410.3	-	5	739	c.689C>T	c.(688-690)tCg>tTg	p.S230L	RNA5SP319_ENST00000362768.1_RNA|DNA2_ENST00000399180.2_Missense_Mutation_p.S316L|DNA2_ENST00000399179.2_Missense_Mutation_p.S230L	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	230	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)	p.S230L(1)|p.S316L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GAAGTCAGTCGAAGTGTTTTT	0.358																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)											89.0	80.0	83.0					10																	70218891		1845	4099	5944	-	-	-	SO:0001583	missense	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.689C>T	10.37:g.70218891G>A	ENSP00000351185:p.Ser230Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	pfam_DNA_replication_fac_Dna2	p.S316L	ENST00000358410.3	37	c.947		10	.	.	.	.	.	.	.	.	.	.	G	10.17	1.277621	0.23307	.	.	ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410	D;D;D	0.94376	-2.9;-3.41;-2.88	5.04	4.13	0.48395	DNA replication factor Dna2 (1);	2.894520	0.00987	N	0.003466	D	0.91971	0.7457	M	0.65975	2.015	0.09310	N	0.999999	P;P	0.51791	0.948;0.92	B;B	0.37047	0.24;0.196	T	0.78420	-0.2211	10	0.15952	T	0.53	.	13.2012	0.59769	0.0:0.0:0.7123:0.2877	.	230;230	F8VR31;P51530	.;DNA2L_HUMAN	L	230;316;230;230	ENSP00000382133:S316L;ENSP00000382132:S230L;ENSP00000351185:S230L	ENSP00000351185:S230L	S	-	2	0	DNA2	69888897	0.876000	0.30132	0.052000	0.19188	0.195000	0.23768	2.945000	0.49043	1.095000	0.41419	0.591000	0.81541	TCG	DNA2	-	pfam_DNA_replication_fac_Dna2	ENSG00000138346		0.358	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2	33	0.00	0	G			70218891	70218891	-1	no_errors	ENST00000399180	ensembl	human	known	69_37n	missense	259	15.86	49	SNP	0.385	A
DSCAML1	57453	genome.wustl.edu	37	11	117342753	117342753	+	Splice_Site	SNP	T	T	C			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr11:117342753T>C	ENST00000321322.6	-	15	2967		c.e15-2		DSCAML1_ENST00000527706.1_Splice_Site	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CCCAGGAATCTGGAGAGAAGA	0.537																																						dbGAP											0													134.0	115.0	122.0					11																	117342753		2201	4296	6497	-	-	-	SO:0001630	splice_region_variant	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2966-2A>G	11.37:g.117342753T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Splice_Site	SNP	-	e15-2	ENST00000321322.6	37	c.2966-2	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	T	21.2	4.116491	0.77323	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6512	0.62312	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DSCAML1	116847963	1.000000	0.71417	0.946000	0.38457	0.926000	0.56050	7.861000	0.87004	1.807000	0.52817	0.374000	0.22700	.	DSCAML1	-	-	ENSG00000177103		0.537	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	48	0.00	0	T	NM_020693	Intron	117342753	117342753	-1	no_errors	ENST00000321322	ensembl	human	known	69_37n	splice_site	95	44.44	76	SNP	1.000	C
DSG4	147409	genome.wustl.edu	37	18	28972180	28972182	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr18:28972180_28972182delTCT	ENST00000308128.4	+	8	1017_1019	c.882_884delTCT	c.(880-885)gatctt>gat	p.L295del	DSG4_ENST00000359747.4_In_Frame_Del_p.L295del|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	295	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Missing (in HYPT6). {ECO:0000269|PubMed:12705872, ECO:0000269|PubMed:15191570}.		anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AAGCAATTGATCTTGATGAAGAA	0.345																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.882_884delTCT	18.37:g.28972180_28972182delTCT	ENSP00000311859:p.Leu295del	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUI1|Q6Y9L9|Q8IXV4	In_Frame_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin,pfscan_Cadherin	p.L295in_frame_del	ENST00000308128.4	37	c.882_884	CCDS11897.1	18																																																																																			DSG4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000175065		0.345	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	HGNC	protein_coding	OTTHUMT00000254941.1	109	0.00	0	TCT	NM_177986		28972180	28972182	+1	no_errors	ENST00000359747	ensembl	human	known	69_37n	in_frame_del	137	16.97	28	DEL	1.000:0.999:0.987	-
DYNC1H1	1778	genome.wustl.edu	37	14	102452147	102452147	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr14:102452147A>G	ENST00000360184.4	+	8	1749	c.1585A>G	c.(1585-1587)Aac>Gac	p.N529D		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	529	Interaction with DYNC1I2. {ECO:0000250}.|Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGCTTATGAGAACGTCAAGGA	0.498																																						dbGAP											0													108.0	94.0	99.0					14																	102452147		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1585A>G	14.37:g.102452147A>G	ENSP00000348965:p.Asn529Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.N529D	ENST00000360184.4	37	c.1585	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	A	11.99	1.802886	0.31869	.	.	ENSG00000197102	ENST00000360184	T	0.55760	0.5	5.75	5.75	0.90469	Dynein heavy chain, domain-1 (1);	0.044407	0.85682	D	0.000000	T	0.52403	0.1732	M	0.71581	2.175	0.80722	D	1	B	0.14012	0.009	B	0.19391	0.025	T	0.51076	-0.8751	10	0.12430	T	0.62	.	16.0919	0.81098	1.0:0.0:0.0:0.0	.	529	Q14204	DYHC1_HUMAN	D	529	ENSP00000348965:N529D	ENSP00000348965:N529D	N	+	1	0	DYNC1H1	101521900	1.000000	0.71417	0.998000	0.56505	0.772000	0.43724	8.957000	0.93082	2.190000	0.69967	0.529000	0.55759	AAC	DYNC1H1	-	pfam_Dynein_heavy_dom-1	ENSG00000197102		0.498	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	101	0.00	0	A	NM_001376		102452147	102452147	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	missense	212	14.52	36	SNP	1.000	G
ERP29	10961	genome.wustl.edu	37	12	112460034	112460034	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr12:112460034C>T	ENST00000261735.3	+	3	514	c.364C>T	c.(364-366)Cgg>Tgg	p.R122W	ERP29_ENST00000455836.1_3'UTR|ERP29_ENST00000546477.1_Missense_Mutation_p.R21W	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	122					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						CTACCTCTTCCGGGATGGGGA	0.527																																						dbGAP											0													53.0	54.0	54.0					12																	112460034		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.364C>T	12.37:g.112460034C>T	ENSP00000261735:p.Arg122Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J183|Q3MJC3|Q6FHT4	Missense_Mutation	SNP	pfam_ERp29_N,pfam_ER_p29_C,superfamily_ER_p29_C,superfamily_Thioredoxin-like_fold,pirsf_ER_p29	p.R122W	ENST00000261735.3	37	c.364	CCDS9158.1	12	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339152	0.41398	.	.	ENSG00000089248	ENST00000261735;ENST00000546477	.	.	.	5.34	5.34	0.76211	ERp29, N-terminal (1);Thioredoxin-like fold (2);	0.623927	0.15971	N	0.235764	T	0.45013	0.1321	N	0.19112	0.55	0.34894	D	0.74586	B	0.10296	0.003	B	0.06405	0.002	T	0.51965	-0.8638	9	0.49607	T	0.09	-0.082	14.6305	0.68653	0.0:0.8546:0.1454:0.0	.	122	P30040	ERP29_HUMAN	W	122;21	.	ENSP00000261735:R122W	R	+	1	2	ERP29	110944417	0.968000	0.33430	1.000000	0.80357	0.996000	0.88848	3.262000	0.51538	2.487000	0.83934	0.462000	0.41574	CGG	ERP29	-	pfam_ERp29_N,superfamily_Thioredoxin-like_fold,pirsf_ER_p29	ENSG00000089248		0.527	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERP29	HGNC	protein_coding	OTTHUMT00000405200.1	77	0.00	0	C			112460034	112460034	+1	no_errors	ENST00000261735	ensembl	human	known	69_37n	missense	90	11.76	12	SNP	0.997	T
LECT2	3950	genome.wustl.edu	37	5	135273118	135273118	+	Intron	SNP	A	A	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr5:135273118A>T	ENST00000522943.1	-	3	418				FBXL21_ENST00000297158.9_RNA|LECT2_ENST00000471827.1_5'Flank|FBXL21_ENST00000467490.1_RNA			O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2						chemotaxis (GO:0006935)|negative regulation of Wnt signaling pathway (GO:0030178)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	identical protein binding (GO:0042802)			large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTCTAGGTTGACAGTAGCGCT	0.378																																						dbGAP											0													64.0	62.0	63.0					5																	135273118		1863	4108	5971	-	-	-	SO:0001627	intron_variant	0			AB007546	CCDS4190.1	5q31.1	2008-05-15			ENSG00000145826	ENSG00000145826			6550	protein-coding gene	gene with protein product		602882				9545637	Standard	NM_002302		Approved	chm-II, chm2	uc003lbe.1	O14960	OTTHUMG00000129146	ENST00000522943.1:c.289+13793T>A	5.37:g.135273118A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA90|O14565|Q52M49	Missense_Mutation	SNP	NULL	p.D124V	ENST00000522943.1	37	c.371		5																																																																																			FBXL21	-	NULL	ENSG00000164616		0.378	LECT2-005	PUTATIVE	basic	protein_coding	FBXL21	HGNC	protein_coding	OTTHUMT00000381629.1	47	0.00	0	A	NM_002302		135273118	135273118	+1	pseudogene	ENST00000297158	ensembl	human	known	69_37n	missense	132	14.29	22	SNP	1.000	T
