#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA6	23460	genome.wustl.edu	37	17	67110993	67110993	+	Missense_Mutation	SNP	G	G	C	rs535844796	byFrequency	TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr17:67110993G>C	ENST00000284425.2	-	13	1866	c.1692C>G	c.(1690-1692)ttC>ttG	p.F564L		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	564	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.F564L(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					ATTGAACATTGAATTGAGGAC	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											150.0	136.0	140.0					17																	67110993		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1692C>G	17.37:g.67110993G>C	ENSP00000284425:p.Phe564Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F564L	ENST00000284425.2	37	c.1692	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	G	0.677	-0.799521	0.02841	.	.	ENSG00000154262	ENST00000284425	D	0.93604	-3.25	4.87	1.62	0.23740	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.548853	0.16345	N	0.218493	D	0.87083	0.6089	L	0.55017	1.72	0.80722	D	1	B	0.02656	0.0	B	0.12837	0.008	T	0.72487	-0.4278	10	0.07482	T	0.82	.	3.8343	0.08888	0.411:0.0:0.4259:0.1631	.	564	Q8N139	ABCA6_HUMAN	L	564	ENSP00000284425:F564L	ENSP00000284425:F564L	F	-	3	2	ABCA6	64622588	0.002000	0.14202	0.932000	0.37286	0.090000	0.18270	-0.135000	0.10420	0.253000	0.21552	-0.158000	0.13435	TTC	ABCA6	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154262		0.383	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	344	0.00	0	G	NM_080284		67110993	67110993	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	missense	288	38.59	181	SNP	0.992	C
APOB	338	genome.wustl.edu	37	2	21231263	21231263	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr2:21231263T>C	ENST00000233242.1	-	26	8604	c.8477A>G	c.(8476-8478)gAg>gGg	p.E2826G		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2826					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.E2826G(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTCACTGACTCCTTCAGAGC	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											115.0	119.0	118.0					2																	21231263		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8477A>G	2.37:g.21231263T>C	ENSP00000233242:p.Glu2826Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E2826G	ENST00000233242.1	37	c.8477	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	T	11.24	1.581046	0.28180	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01165	5.24	5.36	5.36	0.76844	.	0.137434	0.33732	N	0.004611	T	0.03827	0.0108	M	0.64997	1.995	0.80722	D	1	D	0.59767	0.986	P	0.53266	0.722	T	0.44128	-0.9348	10	0.72032	D	0.01	.	15.0165	0.71588	0.0:0.0:0.0:1.0	.	2826	P04114	APOB_HUMAN	G	2826	ENSP00000233242:E2826G	ENSP00000233242:E2826G	E	-	2	0	APOB	21084768	1.000000	0.71417	0.904000	0.35570	0.073000	0.16967	6.096000	0.71446	2.033000	0.60031	0.454000	0.30748	GAG	APOB	-	NULL	ENSG00000084674		0.418	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	492	0.00	0	T			21231263	21231263	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	216	31.86	101	SNP	0.977	C
ARG2	384	genome.wustl.edu	37	14	68117462	68117462	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr14:68117462T>C	ENST00000261783.3	+	8	1070	c.890T>C	c.(889-891)gTc>gCc	p.V297A	VTI1B_ENST00000554659.1_3'UTR	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	297					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)	p.V297A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	CTTGTTGAAGTCAATCCTCAG	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											126.0	110.0	115.0					14																	68117462		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.890T>C	14.37:g.68117462T>C	ENSP00000261783:p.Val297Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R690|Q6FHY8	Missense_Mutation	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase	p.V297A	ENST00000261783.3	37	c.890	CCDS9785.1	14	.	.	.	.	.	.	.	.	.	.	T	25.3	4.619143	0.87460	.	.	ENSG00000081181	ENST00000261783	D	0.87571	-2.27	5.09	5.09	0.68999	Ureohydrolase domain (1);	0.057036	0.64402	D	0.000001	D	0.96018	0.8703	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97609	1.0128	10	0.87932	D	0	.	15.0377	0.71761	0.0:0.0:0.0:1.0	.	297	P78540	ARGI2_HUMAN	A	297	ENSP00000261783:V297A	ENSP00000261783:V297A	V	+	2	0	ARG2	67187215	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.005000	0.76323	2.150000	0.67090	0.533000	0.62120	GTC	ARG2	-	pfam_Ureohydrolase,tigrfam_Arginase	ENSG00000081181		0.502	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARG2	HGNC	protein_coding	OTTHUMT00000415190.2	164	0.00	0	T	NM_001172		68117462	68117462	+1	no_errors	ENST00000261783	ensembl	human	known	69_37n	missense	97	25.38	33	SNP	1.000	C
