#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AASDH	132949	genome.wustl.edu	37	4	57244483	57244483	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr4:57244483delT	ENST00000205214.6	-	4	679	c.499delA	c.(499-501)atafs	p.I167fs	AASDH_ENST00000602986.1_Frame_Shift_Del_p.I14fs|AASDH_ENST00000451613.1_Frame_Shift_Del_p.I167fs|AASDH_ENST00000513376.1_Frame_Shift_Del_p.I67fs|AASDH_ENST00000502617.1_Frame_Shift_Del_p.I167fs|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000510762.1_5'UTR	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	167				I -> R (in Ref. 5; AAI41825/AAI42710). {ECO:0000305}.	fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				ATGCTTTTTATTTTTTCTTTT	0.358																																						dbGAP											0													115.0	105.0	109.0					4																	57244483		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.499delA	4.37:g.57244483delT	ENSP00000205214:p.Ile167fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Frame_Shift_Del	DEL	pfam_AMP-dep_Synth/Lig,pfam_Acyl_carrier_prot-like,superfamily_Quinonprotein_ADH-like,superfamily_Acyl_carrier_prot-like,smart_PQQ_beta_propeller_repeat,pfscan_Acyl_carrier_prot-like	p.I167fs	ENST00000205214.6	37	c.499	CCDS3504.1	4																																																																																			AASDH	-	pfam_AMP-dep_Synth/Lig	ENSG00000157426		0.358	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	HGNC	protein_coding	OTTHUMT00000250780.1	79	0.00	0	T	NM_181806		57244483	57244483	-1	no_errors	ENST00000205214	ensembl	human	known	69_37n	frame_shift_del	220	16.10	43	DEL	0.000	-
ABCA1	19	genome.wustl.edu	37	9	107589387	107589387	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr9:107589387C>A	ENST00000374736.3	-	16	2573	c.2179G>T	c.(2179-2181)Gtg>Ttg	p.V727L	ABCA1_ENST00000494467.1_5'UTR	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	727					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ATTGTCACCACAGCAAACACG	0.537																																						dbGAP											0													168.0	125.0	140.0					9																	107589387		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.2179G>T	9.37:g.107589387C>A	ENSP00000363868:p.Val727Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V727L	ENST00000374736.3	37	c.2179	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496525	0.44352	.	.	ENSG00000165029	ENST00000374736	D	0.82344	-1.6	5.3	2.42	0.29668	.	0.634983	0.15931	N	0.237654	T	0.70159	0.3192	N	0.16602	0.42	0.80722	D	1	B	0.09022	0.002	B	0.14578	0.011	T	0.60188	-0.7312	10	0.49607	T	0.09	.	10.6126	0.45432	0.0:0.7286:0.0:0.2714	.	727	O95477	ABCA1_HUMAN	L	727	ENSP00000363868:V727L	ENSP00000363868:V727L	V	-	1	0	ABCA1	106629208	0.681000	0.27614	0.847000	0.33407	0.984000	0.73092	1.400000	0.34577	0.216000	0.20781	0.655000	0.94253	GTG	ABCA1	-	NULL	ENSG00000165029		0.537	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1	79	0.00	0	C	NM_005502		107589387	107589387	-1	no_errors	ENST00000374736	ensembl	human	known	69_37n	missense	29	56.06	37	SNP	0.806	A
ABCA3	21	genome.wustl.edu	37	16	2369601	2369601	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:2369601delT	ENST00000301732.5	-	8	1554	c.854delA	c.(853-855)gagfs	p.E285fs	ABCA3_ENST00000382381.3_Frame_Shift_Del_p.E285fs	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	285					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CCTTTCCTTCTCCTGCACGAC	0.607																																						dbGAP											0													71.0	65.0	67.0					16																	2369601		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.854delA	16.37:g.2369601delT	ENSP00000301732:p.Glu285fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E285fs	ENST00000301732.5	37	c.854	CCDS10466.1	16																																																																																			ABCA3	-	NULL	ENSG00000167972		0.607	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	21	0.00	0	T	NM_001089		2369601	2369601	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	frame_shift_del	28	42.86	21	DEL	1.000	-
ABCA3	21	genome.wustl.edu	37	16	2369604	2369607	+	Frame_Shift_Del	DEL	TGCA	TGCA	-	rs147636186		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	TGCA	TGCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:2369604_2369607delTGCA	ENST00000301732.5	-	8	1548_1551	c.848_851delTGCA	c.(847-852)gtgcagfs	p.VQ283fs	ABCA3_ENST00000382381.3_Frame_Shift_Del_p.VQ283fs	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	283					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TTCCTTCTCCTGCACGACAGCACG	0.603																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.848_851delTGCA	16.37:g.2369604_2369607delTGCA	ENSP00000301732:p.Val283fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V283fs	ENST00000301732.5	37	c.851_848	CCDS10466.1	16																																																																																			ABCA3	-	NULL	ENSG00000167972		0.603	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	21	0.00	0	TGCA	NM_001089		2369604	2369607	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	frame_shift_del	27	43.75	21	DEL	1.000:1.000:1.000:1.000	-
ABHD5	51099	genome.wustl.edu	37	3	43740768	43740768	+	Splice_Site	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:43740768G>A	ENST00000458276.2	+	2	171	c.48G>A	c.(46-48)agG>agA	p.R16R		NM_016006.4	NP_057090.2	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	16					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|negative regulation of sequestering of triglyceride (GO:0010891)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|lysophosphatidic acid acyltransferase activity (GO:0042171)			kidney(3)|large_intestine(2)|liver(2)|lung(5)|ovary(1)|skin(1)	14		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)		GGTGCTCTAGGTCAGGATGGC	0.413																																						dbGAP											0													198.0	166.0	177.0					3																	43740768		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF007132	CCDS2711.1	3p21.33	2012-05-16			ENSG00000011198	ENSG00000011198		"""Abhydrolase domain containing"""	21396	protein-coding gene	gene with protein product		604780				11590543, 18606822	Standard	NM_016006		Approved	CGI-58, NCIE2	uc003cmx.3	Q8WTS1	OTTHUMG00000133039	ENST00000458276.2:c.48-1G>A	3.37:g.43740768G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9K0|Q9Y369	Silent	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1	p.R16	ENST00000458276.2	37	c.48	CCDS2711.1	3																																																																																			ABHD5	-	NULL	ENSG00000011198		0.413	ABHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD5	HGNC	protein_coding	OTTHUMT00000256644.2	38	0.00	0	G	NM_016006	Silent	43740768	43740768	+1	no_errors	ENST00000458276	ensembl	human	known	69_37n	silent	80	38.93	51	SNP	1.000	A
ABR	29	genome.wustl.edu	37	17	960314	960314	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:960314C>T	ENST00000302538.5	-	13	1556	c.1410G>A	c.(1408-1410)gtG>gtA	p.V470V	ABR_ENST00000573895.1_5'UTR|ABR_ENST00000536794.2_Silent_p.V252V|ABR_ENST00000544583.2_Silent_p.V424V|ABR_ENST00000291107.2_Silent_p.V433V|ABR_ENST00000574437.1_Silent_p.V424V	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	470	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CCTGGAGCTCCACTGAGCTCA	0.587																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)	dbGAP											0													132.0	122.0	126.0					17																	960314		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1410G>A	17.37:g.960314C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G137R	ENST00000302538.5	37	c.409	CCDS10999.1	17																																																																																			ABR	-	NULL	ENSG00000159842		0.587	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	HGNC	protein_coding	OTTHUMT00000206675.4	54	0.00	0	C			960314	960314	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000574544	ensembl	human	putative	69_37n	missense	59	56.93	78	SNP	1.000	T
ACRC	93953	genome.wustl.edu	37	X	70828945	70828945	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chrX:70828945A>T	ENST00000373695.1	+	9	2126	c.1589A>T	c.(1588-1590)aAc>aTc	p.N530I	ACRC_ENST00000373696.3_Missense_Mutation_p.N530I|ACRC_ENST00000471950.1_3'UTR			Q96QF7	ACRC_HUMAN	acidic repeat containing	530	SprT-like.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					GACCTGTTTAACAGATCCGTC	0.398																																						dbGAP											0													65.0	55.0	58.0					X																	70828945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.1589A>T	X.37:g.70828945A>T	ENSP00000362799:p.Asn530Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG62	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain	p.N530I	ENST00000373695.1	37	c.1589	CCDS35326.1	X	.	.	.	.	.	.	.	.	.	.	A	17.04	3.287690	0.59976	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.51817	0.69;0.69	4.81	4.81	0.61882	Domain of unknown function SprT-like (2);	.	.	.	.	T	0.71324	0.3326	M	0.88377	2.95	0.25772	N	0.984824	D	0.89917	1.0	D	0.97110	1.0	T	0.64968	-0.6282	9	0.87932	D	0	.	9.57	0.39422	1.0:0.0:0.0:0.0	.	530	Q96QF7	ACRC_HUMAN	I	530	ENSP00000362800:N530I;ENSP00000362799:N530I	ENSP00000362799:N530I	N	+	2	0	ACRC	70745670	0.974000	0.33945	0.133000	0.22050	0.027000	0.11550	5.659000	0.68010	1.781000	0.52344	0.356000	0.21956	AAC	ACRC	-	pfam_SprT-like_domain,smart_SprT-like_domain	ENSG00000147174		0.398	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	HGNC	protein_coding	OTTHUMT00000081856.1	49	0.00	0	A			70828945	70828945	+1	no_errors	ENST00000373695	ensembl	human	known	69_37n	missense	39	59.38	57	SNP	0.473	T
ACSBG2	81616	genome.wustl.edu	37	19	6183250	6183250	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:6183250C>T	ENST00000586696.1	+	10	1565	c.1289C>T	c.(1288-1290)aCg>aTg	p.T430M	ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000252669.5_Missense_Mutation_p.T430M|ACSBG2_ENST00000588304.1_Missense_Mutation_p.T380M|ACSBG2_ENST00000591403.1_Missense_Mutation_p.T430M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.T243M			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	430					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGACCCCACACGATATCCAAC	0.567																																						dbGAP											0													63.0	67.0	66.0					19																	6183250		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1289C>T	19.37:g.6183250C>T	ENSP00000465589:p.Thr430Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.T430M	ENST00000586696.1	37	c.1289	CCDS12159.1	19	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653427	0.67472	.	.	ENSG00000130377	ENST00000252669	T	0.13420	2.59	5.04	5.04	0.67666	AMP-dependent synthetase/ligase (1);	0.181657	0.26939	N	0.021721	T	0.51787	0.1695	H	0.96048	3.76	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.74023	0.967;0.982	T	0.69011	-0.5258	10	0.72032	D	0.01	-21.7365	16.9798	0.86324	0.0:1.0:0.0:0.0	.	430;430	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	430	ENSP00000252669:T430M	ENSP00000252669:T430M	T	+	2	0	ACSBG2	6134250	0.031000	0.19500	0.045000	0.18777	0.001000	0.01503	2.409000	0.44583	2.334000	0.79466	0.650000	0.86243	ACG	ACSBG2	-	pfam_AMP-dep_Synth/Lig	ENSG00000130377		0.567	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG2	HGNC	protein_coding	OTTHUMT00000452898.1	70	0.00	0	C	NM_030924		6183250	6183250	+1	no_errors	ENST00000252669	ensembl	human	known	69_37n	missense	149	35.22	81	SNP	0.993	T
ACSM5	54988	genome.wustl.edu	37	16	20439155	20439155	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:20439155A>T	ENST00000331849.4	+	7	1114	c.967A>T	c.(967-969)Atc>Ttc	p.I323F		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	323					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TGTCCCAACCATCTTTCGGCT	0.478																																						dbGAP											0													227.0	202.0	210.0					16																	20439155		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.967A>T	16.37:g.20439155A>T	ENSP00000327916:p.Ile323Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.I323F	ENST00000331849.4	37	c.967	CCDS10585.1	16	.	.	.	.	.	.	.	.	.	.	a	15.09	2.729651	0.48833	.	.	ENSG00000183549	ENST00000331849	T	0.42131	0.98	5.01	-2.13	0.07144	AMP-dependent synthetase/ligase (1);	1.204510	0.05781	N	0.608671	T	0.26085	0.0636	N	0.16266	0.395	0.24000	N	0.996213	B	0.23806	0.091	B	0.31245	0.126	T	0.36768	-0.9734	10	0.72032	D	0.01	-2.4038	2.0379	0.03544	0.2566:0.3265:0.2977:0.1192	.	323	Q6NUN0	ACSM5_HUMAN	F	323	ENSP00000327916:I323F	ENSP00000327916:I323F	I	+	1	0	ACSM5	20346656	0.000000	0.05858	0.995000	0.50966	0.956000	0.61745	-0.470000	0.06639	-0.342000	0.08363	-0.378000	0.06908	ATC	ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.478	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	273	0.00	0	A	NM_017888		20439155	20439155	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	missense	596	24.91	198	SNP	0.885	T
ADAMTS17	170691	genome.wustl.edu	37	15	100739614	100739614	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr15:100739614C>T	ENST00000268070.4	-	8	1195	c.1090G>A	c.(1090-1092)Gga>Aga	p.G364R	ADAMTS17_ENST00000559976.1_5'UTR	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	364	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CACACACCTCCTAAGTAAGCA	0.527																																						dbGAP											0													263.0	214.0	230.0					15																	100739614		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1090G>A	15.37:g.100739614C>T	ENSP00000268070:p.Gly364Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G364R	ENST00000268070.4	37	c.1090	CCDS10383.1	15	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527819	0.85706	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	D	0.89617	-2.54	5.55	4.63	0.57726	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.071390	0.53938	D	0.000043	D	0.92361	0.7576	L	0.54863	1.705	0.80722	D	1	D;D	0.76494	0.989;0.999	P;D	0.71656	0.843;0.974	D	0.92900	0.6338	10	0.87932	D	0	.	14.8052	0.69948	0.0:0.9297:0.0:0.0703	.	121;364	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	R	364;121	ENSP00000268070:G364R	ENSP00000268070:G364R	G	-	1	0	ADAMTS17	98557137	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.918000	0.75788	2.596000	0.87737	0.655000	0.94253	GGA	ADAMTS17	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000140470		0.527	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	HGNC	protein_coding	OTTHUMT00000313595.1	81	0.00	0	C	NM_139057		100739614	100739614	-1	no_errors	ENST00000268070	ensembl	human	known	69_37n	missense	91	13.21	14	SNP	1.000	T
ADAMTS20	80070	genome.wustl.edu	37	12	43821169	43821169	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:43821169T>G	ENST00000389420.3	-	27	4048	c.4049A>C	c.(4048-4050)gAg>gCg	p.E1350A	ADAMTS20_ENST00000395541.2_Missense_Mutation_p.E468A|ADAMTS20_ENST00000553158.1_Missense_Mutation_p.E1350A	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1350	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TTGCTGTAACTCTGGAGGCTT	0.463																																						dbGAP											0													116.0	90.0	99.0					12																	43821169		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4049A>C	12.37:g.43821169T>G	ENSP00000374071:p.Glu1350Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.E1350A	ENST00000389420.3	37	c.4049	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985824	0.74589	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	4.94	4.94	0.65067	.	0.115910	0.37577	N	0.002028	T	0.71846	0.3388	L	0.50993	1.605	0.58432	D	0.999999	P;D	0.60160	0.921;0.987	D;D	0.65140	0.917;0.932	T	0.70313	-0.4906	10	0.34782	T	0.22	.	15.2937	0.73885	0.0:0.0:0.0:1.0	.	1350;468	P59510;E9PBD5	ATS20_HUMAN;.	A	1350;480;468;1350;1350	ENSP00000374071:E1350A;ENSP00000447427:E480A;ENSP00000378911:E468A;ENSP00000448341:E1350A	ENSP00000374068:E1350A	E	-	2	0	ADAMTS20	42107436	1.000000	0.71417	0.952000	0.39060	0.422000	0.31414	7.618000	0.83043	2.156000	0.67533	0.528000	0.53228	GAG	ADAMTS20	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000173157		0.463	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	78	0.00	0	T	NM_025003		43821169	43821169	-1	no_errors	ENST00000389420	ensembl	human	known	69_37n	missense	76	13.64	12	SNP	1.000	G
ADAMTS7	11173	genome.wustl.edu	37	15	79064140	79064140	+	Silent	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr15:79064140G>T	ENST00000388820.4	-	15	2373	c.2163C>A	c.(2161-2163)ggC>ggA	p.G721G	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	721	Spacer.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TCTCGCGTGCGCCCGCTGGGA	0.622																																						dbGAP											0													50.0	37.0	42.0					15																	79064140		2196	4293	6489	-	-	-	SO:0001819	synonymous_variant	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.2163C>A	15.37:g.79064140G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14F51|Q6P7J9	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G721	ENST00000388820.4	37	c.2163	CCDS32303.1	15																																																																																			ADAMTS7	-	pfam_ADAM_spacer1	ENSG00000136378		0.622	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	20	0.00	0	G	NM_014272		79064140	79064140	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	silent	23	28.12	9	SNP	0.039	T
ADCY5	111	genome.wustl.edu	37	3	123015062	123015062	+	Splice_Site	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:123015062G>C	ENST00000462833.1	-	17	4144	c.2932C>G	c.(2932-2934)Cct>Gct	p.P978A	ADCY5_ENST00000491190.1_Splice_Site_p.P636A|ADCY5_ENST00000309879.5_Splice_Site_p.P628A	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	978					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GCATGCTCAGGGCTGTGGGGA	0.632																																						dbGAP											0													93.0	78.0	83.0					3																	123015062		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2931-1C>G	3.37:g.123015062G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.P978A	ENST00000462833.1	37	c.2932	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	G	8.123	0.781293	0.16120	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;T;D	0.81659	-1.11;-1.36;-1.52	4.23	4.23	0.50019	.	0.662303	0.14379	N	0.323234	T	0.69504	0.3118	L	0.40543	1.245	0.32696	N	0.513471	B;B	0.19331	0.002;0.035	B;B	0.14023	0.001;0.01	T	0.66658	-0.5868	10	0.20519	T	0.43	.	7.9241	0.29863	0.0851:0.0:0.7559:0.159	.	978;636	O95622;B3KWA8	ADCY5_HUMAN;.	A	978;636;628	ENSP00000419361:P978A;ENSP00000418537:P636A;ENSP00000308685:P628A	ENSP00000308685:P628A	P	-	1	0	ADCY5	124497752	1.000000	0.71417	1.000000	0.80357	0.474000	0.32979	1.145000	0.31577	2.359000	0.80004	0.591000	0.81541	CCT	ADCY5	-	NULL	ENSG00000173175		0.632	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	38	0.00	0	G	XM_171048	Missense_Mutation	123015062	123015062	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	1.000	C
ADCY8	114	genome.wustl.edu	37	8	131792944	131792944	+	Silent	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:131792944G>T	ENST00000286355.5	-	18	5540	c.3448C>A	c.(3448-3450)Cga>Aga	p.R1150R	ADCY8_ENST00000377928.3_Silent_p.R1019R	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	1150					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATCTCCCCTCGGTAATCAAAG	0.522										HNSCC(32;0.087)																												dbGAP											0													154.0	157.0	156.0					8																	131792944		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.3448C>A	8.37:g.131792944G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R1150	ENST00000286355.5	37	c.3448	CCDS6363.1	8																																																																																			ADCY8	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase	ENSG00000155897		0.522	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	249	0.00	0	G			131792944	131792944	-1	no_errors	ENST00000286355	ensembl	human	known	69_37n	silent	275	15.85	52	SNP	1.000	T
AGPAT3	56894	genome.wustl.edu	37	21	45400871	45400871	+	Splice_Site	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr21:45400871A>T	ENST00000398063.2	+	8	1337	c.845A>T	c.(844-846)gAc>gTc	p.D282V	AGPAT3_ENST00000479117.1_3'UTR|AGPAT3_ENST00000398058.1_Splice_Site_p.D282V|AGPAT3_ENST00000291572.8_Splice_Site_p.D282V|AGPAT3_ENST00000327505.2_Splice_Site_p.D282V|AGPAT3_ENST00000546158.1_Splice_Site_p.D282V|AGPAT3_ENST00000398061.1_Splice_Site_p.D282V	NM_001037553.1	NP_001032642.1	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	282					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			large_intestine(4)|lung(5)|ovary(1)|prostate(1)	11				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		CTCTTCTAGGACGCGCTCCAG	0.493																																					Pancreas(60;623 1650 5574 52796)	dbGAP											0													77.0	81.0	80.0					21																	45400871		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF156774	CCDS13703.1	21q22.3	2013-02-05			ENSG00000160216	ENSG00000160216	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	326	protein-coding gene	gene with protein product		614794					Standard	XM_005261159		Approved	LPAAT-gamma	uc002zdw.3	Q9NRZ7	OTTHUMG00000086892	ENST00000398063.2:c.844-1A>T	21.37:g.45400871A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSL2|Q3ZCU2|Q6UWP6|Q6ZUC6|Q8N3Q7|Q9NRZ6	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.D282V	ENST00000398063.2	37	c.845	CCDS13703.1	21	.	.	.	.	.	.	.	.	.	.	A	15.85	2.955330	0.53293	.	.	ENSG00000160216	ENST00000291572;ENST00000398061;ENST00000327505;ENST00000398063;ENST00000398058;ENST00000546158	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.70996	0.3288	M	0.92923	3.36	0.80722	D	1	D;D	0.69078	0.997;0.992	D;D	0.68192	0.94;0.956	T	0.79736	-0.1678	10	0.87932	D	0	-24.8081	14.589	0.68351	1.0:0.0:0.0:0.0	.	302;282	Q9NRZ7-3;Q9NRZ7	.;PLCC_HUMAN	V	282	ENSP00000291572:D282V;ENSP00000381138:D282V;ENSP00000332989:D282V;ENSP00000381140:D282V;ENSP00000381135:D282V;ENSP00000443510:D282V	ENSP00000291572:D282V	D	+	2	0	AGPAT3	44225299	1.000000	0.71417	0.791000	0.31998	0.010000	0.07245	8.656000	0.91102	1.853000	0.53794	0.383000	0.25322	GAC	AGPAT3	-	NULL	ENSG00000160216		0.493	AGPAT3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGPAT3	HGNC	protein_coding	OTTHUMT00000195722.1	84	0.00	0	A	NM_020132	Missense_Mutation	45400871	45400871	+1	no_errors	ENST00000291572	ensembl	human	known	69_37n	missense	95	12.84	14	SNP	1.000	T
AHR	196	genome.wustl.edu	37	7	17349613	17349613	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:17349613G>C	ENST00000242057.4	+	2	762	c.119G>C	c.(118-120)aGa>aCa	p.R40T		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	40	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AAGCGGCATAGAGACCGACTT	0.383																																						dbGAP											0													88.0	76.0	80.0					7																	17349613		2203	4300	6503	-	-	-	SO:0001583	missense	0			L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.119G>C	7.37:g.17349613G>C	ENSP00000242057:p.Arg40Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd	p.R40T	ENST00000242057.4	37	c.119	CCDS5366.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.135559	0.94517	.	.	ENSG00000106546	ENST00000242057	D	0.99201	-5.55	5.49	5.49	0.81192	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99576	0.9847	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98036	1.0379	10	0.87932	D	0	.	19.7314	0.96182	0.0:0.0:1.0:0.0	.	40	P35869	AHR_HUMAN	T	40	ENSP00000242057:R40T	ENSP00000242057:R40T	R	+	2	0	AHR	17316138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.727000	0.93392	0.655000	0.94253	AGA	AHR	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000106546		0.383	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AHR	HGNC	protein_coding	OTTHUMT00000314620.2	73	0.00	0	G	NM_001621		17349613	17349613	+1	no_errors	ENST00000242057	ensembl	human	known	69_37n	missense	164	20.00	41	SNP	1.000	C
AKT1	207	genome.wustl.edu	37	14	105238714	105238714	+	Silent	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr14:105238714C>A	ENST00000554581.1	-	11	2728	c.1248G>T	c.(1246-1248)gtG>gtT	p.V416V	AKT1_ENST00000402615.2_Silent_p.V416V|AKT1_ENST00000554848.1_Silent_p.V416V|AKT1_ENST00000407796.2_Silent_p.V416V|AKT1_ENST00000554585.1_5'UTR|AKT1_ENST00000555528.1_Silent_p.V416V|AKT1_ENST00000554192.1_Silent_p.V103V|AKT1_ENST00000349310.3_Silent_p.V416V|AKT1_ENST00000555458.1_Silent_p.V111V|AKT1_ENST00000544168.1_Silent_p.V354V|RP11-982M15.2_ENST00000557223.1_RNA			P31749	AKT1_HUMAN	v-akt murine thymoma viral oncogene homolog 1	416	AGC-kinase C-terminal.				activation-induced cell death of T cells (GO:0006924)|aging (GO:0007568)|anagen (GO:0042640)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell projection organization (GO:0030030)|cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to mechanical stimulus (GO:0071260)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|execution phase of apoptosis (GO:0097194)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycogen cell differentiation involved in embryonic placenta development (GO:0060709)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|labyrinthine layer blood vessel development (GO:0060716)|mammary gland epithelial cell differentiation (GO:0060644)|maternal placenta development (GO:0001893)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of proteolysis (GO:0045861)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|osteoblast differentiation (GO:0001649)|peptidyl-serine phosphorylation (GO:0018105)|peripheral nervous system myelin maintenance (GO:0032287)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell growth (GO:0030307)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle checkpoint (GO:1901976)|regulation of cell migration (GO:0030334)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of neuron projection development (GO:0010975)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of translation (GO:0006417)|response to fluid shear stress (GO:0034405)|response to food (GO:0032094)|response to heat (GO:0009408)|response to UV-A (GO:0070141)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|striated muscle cell differentiation (GO:0051146)|T cell costimulation (GO:0031295)|translation (GO:0006412)	cell-cell junction (GO:0005911)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|nitric-oxide synthase regulator activity (GO:0030235)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(3)|breast(97)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(7)|lung(10)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|thyroid(10)|urinary_tract(15)	176		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	TCTTCTCGTACACGTGCTGCC	0.612		1	Mis		"""breast, colorectal, ovarian, NSCLC"""																																	dbGAP		Dom	yes		14	14q32.32	207	v-akt murine thymoma viral oncogene homolog 1		E	0													135.0	97.0	110.0					14																	105238714		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M63167	CCDS9994.1	14q32.33	2014-09-17			ENSG00000142208	ENSG00000142208	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	391	protein-coding gene	gene with protein product		164730					Standard	XM_005267401		Approved	RAC, PKB, PRKBA, AKT	uc001ypn.3	P31749	OTTHUMG00000170795	ENST00000554581.1:c.1248G>T	14.37:g.105238714C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM5|B7Z5R1|Q9BWB6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.V416	ENST00000554581.1	37	c.1248	CCDS9994.1	14																																																																																			AKT1	-	superfamily_Kinase-like_dom,smart_AGC-kinase_C	ENSG00000142208		0.612	AKT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AKT1	HGNC	protein_coding	OTTHUMT00000410418.1	21	0.00	0	C	NM_005163		105238714	105238714	-1	no_errors	ENST00000349310	ensembl	human	known	69_37n	silent	5	70.59	12	SNP	0.993	A