FAM71B	153745	genome.wustl.edu	37	5	156589516	156589516	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr5:156589516C>T	ENST00000302938.4	-	2	1855	c.1760G>A	c.(1759-1761)aGt>aAt	p.S587N		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	587						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CATAGTGCCACTGATCATCTC	0.502																																						dbGAP											0													254.0	248.0	250.0					5																	156589516		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1760G>A	5.37:g.156589516C>T	ENSP00000305596:p.Ser587Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	pfam_DUF3699	p.S587N	ENST00000302938.4	37	c.1760	CCDS4335.1	5	.	.	.	.	.	.	.	.	.	.	C	9.649	1.141166	0.21205	.	.	ENSG00000170613	ENST00000302938	T	0.16897	2.31	3.87	-5.32	0.02722	.	1.502430	0.04365	N	0.358065	T	0.08980	0.0222	L	0.40543	1.245	0.09310	N	1	P	0.40144	0.704	B	0.29663	0.105	T	0.24693	-1.0153	10	0.23302	T	0.38	5.1534	3.1069	0.06345	0.1085:0.1762:0.4508:0.2645	.	587	Q8TC56	FA71B_HUMAN	N	587	ENSP00000305596:S587N	ENSP00000305596:S587N	S	-	2	0	FAM71B	156522094	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.277000	0.02812	-1.256000	0.02478	0.655000	0.94253	AGT	FAM71B	-	NULL	ENSG00000170613		0.502	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	179	0.00	0	C	NM_130899		156589516	156589516	-1	no_errors	ENST00000302938	ensembl	human	known	69_37n	missense	200	11.11	25	SNP	0.000	T
GPR52	9293	genome.wustl.edu	37	1	174417939	174417939	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr1:174417939C>A	ENST00000367685.2	+	1	728	c.690C>A	c.(688-690)tgC>tgA	p.C230*	RABGAP1L_ENST00000357444.6_Intron|RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000251507.4_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	230					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						TCAAAATTTGCCGTCAGCACA	0.463																																					Ovarian(92;924 1390 1930 16467 40583)	dbGAP											0													198.0	183.0	188.0					1																	174417939		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.690C>A	1.37:g.174417939C>A	ENSP00000356658:p.Cys230*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75654|Q4VBL6|Q6ISM0	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.C230*	ENST00000367685.2	37	c.690	CCDS30941.1	1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652648	0.67472	.	.	ENSG00000203737	ENST00000367685	.	.	.	6.16	2.88	0.33553	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-15.8006	10.8833	0.46951	0.0:0.7235:0.0:0.2765	.	.	.	.	X	230	.	ENSP00000356658:C230X	C	+	3	2	GPR52	172684562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.949000	0.40313	0.934000	0.37316	0.650000	0.86243	TGC	GPR52	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000203737		0.463	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR52	HGNC	protein_coding	OTTHUMT00000084511.1	306	0.00	0	C	NM_005684		174417939	174417939	+1	no_errors	ENST00000367685	ensembl	human	known	69_37n	nonsense	208	37.80	127	SNP	1.000	A
GRIN3A	116443	genome.wustl.edu	37	9	104499857	104499857	+	Silent	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr9:104499857C>T	ENST00000361820.3	-	1	1005	c.405G>A	c.(403-405)ctG>ctA	p.L135L		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	135					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CCACGCGGTTCAGGTTGTCCA	0.672																																						dbGAP											0													57.0	55.0	56.0					9																	104499857		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.405G>A	9.37:g.104499857C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.L135	ENST00000361820.3	37	c.405	CCDS6758.1	9																																																																																			GRIN3A	-	NULL	ENSG00000198785		0.672	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	15	0.00	0	C			104499857	104499857	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	silent	19	52.50	21	SNP	1.000	T
HLA-C	3107	genome.wustl.edu	37	6	31238880	31238880	+	Missense_Mutation	SNP	C	C	T	rs1050357	byFrequency	TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr6:31238880C>T	ENST00000376228.5	-	3	603	c.589G>A	c.(589-591)Gag>Aag	p.E197K	HLA-C_ENST00000383329.3_Missense_Mutation_p.E197K	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	197	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						TTCCCGTTCTCCAGGTATCTG	0.672																																						dbGAP											0													52.0	44.0	47.0					6																	31238880		2202	4297	6499	-	-	-	SO:0001583	missense	0			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.589G>A	6.37:g.31238880C>T	ENSP00000365402:p.Glu197Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.E234K	ENST00000376228.5	37	c.700	CCDS34393.1	6	250|250	0.11446886446886446|0.11446886446886446	26|26	0.052845528455284556|0.052845528455284556	32|32	0.08839779005524862|0.08839779005524862	110|110	0.19230769230769232|0.19230769230769232	82|82	0.10817941952506596|0.10817941952506596	.|.	14.40|14.40	2.525317|2.525317	0.44969|0.44969	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307|ENST00000415537	T;T|.	0.00864|.	5.6;5.6|.	2.71|2.71	2.71|2.71	0.32032|0.32032	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	0.857122|.	0.09529|.	U|.	0.789762|.	T|T	0.68604|0.68604	0.3019|0.3019	M|M	0.89904|0.89904	3.07|3.07	0.32236|0.32236	P|P	0.573324|0.573324	B;B;B;B|.	0.09022|.	0.001;0.001;0.0;0.002|.	B;B;B;B|.	0.13407|.	0.009;0.003;0.003;0.006|.	T|T	0.74438|0.74438	-0.3665|-0.3665	9|4	0.62326|.	D|.	0.03|.	.|.	11.5435|11.5435	0.50679|0.50679	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	rs1050357;rs3180652;rs12721964|rs1050357;rs3180652;rs12721964	197;197;197;197|.	A2AEA4;A6H578;A2AEA2;P10321|.	.;.;.;1C07_HUMAN|.	K|E	197;197;197;234|196	ENSP00000365402:E197K;ENSP00000372819:E197K|.	ENSP00000365402:E197K|.	E|G	-|-	1|2	0|0	HLA-C|HLA-C	31346859|31346859	0.001000|0.001000	0.12720|0.12720	0.990000|0.990000	0.47175|0.47175	0.087000|0.087000	0.18053|0.18053	-0.307000|-0.307000	0.08167|0.08167	1.826000|1.826000	0.53198|0.53198	0.305000|0.305000	0.20034|0.20034	GAG|GGA	HLA-C	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2	ENSG00000204525		0.672	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-C	HGNC	protein_coding	OTTHUMT00000076281.3	19	0.00	0	C	NM_002117		31238880	31238880	-1	no_errors	ENST00000539307	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.999	T
HPS4	89781	genome.wustl.edu	37	22	26860227	26860227	+	Silent	SNP	T	T	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr22:26860227T>G	ENST00000398145.2	-	11	1985	c.1369A>C	c.(1369-1371)Aga>Cga	p.R457R	HPS4_ENST00000336873.5_Silent_p.R457R|HPS4_ENST00000493455.2_5'Flank|HPS4_ENST00000398141.1_Silent_p.R470R|HPS4_ENST00000402105.3_Silent_p.R452R	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	457					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						GGGTCTGCTCTGGGAATGGGG	0.607									Hermansky-Pudlak syndrome																													dbGAP											0													114.0	114.0	114.0					22																	26860227		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1369A>C	22.37:g.26860227T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Silent	SNP	NULL	p.R470	ENST00000398145.2	37	c.1408	CCDS13835.1	22																																																																																			HPS4	-	NULL	ENSG00000100099		0.607	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPS4	HGNC	protein_coding	OTTHUMT00000320778.1	92	0.00	0	T	NM_022081		26860227	26860227	-1	no_errors	ENST00000398141	ensembl	human	known	69_37n	silent	31	71.56	78	SNP	0.001	G
HSD17B6	8630	genome.wustl.edu	37	12	57181033	57181033	+	Silent	SNP	T	T	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr12:57181033T>A	ENST00000554643.1	+	6	1210	c.861T>A	c.(859-861)gcT>gcA	p.A287A	HSD17B6_ENST00000555159.1_Silent_p.A287A|HSD17B6_ENST00000555805.1_Silent_p.A287A|HSD17B6_ENST00000554150.1_Silent_p.A287A|HSD17B6_ENST00000322165.1_Silent_p.A287A			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	287					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	GCTGGGATGCTAAATTTTTCT	0.453																																						dbGAP											0													121.0	97.0	105.0					12																	57181033		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.861T>A	12.37:g.57181033T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43275	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.A287	ENST00000554643.1	37	c.861	CCDS8925.1	12																																																																																			HSD17B6	-	NULL	ENSG00000025423		0.453	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSD17B6	HGNC	protein_coding	OTTHUMT00000410714.1	69	0.00	0	T	NM_003725		57181033	57181033	+1	no_errors	ENST00000322165	ensembl	human	known	69_37n	silent	86	18.10	19	SNP	0.022	A