ARID2	196528	genome.wustl.edu	37	12	46246210	46246210	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr12:46246210C>T	ENST00000334344.6	+	15	4476	c.4304C>T	c.(4303-4305)tCa>tTa	p.S1435L	ARID2_ENST00000457135.1_Missense_Mutation_p.S43L|ARID2_ENST00000422737.1_Missense_Mutation_p.S1286L|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Missense_Mutation_p.S1045L	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1435					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1435L(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CAGGAGGCTTCAAATGCGGCA	0.423			"""N, S, F"""		hepatocellular carcinoma																																	dbGAP		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	1	Substitution - Missense(1)	breast(1)											123.0	123.0	123.0					12																	46246210		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4304C>T	12.37:g.46246210C>T	ENSP00000335044:p.Ser1435Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S1435L	ENST00000334344.6	37	c.4304	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765163	0.31228	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T	0.32988	1.43	6.07	4.24	0.50183	.	0.821049	0.11151	N	0.594168	T	0.21062	0.0507	N	0.14661	0.345	0.29751	N	0.836336	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.15780	-1.0425	10	0.59425	D	0.04	-0.0422	11.504	0.50454	0.1263:0.8092:0.0:0.0645	.	1435;1045;1435	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	L	1435;552;552;1286;1045;43	ENSP00000335044:S1435L	ENSP00000335044:S1435L	S	+	2	0	ARID2	44532477	0.951000	0.32395	0.809000	0.32408	0.986000	0.74619	0.752000	0.26362	0.882000	0.36016	0.655000	0.94253	TCA	ARID2	-	NULL	ENSG00000189079		0.423	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	372	0.00	0	C	XM_350875		46246210	46246210	+1	no_errors	ENST00000334344	ensembl	human	known	69_37n	missense	398	14.04	65	SNP	0.999	T
ASXL2	55252	genome.wustl.edu	37	2	25978944	25978944	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr2:25978944delG	ENST00000435504.4	-	10	1272	c.979delC	c.(979-981)cttfs	p.L327fs	ASXL2_ENST00000336112.4_Frame_Shift_Del_p.L299fs|ASXL2_ENST00000404843.1_Frame_Shift_Del_p.L67fs|ASXL2_ENST00000272341.4_Frame_Shift_Del_p.L67fs			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	327					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)	p.N68fs*27(1)|p.N328fs*27(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCATTGTTAAGGGCTGAGCCA	0.438																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)											127.0	124.0	125.0					2																	25978944		1883	4112	5995	-	-	-	SO:0001589	frameshift_variant	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.979delC	2.37:g.25978944delG	ENSP00000391447:p.Leu327fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Frame_Shift_Del	DEL	superfamily_Znf_FYVE_PHD	p.N328fs	ENST00000435504.4	37	c.979		2																																																																																			ASXL2	-	NULL	ENSG00000143970		0.438	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	229	0.00	0	G	NM_018263		25978944	25978944	-1	no_errors	ENST00000435504	ensembl	human	known	69_37n	frame_shift_del	83	47.24	77	DEL	1.000	-
B3GNT3	10331	genome.wustl.edu	37	19	17922578	17922578	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr19:17922578G>C	ENST00000318683.6	+	3	913	c.766G>C	c.(766-768)Gag>Cag	p.E256Q	B3GNT3_ENST00000595387.1_Missense_Mutation_p.E256Q	NM_014256.3	NP_055071.2	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3	256					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)|galactosyltransferase activity (GO:0008378)	p.E256Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	21						CTATGTGCCAGAGGTGGTGAC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	70.0	71.0					19																	17922578		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015630	CCDS12364.1	19p13.1	2013-02-19				ENSG00000179913		"""Beta 3-glycosyltransferases"""	13528	protein-coding gene	gene with protein product	"""putative type II membrane protein"", ""beta-1,3-N-acetylglucosaminyltransferase bGnT-3"", ""transmembrane protein 3"""	605863		TMEM3		10072769, 11042166	Standard	NM_014256		Approved	B3GN-T3, beta3Gn-T3, HP10328, B3GNT-3	uc002nhl.1	Q9Y2A9		ENST00000318683.6:c.766G>C	19.37:g.17922578G>C	ENSP00000321874:p.Glu256Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAS4|Q6NWU9|Q6NXU9|Q8WWR6|Q9C0J2	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.E256Q	ENST00000318683.6	37	c.766	CCDS12364.1	19	.	.	.	.	.	.	.	.	.	.	G	1.741	-0.491696	0.04322	.	.	ENSG00000179913	ENST00000318683	T	0.42900	0.96	5.23	-6.72	0.01755	.	1.074000	0.07242	N	0.864459	T	0.30603	0.0770	L	0.53249	1.67	0.09310	N	1	B	0.11235	0.004	B	0.19946	0.027	T	0.32929	-0.9888	10	0.15066	T	0.55	.	7.4185	0.27059	0.3364:0.3712:0.2924:0.0	.	256	Q9Y2A9	B3GN3_HUMAN	Q	256	ENSP00000321874:E256Q	ENSP00000321874:E256Q	E	+	1	0	B3GNT3	17783578	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.147000	0.16202	-1.148000	0.02847	-1.480000	0.00990	GAG	B3GNT3	-	pfam_Glyco_trans_31	ENSG00000179913		0.617	B3GNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT3	HGNC	protein_coding	OTTHUMT00000466877.1	31	0.00	0	G	NM_014256		17922578	17922578	+1	no_errors	ENST00000318683	ensembl	human	known	69_37n	missense	27	34.15	14	SNP	0.000	C
BNIP3P1	319138	genome.wustl.edu	37	14	28734083	28734083	+	RNA	SNP	C	C	T			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr14:28734083C>T	ENST00000550043.1	+	0	488									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		AAGTTGAAAGCATCTTGAAGA	0.453																																						dbGAP											0																																										-	-	-			0					14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28734083C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000550043.1	37	NULL		14																																																																																			BNIP3P1	-	-	ENSG00000197358		0.453	BNIP3P1-002	KNOWN	basic	processed_transcript	BNIP3P1	HGNC	pseudogene	OTTHUMT00000408770.1	140	0.00	0	C			28734083	28734083	+1	no_errors	ENST00000550043	ensembl	human	known	69_37n	rna	90	36.62	52	SNP	1.000	T