ANAPC1	64682	genome.wustl.edu	37	2	112608454	112608454	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:112608454G>T	ENST00000341068.3	-	14	2321	c.1549C>A	c.(1549-1551)Ccc>Acc	p.P517T		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	517					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						GTCAGAGAGGGAGCTGGCAGT	0.408																																						dbGAP											0													37.0	39.0	38.0					2																	112608454		2202	4295	6497	-	-	-	SO:0001583	missense	0			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1549C>A	2.37:g.112608454G>T	ENSP00000339109:p.Pro517Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NULL	p.P517T	ENST00000341068.3	37	c.1549	CCDS2093.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.67|11.67	1.708867|1.708867	0.30322|0.30322	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000341068|ENST00000427997	.|.	.|.	.|.	4.57|4.57	4.57|4.57	0.56435|0.56435	.|.	0.300687|.	0.22025|.	U|.	0.065671|.	T|T	0.60702|0.60702	0.2289|0.2289	L|L	0.39245|0.39245	1.2|1.2	0.53005|0.53005	D|D	0.999965|0.999965	B|.	0.06786|.	0.001|.	B|.	0.09377|.	0.004|.	T|T	0.58086|0.58086	-0.7698|-0.7698	9|5	0.07482|.	T|.	0.82|.	-12.5225|-12.5225	17.3996|17.3996	0.87455|0.87455	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	517|.	Q9H1A4|.	APC1_HUMAN|.	T|Y	517|51	.|.	ENSP00000339109:P517T|.	P|S	-|-	1|2	0|0	ANAPC1|ANAPC1	112324925|112324925	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	7.584000|7.584000	0.82572|0.82572	2.091000|2.091000	0.63221|0.63221	0.449000|0.449000	0.29647|0.29647	CCC|TCC	ANAPC1	-	NULL	ENSG00000153107		0.408	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	HGNC	protein_coding	OTTHUMT00000254045.2	86	0.00	0	G	NM_022662		112608454	112608454	-1	no_errors	ENST00000341068	ensembl	human	known	69_37n	missense	108	17.56	23	SNP	1.000	T
ANKRD26	22852	genome.wustl.edu	37	10	27326984	27326984	+	Splice_Site	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:27326984C>G	ENST00000376087.4	-	22	2541		c.e22-1		ANKRD26_ENST00000436985.2_Splice_Site|ANKRD26_ENST00000376070.3_Splice_Site	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26						glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TAAGCTAAATCTGCAGTTAAA	0.294																																						dbGAP											0													75.0	65.0	68.0					10																	27326984		1813	4064	5877	-	-	-	SO:0001630	splice_region_variant	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.2376-1G>C	10.37:g.27326984C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Splice_Site	SNP	-	e22-1	ENST00000376087.4	37	c.2424-1	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	.	15.47	2.842547	0.51057	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0632	0.80853	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD26	27366990	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	6.342000	0.72982	2.445000	0.82738	0.585000	0.79938	.	ANKRD26	-	-	ENSG00000107890		0.294	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	100	0.00	0	C		Intron	27326984	27326984	-1	no_errors	ENST00000436985	ensembl	human	known	69_37n	splice_site	118	12.59	17	SNP	1.000	G
ARHGAP20	57569	genome.wustl.edu	37	11	110450859	110450859	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:110450859G>T	ENST00000260283.4	-	16	3095	c.2811C>A	c.(2809-2811)agC>agA	p.S937R	ARHGAP20_ENST00000527598.1_Missense_Mutation_p.S901R|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.S911R|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.S901R|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.S911R|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.S480R|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.S914R	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	937	Ser-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GGGAGGATAAGCTGGAATAGC	0.488																																						dbGAP											0													121.0	119.0	120.0					11																	110450859		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2811C>A	11.37:g.110450859G>T	ENSP00000260283:p.Ser937Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Ras-assoc,pfscan_RhoGAP_dom	p.S937R	ENST00000260283.4	37	c.2811	CCDS31673.1	11	.	.	.	.	.	.	.	.	.	.	G	17.18	3.322920	0.60634	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.31510	1.49;1.5;1.59;1.49;1.51;1.5;1.51	5.67	-0.124	0.13523	.	0.278338	0.40554	N	0.001071	T	0.48484	0.1502	M	0.67953	2.075	0.27955	N	0.936997	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.973;0.974	T	0.44406	-0.9330	10	0.87932	D	0	.	11.1168	0.48264	0.3957:0.0:0.6043:0.0	.	911;937;914	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	R	937;911;480;914;901;911;901	ENSP00000260283:S937R;ENSP00000349660:S911R;ENSP00000437905:S480R;ENSP00000432076:S914R;ENSP00000436319:S901R;ENSP00000436522:S911R;ENSP00000431399:S901R	ENSP00000260283:S937R	S	-	3	2	ARHGAP20	109956069	0.783000	0.28701	0.992000	0.48379	0.947000	0.59692	0.130000	0.15850	0.066000	0.16515	0.655000	0.94253	AGC	ARHGAP20	-	NULL	ENSG00000137727		0.488	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP20	HGNC	protein_coding	OTTHUMT00000390628.1	114	0.00	0	G	NM_020809		110450859	110450859	-1	no_errors	ENST00000260283	ensembl	human	known	69_37n	missense	119	17.24	25	SNP	0.997	T
ATAD2	29028	genome.wustl.edu	37	8	124360463	124360463	+	Silent	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:124360463T>C	ENST00000287394.5	-	15	1964	c.1857A>G	c.(1855-1857)ccA>ccG	p.P619P	ATAD2_ENST00000521903.1_5'UTR|MIR548AA1_ENST00000384971.2_RNA	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	619					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ATGTGTCCAGTGGTTTGGGAT	0.284																																						dbGAP											0													41.0	44.0	43.0					8																	124360463		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1857A>G	8.37:g.124360463T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.P619	ENST00000287394.5	37	c.1857	CCDS6343.1	8																																																																																			ATAD2	-	NULL	ENSG00000156802		0.284	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	88	0.00	0	T	NM_014109		124360463	124360463	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	silent	67	20.93	18	SNP	0.370	C
ATM	472	genome.wustl.edu	37	11	108119728	108119728	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:108119728T>G	ENST00000452508.2	+	10	1323	c.1134T>G	c.(1132-1134)agT>agG	p.S378R	ATM_ENST00000278616.4_Missense_Mutation_p.S378R			Q13315	ATM_HUMAN	ATM serine/threonine kinase	378					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GAGAATCTAGTGATTACAGTG	0.333			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													89.0	91.0	90.0					11																	108119728		2201	4298	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1134T>G	11.37:g.108119728T>G	ENSP00000388058:p.Ser378Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S378R	ENST00000452508.2	37	c.1134	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	T	1.883	-0.457334	0.04540	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.01933	4.55;4.83;4.83	5.07	1.19	0.21007	Armadillo-type fold (1);	1.279300	0.04952	N	0.460521	T	0.01558	0.0050	N	0.03608	-0.345	0.09310	N	1	B	0.23735	0.09	B	0.21360	0.034	T	0.49437	-0.8940	10	0.33141	T	0.24	.	9.7054	0.40211	0.0:0.186:0.0:0.8139	.	378	Q13315	ATM_HUMAN	R	378	ENSP00000435747:S378R;ENSP00000278616:S378R;ENSP00000388058:S378R	ENSP00000278616:S378R	S	+	3	2	ATM	107624938	0.007000	0.16637	0.015000	0.15790	0.156000	0.22039	0.443000	0.21644	0.045000	0.15804	0.460000	0.39030	AGT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.333	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	93	0.00	0	T	NM_000051		108119728	108119728	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	105	28.57	42	SNP	0.011	G
ATOH1	474	genome.wustl.edu	37	4	94750843	94750843	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr4:94750843G>A	ENST00000306011.3	+	1	802	c.766G>A	c.(766-768)Gct>Act	p.A256T		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	256					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		CGCAGCTGGGGCTCAGCAGGC	0.711																																						dbGAP											0													14.0	17.0	16.0					4																	94750843		2176	4276	6452	-	-	-	SO:0001583	missense	0			U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.766G>A	4.37:g.94750843G>A	ENSP00000302216:p.Ala256Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CT9	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.A256T	ENST00000306011.3	37	c.766	CCDS3638.1	4	.	.	.	.	.	.	.	.	.	.	G	1.367	-0.587063	0.03827	.	.	ENSG00000172238	ENST00000306011	D	0.97455	-4.39	4.26	1.48	0.22813	.	0.597669	0.16515	N	0.211050	D	0.88433	0.6435	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.78028	-0.2364	10	0.12766	T	0.61	-0.0041	3.7754	0.08657	0.3305:0.1944:0.475:0.0	.	256	Q92858	ATOH1_HUMAN	T	256	ENSP00000302216:A256T	ENSP00000302216:A256T	A	+	1	0	ATOH1	94969866	0.000000	0.05858	0.026000	0.17262	0.410000	0.31052	0.581000	0.23819	0.443000	0.26582	0.478000	0.44815	GCT	ATOH1	-	NULL	ENSG00000172238		0.711	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH1	HGNC	protein_coding	OTTHUMT00000253585.1	56	0.00	0	G	NM_005172		94750843	94750843	+1	no_errors	ENST00000306011	ensembl	human	known	69_37n	missense	14	53.33	16	SNP	0.000	A
ATP5F1	515	genome.wustl.edu	37	1	111996910	111996910	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:111996910G>T	ENST00000369722.3	+	3	761	c.155G>T	c.(154-156)gGa>gTa	p.G52V	ATP5F1_ENST00000369721.4_Intron|ATP5F1_ENST00000483994.1_Intron	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	52					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		GAATACGGAGGAAAAGTTCGT	0.438																																						dbGAP											0													128.0	123.0	125.0					1																	111996910		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.155G>T	1.37:g.111996910G>T	ENSP00000358737:p.Gly52Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQ68|Q9BRU8	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_bsu_mt	p.G52V	ENST00000369722.3	37	c.155	CCDS836.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520575	0.85495	.	.	ENSG00000116459	ENST00000369722	T	0.36878	1.23	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.54532	0.1864	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.60198	-0.7310	10	0.66056	D	0.02	.	17.7882	0.88545	0.0:0.0:1.0:0.0	.	52;52	Q08ET0;P24539	.;AT5F1_HUMAN	V	52	ENSP00000358737:G52V	ENSP00000358737:G52V	G	+	2	0	ATP5F1	111798433	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	8.827000	0.92041	2.373000	0.80994	0.467000	0.42956	GGA	ATP5F1	-	NULL	ENSG00000116459		0.438	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5F1	HGNC	protein_coding	OTTHUMT00000032455.1	153	0.00	0	G	NM_001688		111996910	111996910	+1	no_errors	ENST00000369722	ensembl	human	known	69_37n	missense	163	34.78	88	SNP	1.000	T
AZI2	64343	genome.wustl.edu	37	3	28365572	28365572	+	Silent	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:28365572G>A	ENST00000479665.1	-	8	1671	c.1140C>T	c.(1138-1140)taC>taT	p.Y380Y	CMC1_ENST00000466830.1_3'UTR|AZI2_ENST00000295748.3_5'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	380					dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						GTTGATCCAAGTAATGCAGTG	0.398																																						dbGAP											0													133.0	137.0	136.0					3																	28365572		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.1140C>T	3.37:g.28365572G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Silent	SNP	NULL	p.Y380	ENST00000479665.1	37	c.1140	CCDS2647.1	3																																																																																			AZI2	-	NULL	ENSG00000163512		0.398	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000252998.2	162	0.00	0	G	NM_203326		28365572	28365572	-1	no_errors	ENST00000479665	ensembl	human	known	69_37n	silent	67	56.21	86	SNP	0.960	A
ATXN7	6314	genome.wustl.edu	37	3	63965690	63965690	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:63965690C>T	ENST00000295900.6	+	6	1149	c.599C>T	c.(598-600)gCa>gTa	p.A200V	ATXN7_ENST00000538065.1_Missense_Mutation_p.A200V|ATXN7_ENST00000487717.1_Missense_Mutation_p.A200V|ATXN7_ENST00000488239.1_3'UTR|ATXN7_ENST00000484332.1_Missense_Mutation_p.A55V|ATXN7_ENST00000398590.3_Missense_Mutation_p.A200V	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	200	Ser-rich.				cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		GGAGGCAGTGCAAGTGGAAGC	0.498																																						dbGAP											0													92.0	91.0	91.0					3																	63965690		1998	4194	6192	-	-	-	SO:0001583	missense	0			AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.599C>T	3.37:g.63965690C>T	ENSP00000295900:p.Ala200Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	pfam_SCA7_dom	p.A200V	ENST00000295900.6	37	c.599	CCDS43102.1	3	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793933	0.50102	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	5.76	2.98	0.34508	.	0.562666	0.18816	N	0.130382	T	0.24044	0.0582	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.27559	0.026;0.181;0.145;0.026	B;B;B;B	0.26310	0.031;0.036;0.068;0.031	T	0.06844	-1.0804	10	0.27082	T	0.32	-0.0724	19.0182	0.92902	0.0:0.4312:0.5688:0.0	.	55;55;200;200	E9PHP9;B4E207;O15265-2;O15265	.;.;.;ATX7_HUMAN	V	200;200;200;200;55	ENSP00000381590:A200V;ENSP00000295900:A200V;ENSP00000420234:A200V;ENSP00000439585:A200V;ENSP00000428277:A55V	ENSP00000295900:A200V	A	+	2	0	ATXN7	63940730	0.932000	0.31603	0.451000	0.26982	0.996000	0.88848	2.282000	0.43461	0.350000	0.24002	0.655000	0.94253	GCA	ATXN7	-	NULL	ENSG00000163635		0.498	ATXN7-001	KNOWN	basic|CCDS	protein_coding	ATXN7	HGNC	protein_coding	OTTHUMT00000352070.1	210	0.00	0	C	NM_000333		63965690	63965690	+1	no_errors	ENST00000398590	ensembl	human	known	69_37n	missense	139	27.98	54	SNP	0.155	T
BDKRB2	624	genome.wustl.edu	37	14	96707447	96707448	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr14:96707447_96707448insT	ENST00000306005.3	+	3	978_979	c.782_783insT	c.(781-786)gagatcfs	p.EI261fs	BDKRB2_ENST00000554311.1_Frame_Shift_Ins_p.EI261fs|BDKRB2_ENST00000542454.2_Frame_Shift_Ins_p.EI234fs|BDKRB2_ENST00000539359.1_Frame_Shift_Ins_p.EI234fs|RP11-404P21.8_ENST00000553811.1_Intron	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	261					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	AAGTTCAAGGAGATCCAGACAG	0.559																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		Exception_encountered	14.37:g.96707447_96707448insT	ENSP00000307713:p.Glu261fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_B2_bradkn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Brdyknn_rcpt,prints_ATII_rcpt	p.E261fs	ENST00000306005.3	37	c.782_783	CCDS9942.1	14																																																																																			BDKRB2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_B2_bradkn_rcpt	ENSG00000168398		0.559	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	BDKRB2	HGNC	protein_coding	OTTHUMT00000413294.1	48	0.00	0	-			96707447	96707448	+1	no_errors	ENST00000306005	ensembl	human	known	69_37n	frame_shift_ins	29	53.23	33	INS	1.000:0.998	T
BDKRB1	623	genome.wustl.edu	37	14	96730334	96730334	+	Missense_Mutation	SNP	C	C	G	rs370873606		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr14:96730334C>G	ENST00000216629.6	+	3	921	c.315C>G	c.(313-315)ttC>ttG	p.F105L	BDKRB1_ENST00000553356.1_Missense_Mutation_p.F105L|RP11-404P21.3_ENST00000553638.1_RNA	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	105					cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		ACTGGCCTTTCGGAGCCCTCC	0.557																																						dbGAP											0													77.0	76.0	76.0					14																	96730334		2203	4300	6503	-	-	-	SO:0001583	missense	0			L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.315C>G	14.37:g.96730334C>G	ENSP00000216629:p.Phe105Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7F5|Q546S7|Q8N0Y8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_BK_rcpt_B1,prints_7TM_GPCR_Rhodpsn,prints_Brdyknn_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.F105L	ENST00000216629.6	37	c.315	CCDS9943.1	14	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617373	0.46736	.	.	ENSG00000100739	ENST00000216629;ENST00000553356	T;T	0.38722	1.12;1.12	5.47	-1.49	0.08718	GPCR, rhodopsin-like superfamily (1);	0.069516	0.64402	D	0.000012	T	0.59307	0.2184	M	0.77616	2.38	0.39027	D	0.959869	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.63391	-0.6648	10	0.87932	D	0	-23.8211	10.8279	0.46645	0.0:0.4177:0.0:0.5823	.	105;105	G3V4Y2;P46663	.;BKRB1_HUMAN	L	105	ENSP00000216629:F105L;ENSP00000452064:F105L	ENSP00000216629:F105L	F	+	3	2	BDKRB1	95800087	0.229000	0.23729	0.651000	0.29564	0.127000	0.20565	-0.400000	0.07241	-0.172000	0.10779	0.555000	0.69702	TTC	BDKRB1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000100739		0.557	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDKRB1	HGNC	protein_coding	OTTHUMT00000413300.1	40	0.00	0	C			96730334	96730334	+1	no_errors	ENST00000216629	ensembl	human	known	69_37n	missense	84	12.50	12	SNP	0.975	G
BMX	660	genome.wustl.edu	37	X	15552435	15552435	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chrX:15552435A>G	ENST00000357607.2	+	12	1308	c.1120A>G	c.(1120-1122)Att>Gtt	p.I374V	BMX_ENST00000342014.6_Missense_Mutation_p.I374V|BMX_ENST00000348343.6_Missense_Mutation_p.I374V			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	374	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					TCCAAAGCTTATTCATTATCA	0.343																																						dbGAP											0													126.0	121.0	123.0					X																	15552435		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.1120A>G	X.37:g.15552435A>G	ENSP00000350224:p.Ile374Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIH9|O60564|Q12871	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_Znf_Btk_motif,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_Znf_Btk_motif,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom	p.I374V	ENST00000357607.2	37	c.1120	CCDS14168.1	X	.	.	.	.	.	.	.	.	.	.	A	19.90	3.911883	0.72983	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	T;T;T	0.20881	2.04;2.04;2.04	5.07	5.07	0.68467	SH2 motif (5);	0.000000	0.64402	D	0.000012	T	0.38453	0.1041	L	0.46947	1.48	0.45427	D	0.9984	D	0.63880	0.993	D	0.76071	0.987	T	0.12400	-1.0549	10	0.56958	D	0.05	.	12.6931	0.56988	1.0:0.0:0.0:0.0	.	374	P51813	BMX_HUMAN	V	374	ENSP00000350224:I374V;ENSP00000308774:I374V;ENSP00000340082:I374V	ENSP00000340082:I374V	I	+	1	0	BMX	15462356	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	6.082000	0.71318	1.671000	0.50874	0.486000	0.48141	ATT	BMX	-	pfam_SH2,smart_SH2,prints_SH2,pfscan_SH2	ENSG00000102010		0.343	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	BMX	HGNC	protein_coding	OTTHUMT00000055877.1	231	0.00	0	A	NM_001721		15552435	15552435	+1	no_errors	ENST00000342014	ensembl	human	known	69_37n	missense	258	33.68	131	SNP	1.000	G
C22orf23	84645	genome.wustl.edu	37	22	38349110	38349110	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr22:38349110A>T	ENST00000249079.2	-	2	303	c.47T>A	c.(46-48)tTc>tAc	p.F16Y	POLR2F_ENST00000488684.1_5'Flank|POLR2F_ENST00000606538.1_5'Flank|POLR2F_ENST00000407936.1_5'Flank|POLR2F_ENST00000460648.1_5'Flank|POLR2F_ENST00000470701.1_5'Flank|RP5-1039K5.17_ENST00000609976.1_RNA|C22orf23_ENST00000403305.1_Missense_Mutation_p.F16Y|POLR2F_ENST00000442738.2_5'Flank|POLR2F_ENST00000405557.1_5'Flank|C22orf23_ENST00000403026.1_Missense_Mutation_p.F16Y			Q9BZE7	EVG1_HUMAN	chromosome 22 open reading frame 23	16										endometrium(3)|kidney(2)|large_intestine(7)	12	Melanoma(58;0.045)					GCGGCGCCGGAACCCAGTTCC	0.597																																						dbGAP											0													138.0	132.0	134.0					22																	38349110		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF324466	CCDS13962.1, CCDS74860.1	22q13.1	2013-10-11			ENSG00000128346	ENSG00000128346			18589	protein-coding gene	gene with protein product						11237012	Standard	NM_032561		Approved	FLJ32787, EVG1, LOC84645	uc003auj.2	Q9BZE7	OTTHUMG00000150672	ENST00000249079.2:c.47T>A	22.37:g.38349110A>T	ENSP00000249079:p.Phe16Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYU9|Q96M68	Missense_Mutation	SNP	pfam_UPF0193	p.F16Y	ENST00000249079.2	37	c.47	CCDS13962.1	22	.	.	.	.	.	.	.	.	.	.	A	14.10	2.435943	0.43224	.	.	ENSG00000128346	ENST00000403305;ENST00000249079;ENST00000403026;ENST00000418863;ENST00000422191	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.07	4.0	0.46444	.	0.481200	0.21253	N	0.077610	T	0.61388	0.2343	L	0.58669	1.825	0.20563	N	0.999883	D	0.67145	0.996	P	0.61940	0.896	T	0.53180	-0.8475	10	0.62326	D	0.03	-2.0649	6.5383	0.22367	0.8798:0.0:0.1202:0.0	.	16	Q9BZE7	EVG1_HUMAN	Y	16	ENSP00000384667:F16Y;ENSP00000249079:F16Y;ENSP00000384618:F16Y;ENSP00000395077:F16Y;ENSP00000407707:F16Y	ENSP00000249079:F16Y	F	-	2	0	C22orf23	36679056	0.609000	0.26975	0.002000	0.10522	0.069000	0.16628	2.947000	0.49058	0.758000	0.33059	0.454000	0.30748	TTC	C22orf23	-	pfam_UPF0193	ENSG00000128346		0.597	C22orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C22orf23	HGNC	protein_coding	OTTHUMT00000319564.1	43	0.00	0	A	NM_032561		38349110	38349110	-1	no_errors	ENST00000249079	ensembl	human	known	69_37n	missense	31	43.64	24	SNP	0.091	T
C3orf20	84077	genome.wustl.edu	37	3	14744664	14744664	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:14744664G>T	ENST00000253697.3	+	6	1225	c.773G>T	c.(772-774)aGc>aTc	p.S258I	C3orf20_ENST00000412910.1_Missense_Mutation_p.S136I|C3orf20_ENST00000435614.1_Missense_Mutation_p.S136I	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	258						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GAAGATGTCAGCATGCCGCCC	0.572																																						dbGAP											0													162.0	149.0	153.0					3																	14744664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.773G>T	3.37:g.14744664G>T	ENSP00000253697:p.Ser258Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	NULL	p.S258I	ENST00000253697.3	37	c.773	CCDS33706.1	3	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475880	0.26511	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.08896	3.33;3.04;3.04	4.25	-1.48	0.08745	.	1.821940	0.02780	N	0.120842	T	0.06280	0.0162	N	0.24115	0.695	0.09310	N	1	B	0.24426	0.103	B	0.25140	0.058	T	0.39502	-0.9611	10	0.72032	D	0.01	.	2.1335	0.03755	0.1049:0.3519:0.2603:0.2829	.	258	Q8ND61	CC020_HUMAN	I	258;136;136	ENSP00000253697:S258I;ENSP00000402933:S136I;ENSP00000396081:S136I	ENSP00000253697:S258I	S	+	2	0	C3orf20	14719668	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.814000	0.04486	-0.153000	0.11137	0.585000	0.79938	AGC	C3orf20	-	NULL	ENSG00000131379		0.572	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf20	HGNC	protein_coding	OTTHUMT00000340586.1	110	0.00	0	G	NM_032137		14744664	14744664	+1	no_errors	ENST00000253697	ensembl	human	known	69_37n	missense	119	12.50	17	SNP	0.000	T
C5orf49	134121	genome.wustl.edu	37	5	7835545	7835545	+	Silent	SNP	G	G	T	rs76872483	byFrequency	TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:7835545G>T	ENST00000399810.2	-	2	682	c.214C>A	c.(214-216)Cga>Aga	p.R72R	C5orf49_ENST00000509627.1_Silent_p.R72R	NM_001089584.2	NP_001083053.1	A4QMS7	CE049_HUMAN	chromosome 5 open reading frame 49	72										large_intestine(3)|lung(5)|skin(1)	9						CTGTCATCTCGGTGCAACTTC	0.353																																						dbGAP											0													137.0	131.0	133.0					5																	7835545		1825	4086	5911	-	-	-	SO:0001819	synonymous_variant	0				CCDS43300.1	5p15.31	2008-07-16			ENSG00000215217	ENSG00000215217			27028	protein-coding gene	gene with protein product						12477932	Standard	NM_001089584		Approved	LOC134121	uc003jea.5	A4QMS7	OTTHUMG00000161897	ENST00000399810.2:c.214C>A	5.37:g.7835545G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.R72	ENST00000399810.2	37	c.214	CCDS43300.1	5																																																																																			C5orf49	-	NULL	ENSG00000215217		0.353	C5orf49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C5orf49	HGNC	protein_coding	OTTHUMT00000366322.1	119	0.00	0	G	NM_001089584		7835545	7835545	-1	no_errors	ENST00000399810	ensembl	human	known	69_37n	silent	234	13.28	36	SNP	1.000	T
ERMARD	55780	genome.wustl.edu	37	6	170168259	170168259	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr6:170168259C>T	ENST00000366773.3	+	11	1084	c.1051C>T	c.(1051-1053)Cct>Tct	p.P351S	ERMARD_ENST00000588451.1_Missense_Mutation_p.P215S|ERMARD_ENST00000418781.3_Missense_Mutation_p.P351S|ERMARD_ENST00000366772.2_Missense_Mutation_p.P351S|RP1-266L20.9_ENST00000586101.1_RNA|ERMARD_ENST00000392095.4_Missense_Mutation_p.P225S	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	351					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CCTTGGAGAGCCTGCTATGGT	0.338																																						dbGAP											0													123.0	120.0	121.0					6																	170168259		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.1051C>T	6.37:g.170168259C>T	ENSP00000355735:p.Pro351Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	NULL	p.P351S	ENST00000366773.3	37	c.1051	CCDS34576.1	6	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940677	0.34283	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095	T;T	0.40756	1.04;1.02	5.1	4.22	0.49857	.	0.238473	0.29846	N	0.011055	T	0.28400	0.0702	L	0.40543	1.245	0.34722	D	0.728802	P;P;B	0.46142	0.873;0.484;0.18	P;B;B	0.47673	0.554;0.324;0.079	T	0.03503	-1.1030	10	0.29301	T	0.29	.	14.1593	0.65436	0.0:0.9223:0.0:0.0777	.	351;351;351	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	S	351;351;351;225	ENSP00000355735:P351S;ENSP00000375945:P225S	ENSP00000355734:P351S	P	+	1	0	C6orf70	169910184	0.977000	0.34250	0.994000	0.49952	0.974000	0.67602	2.144000	0.42197	2.546000	0.85860	0.655000	0.94253	CCT	C6orf70	-	NULL	ENSG00000130023		0.338	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf70	HGNC	protein_coding	OTTHUMT00000043238.2	33	0.00	0	C	NM_018341		170168259	170168259	+1	no_errors	ENST00000366773	ensembl	human	known	69_37n	missense	61	20.78	16	SNP	1.000	T
CBLC	23624	genome.wustl.edu	37	19	45284602	45284602	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:45284602delC	ENST00000270279.3	+	3	702	c.639delC	c.(637-639)gtcfs	p.V213fs	CBLC_ENST00000341505.4_Frame_Shift_Del_p.V213fs	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	213	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|EF-hand-like.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				AGTTCGACGTCTTCACCAGGC	0.612			M		AML																																	dbGAP		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	0													91.0	71.0	78.0					19																	45284602		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.639delC	19.37:g.45284602delC	ENSP00000270279:p.Val213fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Frame_Shift_Del	DEL	pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Adaptor_Cbl_N_hlx,pfam_Znf_C3HC4_RING-type,superfamily_Adaptor_Cbl_N_hlx,smart_Znf_RING,pfscan_Znf_RING	p.F214fs	ENST00000270279.3	37	c.639	CCDS12643.1	19																																																																																			CBLC	-	pfam_Adaptor_Cbl_EF_hand-like	ENSG00000142273		0.612	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLC	HGNC	protein_coding	OTTHUMT00000319732.2	19	0.00	0	C	NM_012116		45284602	45284602	+1	no_errors	ENST00000270279	ensembl	human	known	69_37n	frame_shift_del	15	58.97	23	DEL	1.000	-