KLHL7	55975	genome.wustl.edu	37	7	23163424	23163424	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr7:23163424T>G	ENST00000339077.5	+	2	392	c.149T>G	c.(148-150)gTc>gGc	p.V50G	KLHL7_ENST00000539124.1_Intron|KLHL7_ENST00000479288.1_Intron|KLHL7_ENST00000322231.7_Missense_Mutation_p.V28G|KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000322275.5_Missense_Mutation_p.V50G|KLHL7_ENST00000545771.1_Missense_Mutation_p.V28G|KLHL7_ENST00000410047.1_Missense_Mutation_p.V28G|KLHL7_ENST00000545443.1_Missense_Mutation_p.V28G|KLHL7_ENST00000409689.1_Missense_Mutation_p.V2G	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	50	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATCCTCATGGTCCAGGAAAGA	0.368																																						dbGAP											0													155.0	138.0	144.0					7																	23163424		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.149T>G	7.37:g.23163424T>G	ENSP00000343273:p.Val50Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V50G	ENST00000339077.5	37	c.149	CCDS34609.1	7	.	.	.	.	.	.	.	.	.	.	T	25.1	4.603795	0.87157	.	.	ENSG00000122550	ENST00000538858;ENST00000536369;ENST00000322231;ENST00000339077;ENST00000322275;ENST00000409689;ENST00000410047;ENST00000545771;ENST00000545443	T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.46	5.46	0.80206	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.92113	0.7500	H	0.96633	3.855	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.996;0.998;1.0;1.0	D;D;D;D;D	0.83275	0.996;0.928;0.924;0.996;0.996	D	0.94666	0.7852	10	0.87932	D	0	.	15.8362	0.78799	0.0:0.0:0.0:1.0	.	28;50;28;50;28	F5GYE2;Q8IXQ5;Q8IXQ5-2;Q8IXQ5-3;Q8IXQ5-4	.;KLHL7_HUMAN;.;.;.	G	50;50;28;50;50;2;28;28;28	ENSP00000322958:V28G;ENSP00000343273:V50G;ENSP00000323270:V50G;ENSP00000386263:V2G;ENSP00000386999:V28G;ENSP00000446445:V28G;ENSP00000442366:V28G	ENSP00000322958:V28G	V	+	2	0	KLHL7	23129949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.179000	0.77665	2.200000	0.70718	0.460000	0.39030	GTC	KLHL7	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000122550		0.368	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL7	HGNC	protein_coding	OTTHUMT00000326860.3	34	0.00	0	T	NM_018846		23163424	23163424	+1	no_errors	ENST00000339077	ensembl	human	known	69_37n	missense	223	16.79	45	SNP	1.000	G
KRTAP1-1	81851	genome.wustl.edu	37	17	39197512	39197512	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr17:39197512delC	ENST00000306271.4	-	1	201	c.138delG	c.(136-138)cagfs	p.Q46fs		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	46			Missing (in allele KAP1.7). {ECO:0000269|PubMed:11841537}.|PSCSTSGTCGSSCCQPSCCETSSCQPRCCETSCCQPSCCQT SFCGFP -> R (in allele KAP1.6).			keratin filament (GO:0045095)				NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCAGCTTGGCTGGCAGCAGC	0.612																																						dbGAP											0													65.0	79.0	74.0					17																	39197512		2015	4216	6231	-	-	-	SO:0001589	frameshift_variant	0			AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.138delG	17.37:g.39197512delC	ENSP00000305975:p.Gln46fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC32|Q96S60|Q96S67	Frame_Shift_Del	DEL	pfam_Keratin-assoc	p.Q46fs	ENST00000306271.4	37	c.138	CCDS42324.1	17																																																																																			KRTAP1-1	-	pfam_Keratin-assoc	ENSG00000188581		0.612	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP1-1	HGNC	protein_coding	OTTHUMT00000257696.1	45	0.00	0	C	NM_030967		39197512	39197512	-1	no_errors	ENST00000306271	ensembl	human	known	69_37n	frame_shift_del	16	51.52	17	DEL	0.109	-
LRRC16B	90668	genome.wustl.edu	37	14	24528876	24528876	+	Silent	SNP	T	T	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr14:24528876T>G	ENST00000342740.5	+	22	1957	c.1803T>G	c.(1801-1803)acT>acG	p.T601T	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	601						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CCCCCAGAACTATCCTATGGG	0.577																																						dbGAP											0													106.0	90.0	95.0					14																	24528876		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.1803T>G	14.37:g.24528876T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEF7|Q96HS9	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.T601	ENST00000342740.5	37	c.1803	CCDS32054.1	14																																																																																			LRRC16B	-	NULL	ENSG00000186648		0.577	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	HGNC	protein_coding	OTTHUMT00000416527.1	10	0.00	0	T	NM_138360		24528876	24528876	+1	no_errors	ENST00000342740	ensembl	human	known	69_37n	silent	125	25.60	43	SNP	0.997	G
LRRN1	57633	genome.wustl.edu	37	3	3888104	3888104	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr3:3888104A>C	ENST00000319331.3	+	2	2540	c.1779A>C	c.(1777-1779)gaA>gaC	p.E593D	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	593	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CAGATTATGAAGTGTGTCTCA	0.448																																						dbGAP											0													196.0	195.0	195.0					3																	3888104		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.1779A>C	3.37:g.3888104A>C	ENSP00000314901:p.Glu593Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E593D	ENST00000319331.3	37	c.1779	CCDS33685.1	3	.	.	.	.	.	.	.	.	.	.	A	16.65	3.180998	0.57800	.	.	ENSG00000175928	ENST00000319331	T	0.48836	0.8	5.5	0.273	0.15650	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.48040	0.1478	L	0.53249	1.67	0.46678	D	0.999152	D	0.59357	0.985	P	0.53360	0.724	T	0.36383	-0.9750	10	0.24483	T	0.36	.	9.7185	0.40289	0.7355:0.0:0.2645:0.0	.	593	Q6UXK5	LRRN1_HUMAN	D	593	ENSP00000314901:E593D	ENSP00000314901:E593D	E	+	3	2	LRRN1	3863104	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	1.549000	0.36212	-0.103000	0.12175	0.528000	0.53228	GAA	LRRN1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000175928		0.448	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	288	0.00	0	A	NM_020873		3888104	3888104	+1	no_errors	ENST00000319331	ensembl	human	known	69_37n	missense	193	28.52	77	SNP	1.000	C
LRTM2	654429	genome.wustl.edu	37	12	1943503	1943503	+	Silent	SNP	C	C	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr12:1943503C>A	ENST00000543818.1	+	5	1571	c.729C>A	c.(727-729)ccC>ccA	p.P243P	CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000299194.1_Silent_p.P243P|LRTM2_ENST00000535041.1_Silent_p.P243P|LRTM2_ENST00000543730.1_3'UTR	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	243	LRRCT.					integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GGATGGTCCCCATGGAGATGT	0.597																																						dbGAP											0													61.0	50.0	54.0					12																	1943503		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.729C>A	12.37:g.1943503C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2U6	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P243	ENST00000543818.1	37	c.729	CCDS31726.1	12																																																																																			LRTM2	-	smart_Cys-rich_flank_reg_C	ENSG00000166159		0.597	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1	19	0.00	0	C			1943503	1943503	+1	no_errors	ENST00000299194	ensembl	human	known	69_37n	silent	13	45.83	11	SNP	1.000	A
LRTM2	654429	genome.wustl.edu	37	12	1943594	1943594	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr12:1943594C>T	ENST00000543818.1	+	5	1662	c.820C>T	c.(820-822)Cca>Tca	p.P274S	CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000299194.1_Missense_Mutation_p.P274S|LRTM2_ENST00000535041.1_Missense_Mutation_p.P274S|LRTM2_ENST00000543730.1_3'UTR	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	274						integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			CAAGGCCAGTCCAGAGCCTGC	0.657																																						dbGAP											0													36.0	33.0	34.0					12																	1943594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.820C>T	12.37:g.1943594C>T	ENSP00000446278:p.Pro274Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2U6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P274S	ENST00000543818.1	37	c.820	CCDS31726.1	12	.	.	.	.	.	.	.	.	.	.	C	12.40	1.925316	0.34002	.	.	ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041;ENST00000424079	T;T;T	0.58940	0.3;0.3;0.3	5.44	5.44	0.79542	.	0.234460	0.44688	D	0.000430	T	0.44644	0.1303	N	0.22421	0.69	0.43476	D	0.995695	B	0.02656	0.0	B	0.04013	0.001	T	0.32322	-0.9911	10	0.15066	T	0.55	.	18.2551	0.90017	0.0:1.0:0.0:0.0	.	274	Q8N967	LRTM2_HUMAN	S	274;274;274;36	ENSP00000446278:P274S;ENSP00000299194:P274S;ENSP00000444737:P274S	ENSP00000299194:P274S	P	+	1	0	LRTM2	1813855	0.995000	0.38212	0.983000	0.44433	0.973000	0.67179	2.492000	0.45311	2.549000	0.85964	0.655000	0.94253	CCA	LRTM2	-	NULL	ENSG00000166159		0.657	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1	20	0.00	0	C			1943594	1943594	+1	no_errors	ENST00000299194	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.994	T
MAML1	9794	genome.wustl.edu	37	5	179195873	179195873	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr5:179195873C>T	ENST00000292599.3	+	3	2017	c.1754C>T	c.(1753-1755)cCt>cTt	p.P585L	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCAGTGTCCCTGTGCAAGCC	0.572																																						dbGAP											0													140.0	160.0	153.0					5																	179195873		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1754C>T	5.37:g.179195873C>T	ENSP00000292599:p.Pro585Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.P585L	ENST00000292599.3	37	c.1754	CCDS34315.1	5	.	.	.	.	.	.	.	.	.	.	C	17.66	3.445413	0.63178	.	.	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.46819	0.86	4.59	4.59	0.56863	.	0.084192	0.50627	D	0.000107	T	0.66587	0.2804	M	0.67953	2.075	0.58432	D	0.999996	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.925	T	0.70557	-0.4839	10	0.66056	D	0.02	-3.3126	15.183	0.72975	0.0:1.0:0.0:0.0	.	622;585	Q59GH4;Q92585	.;MAML1_HUMAN	L	585;622	ENSP00000292599:P585L	ENSP00000292599:P585L	P	+	2	0	MAML1	179128479	0.897000	0.30589	0.371000	0.25978	0.541000	0.35023	3.931000	0.56529	2.095000	0.63458	0.462000	0.41574	CCT	MAML1	-	NULL	ENSG00000161021		0.572	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000372316.2	205	0.00	0	C	NM_014757		179195873	179195873	+1	no_errors	ENST00000292599	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	0.948	T