C10orf71	118461	genome.wustl.edu	37	10	50531374	50531374	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr10:50531374C>T	ENST00000374144.3	+	3	1072	c.784C>T	c.(784-786)Cct>Tct	p.P262S	C10orf71_ENST00000323868.4_Missense_Mutation_p.P262S			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	262								p.P262S(2)		endometrium(1)	1						CACGGGTGAGCCTGGGAGAGG	0.547																																						dbGAP											2	Substitution - Missense(2)	breast(2)											44.0	50.0	48.0					10																	50531374		2018	4185	6203	-	-	-	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.784C>T	10.37:g.50531374C>T	ENSP00000363259:p.Pro262Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL8	Missense_Mutation	SNP	NULL	p.P262S	ENST00000374144.3	37	c.784	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	C	9.661	1.144262	0.21205	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.15487	2.42;3.57	5.4	-0.583	0.11706	.	0.656368	0.13037	N	0.418804	T	0.11750	0.0286	L	0.45581	1.43	0.09310	N	1	B	0.23377	0.084	B	0.21917	0.037	T	0.31668	-0.9935	10	0.25106	T	0.35	.	3.3846	0.07266	0.4171:0.3549:0.0863:0.1417	.	262	Q711Q0-3	.	S	262	ENSP00000318713:P262S;ENSP00000363259:P262S	ENSP00000318713:P262S	P	+	1	0	C10orf71	50201380	0.140000	0.22579	0.191000	0.23289	0.186000	0.23388	0.535000	0.23114	-0.006000	0.14370	-0.304000	0.09214	CCT	C10orf71	-	NULL	ENSG00000177354		0.547	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	101	0.00	0	C	NM_199459		50531374	50531374	+1	no_errors	ENST00000374144	ensembl	human	known	69_37n	missense	69	36.70	40	SNP	0.003	T
C16orf89	146556	genome.wustl.edu	37	16	5110367	5110367	+	Silent	SNP	C	C	T			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr16:5110367C>T	ENST00000315997.5	-	3	630	c.429G>A	c.(427-429)ttG>ttA	p.L143L	C16orf89_ENST00000350219.4_Silent_p.L181L|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000422873.1_Silent_p.L181L|C16orf89_ENST00000472572.3_Silent_p.L143L|C16orf89_ENST00000474471.3_Silent_p.L143L	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	143						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)	p.L181L(2)|p.L143L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						TGGGGTACACCAAGGAGGCAT	0.617																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											47.0	54.0	51.0					16																	5110367		2003	4176	6179	-	-	-	SO:0001819	synonymous_variant	0				CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.429G>A	16.37:g.5110367C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUM5|Q8N2I3|Q8N4T1	Silent	SNP	NULL	p.L181	ENST00000315997.5	37	c.543	CCDS42116.2	16																																																																																			C16orf89	-	NULL	ENSG00000153446		0.617	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	C16orf89	HGNC	protein_coding	OTTHUMT00000354524.1	18	0.00	0	C	NM_152459		5110367	5110367	-1	no_errors	ENST00000350219	ensembl	human	known	69_37n	silent	11	38.89	7	SNP	0.999	T
EIF3I	8668	genome.wustl.edu	37	1	32691811	32691811	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr1:32691811G>A	ENST00000373586.1	+	5	362	c.290G>A	c.(289-291)cGg>cAg	p.R97Q	EIF3I_ENST00000471486.1_3'UTR	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I									p.R97Q(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				TCGGCTGTCCGGACCTGCGGT	0.532																																					Colon(102;1138 2140 2180 17876)	dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	80.0	80.0					1																	32691811		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364	ENST00000373586.1:c.290G>A	1.37:g.32691811G>A	ENSP00000362688:p.Arg97Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R97Q	ENST00000373586.1	37	c.290	CCDS357.1	1	.	.	.	.	.	.	.	.	.	.	g	33	5.259158	0.95368	.	.	ENSG00000084623	ENST00000355082;ENST00000373586	D;D	0.81739	-1.53;-1.53	4.71	4.71	0.59529	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.89722	0.6797	M	0.82056	2.57	0.58432	D	0.999999	D	0.64830	0.994	D	0.67103	0.949	D	0.91426	0.5162	10	0.87932	D	0	-29.5886	18.0263	0.89270	0.0:0.0:1.0:0.0	.	97	Q13347	EIF3I_HUMAN	Q	97	ENSP00000347194:R97Q;ENSP00000362688:R97Q	ENSP00000347194:R97Q	R	+	2	0	EIF3I	32464398	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.573000	0.82421	2.341000	0.79615	0.457000	0.33378	CGG	EIF3I	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000084623		0.532	EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3I	HGNC	protein_coding	OTTHUMT00000019282.2	62	0.00	0	G	NM_003757		32691811	32691811	+1	no_errors	ENST00000373586	ensembl	human	known	69_37n	missense	63	23.81	20	SNP	1.000	A
EPB41L4A	64097	genome.wustl.edu	37	5	111500728	111500730	+	In_Frame_Del	DEL	TTG	TTG	-	rs200146895|rs184684511	byFrequency	TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	TTG	TTG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr5:111500728_111500730delTTG	ENST00000261486.5	-	23	2294_2296	c.2018_2020delCAA	c.(2017-2022)acaata>ata	p.T673del	EPB41L4A-AS1_ENST00000413221.2_lincRNA|EPB41L4A_ENST00000507810.1_Intron	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	673						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)		p.T673delT(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		ATAGTTTTTATTGTTTTTGCTGT	0.424																																						dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.2018_2020delCAA	5.37:g.111500728_111500730delTTG	ENSP00000261486:p.Thr673del	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FUI6	In_Frame_Del	DEL	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.T673in_frame_del	ENST00000261486.5	37	c.2020_2018	CCDS43350.1	5																																																																																			EPB41L4A	-	NULL	ENSG00000129595		0.424	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370969.1	286	0.00	0	TTG			111500728	111500730	-1	no_errors	ENST00000261486	ensembl	human	known	69_37n	in_frame_del	189	28.68	76	DEL	0.844:0.850:0.998	-