CFAP58	159686	genome.wustl.edu	37	10	106214245	106214245	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:106214245C>G	ENST00000369704.3	+	18	2710	c.2576C>G	c.(2575-2577)aCt>aGt	p.T859S		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		859						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CCTGGTTTTACTGGGGGCGGA	0.453																																						dbGAP											0													177.0	163.0	168.0					10																	106214245		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000369704.3:c.2576C>G	10.37:g.106214245C>G	ENSP00000358718:p.Thr859Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRA6|Q8NA27	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.T859S	ENST00000369704.3	37	c.2576	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	C	7.989	0.752955	0.15778	.	.	ENSG00000120051	ENST00000369704	T	0.36878	1.23	5.47	4.56	0.56223	.	0.526964	0.21023	N	0.081466	T	0.38532	0.1044	M	0.76170	2.325	0.47994	D	0.999569	B	0.18741	0.03	B	0.24701	0.055	T	0.27640	-1.0068	10	0.42905	T	0.14	-0.1355	8.4543	0.32890	0.1522:0.7683:0.0:0.0796	.	859	Q5T655	CC147_HUMAN	S	859	ENSP00000358718:T859S	ENSP00000358718:T859S	T	+	2	0	CCDC147	106204235	0.547000	0.26465	0.820000	0.32676	0.029000	0.11900	0.908000	0.28545	1.444000	0.47605	0.650000	0.86243	ACT	CCDC147	-	NULL	ENSG00000120051		0.453	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1	167	0.00	0	C			106214245	106214245	+1	no_errors	ENST00000369704	ensembl	human	known	69_37n	missense	234	15.22	42	SNP	0.735	G
CCT6B	10693	genome.wustl.edu	37	17	33266673	33266673	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:33266673C>T	ENST00000314144.5	-	9	1143	c.1028G>A	c.(1027-1029)tGc>tAc	p.C343Y	CCT6B_ENST00000436961.3_Missense_Mutation_p.C298Y|CCT6B_ENST00000421975.3_Missense_Mutation_p.C306Y	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	343					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				ATGTCCCAAGCAATCTACAGT	0.363																																						dbGAP											0													112.0	97.0	102.0					17																	33266673		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.1028G>A	17.37:g.33266673C>T	ENSP00000327191:p.Cys343Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_zeta	p.C343Y	ENST00000314144.5	37	c.1028	CCDS32617.1	17	.	.	.	.	.	.	.	.	.	.	C	9.086	1.000471	0.19121	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.78595	-1.19;-1.19;-1.19	4.7	3.57	0.40892	.	0.130780	0.64402	N	0.000001	T	0.73001	0.3531	M	0.79693	2.465	0.47183	D	0.999346	B;B;B	0.19073	0.007;0.014;0.033	B;B;B	0.26310	0.053;0.033;0.068	T	0.62053	-0.6935	10	0.02654	T	1	-0.0356	8.8526	0.35210	0.0:0.8577:0.0:0.1423	.	298;306;343	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	Y	306;343;298	ENSP00000398044:C306Y;ENSP00000327191:C343Y;ENSP00000400917:C298Y	ENSP00000327191:C343Y	C	-	2	0	CCT6B	30290786	1.000000	0.71417	0.977000	0.42913	0.976000	0.68499	3.093000	0.50217	1.076000	0.40961	0.563000	0.77884	TGC	CCT6B	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_zeta	ENSG00000132141		0.363	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6B	HGNC	protein_coding	OTTHUMT00000448014.1	137	0.00	0	C	NM_006584		33266673	33266673	-1	no_errors	ENST00000314144	ensembl	human	known	69_37n	missense	153	23.12	46	SNP	1.000	T
CD207	50489	genome.wustl.edu	37	2	71062661	71062661	+	Silent	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:71062661G>A	ENST00000410009.3	-	2	196	c.151C>T	c.(151-153)Ctg>Ttg	p.L51L		NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin	51					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)			endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						ACCAGGACCAGCGTCAGGCAG	0.582																																						dbGAP											0													75.0	83.0	81.0					2																	71062661		2107	4229	6336	-	-	-	SO:0001819	synonymous_variant	0			AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.151C>T	2.37:g.71062661G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L51	ENST00000410009.3	37	c.151		2																																																																																			CD207	-	NULL	ENSG00000116031		0.582	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	CD207	HGNC	protein_coding	OTTHUMT00000329959.4	31	0.00	0	G	NM_015717		71062661	71062661	-1	no_errors	ENST00000410009	ensembl	human	known	69_37n	silent	36	16.28	7	SNP	0.775	A
CD68	968	genome.wustl.edu	37	17	7483164	7483166	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:7483164_7483166delCAG	ENST00000250092.6	+	2	297_299	c.86_88delCAG	c.(85-90)tcagct>tct	p.A30del	AC113189.5_ENST00000572046.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|AC113189.5_ENST00000417897.1_RNA|SNORD10_ENST00000459579.1_RNA|SNORA67_ENST00000384423.1_RNA|AC113189.5_ENST00000573187.1_RNA|CD68_ENST00000380498.6_Intron|AC113189.5_ENST00000415124.1_RNA	NM_001251.2	NP_001242.2	P34810	CD68_HUMAN	CD68 molecule	30	Mucin-like.				cellular response to organic substance (GO:0071310)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|skin(1)	3						CACAAAAAATCAGCTACTTTGCT	0.571																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			S57235	CCDS11114.1, CCDS58512.1	17p13	2011-11-24	2006-03-28		ENSG00000129226	ENSG00000129226		"""CD molecules"""	1693	protein-coding gene	gene with protein product	"""scavenger receptor class D, member 1"", ""CD68 antigen"", ""macrophage antigen CD68"""	153634	"""CD68 antigen"""			9790779	Standard	NM_001251		Approved	SCARD1, macrosialin, GP110, DKFZp686M18236, LAMP4	uc002ghv.3	P34810	OTTHUMG00000108146	ENST00000250092.6:c.86_88delCAG	17.37:g.7483164_7483166delCAG	ENSP00000250092:p.Ala30del	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVT4|Q53HR6|Q53XI3|Q96BI7	Splice_Site	DEL	-	e2-1	ENST00000250092.6	37	c.50-3_50-1	CCDS11114.1	17																																																																																			CD68	-	-	ENSG00000129226		0.571	CD68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD68	HGNC	protein_coding	OTTHUMT00000226949.3	80	0.00	0	CAG	NM_001251		7483164	7483166	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000584502	ensembl	human	putative	69_37n	splice_site_del	40	23.08	12	DEL	0.446:0.000:0.337	-
CDH12	1010	genome.wustl.edu	37	5	21975210	21975210	+	Missense_Mutation	SNP	C	C	A	rs565906541		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:21975210C>A	ENST00000382254.1	-	6	1602	c.516G>T	c.(514-516)atG>atT	p.M172I	CDH12_ENST00000504376.2_Missense_Mutation_p.M172I|CDH12_ENST00000522262.1_Missense_Mutation_p.M172I	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	172	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CCACAGGAGACATTTCTGGAA	0.383										HNSCC(59;0.17)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		17498	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													89.0	90.0	90.0					5																	21975210		2046	3900	5946	-	-	-	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.516G>T	5.37:g.21975210C>A	ENSP00000371689:p.Met172Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.M172I	ENST00000382254.1	37	c.516	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215000	0.58452	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.60672	0.29;0.29;0.17	5.16	5.16	0.70880	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	N	0.19112	0.55	0.58432	D	0.999999	B;B	0.28933	0.228;0.067	B;B	0.35607	0.206;0.078	T	0.55335	-0.8157	10	0.87932	D	0	.	18.6264	0.91340	0.0:1.0:0.0:0.0	.	172;172	B7Z2U6;P55289	.;CAD12_HUMAN	I	172	ENSP00000423577:M172I;ENSP00000371689:M172I;ENSP00000428786:M172I	ENSP00000371689:M172I	M	-	3	0	CDH12	22010967	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.397000	0.79903	2.414000	0.81942	0.484000	0.47621	ATG	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000154162		0.383	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	340	0.29	1	C	NM_004061		21975210	21975210	-1	no_errors	ENST00000382254	ensembl	human	known	69_37n	missense	365	29.81	155	SNP	1.000	A
CDK20	23552	genome.wustl.edu	37	9	90582115	90582115	+	3'UTR	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr9:90582115G>C	ENST00000325303.8	-	0	1608				CDK20_ENST00000605159.1_3'UTR|CDK20_ENST00000375883.3_3'UTR|CDK20_ENST00000375871.4_3'UTR|CDK20_ENST00000336654.5_3'UTR	NM_001039803.2	NP_001034892.1	Q8IZL9	CDK20_HUMAN	cyclin-dependent kinase 20						cell cycle (GO:0007049)|cell division (GO:0051301)|multicellular organismal development (GO:0007275)	cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			skin(1)	1						TGTCCTGATGGGTACGTCAGT	0.562																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF035013	CCDS6677.1, CCDS6678.1, CCDS35060.1, CCDS55324.1, CCDS65075.1	9q22.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000156345	ENSG00000156345		"""Cyclin-dependent kinases"""	21420	protein-coding gene	gene with protein product		610076	"""cell cycle related kinase"""	CCRK		19884882	Standard	NM_178432		Approved	p42	uc004apr.3	Q8IZL9	OTTHUMG00000020161	ENST00000325303.8:c.*262C>G	9.37:g.90582115G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A389|A2A390|B4DQX1|O95137|Q5EDC4|Q5VYW1|Q9BUF4	RNA	SNP	-	NULL	ENST00000325303.8	37	NULL	CCDS35060.1	9	.	.	.	.	.	.	.	.	.	.	.	2.026	-0.423585	0.04734	.	.	ENSG00000156345	ENST00000286878	.	.	.	3.01	-3.34	0.04943	.	7739.210000	0.00166	N	0.000000	T	0.28599	0.0708	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.13602	-1.0503	6	0.87932	D	0	.	1.4793	0.02433	0.2334:0.2672:0.3586:0.1408	.	.	.	.	R	413	.	ENSP00000286878:P413R	P	-	2	0	CDK20	89771935	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	0.288000	0.18939	-1.256000	0.02478	-2.322000	0.00252	CCC	CDK20	-	-	ENSG00000156345		0.562	CDK20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK20	HGNC	protein_coding	OTTHUMT00000214996.1	13	0.00	0	G	NM_012119		90582115	90582115	-1	no_errors	ENST00000459720	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	0.000	C
CDRT1	374286	genome.wustl.edu	37	17	15508674	15508674	+	Silent	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:15508674T>A	ENST00000395906.3	-	7	1295	c.1296A>T	c.(1294-1296)cgA>cgT	p.R432R	RP11-385D13.1_ENST00000455584.2_Silent_p.R742R	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	432										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		GATGGATCTTTCGATTAGATG	0.498																																						dbGAP											0													11.0	17.0	15.0					17																	15508674		2021	4233	6254	-	-	-	SO:0001819	synonymous_variant	0			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1296A>T	17.37:g.15508674T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43848|O95611	Nonsense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K256*	ENST00000395906.3	37	c.766	CCDS45619.1	17	.	.	.	.	.	.	.	.	.	.	T	9.729	1.161719	0.21538	.	.	ENSG00000251537	ENST00000455584	.	.	.	4.53	1.33	0.21861	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22521	-1.0214	4	.	.	.	.	1.1229	0.01728	0.1565:0.4177:0.1525:0.2734	.	.	.	.	V	757	.	.	E	-	2	0	RP11-385D13.1	15449399	0.555000	0.26530	0.999000	0.59377	0.866000	0.49608	-0.513000	0.06305	0.097000	0.17492	-0.425000	0.05940	GAA	CDRT1	-	superfamily_WD40_repeat_dom	ENSG00000241322		0.498	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	HGNC	protein_coding	OTTHUMT00000448127.1	156	0.64	1	T	NM_006382		15508674	15508674	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000261644	ensembl	human	putative	69_37n	nonsense	142	27.04	53	SNP	0.998	A
CEP192	55125	genome.wustl.edu	37	18	13117605	13117605	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr18:13117605G>A	ENST00000325971.8	+	42	7243	c.5650G>A	c.(5650-5652)Gag>Aag	p.E1884K	CEP192_ENST00000430049.2_Missense_Mutation_p.E2005K|CEP192_ENST00000540847.2_3'UTR|CEP192_ENST00000506447.1_Missense_Mutation_p.E2480K			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1884					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GAGTCCCAGAGAGCCATTCTA	0.358																																						dbGAP											0													115.0	114.0	114.0					18																	13117605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.5650G>A	18.37:g.13117605G>A	ENSP00000317156:p.Glu1884Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.E2480K	ENST00000325971.8	37	c.7438		18	.	.	.	.	.	.	.	.	.	.	G	32	5.149692	0.94645	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.06849	3.25;3.25;3.26	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.29126	0.0724	M	0.71581	2.175	0.58432	D	0.999997	D;D;D;P	0.76494	0.999;0.996;0.992;0.93	D;D;P;P	0.71414	0.973;0.921;0.856;0.641	T	0.01961	-1.1239	10	0.72032	D	0.01	-11.7521	18.0169	0.89243	0.0:0.0:1.0:0.0	.	2005;2480;484;1083	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	K	2480;1884;1884;2005;484	ENSP00000427550:E2480K;ENSP00000317156:E1884K;ENSP00000389190:E2005K	ENSP00000317156:E1884K	E	+	1	0	CEP192	13107605	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.571000	0.82399	2.436000	0.82500	0.655000	0.94253	GAG	CEP192	-	NULL	ENSG00000101639		0.358	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		110	0.00	0	G	NM_032142		13117605	13117605	+1	no_errors	ENST00000506447	ensembl	human	known	69_37n	missense	295	14.49	50	SNP	1.000	A
CHGA	1113	genome.wustl.edu	37	14	93392991	93392991	+	Silent	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr14:93392991C>A	ENST00000216492.5	+	3	415	c.135C>A	c.(133-135)tcC>tcA	p.S45S	CHGA_ENST00000553866.1_3'UTR|CHGA_ENST00000334654.4_Silent_p.S45S	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	45	O-glycosylated at one site only in cerebrospinal fluid.				regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		ACACACTTTCCAAGCCCAGCC	0.597																																					Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)	dbGAP											0													112.0	85.0	94.0					14																	93392991		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.135C>A	14.37:g.93392991C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Silent	SNP	pfam_Granin,prints_Chromogranin_AB	p.S45	ENST00000216492.5	37	c.135	CCDS9906.1	14																																																																																			CHGA	-	pfam_Granin,prints_Chromogranin_AB	ENSG00000100604		0.597	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGA	HGNC	protein_coding	OTTHUMT00000412411.1	13	0.00	0	C	NM_001275		93392991	93392991	+1	no_errors	ENST00000216492	ensembl	human	known	69_37n	silent	9	47.06	8	SNP	1.000	A
CHIA	27159	genome.wustl.edu	37	1	111861257	111861257	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:111861257C>A	ENST00000369740.1	+	9	975	c.872C>A	c.(871-873)gCt>gAt	p.A291D	CHIA_ENST00000343320.6_Missense_Mutation_p.A291D|CHIA_ENST00000451398.2_Missense_Mutation_p.A130D|CHIA_ENST00000430615.1_Missense_Mutation_p.A183D|CHIA_ENST00000353665.6_Missense_Mutation_p.A130D|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Missense_Mutation_p.A130D	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	291					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		GCTGGTCCTGCTGGGCCCTAT	0.537																																						dbGAP											0													144.0	139.0	141.0					1																	111861257		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.872C>A	1.37:g.111861257C>A	ENSP00000358755:p.Ala291Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.A291D	ENST00000369740.1	37	c.872	CCDS41368.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095244	0.76870	.	.	ENSG00000134216	ENST00000422815;ENST00000483391;ENST00000369740;ENST00000343320;ENST00000451398;ENST00000353665;ENST00000489524;ENST00000430615	T;T;T;T;T;T;T;T	0.06218	3.33;3.33;3.33;3.33;3.33;3.33;3.33;3.33	4.84	3.91	0.45181	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.176583	0.34507	U	0.003915	T	0.15046	0.0363	M	0.85710	2.77	0.53005	D	0.999967	D	0.61080	0.989	D	0.65874	0.939	T	0.00855	-1.1539	10	0.62326	D	0.03	-6.1937	10.3782	0.44094	0.0:0.9003:0.0:0.0997	.	291	Q9BZP6	CHIA_HUMAN	D	235;130;291;291;130;130;130;183	ENSP00000387671:A235D;ENSP00000436946:A130D;ENSP00000358755:A291D;ENSP00000341828:A291D;ENSP00000390476:A130D;ENSP00000338970:A130D;ENSP00000433309:A130D;ENSP00000391132:A183D	ENSP00000341828:A291D	A	+	2	0	CHIA	111662780	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	4.117000	0.57877	1.134000	0.42165	0.563000	0.77884	GCT	CHIA	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000134216		0.537	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1	139	0.00	0	C			111861257	111861257	+1	no_errors	ENST00000343320	ensembl	human	known	69_37n	missense	188	19.92	47	SNP	1.000	A
CISH	1154	genome.wustl.edu	37	3	50645365	50645366	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:50645365_50645366insA	ENST00000348721.3	-	3	629_630	c.449_450insT	c.(448-450)atcfs	p.I150fs	CISH_ENST00000443053.2_Frame_Shift_Ins_p.I167fs	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	150	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GAAAGGCCAGGATGCGTGGCCT	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.450dupT	3.37:g.50645366_50645366dupA	ENSP00000294173:p.Ile150fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Frame_Shift_Ins	INS	pfam_SH2,pfam_SOCS_C,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2,prints_SH2	p.L168fs	ENST00000348721.3	37	c.501_500	CCDS2831.1	3																																																																																			CISH	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000114737		0.609	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CISH	HGNC	protein_coding	OTTHUMT00000346245.1	10	0.00	0	-	NM_145071		50645365	50645366	-1	no_errors	ENST00000443053	ensembl	human	known	69_37n	frame_shift_ins	4	55.56	5	INS	0.997:1.000	A
CISH	1154	genome.wustl.edu	37	3	50645374	50645375	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:50645374_50645375insT	ENST00000348721.3	-	3	620_621	c.440_441insA	c.(439-441)aggfs	p.R147fs	CISH_ENST00000443053.2_Frame_Shift_Ins_p.R164fs	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	147	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GGATGCGTGGCCTGGACAAGCA	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.440_441insA	3.37:g.50645374_50645375insT	ENSP00000294173:p.Arg147fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Frame_Shift_Ins	INS	pfam_SH2,pfam_SOCS_C,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2,prints_SH2	p.P165fs	ENST00000348721.3	37	c.492_491	CCDS2831.1	3																																																																																			CISH	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000114737		0.584	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CISH	HGNC	protein_coding	OTTHUMT00000346245.1	10	0.00	0	-	NM_145071		50645374	50645375	-1	no_errors	ENST00000443053	ensembl	human	known	69_37n	frame_shift_ins	4	55.56	5	INS	1.000:1.000	T
CLDN6	9074	genome.wustl.edu	37	16	3065794	3065794	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:3065794delG	ENST00000396925.1	-	3	657	c.229delC	c.(229-231)ctgfs	p.L77fs	CLDN6_ENST00000572154.1_Intron|CLDN6_ENST00000328796.4_Frame_Shift_Del_p.L77fs|TNFRSF12A_ENST00000573001.1_5'Flank			P56747	CLD6_HUMAN	claudin 6	77					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						GCAGCCTGCAGGTCCTGTGGC	0.637																																						dbGAP											0													95.0	70.0	79.0					16																	3065794		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0			AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.229delC	16.37:g.3065794delG	ENSP00000380131:p.Leu77fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQP9|D3DUA5	Frame_Shift_Del	DEL	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin6	p.L77fs	ENST00000396925.1	37	c.229	CCDS10488.1	16																																																																																			CLDN6	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000184697		0.637	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN6	HGNC	protein_coding	OTTHUMT00000250988.1	15	0.00	0	G	NM_021195		3065794	3065794	-1	no_errors	ENST00000328796	ensembl	human	known	69_37n	frame_shift_del	11	42.11	8	DEL	1.000	-
CLDN6	9074	genome.wustl.edu	37	16	3065804	3065805	+	In_Frame_Ins	INS	-	-	GGG			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:3065804_3065805insGGG	ENST00000396925.1	-	3	646_647	c.218_219insCCC	c.(217-219)ctg>ctCCCg	p.74_75insP	CLDN6_ENST00000572154.1_Intron|CLDN6_ENST00000328796.4_In_Frame_Ins_p.74_75insP|TNFRSF12A_ENST00000573001.1_5'Flank			P56747	CLD6_HUMAN	claudin 6	74					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						GGTCCTGTGGCAGCGCCAGCAG	0.639																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.218_219insCCC	16.37:g.3065804_3065805insGGG	ENSP00000380131:p.Pro74_Pro74dup	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQP9|D3DUA5	In_Frame_Ins	INS	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin6	p.75in_frame_insP	ENST00000396925.1	37	c.219_218	CCDS10488.1	16																																																																																			CLDN6	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000184697		0.639	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN6	HGNC	protein_coding	OTTHUMT00000250988.1	16	0.00	0	-	NM_021195		3065804	3065805	-1	no_errors	ENST00000328796	ensembl	human	known	69_37n	in_frame_ins	13	38.10	8	INS	1.000:1.000	GGG
CMKLR1	1240	genome.wustl.edu	37	12	108685671	108685671	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:108685671A>T	ENST00000312143.7	-	3	1432	c.1069T>A	c.(1069-1071)Tca>Aca	p.S357T	CMKLR1_ENST00000412676.1_Missense_Mutation_p.S357T|CMKLR1_ENST00000397688.2_Missense_Mutation_p.S355T|CMKLR1_ENST00000550402.1_Missense_Mutation_p.S357T|CMKLR1_ENST00000552995.1_Missense_Mutation_p.S355T	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	357					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						TTCATTGATGACATCTTGGTA	0.502																																						dbGAP											0													105.0	109.0	108.0					12																	108685671		1912	4132	6044	-	-	-	SO:0001583	missense	0			U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.1069T>A	12.37:g.108685671A>T	ENSP00000311733:p.Ser357Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_DEZorph_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Frt_met_rcpt,prints_Anphylx_rcpt,prints_ATII_rcpt	p.S357T	ENST00000312143.7	37	c.1069	CCDS44965.1	12	.	.	.	.	.	.	.	.	.	.	a	17.02	3.280705	0.59758	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	T;T;T;T;T	0.69175	-0.38;-0.38;-0.37;-0.37;-0.38	5.36	5.36	0.76844	.	0.407123	0.22824	N	0.055197	T	0.54498	0.1862	N	0.17082	0.46	0.42614	D	0.993327	P	0.49961	0.93	P	0.45138	0.471	T	0.55186	-0.8180	10	0.28530	T	0.3	.	14.5435	0.68013	1.0:0.0:0.0:0.0	.	357	Q99788	CML1_HUMAN	T	357;357;355;355;357	ENSP00000311733:S357T;ENSP00000401293:S357T;ENSP00000380803:S355T;ENSP00000447579:S355T;ENSP00000449716:S357T	ENSP00000311733:S357T	S	-	1	0	CMKLR1	107209801	1.000000	0.71417	0.992000	0.48379	0.870000	0.49936	3.581000	0.53914	2.022000	0.59522	0.454000	0.30748	TCA	CMKLR1	-	prints_DEZorph_rcpt	ENSG00000174600		0.502	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CMKLR1	HGNC	protein_coding	OTTHUMT00000404867.1	114	0.00	0	A			108685671	108685671	-1	no_errors	ENST00000312143	ensembl	human	known	69_37n	missense	107	14.40	18	SNP	1.000	T
CNTN4	152330	genome.wustl.edu	37	3	3078956	3078956	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:3078956T>C	ENST00000397461.1	+	17	2420	c.2036T>C	c.(2035-2037)gTg>gCg	p.V679A	CNTN4_ENST00000427331.1_Missense_Mutation_p.V679A|CNTN4_ENST00000358480.3_Missense_Mutation_p.V460A|CNTN4_ENST00000418658.1_Missense_Mutation_p.V679A|CNTN4_ENST00000397459.2_Missense_Mutation_p.V351A|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000448906.2_Missense_Mutation_p.V351A	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	679	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GCAGCCAACGTGATTGGGATT	0.527																																						dbGAP											0													173.0	182.0	179.0					3																	3078956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2036T>C	3.37:g.3078956T>C	ENSP00000380602:p.Val679Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V679A	ENST00000397461.1	37	c.2036	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	T	8.610	0.888804	0.17540	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51	5.48	2.67	0.31697	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.774079	0.12299	N	0.481318	T	0.19644	0.0472	N	0.01267	-0.92	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.23476	-1.0187	10	0.14656	T	0.56	.	5.3602	0.16083	0.132:0.1768:0.0:0.6911	.	678;679;679	Q8IWV2-3;B3KTK4;Q8IWV2	.;.;CNTN4_HUMAN	A	679;679;679;460;351;351	ENSP00000396010:V679A;ENSP00000380602:V679A;ENSP00000413642:V679A;ENSP00000351267:V460A;ENSP00000380600:V351A;ENSP00000392077:V351A	ENSP00000351267:V460A	V	+	2	0	CNTN4	3053956	0.013000	0.17824	0.998000	0.56505	0.919000	0.55068	1.146000	0.31589	0.858000	0.35431	0.533000	0.62120	GTG	CNTN4	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144619		0.527	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	243	0.41	1	T			3078956	3078956	+1	no_errors	ENST00000397461	ensembl	human	known	69_37n	missense	526	12.62	76	SNP	0.099	C
COL11A1	1301	genome.wustl.edu	37	1	103412494	103412494	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:103412494C>G	ENST00000370096.3	-	42	3499	c.3187G>C	c.(3187-3189)Ggg>Cgg	p.G1063R	COL11A1_ENST00000358392.2_Missense_Mutation_p.G1075R|COL11A1_ENST00000512756.1_Missense_Mutation_p.G947R|COL11A1_ENST00000353414.4_Missense_Mutation_p.G1024R	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1063	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTGCTGACCCACGTTCTCCT	0.458																																						dbGAP											0													35.0	34.0	34.0					1																	103412494		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3187G>C	1.37:g.103412494C>G	ENSP00000359114:p.Gly1063Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.G1075R	ENST00000370096.3	37	c.3223	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741251	0.69304	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.99186	-5.53;-5.53;-5.53;-5.53	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.99680	0.9880	H	0.98664	4.295	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.97443	1.0023	10	0.87932	D	0	.	19.0317	0.92960	0.0:1.0:0.0:0.0	.	947;1024;1075;1063;283	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	R	1063;1075;1024;283;947	ENSP00000359114:G1063R;ENSP00000351163:G1075R;ENSP00000302551:G1024R;ENSP00000426533:G947R	ENSP00000302551:G1024R	G	-	1	0	COL11A1	103185082	1.000000	0.71417	0.997000	0.53966	0.863000	0.49368	7.722000	0.84778	2.580000	0.87095	0.650000	0.86243	GGG	COL11A1	-	NULL	ENSG00000060718		0.458	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	25	0.00	0	C	NM_080630		103412494	103412494	-1	no_errors	ENST00000358392	ensembl	human	known	69_37n	missense	44	27.87	17	SNP	1.000	G