MDN1	23195	genome.wustl.edu	37	6	90426511	90426511	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr6:90426511C>G	ENST00000369393.3	-	44	6716	c.6601G>C	c.(6601-6603)Gaa>Caa	p.E2201Q	MDN1_ENST00000428876.1_Missense_Mutation_p.E2201Q			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2201					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.E2201Q(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CGGAACTCTTCAACAAGTTTG	0.438																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											80.0	74.0	76.0					6																	90426511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.6601G>C	6.37:g.90426511C>G	ENSP00000358400:p.Glu2201Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.E2201Q	ENST00000369393.3	37	c.6601	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680466	0.47886	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03358	3.96;3.96	5.35	5.35	0.76521	ATPase, AAA+ type, core (1);	0.237684	0.42294	D	0.000730	T	0.01765	0.0056	N	0.19112	0.55	0.53005	D	0.999965	B	0.22683	0.073	B	0.28991	0.097	T	0.58042	-0.7706	10	0.21540	T	0.41	.	19.4391	0.94811	0.0:1.0:0.0:0.0	.	2201	Q9NU22	MDN1_HUMAN	Q	2201	ENSP00000358400:E2201Q;ENSP00000413970:E2201Q	ENSP00000358400:E2201Q	E	-	1	0	MDN1	90483232	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.586000	0.74067	2.660000	0.90430	0.557000	0.71058	GAA	MDN1	-	smart_AAA+_ATPase,pirsf_Midasin	ENSG00000112159		0.438	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	136	0.00	0	C			90426511	90426511	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	89	73.03	241	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9048936	9048937	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr19:9048936_9048937delAA	ENST00000397910.4	-	5	32897_32898	c.32694_32695delTT	c.(32692-32697)ctttctfs	p.S10899fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10901	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCACCAGGAGAAAGAGTCAGAA	0.495																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32694_32695delTT	19.37:g.9048936_9048937delAA	ENSP00000381008:p.Ser10899fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Frame_Shift_Del	DEL	pfam_SEA,smart_SEA,pfscan_SEA	p.P10900fs	ENST00000397910.4	37	c.32695_32694	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.495	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	706	0.00	0	AA	NM_024690		9048936	9048937	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	frame_shift_del	109	32.72	53	DEL	0.000:0.000	-
MYBL1	4603	genome.wustl.edu	37	8	67485600	67485600	+	Splice_Site	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr8:67485600C>T	ENST00000522677.3	-	11	2022	c.1612G>A	c.(1612-1614)Ggg>Agg	p.G538R	MYBL1_ENST00000524176.2_Splice_Site_p.G538R|MYBL1_ENST00000517885.1_Splice_Site_p.G196R	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	538	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			CCTACTTACCCTACATTTTCC	0.343																																						dbGAP											0													186.0	172.0	176.0					8																	67485600		1822	4097	5919	-	-	-	SO:0001630	splice_region_variant	0			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1613+1G>A	8.37:g.67485600C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EW29|Q495F9	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.G538R	ENST00000522677.3	37	c.1612	CCDS47867.1	8	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119350	0.77323	.	.	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	T;T;T	0.30182	1.54;1.54;1.54	5.42	5.42	0.78866	C-myb, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.55465	0.1922	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.44590	-0.9318	10	0.20519	T	0.43	-8.6101	19.6002	0.95559	0.0:1.0:0.0:0.0	.	538;537;538	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	R	538;196;538	ENSP00000429633:G538R;ENSP00000428265:G196R;ENSP00000428011:G538R	ENSP00000428265:G196R	G	-	1	0	MYBL1	67648154	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.148000	0.64857	2.691000	0.91804	0.655000	0.94253	GGG	MYBL1	-	pfam_C-myb_C	ENSG00000185697		0.343	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	281	0.00	0	C	XM_034274	Missense_Mutation	67485600	67485600	-1	no_errors	ENST00000522677	ensembl	human	known	69_37n	missense	498	15.59	92	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152375530	152375532	+	In_Frame_Del	DEL	CTT	CTT	-	rs201976154		TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr2:152375530_152375532delCTT	ENST00000172853.10	-	127	17686_17688	c.17539_17541delAAG	c.(17539-17541)aagdel	p.K5847del	NEB_ENST00000397345.3_In_Frame_Del_p.K7548del|NEB_ENST00000604864.1_In_Frame_Del_p.K7548del|NEB_ENST00000427231.2_In_Frame_Del_p.K7548del|NEB_ENST00000603639.1_In_Frame_Del_p.K7548del|NEB_ENST00000409198.1_In_Frame_Del_p.K5847del			P20929	NEBU_HUMAN	nebulin	5847					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCAGAGACTCCTTCATGTCAGTC	0.419																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.17539_17541delAAG	2.37:g.152375530_152375532delCTT	ENSP00000172853:p.Lys5847del	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	In_Frame_Del	DEL	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.K7548in_frame_del	ENST00000172853.10	37	c.22644_22642		2																																																																																			NEB	-	smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.419	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		54	0.00	0	CTT	NM_004543		152375530	152375532	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	in_frame_del	251	38.78	159	DEL	0.987:1.000:1.000	-
NR4A3	8013	genome.wustl.edu	37	9	102609749	102609749	+	Silent	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr9:102609749C>T	ENST00000395097.2	+	7	2214	c.1485C>T	c.(1483-1485)ttC>ttT	p.F495F	NR4A3_ENST00000330847.1_Silent_p.F506F	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	495					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)		TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AGTTTGTGTTCTGCAATGGAC	0.433			T	EWSR1	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	0													223.0	196.0	205.0					9																	102609749		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.1485C>T	9.37:g.102609749C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_NOR1_rcpt,prints_Nuc_orph_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.F506	ENST00000395097.2	37	c.1518	CCDS6743.1	9																																																																																			NR4A3	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Nuc_orph_rcpt,prints_Retinoic_acid_rcpt	ENSG00000119508		0.433	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A3	HGNC	protein_coding	OTTHUMT00000055482.1	90	0.00	0	C			102609749	102609749	+1	no_errors	ENST00000330847	ensembl	human	known	69_37n	silent	222	19.57	54	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	50850528	50850528	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr2:50850528G>A	ENST00000406316.2	-	6	2534	c.1058C>T	c.(1057-1059)gCa>gTa	p.A353V	NRXN1_ENST00000406859.3_Missense_Mutation_p.A353V|NRXN1_ENST00000402717.3_Missense_Mutation_p.A353V|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000405472.3_Missense_Mutation_p.A353V|NRXN1_ENST00000401669.2_Missense_Mutation_p.A353V|NRXN1_ENST00000404971.1_Missense_Mutation_p.A386V	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	353	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTCCACTAGTGCTTCAAAGGC	0.463																																						dbGAP											0													99.0	95.0	96.0					2																	50850528		1909	4133	6042	-	-	-	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1058C>T	2.37:g.50850528G>A	ENSP00000384311:p.Ala353Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.A353V	ENST00000406316.2	37	c.1058	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555322	0.86231	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.02;-1.2;-1.02;-1.2	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.81706	0.4879	N	0.21508	0.67	0.54753	D	0.999984	D;D;D	0.89917	0.963;0.999;1.0	P;D;D	0.91635	0.524;0.996;0.999	T	0.79230	-0.1889	10	0.29301	T	0.29	.	19.9037	0.96999	0.0:0.0:1.0:0.0	.	386;353;353	Q9ULB1-3;F8WB18;A7E294	.;.;.	V	386;353;353;353;387;353;353	ENSP00000385142:A386V;ENSP00000384311:A353V;ENSP00000434015:A353V;ENSP00000385017:A353V;ENSP00000385434:A353V;ENSP00000385681:A353V	ENSP00000385017:A353V	A	-	2	0	NRXN1	50704032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.708000	0.92522	0.557000	0.71058	GCA	NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000179915		0.463	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	155	0.00	0	G			50850528	50850528	-1	no_errors	ENST00000402717	ensembl	human	known	69_37n	missense	207	17.86	45	SNP	1.000	A