FAM214B	80256	genome.wustl.edu	37	9	35107628	35107628	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr9:35107628T>G	ENST00000378561.1	-	2	3699	c.644A>C	c.(643-645)gAg>gCg	p.E215A	FAM214B_ENST00000378557.1_Missense_Mutation_p.E215A|FAM214B_ENST00000603301.1_Missense_Mutation_p.E215A|FAM214B_ENST00000488109.2_Missense_Mutation_p.E215A|FAM214B_ENST00000605244.1_Missense_Mutation_p.E215A|FAM214B_ENST00000378554.2_Missense_Mutation_p.E215A|FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000378566.1_Intron|FAM214B_ENST00000322813.5_Missense_Mutation_p.E215A			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	215						nucleus (GO:0005634)		p.E215A(1)									GCCAGGGGACTCCCTAGGCCA	0.637																																						dbGAP											1	Substitution - Missense(1)	breast(1)											33.0	40.0	38.0					9																	35107628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.644A>C	9.37:g.35107628T>G	ENSP00000367823:p.Glu215Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	NULL	p.E215A	ENST00000378561.1	37	c.644	CCDS6578.1	9	.	.	.	.	.	.	.	.	.	.	T	10.76	1.440705	0.25900	.	.	ENSG00000005238	ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	4.87	3.69	0.42338	.	0.374922	0.24836	N	0.035201	T	0.20292	0.0488	L	0.29908	0.895	0.26890	N	0.967353	B	0.30406	0.278	B	0.22386	0.039	T	0.11916	-1.0568	8	.	.	.	-23.161	4.9561	0.14041	0.1634:0.085:0.0:0.7516	.	215	Q7L5A3	K1539_HUMAN	A	215	.	.	E	-	2	0	KIAA1539	35097628	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	0.281000	0.18810	0.842000	0.35045	0.454000	0.30748	GAG	FAM214B	-	NULL	ENSG00000005238		0.637	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214B	HGNC	protein_coding	OTTHUMT00000052261.1	43	0.00	0	T	NM_025182		35107628	35107628	-1	no_errors	ENST00000322813	ensembl	human	known	69_37n	missense	77	35.83	43	SNP	0.999	G
GATA3	2625	genome.wustl.edu	37	10	8111433	8111434	+	Splice_Site	DEL	CA	CA	-	rs111853237		TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr10:8111433_8111434delCA	ENST00000346208.3	+	5	1376		c.e5-1		GATA3_ENST00000461472.1_Splice_Site|GATA3_ENST00000379328.3_Splice_Site			P23771	GATA3_HUMAN	GATA binding protein 3						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(7)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCCCCACTCTCAGTCTGCAGCC	0.48			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	7	Unknown(7)	breast(7)																																								-	-	-	SO:0001630	splice_region_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.922-1CA>-	10.37:g.8111433_8111434delCA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Splice_Site	DEL	-	e4-2	ENST00000346208.3	37	c.925-3_925-2	CCDS7083.1	10																																																																																			GATA3	-	-	ENSG00000107485		0.480	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	44	0	0	CA	NM_001002295	Intron	8111433	8111434	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	splice_site_del	54	26.03	19	DEL	1.000:1.000	-
GGT3P	2679	genome.wustl.edu	37	22	18778612	18778612	+	RNA	SNP	C	C	T	rs1055042	byFrequency	TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr22:18778612C>T	ENST00000412448.1	-	0	793							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										GCGGCCACGGCAGCCCTGGTG	0.637																																						dbGAP											0																																										-	-	-			0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18778612C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.637	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1	11	0.00	0	C	NR_003267		18778612	18778612	-1	no_errors	ENST00000412448	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	0.996	T
KRT39	390792	genome.wustl.edu	37	17	39120738	39120738	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr17:39120738delT	ENST00000355612.2	-	2	546	c.511delA	c.(511-513)attfs	p.I171fs	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	171	Coil 1B.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.I171fs*6(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				GTGTTGTCAATTTGCGAGACC	0.458																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											350.0	274.0	299.0					17																	39120738		2203	4296	6499	-	-	-	SO:0001589	frameshift_variant	0			AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.511delA	17.37:g.39120738delT	ENSP00000347823:p.Ile171fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK6|Q6IFU6	Frame_Shift_Del	DEL	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.I171fs	ENST00000355612.2	37	c.511	CCDS11382.1	17																																																																																			KRT39	-	pfam_F	ENSG00000196859		0.458	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT39	HGNC	protein_coding	OTTHUMT00000257287.1	402	0.00	0	T	NM_213656		39120738	39120738	-1	no_errors	ENST00000355612	ensembl	human	known	69_37n	frame_shift_del	253	34.34	136	DEL	1.000	-