COPS3	8533	genome.wustl.edu	37	17	17168210	17168210	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:17168210T>C	ENST00000268717.5	-	6	633	c.527A>G	c.(526-528)tAt>tGt	p.Y176C	COPS3_ENST00000539941.2_Missense_Mutation_p.Y156C|COPS3_ENST00000439936.2_Missense_Mutation_p.Y156C	NM_003653.3	NP_003644.2	Q9UNS2	CSN3_HUMAN	COP9 signalosome subunit 3	176					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				NS(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TTTTGCATCATAGGCTCCATT	0.368																																						dbGAP											0													111.0	105.0	107.0					17																	17168210		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031647	CCDS11183.1, CCDS56022.1	17p11.2	2013-03-14	2013-03-14		ENSG00000141030	ENSG00000141030			2239	protein-coding gene	gene with protein product		604665	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 3"", ""COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)"""			9535219, 10191102	Standard	NM_003653		Approved	SGN3, CSN3	uc002grd.3	Q9UNS2	OTTHUMG00000059281	ENST00000268717.5:c.527A>G	17.37:g.17168210T>C	ENSP00000268717:p.Tyr176Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.Y176C	ENST00000268717.5	37	c.527	CCDS11183.1	17	.	.	.	.	.	.	.	.	.	.	T	18.51	3.640016	0.67244	.	.	ENSG00000141030	ENST00000268717;ENST00000539941;ENST00000417352;ENST00000439936	T;T;T	0.63096	-0.02;-0.02;-0.02	5.76	5.76	0.90799	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.51210	0.1661	N	0.25647	0.755	0.58432	D	0.999999	B	0.14805	0.011	B	0.12156	0.007	T	0.45920	-0.9228	10	0.45353	T	0.12	-17.0119	15.2546	0.73576	0.0:0.0:0.0:1.0	.	176	Q9UNS2	CSN3_HUMAN	C	176;156;176;200	ENSP00000268717:Y176C;ENSP00000437606:Y156C;ENSP00000409028:Y176C	ENSP00000268717:Y176C	Y	-	2	0	COPS3	17108935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.050000	0.71063	2.195000	0.70347	0.533000	0.62120	TAT	COPS3	-	NULL	ENSG00000141030		0.368	COPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS3	HGNC	protein_coding	OTTHUMT00000131603.2	82	0.00	0	T			17168210	17168210	-1	no_errors	ENST00000268717	ensembl	human	known	69_37n	missense	37	51.32	39	SNP	1.000	C
CPAMD8	27151	genome.wustl.edu	37	19	17040007	17040007	+	Silent	SNP	A	A	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:17040007A>G	ENST00000443236.1	-	24	3061	c.3030T>C	c.(3028-3030)taT>taC	p.Y1010Y		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	963						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GCCGCTGCACATACTGGAACT	0.587																																						dbGAP											0													50.0	57.0	55.0					19																	17040007		2088	4220	6308	-	-	-	SO:0001819	synonymous_variant	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3030T>C	19.37:g.17040007A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.M1021T	ENST00000443236.1	37	c.3062	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	A	8.227	0.803812	0.16467	.	.	ENSG00000160111	ENST00000443236	.	.	.	3.4	-4.77	0.03219	.	.	.	.	.	T	0.62502	0.2433	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60959	-0.7159	4	.	.	.	.	14.2293	0.65879	0.2977:0.0:0.7023:0.0	.	.	.	.	T	1021	.	.	M	-	2	0	CPAMD8	16901007	0.043000	0.20138	0.551000	0.28230	0.964000	0.63967	-0.761000	0.04751	-1.536000	0.01738	-0.290000	0.09829	ATG	CPAMD8	-	NULL	ENSG00000160111		0.587	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	26	0.00	0	A	NM_015692		17040007	17040007	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443236	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	0.866	G
CPS1	1373	genome.wustl.edu	37	2	211459261	211459261	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:211459261A>G	ENST00000233072.5	+	12	1390	c.1194A>G	c.(1192-1194)atA>atG	p.I398M	CPS1_ENST00000430249.2_Missense_Mutation_p.I404M|CPS1_ENST00000451903.2_5'UTR	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	398	Glutamine amidotransferase type-1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCTCACTGATAAAGAAAGGAA	0.368																																						dbGAP											0													126.0	115.0	119.0					2																	211459261		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1194A>G	2.37:g.211459261A>G	ENSP00000233072:p.Ile398Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE_1,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,smart_MGS-like_dom,prints_CbamoylP_synth_lsu_CPSase_dom,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.I404M	ENST00000233072.5	37	c.1212	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	A	14.31	2.497762	0.44455	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D	0.90504	-2.68;-2.68	5.88	0.604	0.17547	Pre-ATP-grasp fold (1);Glutamine amidotransferase type 1 (1);	0.130164	0.64402	N	0.000003	T	0.80518	0.4638	N	0.21583	0.68	0.80722	D	1	P;P	0.47841	0.901;0.901	B;B	0.42462	0.388;0.388	T	0.72613	-0.4240	10	0.72032	D	0.01	-3.5072	2.799	0.05409	0.5399:0.1824:0.1811:0.0966	.	408;398	Q59HF8;P31327	.;CPSM_HUMAN	M	404;406;398;398	ENSP00000402608:I404M;ENSP00000233072:I398M	ENSP00000233072:I398M	I	+	3	3	CPS1	211167506	0.403000	0.25319	0.991000	0.47740	0.630000	0.37929	-0.362000	0.07602	-0.391000	0.07763	-1.463000	0.01021	ATA	CPS1	-	tigrfam_CarbamoylP_synth_ssu	ENSG00000021826		0.368	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	68	0.00	0	A			211459261	211459261	+1	no_errors	ENST00000430249	ensembl	human	known	69_37n	missense	90	23.73	28	SNP	0.942	G
CPT1A	1374	genome.wustl.edu	37	11	68566804	68566804	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:68566804G>C	ENST00000265641.5	-	6	729	c.575C>G	c.(574-576)cCt>cGt	p.P192R	CPT1A_ENST00000539743.1_Missense_Mutation_p.P192R|CPT1A_ENST00000376618.2_Missense_Mutation_p.P192R|CPT1A_ENST00000538994.1_5'Flank|CPT1A_ENST00000540367.1_Missense_Mutation_p.P192R	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	192					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	CTTCATAAGAGGCCTCACCGA	0.403																																						dbGAP											0													86.0	84.0	84.0					11																	68566804		2200	4294	6494	-	-	-	SO:0001583	missense	0			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.575C>G	11.37:g.68566804G>C	ENSP00000265641:p.Pro192Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.P192R	ENST00000265641.5	37	c.575	CCDS8185.1	11	.	.	.	.	.	.	.	.	.	.	g	21.6	4.167411	0.78339	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.95307	-3.67;-3.67;-3.67;-3.67	4.66	4.66	0.58398	.	0.056529	0.64402	D	0.000001	D	0.98340	0.9449	H	0.97758	4.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.995	D;D;D	0.81914	0.993;0.995;0.979	D	0.99874	1.1101	10	0.87932	D	0	.	17.5507	0.87875	0.0:0.0:1.0:0.0	.	192;192;192	B2RAQ8;P50416;P50416-2	.;CPT1A_HUMAN;.	R	192	ENSP00000439084:P192R;ENSP00000365803:P192R;ENSP00000265641:P192R;ENSP00000446108:P192R	ENSP00000265641:P192R	P	-	2	0	CPT1A	68323380	1.000000	0.71417	0.842000	0.33263	0.947000	0.59692	9.356000	0.97091	2.143000	0.66587	0.462000	0.41574	CCT	CPT1A	-	pfam_Carn_acyl_trans	ENSG00000110090		0.403	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1A	HGNC	protein_coding	OTTHUMT00000397457.2	71	0.00	0	G	NM_001876		68566804	68566804	-1	no_errors	ENST00000265641	ensembl	human	known	69_37n	missense	71	44.09	56	SNP	1.000	C
CSMD3	114788	genome.wustl.edu	37	8	113237153	113237153	+	Silent	SNP	T	T	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:113237153T>G	ENST00000297405.5	-	71	11215	c.10971A>C	c.(10969-10971)gcA>gcC	p.A3657A	CSMD3_ENST00000455883.2_Silent_p.A3488A|CSMD3_ENST00000343508.3_Silent_p.A3617A|CSMD3_ENST00000352409.3_Silent_p.A3587A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3657						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTGTTTTAGGTGCAGTCCTGT	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													281.0	257.0	265.0					8																	113237153		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10971A>C	8.37:g.113237153T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.A3657	ENST00000297405.5	37	c.10971	CCDS6315.1	8																																																																																			CSMD3	-	NULL	ENSG00000164796		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	140	0.00	0	T	NM_052900		113237153	113237153	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	silent	209	16.73	42	SNP	1.000	G
CTSG	1511	genome.wustl.edu	37	14	25043693	25043693	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr14:25043693C>A	ENST00000216336.2	-	4	388	c.352G>T	c.(352-354)Gtc>Ttc	p.V118F		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	118	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		TTCCGTCTGACTCTTCTGCTC	0.642																																						dbGAP											0													101.0	103.0	102.0					14																	25043693		2203	4300	6503	-	-	-	SO:0001583	missense	0			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.352G>T	14.37:g.25043693C>A	ENSP00000216336:p.Val118Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V118F	ENST00000216336.2	37	c.352	CCDS9631.1	14	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975971	0.53720	.	.	ENSG00000100448	ENST00000216336	D	0.94376	-3.41	5.04	-5.16	0.02857	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.445340	0.04820	N	0.436790	D	0.94391	0.8196	L	0.41415	1.275	0.09310	N	1	P	0.36438	0.553	P	0.57324	0.818	D	0.90208	0.4262	10	0.87932	D	0	.	13.1226	0.59336	0.0:0.3294:0.0:0.6706	.	118	P08311	CATG_HUMAN	F	118	ENSP00000216336:V118F	ENSP00000216336:V118F	V	-	1	0	CTSG	24113533	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.314000	0.08092	-1.358000	0.02177	-0.794000	0.03295	GTC	CTSG	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000100448		0.642	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSG	HGNC	protein_coding	OTTHUMT00000276536.2	87	0.00	0	C	NM_001911		25043693	25043693	-1	no_errors	ENST00000216336	ensembl	human	known	69_37n	missense	61	25.30	21	SNP	0.000	A
CYLC1	1538	genome.wustl.edu	37	X	83129611	83129611	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chrX:83129611C>G	ENST00000329312.4	+	4	1932	c.1895C>G	c.(1894-1896)cCa>cGa	p.P632R		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	632	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						ATGCCTCCTCCACCTCCAAAA	0.393																																						dbGAP											0													68.0	58.0	61.0					X																	83129611		2203	4298	6501	-	-	-	SO:0001583	missense	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1895C>G	X.37:g.83129611C>G	ENSP00000331556:p.Pro632Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.P632R	ENST00000329312.4	37	c.1895	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	c	7.013	0.557155	0.13436	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.68331	-0.32	3.48	2.6	0.31112	.	.	.	.	.	T	0.68412	0.2998	L	0.29908	0.895	0.19945	N	0.99994	D;D	0.71674	0.998;0.974	D;P	0.68353	0.957;0.792	T	0.55630	-0.8111	9	0.87932	D	0	-1.7941	7.2354	0.26067	0.263:0.737:0.0:0.0	.	632;632	P35663;F5H4V5	CYLC1_HUMAN;.	R	632	ENSP00000331556:P632R	ENSP00000331556:P632R	P	+	2	0	CYLC1	83016267	0.691000	0.27709	0.631000	0.29282	0.388000	0.30384	0.504000	0.22626	0.815000	0.34398	0.513000	0.50165	CCA	CYLC1	-	NULL	ENSG00000183035		0.393	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	180	0.00	0	C	NM_021118		83129611	83129611	+1	no_errors	ENST00000329312	ensembl	human	known	69_37n	missense	148	45.68	127	SNP	0.573	G
DCAF12L1	139170	genome.wustl.edu	37	X	125685742	125685742	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chrX:125685742C>T	ENST00000371126.1	-	1	1092	c.850G>A	c.(850-852)Ggc>Agc	p.G284S		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	284										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						TGGAAGTAGCCGTCCAAGGAC	0.622																																						dbGAP											0													52.0	50.0	51.0					X																	125685742		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.850G>A	X.37:g.125685742C>T	ENSP00000360167:p.Gly284Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYK3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G284S	ENST00000371126.1	37	c.850	CCDS14610.1	X	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929198	0.73327	.	.	ENSG00000198889	ENST00000371126	T	0.73681	-0.77	3.9	3.9	0.45041	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.36778	N	0.002418	D	0.83496	0.5267	M	0.74258	2.255	0.44956	D	0.997978	D	0.89917	1.0	D	0.91635	0.999	D	0.83812	0.0242	10	0.51188	T	0.08	.	10.4451	0.44488	0.0:1.0:0.0:0.0	.	284	Q5VU92	DC121_HUMAN	S	284	ENSP00000360167:G284S	ENSP00000360167:G284S	G	-	1	0	DCAF12L1	125513423	1.000000	0.71417	0.812000	0.32479	0.572000	0.35998	6.072000	0.71238	2.225000	0.72522	0.429000	0.28392	GGC	DCAF12L1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198889		0.622	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	26	0.00	0	C	NM_178470		125685742	125685742	-1	no_errors	ENST00000371126	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	T
DDX20	11218	genome.wustl.edu	37	1	112305306	112305306	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:112305306G>A	ENST00000369702.4	+	9	1732	c.1112G>A	c.(1111-1113)cGt>cAt	p.R371H	DDX20_ENST00000475700.1_5'UTR|DDX20_ENST00000536167.1_3'UTR	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	371	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGACTTCTCGTGGGATTGAT	0.403																																						dbGAP											0													142.0	145.0	144.0					1																	112305306		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.1112G>A	1.37:g.112305306G>A	ENSP00000358716:p.Arg371His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R371H	ENST00000369702.4	37	c.1112	CCDS842.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.220307	0.95139	.	.	ENSG00000064703	ENST00000369702	T	0.79141	-1.24	5.64	5.64	0.86602	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92922	0.7748	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95231	0.8342	10	0.87932	D	0	-25.536	19.3096	0.94182	0.0:0.0:1.0:0.0	.	371	Q9UHI6	DDX20_HUMAN	H	371	ENSP00000358716:R371H	ENSP00000358716:R371H	R	+	2	0	DDX20	112106829	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.292000	0.96076	2.654000	0.90174	0.655000	0.94253	CGT	DDX20	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000064703		0.403	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX20	HGNC	protein_coding	OTTHUMT00000033063.2	103	0.00	0	G	NM_007204		112305306	112305306	+1	no_errors	ENST00000369702	ensembl	human	known	69_37n	missense	117	18.18	26	SNP	1.000	A
DDR2	4921	genome.wustl.edu	37	1	162729697	162729697	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:162729697C>T	ENST00000367922.3	+	9	1221	c.783C>T	c.(781-783)aaC>aaT	p.N261N	DDR2_ENST00000367921.3_Silent_p.N261N	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	261					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	GCTGGCGGAACGAGAGTGCCA	0.532																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													121.0	107.0	112.0					1																	162729697		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.783C>T	1.37:g.162729697C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.N261	ENST00000367922.3	37	c.783	CCDS1241.1	1																																																																																			DDR2	-	NULL	ENSG00000162733		0.532	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	91	0.00	0	C	NM_006182		162729697	162729697	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	silent	212	31.83	99	SNP	0.739	T
DEPDC4	120863	genome.wustl.edu	37	12	100660825	100660825	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:100660825C>T	ENST00000416321.1	-	1	32	c.30G>A	c.(28-30)gaG>gaA	p.E10E	SCYL2_ENST00000360820.2_5'Flank	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	10					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						CCGCCATAAGCTCGCGCGCTG	0.637																																						dbGAP											0													53.0	63.0	59.0					12																	100660825		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.30G>A	12.37:g.100660825C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q496C8|Q96BW0	Silent	SNP	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.E10	ENST00000416321.1	37	c.30	CCDS9075.1	12																																																																																			DEPDC4	-	NULL	ENSG00000166153		0.637	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPDC4	HGNC	protein_coding	OTTHUMT00000408482.1	56	0.00	0	C	NM_152317		100660825	100660825	-1	no_errors	ENST00000378244	ensembl	human	known	69_37n	silent	69	15.85	13	SNP	0.001	T
DNAH3	55567	genome.wustl.edu	37	16	21117908	21117908	+	Silent	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:21117908T>C	ENST00000261383.3	-	15	2186	c.2187A>G	c.(2185-2187)ctA>ctG	p.L729L	DNAH3_ENST00000415178.1_Silent_p.L729L	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	729	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGGATTTCTTTAGGAATTCAA	0.458																																						dbGAP											0													131.0	111.0	118.0					16																	21117908		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.2187A>G	16.37:g.21117908T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.L729	ENST00000261383.3	37	c.2187	CCDS10594.1	16																																																																																			DNAH3	-	NULL	ENSG00000158486		0.458	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	85	0.00	0	T	NM_017539		21117908	21117908	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	silent	271	11.15	34	SNP	0.998	C
DOK1	1796	genome.wustl.edu	37	2	74783920	74783920	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:74783920C>T	ENST00000233668.5	+	5	1794	c.1125C>T	c.(1123-1125)ggC>ggT	p.G375G	DOK1_ENST00000409429.1_Silent_p.G236G|M1AP_ENST00000464686.1_5'Flank|LOXL3_ENST00000264094.3_5'Flank|DOK1_ENST00000480318.1_3'UTR|LOXL3_ENST00000409986.1_5'Flank|LOXL3_ENST00000393937.2_5'Flank|DOK1_ENST00000340004.6_3'UTR	NM_001381.3	NP_001372.1	Q99704	DOK1_HUMAN	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	375	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|insulin receptor signaling pathway (GO:0008286)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)			endometrium(3)|large_intestine(2)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CTCCCCAGGGCCTTTATGATC	0.597																																					Esophageal Squamous(36;520 860 12502 33616 51270)	dbGAP											0													54.0	59.0	58.0					2																	74783920		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U70987	CCDS1954.1, CCDS56125.1	2p13	2008-05-21	2002-08-29		ENSG00000115325	ENSG00000115325			2990	protein-coding gene	gene with protein product		602919	"""docking protein 1, 62kD (downstream of tyrosine kinase 1)"""			9008160, 9790776, 15546884	Standard	NM_001381		Approved	p62dok	uc002sms.3	Q99704	OTTHUMG00000129956	ENST00000233668.5:c.1125C>T	2.37:g.74783920C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43204|Q53TY2|Q9UHG6	Silent	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.G375	ENST00000233668.5	37	c.1125	CCDS1954.1	2																																																																																			DOK1	-	NULL	ENSG00000115325		0.597	DOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK1	HGNC	protein_coding	OTTHUMT00000252218.3	58	0.00	0	C	NM_001381		74783920	74783920	+1	no_errors	ENST00000233668	ensembl	human	known	69_37n	silent	100	16.53	20	SNP	0.924	T
DNAH7	56171	genome.wustl.edu	37	2	196682525	196682525	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:196682525G>C	ENST00000312428.6	-	50	9420	c.9320C>G	c.(9319-9321)cCt>cGt	p.P3107R		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3107	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CATTCCCTCAGGGGTTATCAT	0.343																																						dbGAP											0													77.0	68.0	71.0					2																	196682525		1828	4084	5912	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9320C>G	2.37:g.196682525G>C	ENSP00000311273:p.Pro3107Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.P3107R	ENST00000312428.6	37	c.9320	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038985	0.55003	.	.	ENSG00000118997	ENST00000312428	T	0.13307	2.6	4.89	4.89	0.63831	.	0.188387	0.45867	D	0.000326	T	0.20495	0.0493	L	0.47016	1.485	0.80722	D	1	B	0.29341	0.242	B	0.41813	0.367	T	0.05886	-1.0858	10	0.16896	T	0.51	.	17.8344	0.88692	0.0:0.0:1.0:0.0	.	3107	Q8WXX0	DYH7_HUMAN	R	3107	ENSP00000311273:P3107R	ENSP00000311273:P3107R	P	-	2	0	DNAH7	196390770	1.000000	0.71417	0.889000	0.34880	0.742000	0.42306	7.819000	0.86621	2.520000	0.84964	0.561000	0.74099	CCT	DNAH7	-	NULL	ENSG00000118997		0.343	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	83	0.00	0	G	NM_018897		196682525	196682525	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	90	29.69	38	SNP	0.999	C
DST	667	genome.wustl.edu	37	6	56394933	56394933	+	Splice_Site	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr6:56394933T>C	ENST00000361203.3	-	61	16483		c.e61-2		DST_ENST00000370754.5_Splice_Site|DST_ENST00000312431.6_Splice_Site|DST_ENST00000370769.4_Splice_Site|DST_ENST00000340834.4_Splice_Site|DST_ENST00000421834.2_Splice_Site|DST_ENST00000446842.2_Splice_Site|DST_ENST00000370788.2_Splice_Site|DST_ENST00000244364.6_Splice_Site			Q03001	DYST_HUMAN	dystonin						axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGACGATTCCTACAAATGTGC	0.388																																						dbGAP											0													90.0	77.0	81.0					6																	56394933		1856	4093	5949	-	-	-	SO:0001630	splice_region_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16476-2A>G	6.37:g.56394933T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Splice_Site	SNP	-	e65-2	ENST00000361203.3	37	c.17016-2		6	.	.	.	.	.	.	.	.	.	.	T	21.1	4.090946	0.76756	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3317	0.83023	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DST	56502892	1.000000	0.71417	0.952000	0.39060	0.880000	0.50808	7.803000	0.85983	2.264000	0.75181	0.533000	0.62120	.	DST	-	-	ENSG00000151914		0.388	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	47	0.00	0	T	NM_001723	Intron	56394933	56394933	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	splice_site	55	17.91	12	SNP	1.000	C
EDN1	1906	genome.wustl.edu	37	6	12294286	12294286	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr6:12294286G>T	ENST00000379375.5	+	3	613	c.346G>T	c.(346-348)Gac>Tac	p.D116Y		NM_001168319.1|NM_001955.4	NP_001161791.1|NP_001946.3	P05305	EDN1_HUMAN	endothelin 1	116	Endothelin-like.				artery smooth muscle contraction (GO:0014824)|body fluid secretion (GO:0007589)|calcium-mediated signaling (GO:0019722)|cartilage development (GO:0051216)|cell growth (GO:0016049)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|dorsal/ventral pattern formation (GO:0009953)|epithelial fluid transport (GO:0042045)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose transport (GO:0015758)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|inositol phosphate-mediated signaling (GO:0048016)|leukocyte activation (GO:0045321)|maternal process involved in parturition (GO:0060137)|membrane depolarization (GO:0051899)|middle ear morphogenesis (GO:0042474)|multicellular organismal aging (GO:0010259)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of hormone secretion (GO:0046888)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|nitric oxide transport (GO:0030185)|patterning of blood vessels (GO:0001569)|peptide hormone secretion (GO:0030072)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase D-activating G-protein coupled receptor signaling pathway (GO:0031583)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell size (GO:0045793)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of odontogenesis (GO:0042482)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of urine volume (GO:0035810)|prostaglandin biosynthetic process (GO:0001516)|protein kinase C deactivation (GO:0042313)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|respiratory gaseous exchange (GO:0007585)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to testosterone (GO:0033574)|rhythmic excitation (GO:0043179)|sensory perception of pain (GO:0019233)|superoxide anion generation (GO:0042554)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|endothelin A receptor binding (GO:0031707)|endothelin B receptor binding (GO:0031708)|hormone activity (GO:0005179)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	13	all_cancers(95;0.241)|Breast(50;0.0266)|Ovarian(93;0.12)	all_hematologic(90;0.117)				TAGCCAAAAAGACAAGAAGTG	0.448																																						dbGAP											0													87.0	78.0	81.0					6																	12294286		2203	4300	6503	-	-	-	SO:0001583	missense	0			S56805	CCDS4522.1	6p24.1	2014-03-19			ENSG00000078401	ENSG00000078401		"""Endogenous ligands"""	3176	protein-coding gene	gene with protein product		131240					Standard	NM_001168319		Approved	ET1	uc003nae.4	P05305	OTTHUMG00000014266	ENST00000379375.5:c.346G>T	6.37:g.12294286G>T	ENSP00000368683:p.Asp116Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DA1	Missense_Mutation	SNP	pfam_Endothln-like_toxin,smart_Endothln-like_toxin,prints_Bibrotoxin/Sarafotoxin-D	p.D116Y	ENST00000379375.5	37	c.346	CCDS4522.1	6	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834340	0.91036	.	.	ENSG00000078401	ENST00000379375	D	0.94232	-3.38	5.86	5.86	0.93980	Endothelin-like toxin, conserved site (1);Endothelin-like toxin (1);	0.000000	0.85682	D	0.000000	D	0.97207	0.9087	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97211	0.9871	10	0.87932	D	0	-6.8797	20.1865	0.98220	0.0:0.0:1.0:0.0	.	116;116	Q6FH53;P05305	.;EDN1_HUMAN	Y	116	ENSP00000368683:D116Y	ENSP00000368683:D116Y	D	+	1	0	EDN1	12402272	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.123000	0.89586	2.775000	0.95449	0.655000	0.94253	GAC	EDN1	-	smart_Endothln-like_toxin	ENSG00000078401		0.448	EDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDN1	HGNC	protein_coding	OTTHUMT00000039872.1	180	0.00	0	G	NM_001955		12294286	12294286	+1	no_errors	ENST00000379375	ensembl	human	known	69_37n	missense	184	14.81	32	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56438665	56438665	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr6:56438665C>T	ENST00000361203.3	-	47	12422	c.12415G>A	c.(12415-12417)Gag>Aag	p.E4139K	DST_ENST00000370754.5_Missense_Mutation_p.E4319K|DST_ENST00000312431.6_Missense_Mutation_p.E4139K|DST_ENST00000370769.4_Missense_Mutation_p.E4141K|DST_ENST00000421834.2_Missense_Mutation_p.E2053K|DST_ENST00000446842.2_Missense_Mutation_p.E3815K|DST_ENST00000370788.2_Missense_Mutation_p.E2053K|DST_ENST00000244364.6_Missense_Mutation_p.E1727K			Q03001	DYST_HUMAN	dystonin	4139					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GACAGATCCTCATATCTCCCA	0.413																																						dbGAP											0													112.0	106.0	108.0					6																	56438665		1912	4118	6030	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.12415G>A	6.37:g.56438665C>T	ENSP00000354508:p.Glu4139Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E4319K	ENST00000361203.3	37	c.12955		6	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565726	0.45694	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T;T	0.52983	0.65;0.65;0.65;0.65;0.65;0.64;0.65;0.65	5.95	5.95	0.96441	.	0.229890	0.29587	N	0.011723	T	0.17109	0.0411	N	0.14661	0.345	0.23984	N	0.996262	B;B;B;B;B	0.29671	0.222;0.254;0.16;0.081;0.03	B;B;B;B;B	0.36766	0.09;0.232;0.155;0.061;0.038	T	0.10451	-1.0629	9	0.14252	T	0.57	.	10.695	0.45894	0.0:0.8588:0.0:0.1412	.	2053;4141;4319;4139;1727	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	K	1727;4319;4141;2053;3815;4139;2053;4139	ENSP00000244364:E1727K;ENSP00000359790:E4319K;ENSP00000359805:E4141K;ENSP00000400883:E2053K;ENSP00000393645:E3815K;ENSP00000307959:E4139K;ENSP00000359824:E2053K;ENSP00000354508:E4139K	ENSP00000244364:E1727K	E	-	1	0	DST	56546624	1.000000	0.71417	0.462000	0.27118	0.825000	0.46686	4.688000	0.61715	2.821000	0.97095	0.650000	0.86243	GAG	DST	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000151914		0.413	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	81	0.00	0	C	NM_001723		56438665	56438665	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	128	12.84	19	SNP	0.947	T