NSUN6	221078	genome.wustl.edu	37	10	18931451	18931451	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr10:18931451G>A	ENST00000377304.4	-	3	683	c.265C>T	c.(265-267)Cat>Tat	p.H89Y	RP11-139J15.7_ENST00000606425.1_Missense_Mutation_p.H77Y	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	89							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						AGGTCTGGATGTTGAAGAATA	0.294																																						dbGAP											0													141.0	147.0	145.0					10																	18931451		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.265C>T	10.37:g.18931451G>A	ENSP00000366519:p.His89Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ54	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_PUA,superfamily_PUA-like_domain,prints_RCMT,pfscan_PUA	p.H89Y	ENST00000377304.4	37	c.265	CCDS7130.1	10	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514534	0.64522	.	.	ENSG00000241058	ENST00000377304	T	0.34472	1.36	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	M	0.77820	2.39	0.80722	D	1	D	0.67145	0.996	P	0.61658	0.892	T	0.61302	-0.7090	10	0.48119	T	0.1	.	19.5587	0.95364	0.0:0.0:1.0:0.0	.	89	Q8TEA1	NSUN6_HUMAN	Y	89	ENSP00000366519:H89Y	ENSP00000366519:H89Y	H	-	1	0	NSUN6	18971457	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	7.386000	0.79775	2.632000	0.89209	0.563000	0.77884	CAT	NSUN6	-	NULL	ENSG00000241058		0.294	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN6	HGNC	protein_coding	OTTHUMT00000047083.1	291	0.00	0	G	NM_182543		18931451	18931451	-1	no_errors	ENST00000377304	ensembl	human	known	69_37n	missense	124	18.42	28	SNP	1.000	A
NUP160	23279	genome.wustl.edu	37	11	47859145	47859146	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr11:47859145_47859146delCT	ENST00000378460.2	-	5	824_825	c.778_779delAG	c.(778-780)agtfs	p.S261fs	NUP160_ENST00000530326.1_Frame_Shift_Del_p.S147fs|NUP160_ENST00000528071.1_Frame_Shift_Del_p.S147fs|NUP160_ENST00000532747.1_Frame_Shift_Del_p.E81fs	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	261					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CATTACTGAACTCTGTTTCAGT	0.441																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.778_779delAG	11.37:g.47859147_47859148delCT	ENSP00000367721:p.Ser261fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Frame_Shift_Del	DEL	pfam_Nucleoporin_Nup160	p.S260fs	ENST00000378460.2	37	c.779_778	CCDS31484.1	11																																																																																			NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.441	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	315	0.00	0	CT	NM_015231		47859145	47859146	-1	no_errors	ENST00000378460	ensembl	human	known	69_37n	frame_shift_del	92	36.11	52	DEL	1.000:1.000	-
PDS5B	23047	genome.wustl.edu	37	13	33275522	33275522	+	Silent	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr13:33275522C>T	ENST00000315596.10	+	17	1989	c.1803C>T	c.(1801-1803)atC>atT	p.I601I		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	601					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TGGAAATGATCAAGTTTCTCT	0.353																																						dbGAP											0													94.0	90.0	91.0					13																	33275522		1828	4079	5907	-	-	-	SO:0001819	synonymous_variant	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1803C>T	13.37:g.33275522C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Silent	SNP	superfamily_ARM-type_fold	p.I601	ENST00000315596.10	37	c.1803	CCDS41878.1	13																																																																																			PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.353	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	80	0.00	0	C	NM_015032		33275522	33275522	+1	no_errors	ENST00000315596	ensembl	human	known	69_37n	silent	227	36.77	132	SNP	0.994	T
PEX6	5190	genome.wustl.edu	37	6	42932852	42932852	+	Missense_Mutation	SNP	C	C	T	rs548845453		TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr6:42932852C>T	ENST00000304611.8	-	15	2696	c.2627G>A	c.(2626-2628)cGg>cAg	p.R876Q	PEX6_ENST00000244546.4_3'UTR	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	876					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			CTGGGAGGCCCGGTCCTCATT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		21178	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													94.0	92.0	93.0					6																	42932852		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2627G>A	6.37:g.42932852C>T	ENSP00000303511:p.Arg876Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.R876Q	ENST00000304611.8	37	c.2627	CCDS4877.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.222524	0.95139	.	.	ENSG00000124587	ENST00000304611	D	0.94897	-3.55	5.75	5.75	0.90469	.	0.054791	0.85682	D	0.000000	D	0.94437	0.8210	L	0.57536	1.79	0.80722	D	1	D	0.67145	0.996	P	0.52598	0.703	D	0.93333	0.6703	10	0.42905	T	0.14	-22.2991	19.5524	0.95326	0.0:1.0:0.0:0.0	.	876	Q13608	PEX6_HUMAN	Q	876	ENSP00000303511:R876Q	ENSP00000303511:R876Q	R	-	2	0	PEX6	43040830	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	4.692000	0.61746	2.720000	0.93068	0.555000	0.69702	CGG	PEX6	-	NULL	ENSG00000124587		0.547	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX6	HGNC	protein_coding	OTTHUMT00000040569.1	81	0.00	0	C	NM_000287		42932852	42932852	-1	no_errors	ENST00000304611	ensembl	human	known	69_37n	missense	109	17.91	24	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	74	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	123	41.98	89	SNP	1.000	A
PNLIP	5406	genome.wustl.edu	37	10	118315541	118315541	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr10:118315541T>G	ENST00000369221.2	+	9	869	c.841T>G	c.(841-843)Tta>Gta	p.L281V		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	281					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	CTGTAATCACTTAAGAAGCTA	0.403																																						dbGAP											0													183.0	165.0	171.0					10																	118315541		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.841T>G	10.37:g.118315541T>G	ENSP00000358223:p.Leu281Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSQ2	Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase,prints_Lipase_panc	p.L281V	ENST00000369221.2	37	c.841	CCDS7594.1	10	.	.	.	.	.	.	.	.	.	.	T	11.46	1.644188	0.29246	.	.	ENSG00000175535	ENST00000369221	D	0.90732	-2.72	6.16	-3.9	0.04181	Lipase, N-terminal (1);	0.000000	0.51477	D	0.000081	D	0.87434	0.6176	L	0.50847	1.595	0.34438	D	0.699296	P	0.43633	0.813	P	0.48454	0.578	D	0.84898	0.0840	10	0.26408	T	0.33	.	11.4118	0.49929	0.1086:0.5738:0.0:0.3177	.	281	P16233	LIPP_HUMAN	V	281	ENSP00000358223:L281V	ENSP00000358223:L281V	L	+	1	2	PNLIP	118305531	0.219000	0.23619	0.794000	0.32065	0.977000	0.68977	-0.269000	0.08596	-0.636000	0.05524	-0.297000	0.09499	TTA	PNLIP	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	ENSG00000175535		0.403	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIP	HGNC	protein_coding	OTTHUMT00000050524.1	211	0.00	0	T	NM_000936		118315541	118315541	+1	no_errors	ENST00000369221	ensembl	human	known	69_37n	missense	212	17.83	46	SNP	0.254	G
PRDM1	639	genome.wustl.edu	37	6	106553776	106553776	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr6:106553776G>A	ENST00000369096.4	+	5	1975	c.1741G>A	c.(1741-1743)Gcc>Acc	p.A581T	PRDM1_ENST00000369089.3_Missense_Mutation_p.A447T|PRDM1_ENST00000369091.2_Missense_Mutation_p.A545T	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	581					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CAACGTTTGCGCCAAGACTTT	0.478			"""D, N, Mis, F, S"""		DLBCL																																	dbGAP		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											56.0	50.0	52.0					6																	106553776		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1741G>A	6.37:g.106553776G>A	ENSP00000358092:p.Ala581Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.A581T	ENST00000369096.4	37	c.1741	CCDS5054.2	6	.	.	.	.	.	.	.	.	.	.	G	14.51	2.558071	0.45590	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	T;T;T	0.27890	1.64;1.64;1.64	5.74	-0.29	0.12847	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.295249	0.42821	D	0.000653	T	0.05731	0.0150	N	0.14661	0.345	0.32456	N	0.544785	B;B	0.14438	0.01;0.01	B;B	0.12156	0.004;0.007	T	0.36335	-0.9752	10	0.22109	T	0.4	-14.2813	10.8009	0.46487	0.0762:0.0:0.1919:0.7319	.	447;581	Q86WM7;O75626	.;PRDM1_HUMAN	T	545;581;544;447	ENSP00000358087:A545T;ENSP00000358092:A581T;ENSP00000358085:A447T	ENSP00000358085:A447T	A	+	1	0	PRDM1	106660469	1.000000	0.71417	0.907000	0.35723	0.995000	0.86356	2.100000	0.41777	0.006000	0.14734	0.655000	0.94253	GCC	PRDM1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_Znf_C2H2	ENSG00000057657		0.478	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	74	0.00	0	G			106553776	106553776	+1	no_errors	ENST00000369096	ensembl	human	known	69_37n	missense	27	28.21	11	SNP	0.998	A