LRP4	4038	genome.wustl.edu	37	11	46894951	46894951	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr11:46894951C>T	ENST00000378623.1	-	29	4665	c.4423G>A	c.(4423-4425)Gcc>Acc	p.A1475T	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1475				EPRA -> D (in Ref. 2; BAE19679). {ECO:0000305}.	dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.A1475T(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		ACAGCAATGGCCCGGGGCTCA	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											51.0	48.0	49.0					11																	46894951		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.4423G>A	11.37:g.46894951C>T	ENSP00000367888:p.Ala1475Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A1475T	ENST00000378623.1	37	c.4423	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.746826	0.96882	.	.	ENSG00000134569	ENST00000378623	D	0.97138	-4.26	5.91	5.91	0.95273	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.98751	0.9580	M	0.90542	3.125	0.80722	D	1	D	0.59357	0.985	D	0.67231	0.95	D	0.99143	1.0856	10	0.72032	D	0.01	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	1475	O75096	LRP4_HUMAN	T	1475	ENSP00000367888:A1475T	ENSP00000367888:A1475T	A	-	1	0	LRP4	46851527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.805000	0.86005	2.793000	0.96121	0.655000	0.94253	GCC	LRP4	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000134569		0.542	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	78	0.00	0	C	NM_002334		46894951	46894951	-1	no_errors	ENST00000378623	ensembl	human	known	69_37n	missense	55	23.61	17	SNP	1.000	T
MTOR	2475	genome.wustl.edu	37	1	11187855	11187855	+	Silent	SNP	C	C	T			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr1:11187855C>T	ENST00000361445.4	-	44	6118	c.6042G>A	c.(6040-6042)gaG>gaA	p.E2014E	MTOR_ENST00000376838.1_Silent_p.E219E	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2014	Sufficient for interaction with the FKBP1A/rapamycin complex. {ECO:0000250}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E2014E(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GGATCAGCTCCTCGCTCACCT	0.502																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											142.0	148.0	146.0					1																	11187855		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6042G>A	1.37:g.11187855C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E2014	ENST00000361445.4	37	c.6042	CCDS127.1	1																																																																																			MTOR	-	NULL	ENSG00000198793		0.502	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	141	0.00	0	C	NM_004958		11187855	11187855	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	silent	135	22.86	40	SNP	1.000	T
NETO1	81832	genome.wustl.edu	37	18	70526294	70526294	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr18:70526294C>A	ENST00000327305.6	-	4	893	c.236G>T	c.(235-237)tGc>tTc	p.C79F	NETO1_ENST00000580049.1_5'UTR|NETO1_ENST00000299430.2_Missense_Mutation_p.C78F|NETO1_ENST00000397929.1_Missense_Mutation_p.C78F|NETO1_ENST00000583169.1_Missense_Mutation_p.C79F	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	79	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.C78F(1)|p.C79F(1)		NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		AAGTTCAATGCACTGTCTTGG	0.373																																						dbGAP											2	Substitution - Missense(2)	breast(2)											61.0	61.0	61.0					18																	70526294		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.236G>T	18.37:g.70526294C>A	ENSP00000313088:p.Cys79Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.C79F	ENST00000327305.6	37	c.236	CCDS12000.1	18	.	.	.	.	.	.	.	.	.	.	C	11.07	1.531724	0.27387	.	.	ENSG00000166342	ENST00000327305;ENST00000299430;ENST00000397929	T;T;T	0.17370	2.28;2.28;2.28	5.35	5.35	0.76521	CUB (5);	0.000000	0.64402	D	0.000002	T	0.25754	0.0627	N	0.16478	0.41	0.80722	D	1	D;D;D	0.69078	0.997;0.994;0.984	D;D;P	0.72625	0.944;0.978;0.884	T	0.07404	-1.0774	10	0.13470	T	0.59	-19.783	19.438	0.94806	0.0:1.0:0.0:0.0	.	78;78;79	Q8TDF5-1;Q8TDF5-2;Q8TDF5	.;.;NETO1_HUMAN	F	79;78;78	ENSP00000313088:C79F;ENSP00000299430:C78F;ENSP00000381024:C78F	ENSP00000299430:C78F	C	-	2	0	NETO1	68677274	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.724000	0.84798	2.672000	0.90937	0.655000	0.94253	TGC	NETO1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000166342		0.373	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	118	0.00	0	C	NM_138999		70526294	70526294	-1	no_errors	ENST00000327305	ensembl	human	known	69_37n	missense	121	32.78	59	SNP	1.000	A
PLCB4	5332	genome.wustl.edu	37	20	9382205	9382205	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr20:9382205C>G	ENST00000378493.1	+	17	1594	c.1579C>G	c.(1579-1581)Cac>Gac	p.H527D	PLCB4_ENST00000378473.3_Missense_Mutation_p.H527D|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Missense_Mutation_p.H527D|PLCB4_ENST00000334005.3_Missense_Mutation_p.H527D|PLCB4_ENST00000378501.2_Missense_Mutation_p.H527D|PLCB4_ENST00000414679.2_Missense_Mutation_p.H527D			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	527					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.H527D(1)		NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TGACTTGGGTCACAAGGAAGC	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	60.0	62.0					20																	9382205		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1579C>G	20.37:g.9382205C>G	ENSP00000367754:p.His527Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_PLC-beta_CS,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.H527D	ENST00000378493.1	37	c.1579	CCDS13105.1	20	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777922	0.31502	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.51817	0.72;0.69;0.72;0.72;0.72;0.69	5.98	5.98	0.97165	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.648356	0.17282	N	0.179957	T	0.31167	0.0788	N	0.08118	0	0.42105	D	0.991356	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.20940	-1.0260	10	0.10902	T	0.67	.	