EEF2	1938	genome.wustl.edu	37	19	3982420	3982420	+	Missense_Mutation	SNP	G	G	C	rs375130935		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:3982420G>C	ENST00000309311.6	-	5	703	c.615C>G	c.(613-615)atC>atG	p.I205M	SNORD37_ENST00000384048.1_RNA|EEF2_ENST00000600720.1_5'Flank	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	205	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACAGGATCGATCTGGAAGT	0.632																																					Colon(165;1804 1908 4071 6587 18799)	dbGAP											0													48.0	55.0	52.0					19																	3982420		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.615C>G	19.37:g.3982420G>C	ENSP00000307940:p.Ile205Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.I205M	ENST00000309311.6	37	c.615	CCDS12117.1	19	.	.	.	.	.	.	.	.	.	.	G	8.907	0.957811	0.18507	.	.	ENSG00000167658	ENST00000543343;ENST00000309311	T	0.31247	1.5	5.62	-11.2	0.00127	Protein synthesis factor, GTP-binding (1);	0.168078	0.52532	D	0.000065	T	0.27900	0.0687	L	0.45228	1.405	0.33329	D	0.568358	B	0.27140	0.169	B	0.37387	0.248	T	0.49744	-0.8907	10	0.87932	D	0	-28.8769	20.4346	0.99088	0.7774:0.0:0.2226:0.0	.	205	P13639	EF2_HUMAN	M	205	ENSP00000307940:I205M	ENSP00000307940:I205M	I	-	3	3	EEF2	3933420	0.014000	0.17966	0.085000	0.20634	0.069000	0.16628	-0.549000	0.06041	-3.032000	0.00266	-1.036000	0.02392	ATC	EEF2	-	pfam_ProtSyn_GTP-bd	ENSG00000167658		0.632	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2	HGNC	protein_coding	OTTHUMT00000457615.2	13	0.00	0	G	NM_001961		3982420	3982420	-1	no_errors	ENST00000309311	ensembl	human	known	69_37n	missense	13	26.32	5	SNP	0.064	C
EFCAB12	90288	genome.wustl.edu	37	3	129130116	129130116	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:129130116T>A	ENST00000505956.1	-	5	1082	c.920A>T	c.(919-921)aAa>aTa	p.K307I	EFCAB12_ENST00000326085.3_Missense_Mutation_p.K307I	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	307							calcium ion binding (GO:0005509)										TAGGTCCACTTTGGGAAGCTG	0.592																																						dbGAP											0													51.0	53.0	52.0					3																	129130116		2090	4209	6299	-	-	-	SO:0001583	missense	0			AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.920A>T	3.37:g.129130116T>A	ENSP00000420854:p.Lys307Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX4	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.K307I	ENST00000505956.1	37	c.920	CCDS54638.1	3	.	.	.	.	.	.	.	.	.	.	T	13.22	2.173245	0.38413	.	.	ENSG00000172771	ENST00000505956;ENST00000326085;ENST00000503957	T;T;T	0.43688	3.95;3.95;0.94	4.24	0.106	0.14540	.	0.329070	0.21029	N	0.081362	T	0.36826	0.0981	L	0.29908	0.895	0.22771	N	0.998751	D	0.58268	0.982	P	0.57911	0.829	T	0.15636	-1.0430	10	0.59425	D	0.04	-10.4387	1.9321	0.03329	0.1608:0.0937:0.1669:0.5786	.	307	Q6NXP0	CC025_HUMAN	I	307;307;157	ENSP00000420854:K307I;ENSP00000324241:K307I;ENSP00000421462:K157I	ENSP00000324241:K307I	K	-	2	0	C3orf25	130612806	0.005000	0.15991	0.738000	0.30950	0.026000	0.11368	0.045000	0.14013	0.185000	0.20105	0.379000	0.24179	AAA	EFCAB12	-	NULL	ENSG00000172771		0.592	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB12	HGNC	protein_coding	OTTHUMT00000355530.1	41	0.00	0	T	NM_207307		129130116	129130116	-1	no_errors	ENST00000326085	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.797	A
EGFL6	25975	genome.wustl.edu	37	X	13624525	13624527	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	TCA	TCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chrX:13624525_13624527delTCA	ENST00000361306.1	+	6	805_807	c.548_550delTCA	c.(547-552)gtcatc>gtc	p.I184del	EGFL6_ENST00000380602.3_In_Frame_Del_p.I184del	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	184	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						TCTGGTAAAGTCATCTGTCCCTA	0.424																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.548_550delTCA	X.37:g.13624525_13624527delTCA	ENSP00000355126:p.Ile184del	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	In_Frame_Del	DEL	pfam_MAM_dom,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.I184in_frame_del	ENST00000361306.1	37	c.548_550	CCDS14155.1	X																																																																																			EGFL6	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000198759		0.424	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EGFL6	HGNC	protein_coding	OTTHUMT00000055800.1	141	0.00	0	TCA	NM_015507		13624525	13624527	+1	no_errors	ENST00000380602	ensembl	human	known	69_37n	in_frame_del	163	25.79	57	DEL	0.781:0.025:0.014	-
ERBB2	2064	genome.wustl.edu	37	17	37879581	37879581	+	Silent	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:37879581G>T	ENST00000269571.5	+	17	2115	c.1956G>T	c.(1954-1956)acG>acT	p.T652T	ERBB2_ENST00000406381.2_Silent_p.T622T|ERBB2_ENST00000445658.2_Silent_p.T376T|ERBB2_ENST00000584601.1_Silent_p.T622T|ERBB2_ENST00000541774.1_Silent_p.T637T|ERBB2_ENST00000540147.1_Silent_p.T622T|ERBB2_ENST00000584450.1_Silent_p.T652T			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	652					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GCCCTCTGACGTCCATCATCT	0.602		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0													107.0	98.0	101.0					17																	37879581		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1956G>T	17.37:g.37879581G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R21L	ENST00000269571.5	37	c.62	CCDS32642.1	17																																																																																			ERBB2	-	NULL	ENSG00000141736		0.602	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	42	0.00	0	G			37879581	37879581	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000580074	ensembl	human	novel	69_37n	missense	41	20.75	11	SNP	0.368	T
ERF	2077	genome.wustl.edu	37	19	42752723	42752723	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:42752723C>T	ENST00000222329.4	-	4	1698	c.1541G>A	c.(1540-1542)cGt>cAt	p.R514H	AC006486.9_ENST00000594664.1_Intron|ERF_ENST00000440177.2_Missense_Mutation_p.R439H|ERF_ENST00000595941.1_5'Flank	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	514					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				CCCCTCCCCACGCACCTTCTT	0.682																																						dbGAP											0													25.0	31.0	29.0					19																	42752723		2199	4289	6488	-	-	-	SO:0001583	missense	0			U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.1541G>A	19.37:g.42752723C>T	ENSP00000222329:p.Arg514His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Missense_Mutation	SNP	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.R514H	ENST00000222329.4	37	c.1541	CCDS12600.1	19	.	.	.	.	.	.	.	.	.	.	C	12.89	2.072329	0.36566	.	.	ENSG00000105722	ENST00000222329;ENST00000440177	T;T	0.21191	3.01;2.02	4.51	3.47	0.39725	.	2.191650	0.01745	N	0.029636	T	0.19927	0.0479	N	0.14661	0.345	0.46631	D	0.99913	D	0.56287	0.975	P	0.46320	0.512	T	0.09015	-1.0694	10	0.59425	D	0.04	.	9.2113	0.37320	0.0:0.8156:0.0:0.1844	.	514	P50548	ERF_HUMAN	H	514;439	ENSP00000222329:R514H;ENSP00000388173:R439H	ENSP00000222329:R514H	R	-	2	0	ERF	47444563	0.970000	0.33590	1.000000	0.80357	0.989000	0.77384	2.655000	0.46707	1.201000	0.43203	0.561000	0.74099	CGT	ERF	-	NULL	ENSG00000105722		0.682	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERF	HGNC	protein_coding	OTTHUMT00000463684.1	15	0.00	0	C	NM_006494		42752723	42752723	-1	no_errors	ENST00000222329	ensembl	human	known	69_37n	missense	14	28.57	6	SNP	1.000	T
EVPL	2125	genome.wustl.edu	37	17	74003870	74003870	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:74003870G>C	ENST00000301607.3	-	22	5669	c.5416C>G	c.(5416-5418)Ccc>Gcc	p.P1806A	TEN1-CDK3_ENST00000567351.1_RNA|EVPL_ENST00000586740.1_Missense_Mutation_p.P1828A	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1806	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						GTGCTCTGGGGGGCCGGGGAG	0.587																																						dbGAP											0													77.0	89.0	85.0					17																	74003870		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.5416C>G	17.37:g.74003870G>C	ENSP00000301607:p.Pro1806Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin/RR-like,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.P1806A	ENST00000301607.3	37	c.5416	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	G	0.166	-1.076557	0.01903	.	.	ENSG00000167880	ENST00000301607	T	0.63417	-0.04	5.14	-0.517	0.11947	.	0.442644	0.19487	N	0.113067	T	0.40067	0.1102	L	0.40543	1.245	0.09310	N	1	B;B	0.24483	0.104;0.004	B;B	0.22386	0.039;0.006	T	0.31916	-0.9926	10	0.02654	T	1	-16.7828	5.2389	0.15462	0.2885:0.0:0.5828:0.1287	.	1828;1806	B7ZLH8;Q92817	.;EVPL_HUMAN	A	1806	ENSP00000301607:P1806A	ENSP00000301607:P1806A	P	-	1	0	EVPL	71515465	0.497000	0.26067	0.008000	0.14137	0.002000	0.02628	0.940000	0.28992	-0.042000	0.13535	-0.275000	0.10095	CCC	EVPL	-	NULL	ENSG00000167880		0.587	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	84	0.00	0	G	NM_001988		74003870	74003870	-1	no_errors	ENST00000301607	ensembl	human	known	69_37n	missense	121	17.57	26	SNP	0.002	C
F3	2152	genome.wustl.edu	37	1	95001579	95001579	+	Silent	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:95001579G>T	ENST00000334047.7	-	3	517	c.354C>A	c.(352-354)acC>acA	p.T118T	F3_ENST00000370207.4_Silent_p.T118T|F3_ENST00000480356.1_5'UTR	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	118					activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	CAGCAGAACCGGTGCTCTCCA	0.522																																					Melanoma(40;358 1339 15970 39161)	dbGAP											0													181.0	169.0	173.0					1																	95001579		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.354C>A	1.37:g.95001579G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT47|Q6FHG2|Q86WH4	Silent	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Tissue_fac/coagulation_fac-3,prints_Tissue_factor	p.T118	ENST00000334047.7	37	c.354	CCDS750.1	1																																																																																			F3	-	superfamily_Fibronectin_type3,pirsf_Tissue_fac/coagulation_fac-3	ENSG00000117525		0.522	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F3	HGNC	protein_coding	OTTHUMT00000029593.1	112	0.88	1	G	NM_001993		95001579	95001579	-1	no_errors	ENST00000334047	ensembl	human	known	69_37n	silent	169	11.05	21	SNP	0.000	T
FAM171A1	221061	genome.wustl.edu	37	10	15255094	15255094	+	Silent	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:15255094C>A	ENST00000378116.4	-	8	2499	c.2493G>T	c.(2491-2493)ctG>ctT	p.L831L	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	831						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TCTCCTCCTGCAGGCTGGGCA	0.642																																						dbGAP											0													66.0	72.0	70.0					10																	15255094		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2493G>T	10.37:g.15255094C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	pfam_Uncharacterised_FAM171	p.L831	ENST00000378116.4	37	c.2493	CCDS31154.1	10																																																																																			FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.642	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	64	0.00	0	C	XM_167709		15255094	15255094	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	silent	60	14.29	10	SNP	1.000	A
FAM21A	387680	genome.wustl.edu	37	10	47946862	47946862	+	Silent	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:47946862G>A	ENST00000358474.5	+	28	3498	c.3498G>A	c.(3496-3498)aaG>aaA	p.K1166K		NM_018232.1	NP_060702.1	Q5SNT6	FA21B_HUMAN		1166					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CCAGAGAGAAGGAGAAAACAT	0.308																																						dbGAP											0													4.0	6.0	5.0					10																	47946862		983	2663	3646	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000358474.5:c.3498G>A	10.37:g.47946862G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.K1166	ENST00000358474.5	37	c.3498	CCDS44379.1	10																																																																																			FAM21B	-	NULL	ENSG00000152726		0.308	FAM21B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM21B	HGNC	protein_coding	OTTHUMT00000047871.2	17	0.00	0	G			47946862	47946862	+1	no_errors	ENST00000358474	ensembl	human	known	69_37n	silent	11	26.67	4	SNP	1.000	A
FAM71A	149647	genome.wustl.edu	37	1	212799050	212799050	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:212799050G>C	ENST00000294829.3	+	1	1262	c.831G>C	c.(829-831)gaG>gaC	p.E277D	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	277						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GGATTAAAGAGgcagcagcag	0.552																																						dbGAP											0													41.0	47.0	45.0					1																	212799050		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.831G>C	1.37:g.212799050G>C	ENSP00000294829:p.Glu277Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTZ1	Missense_Mutation	SNP	pfam_DUF3699	p.E277D	ENST00000294829.3	37	c.831	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	G	4.868	0.161274	0.09287	.	.	ENSG00000162771	ENST00000294829;ENST00000545975	T	0.03951	3.75	2.77	1.83	0.25207	.	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.30326	0.276	B	0.27887	0.084	T	0.48514	-0.9029	9	0.13470	T	0.59	.	5.6119	0.17410	0.1616:0.0:0.8384:0.0	.	277	Q8IYT1	FA71A_HUMAN	D	277;52	ENSP00000294829:E277D	ENSP00000294829:E277D	E	+	3	2	FAM71A	210865673	0.004000	0.15560	0.000000	0.03702	0.011000	0.07611	0.537000	0.23144	0.498000	0.27948	0.655000	0.94253	GAG	FAM71A	-	NULL	ENSG00000162771		0.552	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	69	0.00	0	G	NM_153606		212799050	212799050	+1	no_errors	ENST00000294829	ensembl	human	known	69_37n	missense	88	14.56	15	SNP	0.001	C
FCHSD1	89848	genome.wustl.edu	37	5	141025749	141025749	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:141025749G>A	ENST00000435817.2	-	12	1104	c.1054C>T	c.(1054-1056)Cga>Tga	p.R352*	FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522126.1_Nonsense_Mutation_p.R276*|FCHSD1_ENST00000522783.1_Intron	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	352									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCCAGTCGTTGCAGTACC	0.562																																						dbGAP											0													32.0	30.0	31.0					5																	141025749		1992	4158	6150	-	-	-	SO:0001587	stop_gained	0			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.1054C>T	5.37:g.141025749G>A	ENSP00000399259:p.Arg352*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX75|Q86Y77|Q9NXX8	Nonsense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_FCH,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.R352*	ENST00000435817.2	37	c.1054	CCDS47295.1	5	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722166	0.68959	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000518499	.	.	.	5.6	3.72	0.42706	.	0.137857	0.43919	D	0.000505	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-15.0612	7.1856	0.25797	0.0848:0.0:0.6073:0.308	.	.	.	.	X	352;276;35	.	ENSP00000399259:R352X	R	-	1	2	FCHSD1	141005933	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	1.206000	0.32321	1.371000	0.46172	-0.463000	0.05309	CGA	FCHSD1	-	NULL	ENSG00000197948		0.562	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD1	HGNC	protein_coding	OTTHUMT00000375282.2	16	0.00	0	G	NM_033449		141025749	141025749	-1	no_errors	ENST00000435817	ensembl	human	known	69_37n	nonsense	8	50.00	8	SNP	1.000	A
FEN1	2237	genome.wustl.edu	37	11	61563621	61563621	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:61563621T>A	ENST00000305885.2	+	2	1201	c.788T>A	c.(787-789)cTt>cAt	p.L263H	FADS2_ENST00000574708.1_Intron	NM_004111.5	NP_004102.1			flap structure-specific endonuclease 1											endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						GTGCGGCGACTTGACCCCAAC	0.572								Editing and processing nucleases																														dbGAP											0													64.0	63.0	63.0					11																	61563621		2202	4299	6501	-	-	-	SO:0001583	missense	0			L37374	CCDS8010.1	11q12	2013-05-08			ENSG00000168496	ENSG00000168496			3650	protein-coding gene	gene with protein product	"""maturation factor-1"", ""DNase IV"""	600393		RAD2		7774922	Standard	NM_004111		Approved	FEN-1, MF1	uc001nsg.3	P39748	OTTHUMG00000168162	ENST00000305885.2:c.788T>A	11.37:g.61563621T>A	ENSP00000305480:p.Leu263His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_XPG_DNA_repair_N,pfam_XPG/RAD2_endonuclease,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.L263H	ENST00000305885.2	37	c.788	CCDS8010.1	11	.	.	.	.	.	.	.	.	.	.	T	16.12	3.033547	0.54896	.	.	ENSG00000168496	ENST00000305885	T	0.37411	1.2	4.92	4.92	0.64577	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.055689	0.64402	D	0.000002	T	0.45377	0.1339	M	0.76727	2.345	0.80722	D	1	D	0.58620	0.983	P	0.45856	0.495	T	0.55704	-0.8099	10	0.87932	D	0	-2.5789	15.0419	0.71796	0.0:0.0:0.0:1.0	.	263	P39748	FEN1_HUMAN	H	263	ENSP00000305480:L263H	ENSP00000305480:L263H	L	+	2	0	FEN1	61320197	1.000000	0.71417	0.797000	0.32132	0.371000	0.29859	7.519000	0.81809	2.200000	0.70718	0.459000	0.35465	CTT	FEN1	-	superfamily_5-3_exonuclease_C	ENSG00000168496		0.572	FEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEN1	HGNC	protein_coding	OTTHUMT00000398526.1	46	0.00	0	T	NM_004111		61563621	61563621	+1	no_errors	ENST00000305885	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.991	A
FGF23	8074	genome.wustl.edu	37	12	4479691	4479691	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:4479691C>T	ENST00000237837.1	-	3	719	c.574G>A	c.(574-576)Gtg>Atg	p.V192M		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	192					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			GGCTTCAGCACGTTCAGGGGG	0.682																																						dbGAP											0													18.0	23.0	21.0					12																	4479691		2192	4297	6489	-	-	-	SO:0001583	missense	0			AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.574G>A	12.37:g.4479691C>T	ENSP00000237837:p.Val192Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4V758	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	p.V192M	ENST00000237837.1	37	c.574	CCDS8526.1	12	.	.	.	.	.	.	.	.	.	.	C	12.35	1.910696	0.33721	.	.	ENSG00000118972	ENST00000237837	D	0.89617	-2.54	4.84	4.84	0.62591	.	0.199932	0.43579	D	0.000558	D	0.88388	0.6423	L	0.32530	0.975	0.27456	N	0.953295	D	0.71674	0.998	D	0.63381	0.914	T	0.80209	-0.1477	10	0.28530	T	0.3	-19.6233	8.9614	0.35849	0.0:0.9011:0.0:0.0989	.	192	Q9GZV9	FGF23_HUMAN	M	192	ENSP00000237837:V192M	ENSP00000237837:V192M	V	-	1	0	FGF23	4349952	0.965000	0.33210	0.970000	0.41538	0.010000	0.07245	1.811000	0.38942	2.505000	0.84491	0.549000	0.68633	GTG	FGF23	-	NULL	ENSG00000118972		0.682	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	HGNC	protein_coding	OTTHUMT00000398936.1	31	0.00	0	C			4479691	4479691	-1	no_errors	ENST00000237837	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	0.943	T
FKBP8	23770	genome.wustl.edu	37	19	18648426	18648426	+	Silent	SNP	G	G	A	rs185331003		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:18648426G>A	ENST00000596558.2	-	6	1036	c.927C>T	c.(925-927)ctC>ctT	p.L309L	FKBP8_ENST00000453489.2_Silent_p.L338L|FKBP8_ENST00000610101.1_Silent_p.L150L|FKBP8_ENST00000222308.4_Silent_p.L309L|FKBP8_ENST00000597960.3_Silent_p.L310L|FKBP8_ENST00000608443.1_Silent_p.L310L|AC005387.2_ENST00000596596.1_RNA			Q14318	FKBP8_HUMAN	FK506 binding protein 8, 38kDa	309					apoptotic process (GO:0006915)|camera-type eye development (GO:0043010)|cell fate specification (GO:0001708)|chaperone-mediated protein folding (GO:0061077)|dorsal/ventral neural tube patterning (GO:0021904)|intracellular signal transduction (GO:0035556)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|positive regulation of BMP signaling pathway (GO:0030513)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of gene expression (GO:0010468)|smoothened signaling pathway (GO:0007224)|viral process (GO:0016032)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	FK506 binding (GO:0005528)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	15						CCTTGCGGAAGAGAGCCTTGA	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19298	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													53.0	44.0	47.0					19																	18648426		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L37033	CCDS32961.1	19p12	2013-01-10	2002-08-29		ENSG00000105701	ENSG00000105701		"""Tetratricopeptide (TTC) repeat domain containing"""	3724	protein-coding gene	gene with protein product	"""FK506-binding protein 8 (38kD)"""	604840	"""FK506-binding protein 8 (38kD)"""			7543869	Standard	NM_012181		Approved	FKBP38, FKBPr38	uc002njj.1	Q14318		ENST00000596558.2:c.927C>T	19.37:g.18648426G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C8C9T5|Q53GU3|Q7Z349|Q86YK6	Silent	SNP	pfam_PPIase_FKBP_dom,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.L338	ENST00000596558.2	37	c.1014		19																																																																																			FKBP8	-	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000105701		0.637	FKBP8-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate	protein_coding	FKBP8	HGNC	protein_coding	OTTHUMT00000466374.3	10	0.00	0	G	NM_012181		18648426	18648426	-1	no_errors	ENST00000453489	ensembl	human	known	69_37n	silent	24	22.58	7	SNP	0.942	A
GAB2	9846	genome.wustl.edu	37	11	77991673	77991673	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:77991673C>T	ENST00000361507.4	-	2	435	c.350G>A	c.(349-351)gGc>gAc	p.G117D	GAB2_ENST00000526030.1_5'UTR|GAB2_ENST00000340149.2_Missense_Mutation_p.G79D	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	117	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			CTGATTGAAGCCACAGATCTG	0.502																																						dbGAP											0													194.0	173.0	180.0					11																	77991673		2200	4292	6492	-	-	-	SO:0001583	missense	0			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.350G>A	11.37:g.77991673C>T	ENSP00000354952:p.Gly117Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G117D	ENST00000361507.4	37	c.350	CCDS8259.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.299786	0.95574	.	.	ENSG00000033327	ENST00000340149;ENST00000361507;ENST00000528886;ENST00000530915	T;T;T;T	0.79247	-1.25;2.57;-1.25;0.85	5.37	5.37	0.77165	Pleckstrin homology domain (2);	0.000000	0.64402	U	0.000001	D	0.88047	0.6332	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88479	0.3067	10	0.66056	D	0.02	-20.5468	19.4818	0.95013	0.0:1.0:0.0:0.0	.	117	Q9UQC2	GAB2_HUMAN	D	79;117;79;79	ENSP00000343959:G79D;ENSP00000354952:G117D;ENSP00000433762:G79D;ENSP00000431868:G79D	ENSP00000343959:G79D	G	-	2	0	GAB2	77669321	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.667000	0.90743	0.563000	0.77884	GGC	GAB2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000033327		0.502	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB2	HGNC	protein_coding	OTTHUMT00000391085.1	382	0.00	0	C	NM_080491		77991673	77991673	-1	no_errors	ENST00000361507	ensembl	human	known	69_37n	missense	567	10.97	70	SNP	1.000	T
GATA3	2625	genome.wustl.edu	37	10	8111513	8111514	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:8111513_8111514insG	ENST00000346208.3	+	5	1454_1455	c.999_1000insG	c.(1000-1002)gggfs	p.G334fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.G335fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	334					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.N334fs*19(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GGAATGCCAATGGGGACCCTGT	0.569			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Insertion - Frameshift(1)	NS(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1003dupG	10.37:g.8111517_8111517dupG	ENSP00000341619:p.Gly334fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.D335fs	ENST00000346208.3	37	c.1002_1003	CCDS7083.1	10																																																																																			GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.569	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	37	0.00	0	-	NM_001002295		8111513	8111514	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	81	58.67	115	INS	0.859:1.000	G
GGA3	23163	genome.wustl.edu	37	17	73242652	73242652	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:73242652C>A	ENST00000245541.6	-	3	355	c.139G>T	c.(139-141)Gtc>Ttc	p.V47F	GGA3_ENST00000538886.1_Intron|GGA3_ENST00000582486.1_5'UTR|GGA3_ENST00000351904.7_Missense_Mutation_p.V47F|GGA3_ENST00000579743.1_5'UTR|GGA3_ENST00000578348.1_5'UTR|GGA3_ENST00000582717.1_5'UTR|GGA3_ENST00000537686.1_Missense_Mutation_p.V47F	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	47	Binds to ARF1 (in long isoform).|VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			AGCAGTCGGACGGCGATCTGT	0.642																																						dbGAP											0													77.0	66.0	69.0					17																	73242652		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.139G>T	17.37:g.73242652C>A	ENSP00000245541:p.Val47Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_ENTH_VHS,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.V47F	ENST00000245541.6	37	c.139	CCDS11717.1	17	.	.	.	.	.	.	.	.	.	.	c	14.67	2.604985	0.46423	.	.	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537686	T;T;T	0.25250	1.81;1.81;1.81	5.71	5.71	0.89125	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.85682	D	0.000000	T	0.54615	0.1869	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.91635	0.968;0.97;0.999	T	0.53099	-0.8486	10	0.54805	T	0.06	-23.0057	19.9101	0.97023	0.0:1.0:0.0:0.0	.	47;47;47	B7Z9A2;Q9NZ52-2;Q9NZ52	.;.;GGA3_HUMAN	F	47	ENSP00000245541:V47F;ENSP00000326575:V47F;ENSP00000438085:V47F	ENSP00000245541:V47F	V	-	1	0	GGA3	70754247	1.000000	0.71417	0.973000	0.42090	0.803000	0.45373	6.032000	0.70918	2.711000	0.92665	0.645000	0.84053	GTC	GGA3	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pfscan_VHS	ENSG00000125447		0.642	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA3	HGNC	protein_coding	OTTHUMT00000446645.1	27	0.00	0	C	NM_138619		73242652	73242652	-1	no_errors	ENST00000245541	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	A
GJA10	84694	genome.wustl.edu	37	6	90605438	90605438	+	Silent	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr6:90605438G>T	ENST00000369352.1	+	1	1251	c.1251G>T	c.(1249-1251)ggG>ggT	p.G417G	Y_RNA_ENST00000517082.1_RNA	NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	51					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		GAGAGAGTGGGGTCTGGATAG	0.547																																						dbGAP											0													88.0	85.0	86.0					6																	90605438		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.1251G>T	6.37:g.90605438G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R722|B3KVQ2|Q5TA63|Q96KG0	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.G417	ENST00000369352.1	37	c.1251	CCDS5025.1	6																																																																																			GJA10	-	NULL	ENSG00000135355		0.547	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA10	HGNC	protein_coding	OTTHUMT00000041505.1	232	0.00	0	G	NM_032602		90605438	90605438	+1	no_errors	ENST00000369352	ensembl	human	known	69_37n	silent	310	11.40	40	SNP	0.047	T