PRLR	5618	genome.wustl.edu	37	5	35086314	35086314	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr5:35086314C>T	ENST00000382002.5	-	4	625	c.199G>A	c.(199-201)Gaa>Aaa	p.E67K	PRLR_ENST00000231423.3_Missense_Mutation_p.E67K|PRLR_ENST00000342362.5_Intron|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000348262.3_Missense_Mutation_p.E67K|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000542609.1_Missense_Mutation_p.E67K|PRLR_ENST00000513753.1_Missense_Mutation_p.E67K|PRLR_ENST00000310101.5_Missense_Mutation_p.E67K|PRLR_ENST00000511486.1_Intron	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	67	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	TCTTACCCTTCCCTGTGGTAA	0.478																																						dbGAP											0													131.0	120.0	124.0					5																	35086314		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.199G>A	5.37:g.35086314C>T	ENSP00000371432:p.Glu67Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E67K	ENST00000382002.5	37	c.199	CCDS3909.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.558563	0.96514	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000348262;ENST00000542609;ENST00000382002;ENST00000310101;ENST00000514206;ENST00000509839;ENST00000503330	T;T;T;T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.98	5.98	0.97165	Fibronectin, type III (3);Growth hormone/erythropoietin receptor, ligand binding (1);Immunoglobulin-like fold (1);	0.136762	0.64402	D	0.000004	T	0.78805	0.4341	L	0.52011	1.625	0.80722	D	1	D;D;D;D	0.76494	0.989;0.994;0.999;0.999	P;D;D;D	0.68621	0.892;0.917;0.959;0.959	T	0.79082	-0.1949	10	0.87932	D	0	.	19.2161	0.93778	0.0:1.0:0.0:0.0	.	67;67;67;67	P16471;P16471-7;P16471-6;P16471-4	PRLR_HUMAN;.;.;.	K	67	ENSP00000231423:E67K;ENSP00000424841:E67K;ENSP00000311613:E67K;ENSP00000441813:E67K;ENSP00000371432:E67K;ENSP00000309008:E67K;ENSP00000423493:E67K;ENSP00000427060:E67K;ENSP00000422385:E67K	ENSP00000231423:E67K	E	-	1	0	PRLR	35122071	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	6.693000	0.74582	2.834000	0.97654	0.655000	0.94253	GAA	PRLR	-	pfam_Growth/epo_recpt_lig-bind,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113494		0.478	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	185	0.00	0	C			35086314	35086314	-1	no_errors	ENST00000382002	ensembl	human	known	69_37n	missense	91	45.24	76	SNP	1.000	T
RBM27	54439	genome.wustl.edu	37	5	145641353	145641353	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr5:145641353A>G	ENST00000265271.5	+	13	2340	c.2174A>G	c.(2173-2175)cAc>cGc	p.H725R	RBM27_ENST00000506502.1_Missense_Mutation_p.H670R	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	725					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCAACAGTGCACGGAGGTATC	0.483																																						dbGAP											0													61.0	55.0	57.0					5																	145641353		1568	3582	5150	-	-	-	SO:0001583	missense	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2174A>G	5.37:g.145641353A>G	ENSP00000265271:p.His725Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYW9	Missense_Mutation	SNP	pfam_PWI,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.H725R	ENST00000265271.5	37	c.2174	CCDS43378.1	5	.	.	.	.	.	.	.	.	.	.	A	9.832	1.188739	0.21954	.	.	ENSG00000091009	ENST00000265271	T	0.42900	0.96	5.5	5.5	0.81552	.	0.069184	0.64402	D	0.000011	T	0.47432	0.1445	L	0.34521	1.04	0.40766	D	0.983047	P;P	0.50156	0.932;0.928	P;B	0.58520	0.84;0.221	T	0.34229	-0.9837	10	0.21014	T	0.42	-15.1172	14.1823	0.65583	1.0:0.0:0.0:0.0	.	725;670	Q9P2N5;B3KY61	RBM27_HUMAN;.	R	725	ENSP00000265271:H725R	ENSP00000265271:H725R	H	+	2	0	RBM27	145621546	1.000000	0.71417	0.404000	0.26397	0.156000	0.22039	4.040000	0.57333	2.097000	0.63578	0.459000	0.35465	CAC	RBM27	-	NULL	ENSG00000091009		0.483	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1	120	0.00	0	A	XM_291128		145641353	145641353	+1	no_errors	ENST00000265271	ensembl	human	known	69_37n	missense	28	40.82	20	SNP	0.944	G
RBM5	10181	genome.wustl.edu	37	3	50154522	50154522	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr3:50154522C>T	ENST00000347869.3	+	23	2285	c.2110C>T	c.(2110-2112)Cga>Tga	p.R704*	RP11-493K19.3_ENST00000437204.1_RNA|RP11-493K19.3_ENST00000425674.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	704	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ATACCGAGACCGAGCTGCAGA	0.478																																						dbGAP											0													115.0	110.0	112.0					3																	50154522		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.2110C>T	3.37:g.50154522C>T	ENSP00000343054:p.Arg704*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Nonsense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.R704*	ENST00000347869.3	37	c.2110	CCDS2810.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.112079	0.98070	.	.	ENSG00000003756	ENST00000347869;ENST00000543047;ENST00000544851	.	.	.	5.53	2.49	0.30216	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4144	14.0491	0.64725	0.5146:0.4854:0.0:0.0	.	.	.	.	X	704;703;394	.	ENSP00000343054:R704X	R	+	1	2	RBM5	50129526	1.000000	0.71417	0.992000	0.48379	0.972000	0.66771	1.167000	0.31847	0.653000	0.30826	0.555000	0.69702	CGA	RBM5	-	NULL	ENSG00000003756		0.478	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3	42	0.00	0	C	NM_005778		50154522	50154522	+1	no_errors	ENST00000347869	ensembl	human	known	69_37n	nonsense	157	34.31	82	SNP	0.996	T
SALL2	6297	genome.wustl.edu	37	14	21991858	21991858	+	Silent	SNP	G	G	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr14:21991858G>A	ENST00000327430.3	-	2	2298	c.2004C>T	c.(2002-2004)ttC>ttT	p.F668F	AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000450879.2_Silent_p.F531F	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	668					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CCCTGGTGGAGAAGGCTCTGC	0.572																																						dbGAP											0													61.0	54.0	57.0					14																	21991858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2004C>T	14.37:g.21991858G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S527F	ENST00000327430.3	37	c.1580	CCDS32045.1	14	.	.	.	.	.	.	.	.	.	.	G	1.211	-0.629768	0.03610	.	.	ENSG00000165821	ENST00000546363	.	.	.	4.76	1.95	0.26073	.	.	.	.	.	T	0.54287	0.1849	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42816	-0.9429	4	.	.	.	-36.0648	6.615	0.22773	0.3844:0.0:0.6156:0.0	.	.	.	.	F	527	.	.	S	-	2	0	SALL2	21061698	1.000000	0.71417	0.999000	0.59377	0.572000	0.35998	2.289000	0.43523	0.236000	0.21180	0.557000	0.71058	TCT	SALL2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000165821		0.572	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	HGNC	protein_coding	OTTHUMT00000401242.1	78	0.00	0	G	NM_005407		21991858	21991858	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000546363	ensembl	human	putative	69_37n	missense	54	30.77	24	SNP	1.000	A
SLC24A3	57419	genome.wustl.edu	37	20	19560658	19560658	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr20:19560658C>G	ENST00000328041.6	+	4	560	c.363C>G	c.(361-363)ttC>ttG	p.F121L		NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	121					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TATACATGTTCTATGCGCTGG	0.478																																						dbGAP											0													371.0	266.0	301.0					20																	19560658		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.363C>G	20.37:g.19560658C>G	ENSP00000333519:p.Phe121Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.F121L	ENST00000328041.6	37	c.363	CCDS13140.1	20	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848850	0.71603	.	.	ENSG00000185052	ENST00000328041	T	0.74737	-0.87	5.34	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.75591	0.3870	L	0.48362	1.52	0.58432	D	0.999999	P	0.45212	0.853	P	0.56474	0.799	T	0.71444	-0.4591	9	.	.	.	.	7.8063	0.29204	0.0:0.7433:0.0:0.2567	.	121	Q9HC58	NCKX3_HUMAN	L	121	ENSP00000333519:F121L	.	F	+	3	2	SLC24A3	19508658	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.110000	0.31147	0.751000	0.32900	0.655000	0.94253	TTC	SLC24A3	-	tigrfam_K-dep_Na/Ca-exchanger-like	ENSG00000185052		0.478	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A3	HGNC	protein_coding	OTTHUMT00000078207.4	67	0.00	0	C	NM_020689		19560658	19560658	+1	no_errors	ENST00000328041	ensembl	human	known	69_37n	missense	598	15.40	109	SNP	1.000	G
SNCAIP	9627	genome.wustl.edu	37	5	121758575	121758575	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr5:121758575G>C	ENST00000261368.8	+	4	405	c.143G>C	c.(142-144)aGc>aCc	p.S48T	SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000379533.2_Missense_Mutation_p.S95T|SNCAIP_ENST00000379538.3_Intron|SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000504884.2_Intron|SNCAIP_ENST00000379536.2_Missense_Mutation_p.S48T|SNCAIP_ENST00000261367.7_Missense_Mutation_p.S95T|SNCAIP_ENST00000503116.2_Missense_Mutation_p.S95T	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	48					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TCTAGCTCTAGCTGGAATTGT	0.408																																						dbGAP											0													50.0	52.0	52.0					5																	121758575		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.143G>C	5.37:g.121758575G>C	ENSP00000261368:p.Ser48Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S95T	ENST00000261368.8	37	c.284	CCDS4131.1	5	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726110	0.30593	.	.	ENSG00000064692	ENST00000514467;ENST00000506272;ENST00000508681;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000261367;ENST00000503116	T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.72	3.85	0.44370	.	0.374822	0.35235	N	0.003356	T	0.17238	0.0414	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.34329	0.001;0.029;0.449;0.001	B;B;B;B	0.35971	0.002;0.023;0.215;0.002	T	0.02813	-1.1107	10	0.49607	T	0.09	-2.1075	7.2424	0.26104	0.187:0.1389:0.6741:0.0	.	48;95;95;48	D6R9G8;Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5	.;.;.;SNCAP_HUMAN	T	48;95;48;48;48;95;48;95;95	ENSP00000427090:S48T;ENSP00000426551:S95T;ENSP00000422610:S48T;ENSP00000422106:S48T;ENSP00000261368:S48T;ENSP00000368848:S95T;ENSP00000368851:S48T;ENSP00000261367:S95T;ENSP00000423199:S95T	ENSP00000261367:S95T	S	+	2	0	SNCAIP	121786474	0.998000	0.40836	0.987000	0.45799	0.989000	0.77384	2.532000	0.45659	2.704000	0.92352	0.655000	0.94253	AGC	SNCAIP	-	NULL	ENSG00000064692		0.408	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	121	0.00	0	G			121758575	121758575	+1	no_errors	ENST00000379533	ensembl	human	known	69_37n	missense	34	60.47	52	SNP	0.984	C