20.4434	0.99119	0.0:1.0:0.0:0.0	.	527;374;527;527	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	D	527;527;527;527;527;363	ENSP00000334105:H527D;ENSP00000367734:H527D;ENSP00000278655:H527D;ENSP00000367754:H527D;ENSP00000367762:H527D;ENSP00000390616:H363D	ENSP00000278655:H527D	H	+	1	0	PLCB4	9330205	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.380000	0.66202	2.838000	0.97847	0.655000	0.94253	CAC	PLCB4	-	pirsf_PLC-beta,superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000101333		0.418	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCB4	HGNC	protein_coding	OTTHUMT00000077948.2	43	0.00	0	C			9382205	9382205	+1	no_errors	ENST00000334005	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	G
PPL	5493	genome.wustl.edu	37	16	4939022	4939022	+	Missense_Mutation	SNP	T	T	C	rs371832541		TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr16:4939022T>C	ENST00000345988.2	-	19	2443	c.2354A>G	c.(2353-2355)cAg>cGg	p.Q785R	PPL_ENST00000590782.2_Missense_Mutation_p.Q783R	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	785					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.Q785R(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						ACAGATCTTCTGTACTTCCTG	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											330.0	322.0	324.0					16																	4939022		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2354A>G	16.37:g.4939022T>C	ENSP00000340510:p.Gln785Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O60314|O60454|Q14C98	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Q785R	ENST00000345988.2	37	c.2354	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	T	6.228	0.410286	0.11812	.	.	ENSG00000118898	ENST00000345988	T	0.51325	0.71	5.48	5.48	0.80851	.	0.268649	0.36893	N	0.002348	T	0.45115	0.1326	M	0.64997	1.995	0.41929	D	0.990556	B	0.28713	0.22	B	0.23275	0.045	T	0.38950	-0.9637	10	0.30854	T	0.27	.	14.7507	0.69522	0.0:0.0:0.0:1.0	.	785	O60437	PEPL_HUMAN	R	785	ENSP00000340510:Q785R	ENSP00000340510:Q785R	Q	-	2	0	PPL	4879023	1.000000	0.71417	0.076000	0.20297	0.411000	0.31082	5.532000	0.67154	2.077000	0.62373	0.454000	0.30748	CAG	PPL	-	smart_Spectrin/alpha-actinin	ENSG00000118898		0.438	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	120	0.00	0	T	NM_002705		4939022	4939022	-1	no_errors	ENST00000345988	ensembl	human	known	69_37n	missense	83	34.13	43	SNP	0.990	C
RBM12B	389677	genome.wustl.edu	37	8	94746354	94746354	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr8:94746354T>G	ENST00000399300.2	-	3	2498	c.2285A>C	c.(2284-2286)cAc>cCc	p.H762P	RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Missense_Mutation_p.H642P|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	762							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H762P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CCGCCTGAAGTGCTCTGGGGG	0.672																																						dbGAP											1	Substitution - Missense(1)	breast(1)											29.0	35.0	33.0					8																	94746354		1781	4019	5800	-	-	-	SO:0001583	missense	0				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2285A>C	8.37:g.94746354T>G	ENSP00000382239:p.His762Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYB5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H762P	ENST00000399300.2	37	c.2285	CCDS43755.1	8	.	.	.	.	.	.	.	.	.	.	T	16.51	3.142719	0.57044	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.06768	3.26;3.29	4.66	3.48	0.39840	.	.	.	.	.	T	0.06600	0.0169	N	0.19112	0.55	0.19575	N	0.999966	B	0.02656	0.0	B	0.04013	0.001	T	0.30238	-0.9985	9	0.56958	D	0.05	-0.379	10.3509	0.43934	0.0:0.0:0.1643:0.8357	.	762	Q8IXT5	RB12B_HUMAN	P	762;642	ENSP00000382239:H762P;ENSP00000427729:H642P	ENSP00000382239:H762P	H	-	2	0	RBM12B	94815530	0.000000	0.05858	0.706000	0.30403	0.081000	0.17604	0.052000	0.14163	1.072000	0.40860	0.460000	0.39030	CAC	RBM12B	-	NULL	ENSG00000183808		0.672	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12B	HGNC	protein_coding	OTTHUMT00000383603.1	85	0.00	0	T	NM_203390		94746354	94746354	-1	no_errors	ENST00000399300	ensembl	human	known	69_37n	missense	95	26.36	34	SNP	0.668	G
RC3H1	149041	genome.wustl.edu	37	1	173930909	173930909	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr1:173930909T>C	ENST00000367696.2	-	12	2507	c.2156A>G	c.(2155-2157)tAt>tGt	p.Y719C	RC3H1_ENST00000258349.4_Missense_Mutation_p.Y719C|RC3H1_ENST00000367694.2_Missense_Mutation_p.Y719C			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	719	Pro-rich.				B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y719C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						AGCCACTGGATAGTAACTCTC	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											249.0	243.0	245.0					1																	173930909		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2156A>G	1.37:g.173930909T>C	ENSP00000356669:p.Tyr719Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.Y719C	ENST00000367696.2	37	c.2156	CCDS30940.1	1	.	.	.	.	.	.	.	.	.	.	T	14.30	2.495024	0.44352	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.57273	0.41;0.41;0.41	5.92	5.92	0.95590	.	