GPM6A	2823	genome.wustl.edu	37	4	176594836	176594836	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr4:176594836C>T	ENST00000280187.7	-	4	427	c.382G>A	c.(382-384)Gct>Act	p.A128T	GPM6A_ENST00000506894.1_Missense_Mutation_p.A117T|GPM6A_ENST00000393658.2_Missense_Mutation_p.A128T|GPM6A_ENST00000515090.1_Missense_Mutation_p.A121T	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	128					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CATACCCAAGCGCTCACACAT	0.393																																						dbGAP											0													87.0	84.0	85.0					4																	176594836		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.382G>A	4.37:g.176594836C>T	ENSP00000280187:p.Ala128Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.A128T	ENST00000280187.7	37	c.382	CCDS3824.1	4	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916963	0.92249	.	.	ENSG00000150625	ENST00000280187;ENST00000393658;ENST00000506894;ENST00000515090;ENST00000503397;ENST00000512610;ENST00000502754;ENST00000507520;ENST00000513667;ENST00000505561;ENST00000505375;ENST00000513365	D;D;D;D;D;D;D;D;D;D;D;D	0.99207	-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56	5.84	5.0	0.66597	.	0.044914	0.85682	N	0.000000	D	0.98701	0.9564	L	0.49350	1.555	0.80722	D	1	D;D;D	0.57899	0.981;0.981;0.981	P;P;P	0.53861	0.736;0.629;0.629	D	0.98810	1.0743	10	0.54805	T	0.06	-1.6222	14.8435	0.70243	0.0:0.9312:0.0:0.0688	.	121;117;128	B7Z642;E9PHI5;P51674	.;.;GPM6A_HUMAN	T	128;128;117;121;120;65;65;65;65;65;65;128	ENSP00000280187:A128T;ENSP00000377268:A128T;ENSP00000421578:A117T;ENSP00000423984:A121T;ENSP00000422959:A120T;ENSP00000426984:A65T;ENSP00000426821:A65T;ENSP00000424075:A65T;ENSP00000421373:A65T;ENSP00000425409:A65T;ENSP00000424125:A65T;ENSP00000423122:A128T	ENSP00000280187:A128T	A	-	1	0	GPM6A	176831830	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.700000	0.68318	1.477000	0.48234	-0.218000	0.12543	GCT	GPM6A	-	pfam_Myelin_PLP,prints_Myelin_PLP	ENSG00000150625		0.393	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPM6A	HGNC	protein_coding	OTTHUMT00000362163.1	117	0.00	0	C			176594836	176594836	-1	no_errors	ENST00000280187	ensembl	human	known	69_37n	missense	60	29.07	25	SNP	1.000	T
GRTP1	79774	genome.wustl.edu	37	13	114009727	114009727	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr13:114009727G>T	ENST00000375431.4	-	3	325	c.251C>A	c.(250-252)gCc>gAc	p.A84D	GRTP1_ENST00000375430.4_Missense_Mutation_p.A84D|GRTP1-AS1_ENST00000423246.1_RNA|GRTP1_ENST00000326039.3_Missense_Mutation_p.A6D|GRTP1-AS1_ENST00000419199.1_RNA	NM_024719.2	NP_078995.2	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	84	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.A84V(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	14	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			CTGCGCCTGGGCCCCACTCAG	0.647																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											62.0	56.0	58.0					13																	114009727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026127	CCDS9534.2, CCDS66591.1, CCDS73606.1	13q34	2011-11-30			ENSG00000139835	ENSG00000139835			20310	protein-coding gene	gene with protein product						11564724	Standard	NM_001286732		Approved	FLJ22474, TBC1D6	uc001vtn.3	Q5TC63	OTTHUMG00000017381	ENST00000375431.4:c.251C>A	13.37:g.114009727G>T	ENSP00000364580:p.Ala84Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6K2|Q2M232|Q5TC64|Q66K26|Q6P659|Q8N528|Q9H695	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A84D	ENST00000375431.4	37	c.251	CCDS9534.2	13	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910554	0.92107	.	.	ENSG00000139835	ENST00000375431;ENST00000326039;ENST00000375430	T;T;T	0.04706	3.57;3.57;3.57	4.5	4.5	0.54988	Rab-GAP/TBC domain (4);	0.123873	0.53938	U	0.000053	T	0.28764	0.0713	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.83275	0.996;0.988;0.983	T	0.29941	-0.9995	10	0.87932	D	0	.	16.1597	0.81693	0.0:0.0:1.0:0.0	.	84;6;84	B9A6K2;Q5TC63-2;Q5TC63	.;.;GRTP1_HUMAN	D	84;6;84	ENSP00000364580:A84D;ENSP00000321850:A6D;ENSP00000364579:A84D	ENSP00000321850:A6D	A	-	2	0	GRTP1	113057728	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.240000	0.89813	2.332000	0.79248	0.591000	0.81541	GCC	GRTP1	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000139835		0.647	GRTP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	GRTP1	HGNC	protein_coding	OTTHUMT00000045882.5	9	0.00	0	G	NM_024719		114009727	114009727	-1	no_errors	ENST00000375430	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	1.000	T
GTF2IRD2	84163	genome.wustl.edu	37	7	74212296	74212298	+	In_Frame_Del	DEL	GGG	GGG	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	GGG	GGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:74212296_74212298delGGG	ENST00000405086.2	-	16	1742_1744	c.1553_1555delCCC	c.(1552-1557)acccag>aag	p.518_519TQ>K	GTF2IRD2_ENST00000451013.2_In_Frame_Del_p.65_66TQ>K	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						ggggatttctgggttggacttgg	0.478																																					NSCLC(40;560 1096 7501 40315 49546)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.1553_1555delCCC	7.37:g.74212296_74212298delGGG	ENSP00000385491:p.Thr518_Gln519delinsLys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	In_Frame_Del	DEL	pfam_GTF2I,superfamily_GTF2I,superfamily_RNaseH-like_dom,pfscan_GTF2I	p.TQ518in_frame_delK	ENST00000405086.2	37	c.1555_1553	CCDS5576.1	7																																																																																			GTF2IRD2	-	NULL	ENSG00000196275		0.478	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2	HGNC	protein_coding	OTTHUMT00000252712.3	29	0.00	0	GGG	NM_173537		74212296	74212298	-1	no_errors	ENST00000405086	ensembl	human	known	69_37n	in_frame_del	28	42.86	21	DEL	0.000:0.000:0.000	-
GYS1	2997	genome.wustl.edu	37	19	49481193	49481193	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:49481193G>C	ENST00000323798.3	-	10	1492	c.1296C>G	c.(1294-1296)atC>atG	p.I432M	GYS1_ENST00000263276.6_Missense_Mutation_p.I368M|GYS1_ENST00000544287.1_Missense_Mutation_p.I65M|GYS1_ENST00000540532.1_3'UTR|GYS1_ENST00000541188.1_Missense_Mutation_p.I352M	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	432					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GCGTTGCAAAGATGGCTCTCT	0.547																																						dbGAP											0													162.0	119.0	134.0					19																	49481193		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1296C>G	19.37:g.49481193G>C	ENSP00000317904:p.Ile432Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTT9	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.I432M	ENST00000323798.3	37	c.1296	CCDS12747.1	19	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419694	0.42918	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000544287	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.22	4.17	0.49024	.	0.147877	0.64402	D	0.000014	T	0.74764	0.3759	M	0.70108	2.13	0.80722	D	1	P;B;D	0.53745	0.917;0.057;0.962	P;B;P	0.61328	0.887;0.058;0.815	T	0.74331	-0.3700	10	0.44086	T	0.13	-25.2514	7.3157	0.26499	0.0861:0.0:0.7435:0.1703	.	352;368;432	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	M	432;368;352;65	ENSP00000317904:I432M;ENSP00000263276:I368M;ENSP00000437922:I352M;ENSP00000444004:I65M	ENSP00000263276:I368M	I	-	3	3	GYS1	54173005	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.069000	0.41481	1.510000	0.48803	0.491000	0.48974	ATC	GYS1	-	pfam_Glycogen_synth	ENSG00000104812		0.547	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1	68	0.00	0	G	NM_002103		49481193	49481193	-1	no_errors	ENST00000323798	ensembl	human	known	69_37n	missense	94	10.48	11	SNP	1.000	C
HCLS1	3059	genome.wustl.edu	37	3	121376169	121376169	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:121376169C>A	ENST00000314583.3	-	3	206	c.115G>T	c.(115-117)Gga>Tga	p.G39*	HCLS1_ENST00000428394.2_Nonsense_Mutation_p.G39*|RNU4-62P_ENST00000410125.1_RNA	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	39	Involved in HAX-1 binding.				actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		GTCTTGGCTCCCCATCGTTGC	0.512																																						dbGAP											0													235.0	204.0	214.0					3																	121376169		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.115G>T	3.37:g.121376169C>A	ENSP00000320176:p.Gly39*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Nonsense_Mutation	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.G39*	ENST00000314583.3	37	c.115	CCDS3003.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.161730	0.94727	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.0225	16.1002	0.81166	0.0:1.0:0.0:0.0	.	.	.	.	X	39	.	ENSP00000320176:G39X	G	-	1	0	HCLS1	122858859	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.411000	0.73298	2.661000	0.90470	0.655000	0.94253	GGA	HCLS1	-	NULL	ENSG00000180353		0.512	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	HGNC	protein_coding	OTTHUMT00000355144.1	259	0.00	0	C	NM_005335		121376169	121376169	-1	no_errors	ENST00000314583	ensembl	human	known	69_37n	nonsense	551	12.26	77	SNP	1.000	A
HECW2	57520	genome.wustl.edu	37	2	197189776	197189776	+	Silent	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:197189776G>A	ENST00000260983.3	-	6	851	c.669C>T	c.(667-669)acC>acT	p.T223T	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	223	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GGTGGGCACAGGTGGGGAAAC	0.493																																						dbGAP											0													262.0	237.0	245.0					2																	197189776		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.669C>T	2.37:g.197189776G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.T223	ENST00000260983.3	37	c.669	CCDS33354.1	2																																																																																			HECW2	-	pfam_C2_Ca-dep,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000138411		0.493	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	177	0.00	0	G	NM_020760		197189776	197189776	-1	no_errors	ENST00000260983	ensembl	human	known	69_37n	silent	286	28.61	115	SNP	0.991	A
HIST2H3D	653604	genome.wustl.edu	37	1	149784973	149784973	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:149784973C>T	ENST00000331491.1	-	1	263	c.264G>A	c.(262-264)tcG>tcA	p.S88S	HIST2H2BF_ENST00000369167.1_5'Flank|HIST2H2BF_ENST00000469483.1_5'Flank|HIST2H2BF_ENST00000545683.1_5'Flank|HIST2H2BF_ENST00000427880.2_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	88					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						CCATCACGGCCGAGCTCTGGA	0.632																																						dbGAP											0													16.0	19.0	18.0					1																	149784973		1540	3513	5053	-	-	-	SO:0001819	synonymous_variant	0			AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.264G>A	1.37:g.149784973C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDF6|A6NFS4|Q6B053	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.S88	ENST00000331491.1	37	c.264	CCDS41388.1	1																																																																																			HIST2H3D	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000183598		0.632	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H3D	HGNC	protein_coding	OTTHUMT00000033452.1	39	0.00	0	C	NM_001123375		149784973	149784973	-1	no_errors	ENST00000331491	ensembl	human	known	69_37n	silent	25	37.50	15	SNP	0.989	T
HRNR	388697	genome.wustl.edu	37	1	152186699	152186699	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:152186699T>A	ENST00000368801.2	-	3	7481	c.7406A>T	c.(7405-7407)cAg>cTg	p.Q2469L	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2469					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGAGGACTGTCCTGAGCG	0.557																																						dbGAP											0													1.0	1.0	1.0					1																	152186699		226	649	875	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7406A>T	1.37:g.152186699T>A	ENSP00000357791:p.Gln2469Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.Q2469L	ENST00000368801.2	37	c.7406	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	-	7.119	0.577571	0.13686	.	.	ENSG00000197915	ENST00000368801	T	0.01629	4.72	3.61	1.18	0.20946	.	.	.	.	.	T	0.00608	0.0020	L	0.43152	1.355	0.09310	N	1	P	0.47409	0.895	B	0.43838	0.433	T	0.36089	-0.9762	9	0.08599	T	0.76	.	6.706	0.23250	0.0:0.2023:0.0:0.7977	.	2469	Q86YZ3	HORN_HUMAN	L	2469	ENSP00000357791:Q2469L	ENSP00000357791:Q2469L	Q	-	2	0	HRNR	150453323	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	1.092000	0.30927	0.123000	0.18342	0.529000	0.55759	CAG	HRNR	-	NULL	ENSG00000197915		0.557	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	52	0.00	0	T	XM_373868		152186699	152186699	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.000	A
HSD11B1	3290	genome.wustl.edu	37	1	209879201	209879201	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:209879201G>T	ENST00000367028.2	+	3	303	c.134G>T	c.(133-135)gGg>gTg	p.G45V	HSD11B1_ENST00000261465.1_Missense_Mutation_p.G45V|RP1-28O10.1_ENST00000441672.1_RNA|HSD11B1_ENST00000367027.3_Missense_Mutation_p.G45V	NM_001206741.1	NP_001193670.1	P28845	DHI1_HUMAN	hydroxysteroid (11-beta) dehydrogenase 1	45					glucocorticoid biosynthetic process (GO:0006704)|lung development (GO:0030324)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	11-beta-hydroxysteroid dehydrogenase (NADP+) activity (GO:0070524)|11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	16				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	Prednisone(DB00635)	GCCAGCAAAGGGATCGGAAGA	0.507																																						dbGAP											0													133.0	127.0	129.0					1																	209879201		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012593	CCDS1489.1	1q32-q41	2011-09-20			ENSG00000117594	ENSG00000117594	1.1.1.146	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5208	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 26C, member 1"""	600713		HSD11B, HSD11		1885595, 19027726	Standard	NM_005525		Approved	SDR26C1	uc001hhk.3	P28845	OTTHUMG00000036481	ENST00000367028.2:c.134G>T	1.37:g.209879201G>T	ENSP00000355995:p.Gly45Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Z1|D3DT89	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	p.G45V	ENST00000367028.2	37	c.134	CCDS1489.1	1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632422	0.67015	.	.	ENSG00000117594	ENST00000367028;ENST00000261465;ENST00000367027	T;T;T	0.69685	-0.42;-0.42;-0.42	3.95	3.95	0.45737	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.87625	0.6224	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.92459	0.5976	10	0.87932	D	0	.	16.8669	0.86032	0.0:0.0:1.0:0.0	.	45	P28845	DHI1_HUMAN	V	45	ENSP00000355995:G45V;ENSP00000261465:G45V;ENSP00000355994:G45V	ENSP00000261465:G45V	G	+	2	0	HSD11B1	207945824	1.000000	0.71417	0.994000	0.49952	0.743000	0.42351	7.147000	0.77382	2.151000	0.67156	0.442000	0.29010	GGG	HSD11B1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	ENSG00000117594		0.507	HSD11B1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD11B1	HGNC	protein_coding	OTTHUMT00000088743.2	84	0.00	0	G	NM_005525		209879201	209879201	+1	no_errors	ENST00000261465	ensembl	human	known	69_37n	missense	182	27.84	71	SNP	1.000	T
HUWE1	10075	genome.wustl.edu	37	X	53573667	53573667	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chrX:53573667C>G	ENST00000342160.3	-	68	11213	c.10756G>C	c.(10756-10758)Gag>Cag	p.E3586Q	HUWE1_ENST00000474288.1_5'UTR|HUWE1_ENST00000262854.6_Missense_Mutation_p.E3586Q			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3586					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGACTCACCTCTACAGAGAGC	0.493																																						dbGAP											0													68.0	57.0	61.0					X																	53573667		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.10756G>C	X.37:g.53573667C>G	ENSP00000340648:p.Glu3586Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.E3586Q	ENST00000342160.3	37	c.10756	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.76|15.76	2.927705|2.927705	0.52759|0.52759	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052;ENST00000426907	T;T|.	0.37915|.	1.17;1.17|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	1.328080|.	0.04895|.	N|.	0.450264|.	T|T	0.53238|0.53238	0.1784|0.1784	N|N	0.20685|0.20685	0.6|0.6	0.80722|0.80722	D|D	1|1	D;D|.	0.61697|.	0.982;0.99|.	P;P|.	0.56216|.	0.628;0.794|.	T|T	0.49293|0.49293	-0.8955|-0.8955	10|5	0.29301|.	T|.	0.29|.	.|.	17.5034|17.5034	0.87738|0.87738	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3586;3570|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	Q|T	3586|2619;423	ENSP00000340648:E3586Q;ENSP00000262854:E3586Q|.	ENSP00000262854:E3586Q|.	E|R	-|-	1|2	0|0	HUWE1|HUWE1	53590392|53590392	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.828000|0.828000	0.46876|0.46876	6.842000|6.842000	0.75379|0.75379	2.403000|2.403000	0.81681|0.81681	0.544000|0.544000	0.68410|0.68410	GAG|AGA	HUWE1	-	NULL	ENSG00000086758		0.493	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	90	0.00	0	C	XM_497119		53573667	53573667	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	102	15.00	18	SNP	1.000	G
IFNE	338376	genome.wustl.edu	37	9	21481118	21481118	+	Silent	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr9:21481118G>A	ENST00000448696.3	-	1	1194	c.576C>T	c.(574-576)ccC>ccT	p.P192P	MIR31HG_ENST00000304425.3_RNA	NM_176891.4	NP_795372.1	Q86WN2	IFNE_HUMAN	interferon, epsilon	192					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(2)|lung(1)|skin(1)	4						TGTCGTTCAAGGGTCTTCCTT	0.468																																						dbGAP											0													116.0	117.0	116.0					9																	21481118		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY190045	CCDS34997.1	9p21.1	2008-12-12			ENSG00000184995	ENSG00000184995			18163	protein-coding gene	gene with protein product		615223				15546383, 17287131	Standard	NM_176891		Approved	IFNE1	uc003zpg.3	Q86WN2	OTTHUMG00000019672	ENST00000448696.3:c.576C>T	9.37:g.21481118G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.P192	ENST00000448696.3	37	c.576	CCDS34997.1	9																																																																																			IFNE	-	NULL	ENSG00000184995		0.468	IFNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNE	HGNC	protein_coding	OTTHUMT00000051901.2	155	0.00	0	G	NM_176891		21481118	21481118	-1	no_errors	ENST00000448696	ensembl	human	known	69_37n	silent	242	16.84	49	SNP	0.105	A
INADL	10207	genome.wustl.edu	37	1	62380272	62380272	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:62380272T>C	ENST00000371158.2	+	26	3620	c.3506T>C	c.(3505-3507)gTa>gCa	p.V1169A	INADL_ENST00000316485.6_Missense_Mutation_p.V1169A	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1169					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						ATTCCTAACGTACATAACAAG	0.378																																						dbGAP											0													94.0	103.0	100.0					1																	62380272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3506T>C	1.37:g.62380272T>C	ENSP00000360200:p.Val1169Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.V1169A	ENST00000371158.2	37	c.3506	CCDS617.2	1	.	.	.	.	.	.	.	.	.	.	T	3.378	-0.127070	0.06795	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513	T;T	0.12984	2.74;2.63	4.69	-0.417	0.12347	.	0.834960	0.10372	N	0.682635	T	0.12774	0.0310	M	0.64997	1.995	0.09310	N	1	B;B;B	0.25007	0.022;0.116;0.09	B;B;B	0.20767	0.026;0.014;0.031	T	0.38351	-0.9665	10	0.18276	T	0.48	.	7.8771	0.29599	0.0:0.3827:0.0:0.6173	.	1169;1169;1169	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	A	1169	ENSP00000360200:V1169A;ENSP00000326199:V1169A	ENSP00000326199:V1169A	V	+	2	0	INADL	62152860	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	0.194000	0.17135	-0.150000	0.11195	0.472000	0.43445	GTA	INADL	-	NULL	ENSG00000132849		0.378	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	188	0.00	0	T	NM_170605		62380272	62380272	+1	no_errors	ENST00000371158	ensembl	human	known	69_37n	missense	298	19.84	74	SNP	0.000	C
ITGBL1	9358	genome.wustl.edu	37	13	102220051	102220051	+	Splice_Site	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr13:102220051C>G	ENST00000376180.3	+	3	537	c.318C>G	c.(316-318)ggC>ggG	p.G106G	ITGBL1_ENST00000545560.2_5'UTR|ITGBL1_ENST00000376162.3_Splice_Site_p.G13G	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	106	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AATCCCCAGGCCATGGTAAGT	0.433																																						dbGAP											0													205.0	179.0	187.0					13																	102220051		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.317-1C>G	13.37:g.102220051C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Silent	SNP	pfam_EGF_extracell,smart_EGF-like	p.G106	ENST00000376180.3	37	c.318	CCDS9499.1	13	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326742	0.41197	.	.	ENSG00000198542	ENST00000537118	.	.	.	5.39	4.53	0.55603	.	.	.	.	.	T	0.63546	0.2520	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60637	-0.7224	4	.	.	.	.	12.1604	0.54101	0.0:0.9207:0.0:0.0793	.	.	.	.	G	15	.	.	A	+	2	0	ITGBL1	101018052	0.965000	0.33210	1.000000	0.80357	0.967000	0.64934	0.076000	0.14712	2.688000	0.91661	0.650000	0.86243	GCC	ITGBL1	-	pfam_EGF_extracell,smart_EGF-like	ENSG00000198542		0.433	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGBL1	HGNC	protein_coding	OTTHUMT00000045669.2	235	0.00	0	C	NM_004791	Silent	102220051	102220051	+1	no_errors	ENST00000376180	ensembl	human	known	69_37n	silent	323	10.74	39	SNP	1.000	G
KCNV1	27012	genome.wustl.edu	37	8	110984688	110984688	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:110984688C>A	ENST00000524391.1	-	3	1822	c.790G>T	c.(790-792)Gtg>Ttg	p.V264L	RP11-696P8.2_ENST00000530667.1_RNA|KCNV1_ENST00000297404.1_Missense_Mutation_p.V264L			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	264					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CTGTCCCGCACACACAGGAAG	0.532																																						dbGAP											0													81.0	69.0	73.0					8																	110984688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.790G>T	8.37:g.110984688C>A	ENSP00000435954:p.Val264Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UHJ4	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.V264L	ENST00000524391.1	37	c.790	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	C	17.73	3.460527	0.63513	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.97186	-4.28;-4.28	5.7	5.7	0.88788	Ion transport (1);	0.218501	0.37437	N	0.002092	D	0.95868	0.8655	M	0.63843	1.955	0.45914	D	0.998752	B	0.29481	0.245	B	0.32090	0.14	D	0.94513	0.7720	10	0.72032	D	0.01	.	14.1042	0.65078	0.0:0.9259:0.0:0.0741	.	264	Q6PIU1	KCNV1_HUMAN	L	264;264;140	ENSP00000435954:V264L;ENSP00000297404:V264L	ENSP00000297404:V264L	V	-	1	0	KCNV1	111053864	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.033000	0.57282	2.697000	0.92050	0.557000	0.71058	GTG	KCNV1	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000164794		0.532	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	82	0.00	0	C	NM_014379		110984688	110984688	-1	no_errors	ENST00000297404	ensembl	human	known	69_37n	missense	66	13.16	10	SNP	1.000	A
KIF1B	23095	genome.wustl.edu	37	1	10356711	10356711	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:10356711C>G	ENST00000377086.1	+	20	2051	c.1849C>G	c.(1849-1851)Cag>Gag	p.Q617E	KIF1B_ENST00000377081.1_Missense_Mutation_p.Q617E|KIF1B_ENST00000377083.1_Missense_Mutation_p.Q571E|KIF1B_ENST00000377093.4_Missense_Mutation_p.Q571E|KIF1B_ENST00000263934.6_Missense_Mutation_p.Q571E|RNU6-37P_ENST00000362692.1_RNA			O60333	KIF1B_HUMAN	kinesin family member 1B	617					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CCAGCCTGTTCAGCTGCGCTC	0.468																																						dbGAP											0													67.0	64.0	65.0					1																	10356711		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1849C>G	1.37:g.10356711C>G	ENSP00000366290:p.Gln617Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q571E	ENST00000377086.1	37	c.1711		1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.789091	0.31685	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	5.81	5.81	0.92471	Forkhead-associated (FHA) domain (2);SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	T	0.80053	0.4553	L	0.41356	1.27	0.51767	D	0.999937	B;B;B;B;B;B;B	0.18610	0.0;0.001;0.001;0.002;0.0;0.001;0.029	B;B;B;B;B;B;B	0.22386	0.002;0.01;0.002;0.01;0.002;0.002;0.039	T	0.73206	-0.4056	10	0.20046	T	0.44	.	15.5509	0.76152	0.0:0.8627:0.1373:0.0	.	603;577;617;591;617;571;571	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	E	617;571;571;617;571;617	ENSP00000263934:Q571E;ENSP00000366297:Q571E;ENSP00000366290:Q617E;ENSP00000366287:Q571E;ENSP00000366284:Q617E	ENSP00000263934:Q571E	Q	+	1	0	KIF1B	10279298	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.038000	0.49783	2.746000	0.94184	0.655000	0.94253	CAG	KIF1B	-	pfam_FHA_dom,superfamily_SMAD_FHA_domain	ENSG00000054523		0.468	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	40	0.00	0	C			10356711	10356711	+1	no_errors	ENST00000263934	ensembl	human	known	69_37n	missense	58	32.56	28	SNP	1.000	G
KIF17	57576	genome.wustl.edu	37	1	21009345	21009345	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:21009345C>T	ENST00000247986.2	-	11	2574	c.2264G>A	c.(2263-2265)gGa>gAa	p.G755E	KIF17_ENST00000400463.3_Missense_Mutation_p.G755E|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000375044.1_Missense_Mutation_p.G655E			Q9P2E2	KIF17_HUMAN	kinesin family member 17	755					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GGCCTGCTCTCCACCCACAAC	0.602																																						dbGAP											0													78.0	67.0	71.0					1																	21009345		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2264G>A	1.37:g.21009345C>T	ENSP00000247986:p.Gly755Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G755E	ENST00000247986.2	37	c.2264	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.845815	0.91197	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	D;D;D	0.89123	-2.47;-2.22;-2.18	5.76	5.76	0.90799	.	0.000000	0.32785	U	0.005649	D	0.94532	0.8239	M	0.81942	2.565	0.40732	D	0.982756	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.74023	0.963;0.982;0.96	D	0.95117	0.8243	10	0.87932	D	0	.	17.1332	0.86732	0.0:1.0:0.0:0.0	.	755;755;755	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	E	655;755;755;136	ENSP00000364184:G655E;ENSP00000383311:G755E;ENSP00000247986:G755E	ENSP00000247986:G755E	G	-	2	0	KIF17	20881932	1.000000	0.71417	0.527000	0.27925	0.929000	0.56500	7.112000	0.77086	2.724000	0.93272	0.563000	0.77884	GGA	KIF17	-	NULL	ENSG00000117245		0.602	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	79	0.00	0	C	NM_020816		21009345	21009345	-1	no_errors	ENST00000247986	ensembl	human	known	69_37n	missense	50	24.24	16	SNP	0.975	T
KIF26B	55083	genome.wustl.edu	37	1	245849668	245849668	+	Missense_Mutation	SNP	C	C	A	rs373156923		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:245849668C>A	ENST00000407071.2	+	12	3823	c.3383C>A	c.(3382-3384)cCg>cAg	p.P1128Q	KIF26B_ENST00000366518.4_Missense_Mutation_p.P747Q	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1128					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGTACGCCCCCGGTTGGAATG	0.622																																						dbGAP											0													79.0	87.0	84.0					1																	245849668		1938	4142	6080	-	-	-	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.3383C>A	1.37:g.245849668C>A	ENSP00000385545:p.Pro1128Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P1128Q	ENST00000407071.2	37	c.3383	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550526	0.65311	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.94576	-3.46;-3.45	5.76	5.76	0.90799	.	.	.	.	.	D	0.97642	0.9227	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97914	1.0310	9	0.87932	D	0	.	19.9554	0.97216	0.0:1.0:0.0:0.0	.	747;1128	B7WPD9;Q2KJY2	.;KI26B_HUMAN	Q	1128;747;744	ENSP00000385545:P1128Q;ENSP00000355475:P747Q	ENSP00000355475:P747Q	P	+	2	0	KIF26B	243916291	1.000000	0.71417	0.744000	0.31058	0.468000	0.32798	7.800000	0.85949	2.735000	0.93741	0.549000	0.68633	CCG	KIF26B	-	NULL	ENSG00000162849		0.622	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	36	0.00	0	C	XM_371354		245849668	245849668	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	A