SNW1	22938	genome.wustl.edu	37	14	78205185	78205185	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr14:78205185G>A	ENST00000261531.7	-	5	531	c.469C>T	c.(469-471)Cag>Tag	p.Q157*	SNW1_ENST00000555761.1_Nonsense_Mutation_p.Q157*|SNW1_ENST00000554775.1_5'UTR|SLIRP_ENST00000557431.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	157					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GCGACCTTCTGTGATACAGAT	0.403																																						dbGAP											0													87.0	89.0	88.0					14																	78205185		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.469C>T	14.37:g.78205185G>A	ENSP00000261531:p.Gln157*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8A9|Q13483|Q32N03|Q5D0D6	Nonsense_Mutation	SNP	pfam_SKI-int_prot_SKIP_SNW-dom,superfamily_Signal_recog_particl_SRP54_hlx	p.Q157*	ENST00000261531.7	37	c.469	CCDS9867.1	14	.	.	.	.	.	.	.	.	.	.	G	22.4	4.282181	0.80692	.	.	ENSG00000100603	ENST00000261531;ENST00000555761;ENST00000416259	.	.	.	5.81	5.81	0.92471	.	0.102660	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	20.0796	0.97766	0.0:0.0:1.0:0.0	.	.	.	.	X	157	.	ENSP00000261531:Q157X	Q	-	1	0	SNW1	77274938	1.000000	0.71417	0.982000	0.44146	0.984000	0.73092	9.420000	0.97426	2.758000	0.94735	0.460000	0.39030	CAG	SNW1	-	NULL	ENSG00000100603		0.403	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNW1	HGNC	protein_coding	OTTHUMT00000413912.1	127	0.00	0	G	NM_012245		78205185	78205185	-1	no_errors	ENST00000261531	ensembl	human	known	69_37n	nonsense	132	32.83	65	SNP	1.000	A
SSPN	8082	genome.wustl.edu	37	12	26383694	26383694	+	Silent	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr12:26383694C>T	ENST00000242729.2	+	3	594	c.417C>T	c.(415-417)gcC>gcT	p.A139A	SSPN_ENST00000540266.1_Silent_p.A36A|RP11-283G6.5_ENST00000537525.1_RNA|RP11-283G6.5_ENST00000541940.1_RNA|RP11-283G6.5_ENST00000540625.1_RNA|RP11-283G6.4_ENST00000540392.1_RNA|SSPN_ENST00000422622.2_Silent_p.A36A|SSPN_ENST00000535504.1_Intron	NM_005086.4	NP_005077.2	Q14714	SSPN_HUMAN	sarcospan	139					cell adhesion (GO:0007155)|muscle contraction (GO:0006936)	cell junction (GO:0030054)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10	Colorectal(261;0.0847)					GTGTGCTGGCCGTGGCCTTTG	0.537																																						dbGAP											0													84.0	81.0	82.0					12																	26383694		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF016028	CCDS8707.1, CCDS44850.1	12p11.2	2014-09-17	2012-03-14			ENSG00000123096			11322	protein-coding gene	gene with protein product		601599	"""Kras oncogene-associated gene"""	KRAG		9395445, 8661122	Standard	NM_005086		Approved	SPN1, SPN2	uc001rhe.3	Q14714		ENST00000242729.2:c.417C>T	12.37:g.26383694C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS67	Silent	SNP	pfam_CD20-like	p.A139	ENST00000242729.2	37	c.417	CCDS8707.1	12																																																																																			SSPN	-	pfam_CD20-like	ENSG00000123096		0.537	SSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSPN	HGNC	protein_coding	OTTHUMT00000402654.2	67	0.00	0	C	NM_005086		26383694	26383694	+1	no_errors	ENST00000242729	ensembl	human	known	69_37n	silent	135	14.01	22	SNP	0.277	T
STAG3L1	54441	genome.wustl.edu	37	7	74991317	74991317	+	RNA	DEL	G	G	-			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr7:74991317delG	ENST00000402225.5	+	0	393							P0CL83	ST3L1_HUMAN	stromal antigen 3-like 1 (pseudogene)							nucleus (GO:0005634)											ACCAGCCAATGATCTTTTCAA	0.438																																						dbGAP											0													1.0	3.0	2.0					7																	74991317		527	1736	2263	-	-	-			0					7q11.23	2013-06-26	2013-06-26		ENSG00000205583	ENSG00000205583			33852	pseudogene	pseudogene			"""stromal antigen 3-like 1"""				Standard	NR_040583		Approved	DKFZP434A0131, STAG3L1P	uc022agf.1	P0CL83	OTTHUMG00000155940		7.37:g.74991317delG		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	RNA	DEL	-	NULL	ENST00000402225.5	37	NULL		7																																																																																			STAG3L1	-	-	ENSG00000205583		0.438	STAG3L1-012	KNOWN	basic	processed_transcript	STAG3L1	HGNC	pseudogene	OTTHUMT00000437242.1	94	0.00	0	G	NM_001002840		74991317	74991317	+1	no_errors	ENST00000402225	ensembl	human	known	69_37n	rna	40	19.23	10	DEL	0.943	-
TPR	7175	genome.wustl.edu	37	1	186287865	186287865	+	Splice_Site	SNP	C	C	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr1:186287865C>T	ENST00000367478.4	-	47	6960	c.6664G>A	c.(6664-6666)Gtg>Atg	p.V2222M		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2222					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGATCCCTACCTGGGGCTGCT	0.403			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													128.0	122.0	124.0					1																	186287865		1853	4091	5944	-	-	-	SO:0001630	splice_region_variant	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6664+1G>A	1.37:g.186287865C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.V2222M	ENST00000367478.4	37	c.6664	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.975675	0.92919	.	.	ENSG00000047410	ENST00000367478	T	0.26223	1.75	5.62	5.62	0.85841	.	0.060125	0.64402	D	0.000003	T	0.52693	0.1750	M	0.71581	2.175	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.46925	-0.9156	9	.	.	.	.	19.6768	0.95939	0.0:1.0:0.0:0.0	.	2222	P12270	TPR_HUMAN	M	2222	ENSP00000356448:V2222M	.	V	-	1	0	TPR	184554488	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.487000	0.81328	2.634000	0.89283	0.655000	0.94253	GTG	TPR	-	NULL	ENSG00000047410		0.403	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	126	0.00	0	C	NM_003292	Missense_Mutation	186287865	186287865	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	112	25.33	38	SNP	0.995	T
TSG101	7251	genome.wustl.edu	37	11	18531179	18531179	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr11:18531179T>C	ENST00000251968.3	-	5	806	c.391A>G	c.(391-393)Atg>Gtg	p.M131V	TSG101_ENST00000543087.1_5'UTR|TSG101_ENST00000357193.3_Missense_Mutation_p.M26V|TSG101_ENST00000536719.1_Missense_Mutation_p.M131V|RP11-613F22.8_ENST00000539313.1_RNA	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	131	UEV. {ECO:0000255|PROSITE- ProRule:PRU00652}.				cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						ACCACAATCATGACCTGAATA	0.428																																					GBM(99;1348 1396 8611 26475 50572)	dbGAP											0													88.0	86.0	87.0					11																	18531179		2199	4293	6492	-	-	-	SO:0001583	missense	0			U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.391A>G	11.37:g.18531179T>C	ENSP00000251968:p.Met131Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUM5	Missense_Mutation	SNP	pfam_UEV_N,pfam_Steadiness_box,superfamily_UBQ-conjugating_enzyme/RWD	p.M131V	ENST00000251968.3	37	c.391	CCDS7842.1	11	.	.	.	.	.	.	.	.	.	.	T	19.00	3.742288	0.69418	.	.	ENSG00000074319	ENST00000536719;ENST00000251968;ENST00000357193	T;T;T	0.58060	0.76;0.76;0.36	5.37	5.37	0.77165	Ubiquitin E2 variant, N-terminal (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.042782	0.85682	D	0.000000	T	0.66187	0.2764	M	0.92317	3.295	0.80722	D	1	B	0.18968	0.032	B	0.33454	0.164	T	0.69778	-0.5053	10	0.72032	D	0.01	-10.9239	11.4372	0.50074	0.0:0.0:0.1506:0.8494	.	131	Q99816	TS101_HUMAN	V	131;131;26	ENSP00000438471:M131V;ENSP00000251968:M131V;ENSP00000349721:M26V	ENSP00000251968:M131V	M	-	1	0	TSG101	18487755	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.193000	0.72075	2.036000	0.60181	0.524000	0.50904	ATG	TSG101	-	pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD	ENSG00000074319		0.428	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSG101	HGNC	protein_coding	OTTHUMT00000395906.1	156	0.00	0	T	NM_006292		18531179	18531179	-1	no_errors	ENST00000251968	ensembl	human	known	69_37n	missense	89	16.04	17	SNP	1.000	C
TTYH2	94015	genome.wustl.edu	37	17	72248454	72248454	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr17:72248454G>T	ENST00000269346.4	+	11	1272	c.1198G>T	c.(1198-1200)Gcc>Tcc	p.A400S	TTYH2_ENST00000441391.2_Missense_Mutation_p.A79S|TTYH2_ENST00000529107.1_Missense_Mutation_p.A379S	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	400						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CTTCCTGGCCGCCCTCGCCTT	0.622																																						dbGAP											0													101.0	82.0	88.0					17																	72248454		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.1198G>T	17.37:g.72248454G>T	ENSP00000269346:p.Ala400Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	pfam_Tweety	p.A400S	ENST00000269346.4	37	c.1198	CCDS32717.1	17	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220673	0.79464	.	.	ENSG00000141540	ENST00000269346;ENST00000529107;ENST00000441391	T;T;T	0.18657	2.2;2.2;2.2	5.79	4.83	0.62350	.	0.212631	0.47852	D	0.000201	T	0.51075	0.1653	M	0.89414	3.03	0.52501	D	0.999959	D;D	0.64830	0.987;0.994	P;D	0.67382	0.794;0.951	T	0.61367	-0.7077	10	0.87932	D	0	-23.6684	13.7571	0.62943	0.0746:0.0:0.9254:0.0	.	379;400	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	S	400;379;79	ENSP00000269346:A400S;ENSP00000433089:A379S;ENSP00000394576:A79S	ENSP00000269346:A400S	A	+	1	0	TTYH2	69760049	1.000000	0.71417	0.895000	0.35142	0.630000	0.37929	4.308000	0.59129	1.447000	0.47661	0.655000	0.94253	GCC	TTYH2	-	pfam_Tweety	ENSG00000141540		0.622	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	HGNC	protein_coding	OTTHUMT00000387459.1	42	0.00	0	G			72248454	72248454	+1	no_errors	ENST00000269346	ensembl	human	known	69_37n	missense	177	16.51	35	SNP	0.992	T