0.054173	0.85682	D	0.000000	T	0.23766	0.0575	N	0.21448	0.665	0.42845	D	0.994066	B;B;B;B	0.15930	0.009;0.003;0.015;0.003	B;B;B;B	0.14578	0.005;0.003;0.011;0.005	T	0.12426	-1.0548	10	0.48119	T	0.1	-11.2142	10.9571	0.47364	0.0:0.0779:0.0:0.9221	.	719;719;719;719	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	C	719	ENSP00000356669:Y719C;ENSP00000258349:Y719C;ENSP00000356667:Y719C	ENSP00000258349:Y719C	Y	-	2	0	RC3H1	172197532	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.121000	0.50438	2.260000	0.74910	0.528000	0.53228	TAT	RC3H1	-	NULL	ENSG00000135870		0.418	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H1	HGNC	protein_coding	OTTHUMT00000090733.2	292	0.00	0	T	NM_172071		173930909	173930909	-1	no_errors	ENST00000258349	ensembl	human	known	69_37n	missense	209	43.51	161	SNP	1.000	C
SEC14L4	284904	genome.wustl.edu	37	22	30891391	30891391	+	Silent	SNP	G	G	A	rs200916088	byFrequency	TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr22:30891391G>A	ENST00000255858.7	-	5	356	c.273C>T	c.(271-273)taC>taT	p.Y91Y	SEC14L4_ENST00000540456.1_Silent_p.Y76Y|RP4-539M6.14_ENST00000610156.1_RNA|SEC14L4_ENST00000381982.3_Silent_p.Y91Y|SEC14L4_ENST00000392772.2_Silent_p.Y37Y|RP4-539M6.14_ENST00000442126.1_RNA	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	91	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.Y91Y(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	CTTCGTAGTCGTAGCCACAAA	0.567													G|||	2	0.000399361	0.0	0.0	5008	,	,		19541	0.0		0.001	False		,,,				2504	0.001					dbGAP											1	Substitution - coding silent(1)	breast(1)											96.0	86.0	89.0					22																	30891391		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.273C>T	22.37:g.30891391G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6W7|A6NCV4	Silent	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.Y91	ENST00000255858.7	37	c.273	CCDS13878.1	22																																																																																			SEC14L4	-	superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000133488		0.567	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L4	HGNC	protein_coding	OTTHUMT00000321946.1	36	0.00	0	G	NM_174977		30891391	30891391	-1	no_errors	ENST00000255858	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	0.923	A
SERTAD2	9792	genome.wustl.edu	37	2	64863109	64863109	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr2:64863109C>T	ENST00000313349.3	-	2	1194	c.897G>A	c.(895-897)atG>atA	p.M299I	SERTAD2_ENST00000476805.2_5'Flank	NM_014755.2	NP_055570.1	Q14140	SRTD2_HUMAN	SERTA domain containing 2	299	Required for transactivation activity.				negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.M299I(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|skin(1)	12						CTGTGAGGTCCATTTTGAAAG	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	82.0	84.0					2																	64863109		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50917	CCDS33210.1	2p15	2007-05-01			ENSG00000179833	ENSG00000179833			30784	protein-coding gene	gene with protein product	"""transcriptional regulator interacting with the PHS-bromodomain 2"""					8590280, 11331592	Standard	NM_014755		Approved	TRIP-Br2, KIAA0127, Sei-2	uc002sde.2	Q14140	OTTHUMG00000152678	ENST00000313349.3:c.897G>A	2.37:g.64863109C>T	ENSP00000326933:p.Met299Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TS2	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.M299I	ENST00000313349.3	37	c.897	CCDS33210.1	2	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382661	0.25031	.	.	ENSG00000179833	ENST00000313349	.	.	.	6.01	6.01	0.97437	.	0.080163	0.85682	D	0.000000	T	0.44623	0.1302	N	0.19112	0.55	0.58432	D	0.999998	B	0.09022	0.002	B	0.09377	0.004	T	0.25882	-1.0119	9	0.44086	T	0.13	-4.9361	15.2596	0.73613	0.1403:0.8597:0.0:0.0	.	299	Q14140	SRTD2_HUMAN	I	299	.	ENSP00000326933:M299I	M	-	3	0	SERTAD2	64716613	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.504000	0.53347	2.860000	0.98153	0.655000	0.94253	ATG	SERTAD2	-	NULL	ENSG00000179833		0.567	SERTAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD2	HGNC	protein_coding	OTTHUMT00000327322.2	59	0.00	0	C	NM_014755		64863109	64863109	-1	no_errors	ENST00000313349	ensembl	human	known	69_37n	missense	61	29.89	26	SNP	1.000	T
SIPA1L2	57568	genome.wustl.edu	37	1	232596654	232596654	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr1:232596654T>A	ENST00000366630.1	-	9	3432	c.3074A>T	c.(3073-3075)cAt>cTt	p.H1025L	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.H1025L|SIPA1L2_ENST00000308942.4_Missense_Mutation_p.H99L			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1025	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)	p.H1025L(1)		NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCCGTCATCATGGGGCTGGAT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											32.0	33.0	33.0					1																	232596654		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3074A>T	1.37:g.232596654T>A	ENSP00000355589:p.His1025Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.H1025L	ENST00000366630.1	37	c.3074	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.058178	0.36277	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.61980	0.06;0.06;0.06	5.64	5.64	0.86602	PDZ/DHR/GLGF (3);	0.052644	0.85682	D	0.000000	T	0.43166	0.1235	N	0.08118	0	0.49687	D	0.999815	B;B	0.30114	0.269;0.02	B;B	0.29942	0.109;0.03	T	0.39522	-0.9610	10	0.22109	T	0.4	-25.6902	16.1492	0.81602	0.0:0.0:0.0:1.0	.	1025;99	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	L	1025;1025;99	ENSP00000355589:H1025L;ENSP00000262861:H1025L;ENSP00000309102:H99L	ENSP00000262861:H1025L	H	-	2	0	SIPA1L2	230663277	1.000000	0.71417	0.647000	0.29507	0.387000	0.30353	7.924000	0.87555	2.272000	0.75746	0.460000	0.39030	CAT	SIPA1L2	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000116991		0.582	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	93	0.00	0	T	XM_045839		232596654	232596654	-1	no_errors	ENST00000262861	ensembl	human	known	69_37n	missense	66	37.38	40	SNP	0.965	A