KIR3DL2	3812	genome.wustl.edu	37	19	55367355	55367355	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:55367355G>C	ENST00000326321.3	+	5	970	c.937G>C	c.(937-939)Gtt>Ctt	p.V313L	KIR3DL1_ENST00000402254.2_Intron|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.V313L	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	313					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		CCCACTGCTTGTTTCTGTCAC	0.567																																						dbGAP											0													8.0	9.0	8.0					19																	55367355		1643	3517	5160	-	-	-	SO:0001583	missense	0			L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.937G>C	19.37:g.55367355G>C	ENSP00000325525:p.Val313Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.V313L	ENST00000326321.3	37	c.937	CCDS12906.1	19	.	.	.	.	.	.	.	.	.	.	g	1.550	-0.539580	0.04053	.	.	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.00530	6.77;6.77	0.993	-1.99	0.07457	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00608	0.0020	L	0.31752	0.955	0.09310	N	1	B;P;B	0.41188	0.0;0.741;0.003	B;P;B	0.57204	0.002;0.815;0.002	T	0.50110	-0.8866	9	0.87932	D	0	.	3.0189	0.06069	0.2984:0.3964:0.3052:0.0	.	313;313;118	Q95366;P43630;B5MCJ6	.;KI3L2_HUMAN;.	L	313	ENSP00000325525:V313L;ENSP00000270442:V313L	ENSP00000270442:V313L	V	+	1	0	KIR3DL2	60059167	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.547000	0.06055	-0.527000	0.06374	-1.109000	0.02080	GTT	KIR3DL2	-	smart_Ig_sub	ENSG00000240403		0.567	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIR3DL2	HGNC	protein_coding	OTTHUMT00000141241.1	65	0.00	0	G			55367355	55367355	+1	no_errors	ENST00000326321	ensembl	human	known	69_37n	missense	114	16.18	22	SNP	0.000	C
KRT77	374454	genome.wustl.edu	37	12	53086263	53086263	+	Silent	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:53086263G>A	ENST00000341809.3	-	7	1397	c.1369C>T	c.(1369-1371)Ctg>Ttg	p.L457L	RP11-641A6.3_ENST00000547533.1_RNA|KRT77_ENST00000537195.1_Silent_p.L224L	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	457	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TCCAGGGACAGCTTGACCCCC	0.647																																						dbGAP											0													57.0	51.0	53.0					12																	53086263		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1369C>T	12.37:g.53086263G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTS8	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.L457	ENST00000341809.3	37	c.1369	CCDS8837.1	12																																																																																			KRT77	-	pfam_F	ENSG00000189182		0.647	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	HGNC	protein_coding	OTTHUMT00000404111.1	80	0.00	0	G	NM_175078		53086263	53086263	-1	no_errors	ENST00000341809	ensembl	human	known	69_37n	silent	110	17.29	23	SNP	1.000	A
KRTAP5-5	439915	genome.wustl.edu	37	11	1651534	1651534	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:1651534delC	ENST00000399676.2	+	1	502	c.464delC	c.(463-465)tccfs	p.S155fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	155	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TATGGCTGCTCCCAGTCCAGC	0.662																																						dbGAP											0													42.0	58.0	53.0					11																	1651534		2176	4240	6416	-	-	-	SO:0001589	frameshift_variant	0			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.464delC	11.37:g.1651534delC	ENSP00000382584:p.Ser155fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWN2	Frame_Shift_Del	DEL	NULL	p.Q156fs	ENST00000399676.2	37	c.464	CCDS41592.1	11																																																																																			KRTAP5-5	-	NULL	ENSG00000185940		0.662	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	49	0.00	0	C			1651534	1651534	+1	no_errors	ENST00000399676	ensembl	human	known	69_37n	frame_shift_del	34	12.82	5	DEL	0.000	-
LCE1C	353133	genome.wustl.edu	37	1	152777887	152777887	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:152777887T>A	ENST00000607093.1	-	1	67	c.68A>T	c.(67-69)aAg>aTg	p.K23M	LCE1C_ENST00000368768.1_Missense_Mutation_p.K23M			Q5T751	LCE1C_HUMAN	late cornified envelope 1C	23	Pro-rich.				keratinization (GO:0031424)					NS(1)|lung(4)|prostate(1)|skin(2)|urinary_tract(1)	9	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ggTGgggcacttgggagggca	0.627																																						dbGAP											0													43.0	43.0	43.0					1																	152777887		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1026.1	1q21.3	2008-02-05			ENSG00000197084	ENSG00000197084		"""Late cornified envelopes"""	29464	protein-coding gene	gene with protein product		612605				11698679	Standard	NM_001276331		Approved	LEP3	uc001fap.1	Q5T751	OTTHUMG00000012445	ENST00000607093.1:c.68A>T	1.37:g.152777887T>A	ENSP00000475270:p.Lys23Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.K23M	ENST00000607093.1	37	c.68	CCDS1026.1	1	.	.	.	.	.	.	.	.	.	.	T	9.317	1.057074	0.19907	.	.	ENSG00000197084	ENST00000368768	T	0.05382	3.45	3.53	3.53	0.40419	.	.	.	.	.	T	0.12603	0.0306	M	0.79805	2.47	0.24798	N	0.992713	D	0.89917	1.0	D	0.68353	0.957	T	0.05146	-1.0903	9	0.87932	D	0	.	8.62	0.33855	0.0:0.0:0.0:1.0	.	23	Q5T751	LCE1C_HUMAN	M	23	ENSP00000357757:K23M	ENSP00000357757:K23M	K	-	2	0	LCE1C	151044511	0.999000	0.42202	0.947000	0.38551	0.803000	0.45373	1.597000	0.36729	1.601000	0.50113	0.533000	0.62120	AAG	LCE1C	-	NULL	ENSG00000197084		0.627	LCE1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1C	HGNC	protein_coding	OTTHUMT00000034658.2	85	0.00	0	T	NM_178351		152777887	152777887	-1	no_errors	ENST00000368768	ensembl	human	known	69_37n	missense	92	43.21	70	SNP	0.988	A
MALAT1	378938	genome.wustl.edu	37	11	65267999	65268000	+	lincRNA	INS	-	-	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:65267999_65268000insG	ENST00000534336.1	+	0	2767_2768				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AGATAGGAAAAGAGTCCAGGAG	0.505																																						dbGAP											0																																										-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268000_65268000dupG		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.505	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	38	0.00	0	-	NR_002819		65267999	65268000	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	79	16.84	16	INS	0.000:0.003	G
MEGF11	84465	genome.wustl.edu	37	15	66416295	66416295	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr15:66416295G>C	ENST00000409699.2	-	3	314	c.142C>G	c.(142-144)Cag>Gag	p.Q48E	MEGF11_ENST00000360698.4_Missense_Mutation_p.Q48E|MEGF11_ENST00000395625.2_Missense_Mutation_p.I6M|MEGF11_ENST00000288745.3_Missense_Mutation_p.I6M|MEGF11_ENST00000395614.1_De_novo_Start_OutOfFrame|MEGF11_ENST00000422354.1_Missense_Mutation_p.Q48E			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	48	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						TAATAGATCTGATCGAAGGGG	0.512																																						dbGAP											0													232.0	171.0	191.0					15																	66416295		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.142C>G	15.37:g.66416295G>C	ENSP00000386908:p.Gln48Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_EMI_domain	p.Q48E	ENST00000409699.2	37	c.142	CCDS10213.2	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.96|18.96	3.733077|3.733077	0.69189|0.69189	.|.	.|.	ENSG00000157890|ENSG00000157890	ENST00000288745;ENST00000395625|ENST00000409699;ENST00000422354;ENST00000360698	D;D|D;D;D	0.86297|0.86366	-2.1;-2.1|-2.11;-2.11;-2.04	5.71|5.71	5.71|5.71	0.89125|0.89125	.|EMI domain (1);	.|.	.|.	.|.	.|.	D|D	0.91284|0.91284	0.7252|0.7252	L|L	0.56769|0.56769	1.78|1.78	0.58432|0.58432	D|D	0.999994|0.999994	P|D	0.36315|0.59767	0.547|0.986	B|D	0.44224|0.69654	0.444|0.965	D|D	0.87276|0.87276	0.2289|0.2289	9|9	0.39692|0.12766	T|T	0.17|0.61	.|.	18.8392|18.8392	0.92176|0.92176	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	6|48	A6BM72-2|A6BM72	.|MEG11_HUMAN	M|E	6|48	ENSP00000288745:I6M;ENSP00000378987:I6M|ENSP00000386908:Q48E;ENSP00000414475:Q48E;ENSP00000353919:Q48E	ENSP00000288745:I6M|ENSP00000353919:Q48E	I|Q	-|-	3|1	3|0	MEGF11|MEGF11	64203349|64203349	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	9.663000|9.663000	0.98605|0.98605	2.702000|2.702000	0.92279|0.92279	0.561000|0.561000	0.74099|0.74099	ATC|CAG	MEGF11	-	pfscan_EMI_domain	ENSG00000157890		0.512	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF11	HGNC	protein_coding	OTTHUMT00000329307.2	42	0.00	0	G	NM_032445		66416295	66416295	-1	no_errors	ENST00000409699	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	1.000	C
MET	4233	genome.wustl.edu	37	7	116339812	116339812	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:116339812G>A	ENST00000318493.6	+	2	861	c.674G>A	c.(673-675)gGt>gAt	p.G225D	MET_ENST00000397752.3_Missense_Mutation_p.G225D|MET_ENST00000436117.2_Missense_Mutation_p.G225D			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			ACGAAAGATGGTTTTATGTTT	0.363			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																													dbGAP		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													192.0	189.0	190.0					7																	116339812		1894	4113	6007	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.674G>A	7.37:g.116339812G>A	ENSP00000317272:p.Gly225Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semaphorin/CD100_Ag,pfscan_Prot_kinase_cat_dom	p.G225D	ENST00000318493.6	37	c.674	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363162	0.82353	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.04970	3.52;3.52;3.52	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	M	0.79805	2.47	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.00334	-1.1809	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	225;225;225;225;225;225;225;225;225;225;225;225;225	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	D	225	ENSP00000380860:G225D;ENSP00000317272:G225D;ENSP00000410980:G225D	ENSP00000317272:G225D	G	+	2	0	MET	116127048	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.396000	0.97270	2.941000	0.99782	0.655000	0.94253	GGT	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000105976		0.363	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	246	0.00	0	G			116339812	116339812	+1	no_errors	ENST00000318493	ensembl	human	known	69_37n	missense	257	49.51	254	SNP	1.000	A
MGAT5	4249	genome.wustl.edu	37	2	135107491	135107491	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:135107491C>T	ENST00000409645.1	+	10	1480	c.1228C>T	c.(1228-1230)Cag>Tag	p.Q410*	MGAT5_ENST00000281923.2_Nonsense_Mutation_p.Q410*			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	410					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GAACCCTCAGCAGTTTTATAC	0.418																																						dbGAP											0													138.0	133.0	135.0					2																	135107491		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.1228C>T	2.37:g.135107491C>T	ENSP00000386377:p.Gln410*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP70	Nonsense_Mutation	SNP	NULL	p.Q410*	ENST00000409645.1	37	c.1228	CCDS2171.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.068077	0.98638	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.2078	19.2484	0.93912	0.0:1.0:0.0:0.0	.	.	.	.	X	410	.	ENSP00000281923:Q410X	Q	+	1	0	MGAT5	134823961	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.600000	0.87896	0.655000	0.94253	CAG	MGAT5	-	NULL	ENSG00000152127		0.418	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT5	HGNC	protein_coding	OTTHUMT00000254584.3	189	0.00	0	C	NM_002410		135107491	135107491	+1	no_errors	ENST00000281923	ensembl	human	known	69_37n	nonsense	174	30.12	75	SNP	1.000	T
MIA3	375056	genome.wustl.edu	37	1	222802425	222802425	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:222802425A>T	ENST00000344922.5	+	4	1888	c.1863A>T	c.(1861-1863)gaA>gaT	p.E621D	MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344441.6_Missense_Mutation_p.E621D|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	621					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TGAAAGAGGAATTAGTTCTTA	0.463																																						dbGAP											0													102.0	105.0	104.0					1																	222802425		1943	4143	6086	-	-	-	SO:0001583	missense	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.1863A>T	1.37:g.222802425A>T	ENSP00000340900:p.Glu621Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.E621D	ENST00000344922.5	37	c.1863	CCDS41470.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.91|10.91	1.483302|1.483302	0.26598|0.26598	.|.	.|.	ENSG00000154305|ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831|ENST00000354906	T;T|.	0.04758|.	3.56;3.56|.	4.64|4.64	-0.927|-0.927	0.10451|0.10451	.|.	.|.	.|.	.|.	.|.	T|T	0.21022|0.21022	0.0506|0.0506	L|L	0.31664|0.31664	0.95|0.95	0.09310|0.09310	N|N	1|1	B;B|.	0.14805|.	0.011;0.005|.	B;B|.	0.12156|.	0.004;0.007|.	T|T	0.23868|0.23868	-1.0176|-1.0176	9|5	0.34782|.	T|.	0.22|.	.|.	0.8996|0.8996	0.01271|0.01271	0.4958:0.1602:0.1894:0.1546|0.4958:0.1602:0.1894:0.1546	.|.	621;621|.	Q5JRA6-2;Q5JRA6|.	.;MIA3_HUMAN|.	D|F	621|204	ENSP00000340900:E621D;ENSP00000340587:E621D|.	ENSP00000325973:E621D|.	E|I	+|+	3|1	2|0	MIA3|MIA3	220869048|220869048	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.329000|0.329000	0.28539|0.28539	-0.043000|-0.043000	0.12043|0.12043	-0.366000|-0.366000	0.08064|0.08064	0.254000|0.254000	0.18369|0.18369	GAA|ATT	MIA3	-	NULL	ENSG00000154305		0.463	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4	182	0.00	0	A	NM_198551		222802425	222802425	+1	no_errors	ENST00000344441	ensembl	human	known	69_37n	missense	307	42.35	227	SNP	0.000	T
KMT2C	58508	genome.wustl.edu	37	7	151855984	151855985	+	In_Frame_Ins	INS	-	-	TCT			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:151855984_151855985insTCT	ENST00000262189.6	-	44	11851_11852	c.11633_11634insAGA	c.(11632-11634)atg>atAGAg	p.3878_3878M>IE	KMT2C_ENST00000355193.2_In_Frame_Ins_p.3878_3878M>IE	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3878					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGCTAGAGTACATAGCTTGTTT	0.48																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11633_11634insAGA	7.37:g.151855984_151855985insTCT	ENSP00000262189:p.Met3878delinsIleGlu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	In_Frame_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.M3878in_frame_insIE	ENST00000262189.6	37	c.11634_11633	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.480	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	348	0.00	0	-			151855984	151855985	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	in_frame_ins	214	47.42	193	INS	0.970:0.965	TCT
APEH	327	genome.wustl.edu	37	3	49723823	49723823	+	IGR	SNP	A	A	G	rs7431215		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:49723823A>G	ENST00000296456.5	+	0	3220				MST1_ENST00000545762.1_3'UTR|MST1_ENST00000449682.2_Silent_p.T313T|MST1_ENST00000494828.2_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_Silent_p.T238T	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTACGCCCGCAGTGGTGGTAT	0.647																																						dbGAP											0													36.0	33.0	34.0					3																	49723823		2202	4297	6499	-	-	-	SO:0001628	intergenic_variant	0			D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723823A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	pfam_Kringle,pfam_PAN-1_domain,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,pfscan_Pan_app,pfscan_Kringle	p.L247P	ENST00000296456.5	37	c.740	CCDS2801.1	3																																																																																			MST1	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000173531		0.647	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MST1	HGNC	protein_coding	OTTHUMT00000346415.2	9	0.00	0	A			49723823	49723823	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000428801	ensembl	human	known	69_37n	missense	1	75.00	3	SNP	0.004	G
MUC5B	727897	genome.wustl.edu	37	11	1272402	1272402	+	Silent	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:1272402C>A	ENST00000529681.1	+	31	14350	c.14292C>A	c.(14290-14292)gtC>gtA	p.V4764V	MUC5B_ENST00000447027.1_Silent_p.V4767V|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4764	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGTGGACCGTCCCAGCACAGA	0.587																																						dbGAP											0													169.0	195.0	187.0					11																	1272402		2186	4256	6442	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14292C>A	11.37:g.1272402C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V4767	ENST00000529681.1	37	c.14301	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	1.662	-0.511237	0.04231	.	.	ENSG00000117983	ENST00000535652	.	.	.	1.41	0.23	0.15372	.	.	.	.	.	T	0.38134	0.1029	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37820	-0.9689	5	0.87932	D	0	.	4.9512	0.14015	0.353:0.647:0.0:0.0	.	.	.	.	Y	536	.	ENSP00000439776:S536Y	S	+	2	0	MUC5B	1228978	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	0.000000	0.12993	-0.168000	0.10853	0.194000	0.17425	TCC	MUC5B	-	NULL	ENSG00000117983		0.587	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	39	0.00	0	C	XM_001126093		1272402	1272402	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	15	63.64	28	SNP	0.000	A
MYO7A	4647	genome.wustl.edu	37	11	76870558	76870558	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:76870558T>A	ENST00000409709.3	+	10	1341	c.1069T>A	c.(1069-1071)Tcc>Acc	p.S357T	MYO7A_ENST00000409893.1_Missense_Mutation_p.S357T|MYO7A_ENST00000409619.2_Missense_Mutation_p.S346T|MYO7A_ENST00000458637.2_Missense_Mutation_p.S357T	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	357	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CACAGCTGCATCCCTGCTTGA	0.577																																						dbGAP											0													86.0	88.0	87.0					11																	76870558		2031	4201	6232	-	-	-	SO:0001583	missense	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.1069T>A	11.37:g.76870558T>A	ENSP00000386331:p.Ser357Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.S357T	ENST00000409709.3	37	c.1069	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	T	10.44	1.351600	0.24512	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000343419	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	5.15	2.47	0.30058	Myosin head, motor domain (2);	0.430804	0.23435	N	0.048219	T	0.73466	0.3590	N	0.16790	0.44	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.10450	0.005;0.003;0.004	T	0.67440	-0.5670	10	0.33141	T	0.24	.	6.7496	0.23480	0.3241:0.0:0.1176:0.5584	.	357;357;357	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	T	357;357;357;346;356;356;356	ENSP00000386331:S357T;ENSP00000386689:S357T;ENSP00000392185:S357T;ENSP00000386635:S346T	ENSP00000340325:S356T	S	+	1	0	MYO7A	76548206	0.015000	0.18098	0.565000	0.28409	0.984000	0.73092	0.451000	0.21779	1.938000	0.56188	0.482000	0.46254	TCC	MYO7A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000137474		0.577	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	28	0.00	0	T	NM_000260		76870558	76870558	+1	no_errors	ENST00000409709	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.015	A
NETO1	81832	genome.wustl.edu	37	18	70416292	70416292	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr18:70416292C>T	ENST00000327305.6	-	10	2230	c.1573G>A	c.(1573-1575)Gaa>Aaa	p.E525K	NETO1_ENST00000583169.1_Missense_Mutation_p.E525K|NETO1_ENST00000299430.2_Missense_Mutation_p.E524K|RNA5SP460_ENST00000516789.1_RNA	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	525					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TATTCAGATTCATGTTTGCTT	0.348																																						dbGAP											0													251.0	212.0	225.0					18																	70416292		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1573G>A	18.37:g.70416292C>T	ENSP00000313088:p.Glu525Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.E525K	ENST00000327305.6	37	c.1573	CCDS12000.1	18	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661233	0.88154	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.27720	1.65;1.65	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000018	T	0.43853	0.1266	L	0.51422	1.61	0.80722	D	1	P;P	0.50156	0.932;0.888	P;P	0.50970	0.655;0.453	T	0.33828	-0.9853	10	0.87932	D	0	-21.9871	19.6075	0.95586	0.0:1.0:0.0:0.0	.	524;525	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	K	525;524	ENSP00000313088:E525K;ENSP00000299430:E524K	ENSP00000299430:E524K	E	-	1	0	NETO1	68567272	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.452000	0.80683	2.640000	0.89533	0.585000	0.79938	GAA	NETO1	-	NULL	ENSG00000166342		0.348	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	230	0.00	0	C	NM_138999		70416292	70416292	-1	no_errors	ENST00000327305	ensembl	human	known	69_37n	missense	240	22.58	70	SNP	1.000	T
NF1	4763	genome.wustl.edu	37	17	29576081	29576081	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:29576081A>G	ENST00000358273.4	+	30	4437	c.4054A>G	c.(4054-4056)Agt>Ggt	p.S1352G	NF1_ENST00000356175.3_Missense_Mutation_p.S1352G	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1352	Poly-Ser.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGCCATCATCAGTTCCTCCTC	0.388			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)											167.0	150.0	156.0					17																	29576081		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4054A>G	17.37:g.29576081A>G	ENSP00000351015:p.Ser1352Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.S1352G	ENST00000358273.4	37	c.4054	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	A	16.52	3.145515	0.57044	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.80393	-1.37;-1.37;-1.37	5.74	5.74	0.90152	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (4);	0.134314	0.64402	D	0.000002	T	0.75369	0.3840	L	0.41079	1.255	0.80722	D	1	B;B;B;B	0.12013	0.002;0.005;0.0;0.0	B;B;B;B	0.18871	0.006;0.023;0.0;0.012	T	0.70182	-0.4942	10	0.41790	T	0.15	.	16.3426	0.83092	1.0:0.0:0.0:0.0	.	1352;402;1352;1352	E1P657;Q59FX3;P21359-2;P21359	.;.;.;NF1_HUMAN	G	1352;1352;1018	ENSP00000351015:S1352G;ENSP00000348498:S1352G;ENSP00000389907:S1018G	ENSP00000348498:S1352G	S	+	1	0	NF1	26600207	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.678000	0.68153	2.317000	0.78254	0.460000	0.39030	AGT	NF1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,smart_RasGAP,pfscan_RasGAP	ENSG00000196712		0.388	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	184	0.00	0	A	NM_000267		29576081	29576081	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	missense	215	25.26	73	SNP	1.000	G
NMNAT1	64802	genome.wustl.edu	37	1	10042669	10042669	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:10042669G>T	ENST00000377205.1	+	5	894	c.750G>T	c.(748-750)aaG>aaT	p.K250N	RP11-807G9.2_ENST00000413148.1_RNA	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	250					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		ACATTGAAAAGCATAATTTGT	0.463																																						dbGAP											0													51.0	52.0	51.0					1																	10042669		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.750G>T	1.37:g.10042669G>T	ENSP00000366410:p.Lys250Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	pfam_Cytidylyltransf,tigrfam_NAMN_adtrnsfrase	p.K250N	ENST00000377205.1	37	c.750	CCDS108.1	1	.	.	.	.	.	.	.	.	.	.	G	7.201	0.593392	0.13875	.	.	ENSG00000173614	ENST00000377205	D	0.97850	-4.57	5.01	4.09	0.47781	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.297730	0.36815	N	0.002381	D	0.95522	0.8545	M	0.65975	2.015	0.35648	D	0.811559	B	0.14805	0.011	B	0.19391	0.025	D	0.93558	0.6892	10	0.33141	T	0.24	-6.7456	6.2935	0.21073	0.1192:0.0:0.5954:0.2854	.	250	Q9HAN9	NMNA1_HUMAN	N	250	ENSP00000366410:K250N	ENSP00000366410:K250N	K	+	3	2	NMNAT1	9965256	0.998000	0.40836	0.656000	0.29637	0.398000	0.30690	0.793000	0.26944	1.228000	0.43614	-0.475000	0.04921	AAG	NMNAT1	-	tigrfam_NAMN_adtrnsfrase	ENSG00000173614		0.463	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT1	HGNC	protein_coding	OTTHUMT00000005029.1	55	0.00	0	G			10042669	10042669	+1	no_errors	ENST00000377205	ensembl	human	known	69_37n	missense	74	41.27	52	SNP	0.996	T
NID1	4811	genome.wustl.edu	37	1	236211995	236211995	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:236211995C>G	ENST00000264187.6	-	2	602	c.520G>C	c.(520-522)Ggc>Cgc	p.G174R	NID1_ENST00000366595.3_Missense_Mutation_p.G174R	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	174	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CTTACCTTGCCTTTCTGGTCT	0.547																																						dbGAP											0													83.0	64.0	70.0					1																	236211995		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.520G>C	1.37:g.236211995C>G	ENSP00000264187:p.Gly174Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd,smart_EGF-like,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.G174R	ENST00000264187.6	37	c.520	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	C	8.790	0.930326	0.18131	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.21734	1.99;1.99	4.66	3.72	0.42706	Nidogen, extracellular domain (2);	0.544586	0.22611	N	0.057835	T	0.30727	0.0774	L	0.52759	1.655	0.27022	N	0.964447	D;B	0.67145	0.996;0.037	P;B	0.62184	0.899;0.011	T	0.05517	-1.0880	10	0.15952	T	0.53	.	9.7832	0.40660	0.0:0.8406:0.0:0.1594	.	174;174	P14543-2;P14543	.;NID1_HUMAN	R	174	ENSP00000264187:G174R;ENSP00000355554:G174R	ENSP00000264187:G174R	G	-	1	0	NID1	234278618	0.738000	0.28186	1.000000	0.80357	0.637000	0.38172	0.553000	0.23391	2.425000	0.82216	0.655000	0.94253	GGC	NID1	-	smart_Nidogen_extracell_dom	ENSG00000116962		0.547	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	31	0.00	0	C	NM_002508		236211995	236211995	-1	no_errors	ENST00000264187	ensembl	human	known	69_37n	missense	42	30.00	18	SNP	1.000	G
NOX4	50507	genome.wustl.edu	37	11	89073285	89073285	+	Silent	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:89073285T>C	ENST00000263317.4	-	15	1630	c.1392A>G	c.(1390-1392)agA>agG	p.R464R	NOX4_ENST00000424319.1_Silent_p.R440R|NOX4_ENST00000413594.2_Silent_p.R485R|NOX4_ENST00000535633.1_Silent_p.R440R|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000343727.5_Silent_p.R440R|NOX4_ENST00000531342.1_Silent_p.R117R|NOX4_ENST00000375979.3_Silent_p.R157R|NOX4_ENST00000534731.1_Silent_p.R424R|NOX4_ENST00000525196.1_Silent_p.R228R|NOX4_ENST00000542487.1_Silent_p.R440R|NOX4_ENST00000527956.1_Silent_p.R440R|NOX4_ENST00000532825.1_Silent_p.R400R|NOX4_ENST00000528341.1_Silent_p.R439R			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	464	Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ACTGGATATCTCTGCATACCC	0.338																																						dbGAP											0													135.0	133.0	134.0					11																	89073285		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1392A>G	11.37:g.89073285T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.R485	ENST00000263317.4	37	c.1455	CCDS8285.1	11																																																																																			NOX4	-	pfam_Fe_red_NAD-bd_6	ENSG00000086991		0.338	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	187	0.00	0	T	NM_016931		89073285	89073285	-1	no_errors	ENST00000413594	ensembl	human	known	69_37n	silent	144	41.13	102	SNP	1.000	C