UCHL3	7347	genome.wustl.edu	37	13	76141383	76141383	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr13:76141383A>G	ENST00000377595.3	+	5	391	c.361A>G	c.(361-363)Aaa>Gaa	p.K121E	RP11-29G8.3_ENST00000563635.1_RNA	NM_001270952.1|NM_006002.4	NP_001257881.1|NP_005993.1	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)	121					protein catabolic process (GO:0030163)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(2)|lung(3)|skin(1)	7				GBM - Glioblastoma multiforme(99;0.0125)		AACCTTGAAAAAATTCCTGGA	0.388																																						dbGAP											0													101.0	105.0	103.0					13																	76141383		2203	4300	6503	-	-	-	SO:0001583	missense	0			M30496	CCDS9453.1, CCDS73586.1	13q21.33	2008-02-05			ENSG00000118939	ENSG00000118939	3.2.1.15		12515	protein-coding gene	gene with protein product		603090				2530630	Standard	NM_001270952		Approved		uc001vjq.4	P15374	OTTHUMG00000017090	ENST00000377595.3:c.361A>G	13.37:g.76141383A>G	ENSP00000366819:p.Lys121Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R970|Q5TBK8|Q6IBE9	Missense_Mutation	SNP	pfam_Peptidase_C12,prints_Peptidase_C12	p.K121E	ENST00000377595.3	37	c.361	CCDS9453.1	13	.	.	.	.	.	.	.	.	.	.	A	17.02	3.282955	0.59867	.	.	ENSG00000118939	ENST00000377595;ENST00000377589;ENST00000419068	T;T	0.55052	0.54;0.54	6.17	4.99	0.66335	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.091851	0.64402	D	0.000001	T	0.44477	0.1295	L	0.42008	1.315	0.54753	D	0.999981	B	0.12630	0.006	B	0.19148	0.024	T	0.25710	-1.0124	10	0.25106	T	0.35	-22.7499	12.4759	0.55814	0.935:0.0:0.065:0.0	.	121	P15374	UCHL3_HUMAN	E	121;78;55	ENSP00000366819:K121E;ENSP00000398189:K55E	ENSP00000366813:K78E	K	+	1	0	UCHL3	75039384	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.608000	0.82898	1.144000	0.42321	0.533000	0.62120	AAA	UCHL3	-	pfam_Peptidase_C12	ENSG00000118939		0.388	UCHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCHL3	HGNC	protein_coding	OTTHUMT00000045292.2	244	0.00	0	A	NM_006002		76141383	76141383	+1	no_errors	ENST00000377595	ensembl	human	known	69_37n	missense	107	28.67	43	SNP	1.000	G
USP51	158880	genome.wustl.edu	37	X	55513981	55513981	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chrX:55513981G>C	ENST00000500968.3	-	2	1474	c.1392C>G	c.(1390-1392)caC>caG	p.H464Q	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	464	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						CATCTTTGCTGTGTCTATGTA	0.458																																						dbGAP											0													136.0	107.0	117.0					X																	55513981		2203	4300	6503	-	-	-	SO:0001583	missense	0			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.1392C>G	X.37:g.55513981G>C	ENSP00000423333:p.His464Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWJ8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.H464Q	ENST00000500968.3	37	c.1392	CCDS14370.1	X	.	.	.	.	.	.	.	.	.	.	.	13.69	2.312531	0.40895	.	.	ENSG00000247746	ENST00000500968	T	0.28895	1.59	3.04	2.17	0.27698	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	U	0.000000	T	0.47525	0.1450	M	0.75615	2.305	0.51482	D	0.999923	D	0.89917	1.0	D	0.85130	0.997	T	0.39014	-0.9634	10	0.48119	T	0.1	.	4.702	0.12832	0.3048:0.0:0.6952:0.0	.	464	Q70EK9	UBP51_HUMAN	Q	464	ENSP00000423333:H464Q	ENSP00000423333:H464Q	H	-	3	2	USP51	55530706	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.880000	0.63107	0.689000	0.31550	0.508000	0.49915	CAC	USP51	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000247746		0.458	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP51	HGNC	protein_coding	OTTHUMT00000056871.2	175	0.00	0	G	NM_201286		55513981	55513981	-1	no_errors	ENST00000500968	ensembl	human	known	69_37n	missense	189	12.90	28	SNP	1.000	C
WHSC1	7468	genome.wustl.edu	37	4	1920229	1920229	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr4:1920229A>G	ENST00000382895.3	+	7	1720	c.1289A>G	c.(1288-1290)gAc>gGc	p.D430G	WHSC1_ENST00000508803.1_Missense_Mutation_p.D430G|WHSC1_ENST00000382892.2_Missense_Mutation_p.D430G|WHSC1_ENST00000514045.1_Missense_Mutation_p.D430G|WHSC1_ENST00000382891.5_Missense_Mutation_p.D430G|WHSC1_ENST00000420906.2_Missense_Mutation_p.D430G|WHSC1_ENST00000503128.1_Missense_Mutation_p.D430G|WHSC1_ENST00000398261.1_Missense_Mutation_p.D430G	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	430					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GCAGAGGCTGACCCCAGAAGA	0.557			T	IGH@	MM																																	dbGAP		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0													31.0	34.0	33.0					4																	1920229		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1289A>G	4.37:g.1920229A>G	ENSP00000372351:p.Asp430Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_superfamily,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_PWWP,smart_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_superfamily	p.D430G	ENST00000382895.3	37	c.1289	CCDS33940.1	4	.	.	.	.	.	.	.	.	.	.	A	12.59	1.982254	0.34942	.	.	ENSG00000109685	ENST00000508803;ENST00000514045;ENST00000382891;ENST00000382892;ENST00000420906;ENST00000382895;ENST00000503128;ENST00000398261	D;T;D;D;T;D;T;T	0.95171	-3.63;1.18;-3.63;-3.63;1.18;-3.63;1.18;1.18	5.22	2.8	0.32819	.	0.527765	0.17558	N	0.169920	D	0.90021	0.6884	L	0.34521	1.04	0.58432	D	0.99999	B;B;B;P	0.36789	0.204;0.055;0.204;0.57	B;B;B;B	0.39217	0.107;0.036;0.107;0.294	D	0.84885	0.0833	10	0.39692	T	0.17	.	9.2813	0.37731	0.8538:0.0:0.1462:0.0	.	430;430;430;430	O96028-3;O96028;O96028-5;O96028-6	.;NSD2_HUMAN;.;.	G	430	ENSP00000423972:D430G;ENSP00000421681:D430G;ENSP00000372347:D430G;ENSP00000372348:D430G;ENSP00000399251:D430G;ENSP00000372351:D430G;ENSP00000425761:D430G;ENSP00000381311:D430G	ENSP00000308780:D430G	D	+	2	0	WHSC1	1890027	0.643000	0.27269	0.006000	0.13384	0.791000	0.44710	1.530000	0.36007	0.408000	0.25621	0.454000	0.30748	GAC	WHSC1	-	NULL	ENSG00000109685		0.557	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2	37	0.00	0	A	NM_133330		1920229	1920229	+1	no_errors	ENST00000382891	ensembl	human	known	69_37n	missense	73	25.74	26	SNP	0.278	G
ZC3H18	124245	genome.wustl.edu	37	16	88677692	88677693	+	Frame_Shift_Del	DEL	GA	GA	-	rs145094173		TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr16:88677692_88677693delGA	ENST00000301011.5	+	8	1423_1424	c.1223_1224delGA	c.(1222-1224)cgafs	p.R408fs	ZC3H18_ENST00000452588.2_Frame_Shift_Del_p.R432fs	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	408						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		gagcgggagcgagagagagaga	0.644																																					Ovarian(121;375 2276 20373 38669)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1223_1224delGA	16.37:g.88677702_88677703delGA	ENSP00000301011:p.Arg408fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DG4|Q96MP7	Frame_Shift_Del	DEL	smart_Znf_CCCH	p.E411fs	ENST00000301011.5	37	c.1223_1224	CCDS10967.1	16																																																																																			ZC3H18	-	NULL	ENSG00000158545		0.644	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	HGNC	protein_coding	OTTHUMT00000269168.1	8	0.00	0	GA	NM_144604		88677692	88677693	+1	no_errors	ENST00000301011	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.616:0.522	-
ZFHX4	79776	genome.wustl.edu	37	8	77620135	77620135	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06R-01A-11D-A015-09	TCGA-A8-A06R-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c6b00eff-6c4e-4d79-a9b1-8fb1f3090816	bf64ab88-5956-4a6a-a303-6a2cbb82f649	g.chr8:77620135A>G	ENST00000521891.2	+	3	3393	c.2945A>G	c.(2944-2946)aAa>aGa	p.K982R	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.K956R|ZFHX4_ENST00000455469.2_Missense_Mutation_p.K956R|ZFHX4_ENST00000518282.1_Missense_Mutation_p.K956R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	956					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GAAGGGGGCAAAAGCAATGAG	0.428										HNSCC(33;0.089)																												dbGAP											0													107.0	108.0	108.0					8																	77620135		2168	4278	6446	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2945A>G	8.37:g.77620135A>G	ENSP00000430497:p.Lys982Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.K982R	ENST00000521891.2	37	c.2945	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	A	12.89	2.074540	0.36566	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.28	5.28	0.74379	.	0.000000	0.47455	U	0.000231	T	0.60907	0.2305	L	0.58925	1.835	0.80722	D	1	D;D;D;P	0.63880	0.988;0.993;0.993;0.508	P;P;P;B	0.60789	0.76;0.879;0.879;0.159	T	0.58358	-0.7650	10	0.33141	T	0.24	.	15.3829	0.74673	1.0:0.0:0.0:0.0	.	956;956;982;956	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	R	982;982;956;956;956	ENSP00000430497:K982R;ENSP00000399605:K956R;ENSP00000050961:K956R;ENSP00000430848:K956R	ENSP00000050961:K956R	K	+	2	0	ZFHX4	77782690	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.761000	0.91691	2.230000	0.72887	0.528000	0.53228	AAA	ZFHX4	-	NULL	ENSG00000091656		0.428	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	141	0.00	0	A	NM_024721		77620135	77620135	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	188	10.48	22	SNP	1.000	G