SLITRK2	84631	genome.wustl.edu	37	X	144903965	144903965	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chrX:144903965C>A	ENST00000370490.1	+	1	4277	c.22C>A	c.(22-24)Ctc>Atc	p.L8I	SLITRK2_ENST00000447897.2_Missense_Mutation_p.L8I|SLITRK2_ENST00000413937.2_Missense_Mutation_p.L8I|SLITRK2_ENST00000434188.2_Missense_Mutation_p.L8I|SLITRK2_ENST00000428560.2_Missense_Mutation_p.L8I			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	8					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.L8I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CGTTTGGTTCCTCAGTGTGTT	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	57.0	57.0					X																	144903965		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.22C>A	X.37:g.144903965C>A	ENSP00000359521:p.Leu8Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L8I	ENST00000370490.1	37	c.22	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885668	0.51908	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.54866	0.62;0.55;0.55;0.55;0.55;0.55	4.56	4.56	0.56223	.	0.000000	0.64402	U	0.000006	T	0.52885	0.1762	L	0.42686	1.345	0.41310	D	0.987108	D	0.55172	0.97	P	0.50049	0.629	T	0.53173	-0.8476	10	0.36615	T	0.2	-6.4295	13.8997	0.63794	0.0:1.0:0.0:0.0	.	8	Q9H156	SLIK2_HUMAN	I	8	ENSP00000334374:L8I;ENSP00000411681:L8I;ENSP00000359521:L8I;ENSP00000397015:L8I;ENSP00000407347:L8I;ENSP00000412010:L8I	ENSP00000334374:L8I	L	+	1	0	SLITRK2	144711657	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.724000	0.54962	1.846000	0.53633	0.436000	0.28706	CTC	SLITRK2	-	NULL	ENSG00000185985		0.537	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	46	0.00	0	C	NM_032539		144903965	144903965	+1	no_errors	ENST00000370490	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	A
TJP1	7082	genome.wustl.edu	37	15	30012801	30012802	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr15:30012801_30012802insAA	ENST00000346128.6	-	19	2997_2998	c.2523_2524insTT	c.(2521-2526)tctgacfs	p.D842fs	TJP1_ENST00000356107.6_Frame_Shift_Ins_p.D842fs|TJP1_ENST00000545208.2_Frame_Shift_Ins_p.D842fs|TJP1_ENST00000400011.2_Frame_Shift_Ins_p.D846fs	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	842					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.D842fs*18(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCTTCATAGTCAGAAGTGTGTC	0.465																																					Melanoma(77;681 1843 6309 6570)	dbGAP											1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.2523_2524insTT	15.37:g.30012801_30012802insAA	ENSP00000281537:p.Asp842fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Frame_Shift_Ins	INS	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.D841fs	ENST00000346128.6	37	c.2524_2523	CCDS42007.1	15																																																																																			TJP1	-	prints_ZonOcculdens	ENSG00000104067		0.465	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	121	0.00	0	-	NM_003257		30012801	30012802	-1	no_errors	ENST00000346128	ensembl	human	known	69_37n	frame_shift_ins	75	35.34	41	INS	1.000:1.000	AA
ZBTB14	7541	genome.wustl.edu	37	18	5290912	5290912	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06T-01A-11W-A019-09	TCGA-A8-A06T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	11ec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7	b1e53432-5968-4fb9-acf4-f161e65013da	g.chr18:5290912G>A	ENST00000357006.4	-	4	1633	c.1295C>T	c.(1294-1296)gCg>gTg	p.A432V	ZBTB14_ENST00000400143.3_Missense_Mutation_p.A432V	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	432					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A432V(1)									CATCGCTGCCGCCTGCAACTG	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	98.0	106.0					18																	5290912		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.1295C>T	18.37:g.5290912G>A	ENSP00000349503:p.Ala432Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O00403|Q2TB80	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A432V	ENST00000357006.4	37	c.1295	CCDS11837.1	18	.	.	.	.	.	.	.	.	.	.	G	19.38	3.815792	0.70912	.	.	ENSG00000198081	ENST00000357006;ENST00000400143	T;T	0.11169	2.8;2.8	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.08714	0.0216	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	B	0.39590	0.304	T	0.31696	-0.9934	10	0.27082	T	0.32	-14.5784	19.8253	0.96616	0.0:0.0:1.0:0.0	.	432	O43829	ZF161_HUMAN	V	432	ENSP00000349503:A432V;ENSP00000383009:A432V	ENSP00000349503:A432V	A	-	2	0	ZFP161	5280912	1.000000	0.71417	0.965000	0.40720	0.630000	0.37929	3.686000	0.54685	2.676000	0.91093	0.650000	0.86243	GCG	ZFP161	-	NULL	ENSG00000198081		0.557	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP161	HGNC	protein_coding	OTTHUMT00000254425.1	62	0.00	0	G	NM_003409		5290912	5290912	-1	no_errors	ENST00000357006	ensembl	human	known	69_37n	missense	78	32.79	40	SNP	1.000	A