NT5C3B	115024	genome.wustl.edu	37	17	39988648	39988648	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr17:39988648C>G	ENST00000435506.2	-	5	379	c.310G>C	c.(310-312)Gaa>Caa	p.E104Q	NT5C3B_ENST00000521789.1_Missense_Mutation_p.E71Q|NT5C3B_ENST00000269534.8_Missense_Mutation_p.E96Q			Q969T7	5NT3B_HUMAN	5'-nucleotidase, cytosolic IIIB	104					nucleotide metabolic process (GO:0009117)	cytoplasm (GO:0005737)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										ACTCACCATTCCACCATATGA	0.527																																						dbGAP											0													178.0	131.0	147.0					17																	39988648		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11410.1, CCDS11410.2	17q21.2	2013-01-31	2013-01-31	2013-01-31	ENSG00000141698	ENSG00000141698	3.1.3.5		28300	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic III-like"""	NT5C3L		23223233	Standard	NM_052935		Approved	MGC20781	uc021txo.1	Q969T7	OTTHUMG00000133499	ENST00000435506.2:c.310G>C	17.37:g.39988648C>G	ENSP00000389948:p.Glu104Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWB9|C9JKC4|Q7L3B7	Missense_Mutation	SNP	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	p.E96Q	ENST00000435506.2	37	c.286	CCDS11410.2	17	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101094	0.56183	.	.	ENSG00000141698	ENST00000269534;ENST00000521789;ENST00000393911;ENST00000435506;ENST00000415460	D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02	5.5	4.51	0.55191	HAD-like domain (1);	0.053204	0.64402	N	0.000001	D	0.87216	0.6122	M	0.84326	2.69	0.58432	D	0.999998	B;P;B	0.36483	0.008;0.555;0.008	B;B;B	0.38921	0.019;0.285;0.019	D	0.87643	0.2523	10	0.54805	T	0.06	.	15.6601	0.77178	0.0:0.8574:0.1426:0.0	.	104;71;96	C9JKC4;E5RH64;Q969T7	.;.;5NT3L_HUMAN	Q	96;71;138;104;104	ENSP00000269534:E96Q;ENSP00000429878:E71Q;ENSP00000389948:E104Q;ENSP00000397742:E104Q	ENSP00000269534:E96Q	E	-	1	0	NT5C3L	37242174	1.000000	0.71417	0.958000	0.39756	0.664000	0.39144	6.029000	0.70895	1.290000	0.44636	0.456000	0.33151	GAA	NT5C3L	-	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	ENSG00000141698		0.527	NT5C3B-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NT5C3L	HGNC	protein_coding	OTTHUMT00000257430.2	26	0.00	0	C	NM_052935		39988648	39988648	-1	no_errors	ENST00000269534	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	1.000	G
OR8B12	219858	genome.wustl.edu	37	11	124412711	124412711	+	Silent	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr11:124412711T>A	ENST00000306842.2	-	1	864	c.840A>T	c.(838-840)atA>atT	p.I280I		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		ACACGGGGACTATTATGGTAT	0.428																																						dbGAP											0													78.0	76.0	77.0					11																	124412711		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.840A>T	11.37:g.124412711T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNF6|Q6IEW8|Q96RC7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I280	ENST00000306842.2	37	c.840	CCDS31711.1	11																																																																																			OR8B12	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000170953		0.428	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B12	HGNC	protein_coding	OTTHUMT00000387061.1	124	0.00	0	T			124412711	124412711	-1	no_errors	ENST00000306842	ensembl	human	known	69_37n	silent	123	21.52	34	SNP	0.006	A
OR9A4	130075	genome.wustl.edu	37	7	141618801	141618801	+	Silent	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:141618801A>T	ENST00000548136.1	+	1	185	c.126A>T	c.(124-126)acA>acT	p.T42T	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					TGGGAAACACAGTCATCATCA	0.433																																						dbGAP											0													195.0	203.0	201.0					7																	141618801		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.126A>T	7.37:g.141618801A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGV6|Q6IFI4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T42	ENST00000548136.1	37	c.126	CCDS43661.1	7																																																																																			OR9A4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000258083		0.433	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9A4	HGNC	protein_coding	OTTHUMT00000350806.3	507	0.20	1	A	NM_001001656		141618801	141618801	+1	no_errors	ENST00000548136	ensembl	human	known	69_37n	silent	597	19.95	149	SNP	0.000	T
OTOGL	283310	genome.wustl.edu	37	12	80726854	80726854	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:80726854G>A	ENST00000547103.1	+	37	4361	c.4355G>A	c.(4354-4356)tGt>tAt	p.C1452Y	OTOGL_ENST00000458043.2_Missense_Mutation_p.C1464Y			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1452					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						GGCTTGGAATGTGAGGTATGA	0.353																																						dbGAP											0													89.0	84.0	86.0					12																	80726854		1900	4120	6020	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4355G>A	12.37:g.80726854G>A	ENSP00000447211:p.Cys1452Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.C1464Y	ENST00000547103.1	37	c.4391		12	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429453	0.43122	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.16743	2.32;2.4	4.78	4.78	0.61160	.	.	.	.	.	T	0.21387	0.0515	L	0.49778	1.585	0.33836	D	0.630902	.	.	.	.	.	.	T	0.02553	-1.1142	7	0.09084	T	0.74	.	13.6287	0.62183	0.0:0.0:1.0:0.0	.	.	.	.	Y	1452;1464	ENSP00000447211:C1452Y;ENSP00000400895:C1464Y	ENSP00000400895:C1464Y	C	+	2	0	OTOGL	79250985	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.817000	0.55668	2.937000	0.99478	0.650000	0.86243	TGT	OTOGL	-	NULL	ENSG00000165899		0.353	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	16	0.00	0	G	NM_173591		80726854	80726854	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	A
PCDHB12	56124	genome.wustl.edu	37	5	140588975	140588976	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G|C	G|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:140588975_140588976GC>TT	ENST00000239450.2	+	1	685_686	c.496_497GC>TT	c.(496-498)GCt>TTt	p.A166F	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	166	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGAATCAATGCTGTAAAAAGC	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	Exception_encountered	5.37:g.140588975_140588976delinsTT	ENSP00000239450:p.Ala166Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A166S|p.A166V	ENST00000239450.2	37	c.496|c.497	CCDS4254.1	5																																																																																			PCDHB12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120328		0.391	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	169|170	0.00	0	G|C	NM_018932		140588975|140588976	140588975|140588976	+1	no_errors	ENST00000239450	ensembl	human	known	69_37n	missense	99|97	18.85|19.17	23	SNP	0.000	T
PCDHGB3	56102	genome.wustl.edu	37	5	140750980	140750980	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:140750980A>T	ENST00000576222.1	+	1	1150	c.1019A>T	c.(1018-1020)gAa>gTa	p.E340V	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	340	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTCAGATGAAAATGACAAT	0.443																																						dbGAP											0													63.0	63.0	63.0					5																	140750980		1922	4136	6058	-	-	-	SO:0001583	missense	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1019A>T	5.37:g.140750980A>T	ENSP00000461862:p.Glu340Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E340V	ENST00000576222.1	37	c.1019	CCDS58980.1	5																																																																																			PCDHGB3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000262209		0.443	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	114	0.00	0	A	NM_018924		140750980	140750980	+1	no_errors	ENST00000576222	ensembl	human	known	69_37n	missense	63	23.17	19	SNP	0.997	T
PCDHGA6	56109	genome.wustl.edu	37	5	140755396	140755396	+	Silent	SNP	A	A	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:140755396A>C	ENST00000517434.1	+	1	1746	c.1746A>C	c.(1744-1746)gcA>gcC	p.A582A	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	582	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGCTCCGCAGAGCCCGGCT	0.672																																						dbGAP											0													71.0	87.0	81.0					5																	140755396		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1746A>C	5.37:g.140755396A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A582	ENST00000517434.1	37	c.1746	CCDS54926.1	5																																																																																			PCDHGA6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253731		0.672	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	72	0.00	0	A	NM_018919		140755396	140755396	+1	no_errors	ENST00000517434	ensembl	human	known	69_37n	silent	36	18.18	8	SNP	0.998	C
PCLO	27445	genome.wustl.edu	37	7	82545243	82545243	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:82545243C>A	ENST00000333891.9	-	7	12396	c.12059G>T	c.(12058-12060)aGc>aTc	p.S4020I	PCLO_ENST00000423517.2_Missense_Mutation_p.S4020I|PCLO_ENST00000437081.1_Missense_Mutation_p.S740I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCTTGCCATGCTACTTCTTTC	0.383																																						dbGAP											0													225.0	210.0	214.0					7																	82545243		1931	4141	6072	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12059G>T	7.37:g.82545243C>A	ENSP00000334319:p.Ser4020Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.S4020I	ENST00000333891.9	37	c.12059	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	18.28	3.588471	0.66105	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.21543	2.0;2.0	5.85	5.85	0.93711	.	.	.	.	.	T	0.47655	0.1457	M	0.68593	2.085	0.80722	D	1	P;D;D	0.76494	0.943;0.999;0.999	P;D;D	0.69142	0.69;0.962;0.962	T	0.38457	-0.9660	9	0.87932	D	0	.	20.1542	0.98100	0.0:1.0:0.0:0.0	.	3951;4020;4020	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	I	4020;4020;740	ENSP00000334319:S4020I;ENSP00000388393:S4020I	ENSP00000334319:S4020I	S	-	2	0	PCLO	82383179	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.087000	0.71362	2.767000	0.95098	0.563000	0.77884	AGC	PCLO	-	NULL	ENSG00000186472		0.383	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	287	0.00	0	C	NM_014510		82545243	82545243	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	266	36.67	154	SNP	1.000	A
PENK	5179	genome.wustl.edu	37	8	57354286	57354286	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:57354286G>T	ENST00000314922.3	-	2	425	c.349C>A	c.(349-351)Ctt>Att	p.L117I	PENK_ENST00000451791.2_Missense_Mutation_p.L117I|PENK_ENST00000523274.1_5'UTR	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	117					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			ATGGGATAAAGCTCATCCATT	0.493																																						dbGAP											0													113.0	99.0	104.0					8																	57354286		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.349C>A	8.37:g.57354286G>T	ENSP00000324248:p.Leu117Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	pfam_Opioid_neupept,prints_Proenkphlin_A,prints_Opioid_neupept	p.L117I	ENST00000314922.3	37	c.349	CCDS6168.1	8	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453775	0.43531	.	.	ENSG00000181195	ENST00000539312;ENST00000314922;ENST00000451791	T;T	0.28895	1.59;1.59	5.98	5.1	0.69264	.	0.278896	0.34879	N	0.003608	T	0.26774	0.0655	L	0.52573	1.65	0.80722	D	1	P	0.45176	0.852	B	0.38985	0.287	T	0.03576	-1.1023	10	0.35671	T	0.21	-5.22	10.3987	0.44216	0.148:0.0:0.852:0.0	.	117	P01210	PENK_HUMAN	I	117	ENSP00000324248:L117I;ENSP00000400894:L117I	ENSP00000324248:L117I	L	-	1	0	PENK	57516840	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	2.206000	0.42779	1.532000	0.49169	0.655000	0.94253	CTT	PENK	-	prints_Proenkphlin_A	ENSG00000181195		0.493	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	HGNC	protein_coding	OTTHUMT00000378645.1	144	0.00	0	G			57354286	57354286	-1	no_errors	ENST00000314922	ensembl	human	known	69_37n	missense	92	38.67	58	SNP	1.000	T
PGAP1	80055	genome.wustl.edu	37	2	197710731	197710731	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:197710731G>A	ENST00000354764.4	-	23	2275	c.2161C>T	c.(2161-2163)Ctt>Ttt	p.L721F		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	721					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						TCTTTAGGAAGTTCAGAGGGT	0.318																																						dbGAP											0													69.0	67.0	67.0					2																	197710731		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2161C>T	2.37:g.197710731G>A	ENSP00000346809:p.Leu721Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	pfam_PGAP1-like	p.L721F	ENST00000354764.4	37	c.2161	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018258	0.35606	.	.	ENSG00000197121	ENST00000354764	.	.	.	5.37	4.43	0.53597	.	0.472556	0.22341	N	0.061321	T	0.34948	0.0915	N	0.12182	0.205	0.80722	D	1	P	0.43477	0.808	B	0.42851	0.4	T	0.08452	-1.0721	9	0.09590	T	0.72	-20.447	14.9148	0.70789	0.0:0.0:0.8481:0.1519	.	721	Q75T13	PGAP1_HUMAN	F	721	.	ENSP00000346809:L721F	L	-	1	0	PGAP1	197418976	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.363000	0.59473	2.798000	0.96311	0.650000	0.86243	CTT	PGAP1	-	NULL	ENSG00000197121		0.318	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	HGNC	protein_coding	OTTHUMT00000256103.5	88	0.00	0	G	NM_024989		197710731	197710731	-1	no_errors	ENST00000354764	ensembl	human	known	69_37n	missense	163	16.84	33	SNP	1.000	A
HOGA1	112817	genome.wustl.edu	37	10	99361620	99361621	+	Frame_Shift_Ins	INS	-	-	G	rs61731946	byFrequency	TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:99361620_99361621insG	ENST00000370646.4	+	6	1068_1069	c.707_708insG	c.(706-711)gtggggfs	p.VG236fs	PI4K2A_ENST00000555577.1_Frame_Shift_Ins_p.VG73fs|HOGA1_ENST00000370647.4_Frame_Shift_Ins_p.VG73fs|PI4K2A_ENST00000370649.3_Frame_Shift_Ins_p.VG73fs	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	236					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						GCAGGAGCTGTGGGGGGCGTCT	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.713dupG	10.37:g.99361626_99361626dupG	ENSP00000359680:p.Val236fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Frame_Shift_Ins	INS	pfam_PI3/4_kinase_cat_dom	p.V76fs	ENST00000370646.4	37	c.218_219	CCDS7467.1	10																																																																																			PI4K2A	-	NULL	ENSG00000155252		0.634	HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PI4K2A	HGNC	protein_coding	OTTHUMT00000049726.1	23	0.00	0	-	NM_138413		99361620	99361621	+1	no_errors	ENST00000555577	ensembl	human	known	69_37n	frame_shift_ins	13	18.75	3	INS	1.000:0.996	G
PIH1D3	139212	genome.wustl.edu	37	X	106486492	106486492	+	Silent	SNP	T	T	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chrX:106486492T>G	ENST00000372453.3	+	7	671	c.609T>G	c.(607-609)acT>acG	p.T203T	PIH1D3_ENST00000535523.1_Silent_p.T203T|PIH1D3_ENST00000336387.4_Silent_p.T203T	NM_173494.1	NP_775765.1	Q9NQM4	PIHD3_HUMAN	PIH1 domain containing 3	203																	TCACTATGACTATGAAAAGAG	0.328																																						dbGAP											0													117.0	115.0	116.0					X																	106486492		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AL136112	CCDS14528.1	Xq22.3	2014-05-20	2012-07-18	2012-07-18	ENSG00000080572	ENSG00000080572			28570	protein-coding gene	gene with protein product	"""sarcoma antigen NY-SAR-97"""		"""chromosome X open reading frame 41"""	CXorf41		12601173, 24421334	Standard	NM_001169154		Approved	MGC35261, NYSAR97	uc004enc.3	Q9NQM4	OTTHUMG00000022160	ENST00000372453.3:c.609T>G	X.37:g.106486492T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUX5|Q86WE1	Silent	SNP	NULL	p.T203	ENST00000372453.3	37	c.609	CCDS14528.1	X																																																																																			PIH1D3	-	NULL	ENSG00000080572		0.328	PIH1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIH1D3	HGNC	protein_coding	OTTHUMT00000057832.1	202	0.00	0	T	NM_173494		106486492	106486492	+1	no_errors	ENST00000336387	ensembl	human	known	69_37n	silent	171	57.99	236	SNP	0.002	G
PIK3C2B	5287	genome.wustl.edu	37	1	204401416	204401416	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:204401416G>C	ENST00000367187.3	-	28	4623	c.4067C>G	c.(4066-4068)tCc>tGc	p.S1356C	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.S1328C|RP11-739N20.2_ENST00000443515.1_RNA	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1356					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GTGTGTTCGGGAGGCAAAGGA	0.502																																						dbGAP											0													122.0	117.0	119.0					1																	204401416		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4067C>G	1.37:g.204401416G>C	ENSP00000356155:p.Ser1356Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.S1356C	ENST00000367187.3	37	c.4067	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	g	22.7	4.326122	0.81580	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.61040	0.14;0.22	6.07	6.07	0.98685	.	0.054097	0.85682	D	0.000000	T	0.52725	0.1752	N	0.08118	0	0.43830	D	0.996405	B;B	0.32425	0.176;0.371	P;B	0.44477	0.451;0.215	T	0.59032	-0.7530	10	0.87932	D	0	.	20.2436	0.98387	0.0:0.0:1.0:0.0	.	1328;1356	F5GWN5;O00750	.;P3C2B_HUMAN	C	1356;1328	ENSP00000356155:S1356C;ENSP00000400561:S1328C	ENSP00000356155:S1356C	S	-	2	0	PIK3C2B	202668039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.891000	0.99171	0.651000	0.88453	TCC	PIK3C2B	-	NULL	ENSG00000133056		0.502	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	88	0.00	0	G	NM_002646		204401416	204401416	-1	no_errors	ENST00000367187	ensembl	human	known	69_37n	missense	167	32.39	80	SNP	1.000	C
PIWIL1	9271	genome.wustl.edu	37	12	130839517	130839517	+	Missense_Mutation	SNP	G	G	A	rs138419869		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:130839517G>A	ENST00000245255.3	+	11	1528	c.1256G>A	c.(1255-1257)cGt>cAt	p.R419H		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	419					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CAAAGGCAGCGTGAAGTGGGA	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		19068	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													197.0	185.0	189.0					12																	130839517		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1256G>A	12.37:g.130839517G>A	ENSP00000245255:p.Arg419His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R419H	ENST00000245255.3	37	c.1256	CCDS9268.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	7.859	0.725640	0.15439	.	.	ENSG00000125207	ENST00000245255	T	0.14391	2.51	5.38	5.38	0.77491	Argonaute/Dicer protein, PAZ (1);Ribonuclease H-like (1);	0.470777	0.24564	N	0.037444	T	0.12603	0.0306	N	0.19112	0.55	0.39431	D	0.967076	B;D	0.58268	0.0;0.982	B;P	0.49708	0.001;0.62	T	0.17167	-1.0378	10	0.13470	T	0.59	-30.6931	13.179	0.59642	0.0:0.0:0.8406:0.1594	.	419;419	Q96J94;Q96J94-2	PIWL1_HUMAN;.	H	419	ENSP00000245255:R419H	ENSP00000245255:R419H	R	+	2	0	PIWIL1	129405470	0.973000	0.33851	0.979000	0.43373	0.371000	0.29859	2.923000	0.48868	2.516000	0.84829	0.558000	0.71614	CGT	PIWIL1	-	superfamily_RNaseH-like_dom,superfamily_PAZ	ENSG00000125207		0.378	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	339	0.00	0	G			130839517	130839517	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	missense	580	14.96	102	SNP	0.907	A
PKD1L1	168507	genome.wustl.edu	37	7	47917120	47917120	+	Silent	SNP	G	G	A	rs145960512		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:47917120G>A	ENST00000289672.2	-	22	3680	c.3630C>T	c.(3628-3630)acC>acT	p.T1210T		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1210	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CACTGAAGACGGTGTGTGCTT	0.572																																						dbGAP											0													159.0	144.0	149.0					7																	47917120		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3630C>T	7.37:g.47917120G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Silent	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.T1210	ENST00000289672.2	37	c.3630	CCDS34633.1	7																																																																																			PKD1L1	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000158683		0.572	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	44	0.00	0	G	NM_138295		47917120	47917120	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	silent	58	36.96	34	SNP	0.544	A
PKD1L1	168507	genome.wustl.edu	37	7	47921626	47921626	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:47921626C>G	ENST00000289672.2	-	20	3373	c.3323G>C	c.(3322-3324)gGa>gCa	p.G1108A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1108	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ATCCCCATCTCCAGGGCTCTC	0.537																																						dbGAP											0													82.0	72.0	75.0					7																	47921626		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3323G>C	7.37:g.47921626C>G	ENSP00000289672:p.Gly1108Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.G1108A	ENST00000289672.2	37	c.3323	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648795	0.29336	.	.	ENSG00000158683	ENST00000289672	T	0.19938	2.11	5.54	2.37	0.29283	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	0.943032	0.08914	N	0.875424	T	0.16642	0.0400	L	0.38531	1.155	0.09310	N	1	P	0.40144	0.704	B	0.39217	0.294	T	0.19224	-1.0312	10	0.44086	T	0.13	-2.4989	5.3427	0.15992	0.0:0.6048:0.0:0.3952	.	1108	Q8TDX9	PK1L1_HUMAN	A	1108	ENSP00000289672:G1108A	ENSP00000289672:G1108A	G	-	2	0	PKD1L1	47888151	0.006000	0.16342	0.003000	0.11579	0.189000	0.23516	1.071000	0.30666	0.710000	0.31997	0.650000	0.86243	GGA	PKD1L1	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000158683		0.537	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	30	0.00	0	C	NM_138295		47921626	47921626	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	71	12.35	10	SNP	0.002	G
PKD1L2	114780	genome.wustl.edu	37	16	81232281	81232281	+	RNA	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:81232281G>A	ENST00000525539.1	-	0	1528				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AACCGGAACAGCCAGGCGGCA	0.582																																						dbGAP											0													48.0	49.0	49.0					16																	81232281		2002	4156	6158	-	-	-			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81232281G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	pfam_Lectin_gal-bd_dom,pfam_C-type_lectin,pfam_PKD/REJ-like,superfamily_C-type_lectin_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_PKD_dom,smart_C-type_lectin,pfscan_C-type_lectin,pfscan_Lectin_gal-bd_dom,pfscan_REJ-like	p.A510V	ENST00000525539.1	37	c.1529		16	.	.	.	.	.	.	.	.	.	.	G	10.76	1.439717	0.25900	.	.	ENSG00000166473	ENST00000337114	T	0.01323	5.01	5.08	3.13	0.36017	Egg jelly receptor, REJ-like (1);	0.210842	0.39759	N	0.001265	T	0.01523	0.0049	.	.	.	0.09310	N	1	P;P	0.38078	0.617;0.555	B;B	0.33960	0.173;0.171	T	0.47886	-0.9082	9	0.56958	D	0.05	-10.8249	10.9679	0.47422	0.1509:0.0:0.8491:0.0	.	510;510	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	V	510	ENSP00000337397:A510V	ENSP00000337397:A510V	A	-	2	0	PKD1L2	79789782	0.989000	0.36119	0.045000	0.18777	0.008000	0.06430	2.335000	0.43929	0.558000	0.29135	0.549000	0.68633	GCT	PKD1L2	-	pfscan_REJ-like	ENSG00000166473		0.582	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387972.2	30	0.00	0	G			81232281	81232281	-1	no_errors	ENST00000337114	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.197	A
PLAT	5327	genome.wustl.edu	37	8	42050632	42050632	+	Splice_Site	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:42050632C>G	ENST00000220809.4	-	2	328	c.72G>C	c.(70-72)caG>caC	p.Q24H	PLAT_ENST00000270189.6_Splice_Site_p.Q24H|PLAT_ENST00000429710.2_Splice_Site_p.Q24H|PLAT_ENST00000524009.1_Splice_Site_p.Q24H|PLAT_ENST00000519510.1_Splice_Site_p.Q24H|PLAT_ENST00000429089.2_Splice_Site_p.Q24H|PLAT_ENST00000352041.3_Splice_Site_p.Q24H	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	24					blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	GCACACCAACCTGGCTGGGCG	0.582																																						dbGAP											0													147.0	119.0	128.0					8																	42050632		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.72+1G>C	8.37:g.42050632C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Kringle,pfam_Fibronectin_type1,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1_S6,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Q24H	ENST00000220809.4	37	c.72	CCDS6126.1	8	.	.	.	.	.	.	.	.	.	.	C	20.8	4.058134	0.76074	.	.	ENSG00000104368	ENST00000270189;ENST00000429089;ENST00000220809;ENST00000352041;ENST00000519510;ENST00000429710;ENST00000524009;ENST00000520523;ENST00000521694	T;D;D;D;D;D;D;T;T	0.89746	-0.79;-2.27;-2.27;-2.56;-2.37;-2.41;-2.33;-1.18;-1.25	4.04	4.04	0.47022	.	0.357658	0.30051	N	0.010535	D	0.93128	0.7812	M	0.72894	2.215	0.37674	D	0.923225	D;D;D;P;P	0.76494	0.999;0.999;0.999;0.931;0.954	D;D;D;P;P	0.75484	0.972;0.972;0.986;0.77;0.647	D	0.93780	0.7083	9	.	.	.	.	14.0404	0.64672	0.0:1.0:0.0:0.0	.	24;24;24;24;24	B4DNJ1;B4DN26;B4DV92;P00750-3;P00750	.;.;.;.;TPA_HUMAN	H	24	ENSP00000270189:Q24H;ENSP00000392045:Q24H;ENSP00000220809:Q24H;ENSP00000270188:Q24H;ENSP00000428886:Q24H;ENSP00000407861:Q24H;ENSP00000429401:Q24H;ENSP00000428797:Q24H;ENSP00000429801:Q24H	.	Q	-	3	2	PLAT	42169789	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	3.523000	0.53488	2.538000	0.85594	0.655000	0.94253	CAG	PLAT	-	NULL	ENSG00000104368		0.582	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAT	HGNC	protein_coding	OTTHUMT00000377100.1	22	0.00	0	C	NM_000930	Missense_Mutation	42050632	42050632	-1	no_errors	ENST00000220809	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	1.000	G
PLCB2	5330	genome.wustl.edu	37	15	40589083	40589083	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr15:40589083G>T	ENST00000260402.3	-	14	1599	c.1350C>A	c.(1348-1350)agC>agA	p.S450R	PLCB2_ENST00000557821.1_Missense_Mutation_p.S450R|PLCB2_ENST00000456256.2_Missense_Mutation_p.S450R	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	450	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GATCCTCAGGGCTGGGCAGGG	0.547																																						dbGAP											0													81.0	83.0	82.0					15																	40589083		1992	4165	6157	-	-	-	SO:0001583	missense	0				CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1350C>A	15.37:g.40589083G>T	ENSP00000260402:p.Ser450Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J2|B9EGH5	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLC-beta_C,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.S450R	ENST00000260402.3	37	c.1350	CCDS42020.1	15	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343392	0.41498	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.60040	0.22;0.22	4.55	0.595	0.17490	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	T	0.75503	0.3858	M	0.90019	3.08	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.993;1.0	T	0.75331	-0.3355	10	0.72032	D	0.01	.	8.3182	0.32113	0.4784:0.0:0.5216:0.0	.	450;450;450	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	R	450	ENSP00000260402:S450R;ENSP00000411991:S450R	ENSP00000260402:S450R	S	-	3	2	PLCB2	38376375	1.000000	0.71417	0.998000	0.56505	0.251000	0.25915	0.740000	0.26188	0.266000	0.21894	0.655000	0.94253	AGC	PLCB2	-	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000137841		0.547	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	HGNC	protein_coding	OTTHUMT00000418430.1	43	0.00	0	G			40589083	40589083	-1	no_errors	ENST00000260402	ensembl	human	known	69_37n	missense	34	33.96	18	SNP	0.996	T
PLCL2	23228	genome.wustl.edu	37	3	17052777	17052777	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:17052777T>C	ENST00000418129.2	+	2	2026	c.1561T>C	c.(1561-1563)Tcc>Ccc	p.S521P	PLCL2_ENST00000396755.2_Missense_Mutation_p.S521P|PLCL2_ENST00000432376.1_Missense_Mutation_p.S521P	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	647	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						GGAAGTCTGTTCCTTTAATGA	0.413																																						dbGAP											0													101.0	106.0	105.0					3																	17052777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1561T>C	3.37:g.17052777T>C	ENSP00000409637:p.Ser521Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.S521P	ENST00000418129.2	37	c.1561	CCDS33713.1	3	.	.	.	.	.	.	.	.	.	.	T	15.45	2.836126	0.50951	.	.	ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	T;T;T	0.78595	-1.19;-1.19;-1.19	5.63	5.63	0.86233	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.112118	0.64402	D	0.000006	D	0.88507	0.6455	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90068	0.4161	9	0.87932	D	0	.	15.8536	0.78956	0.0:0.0:0.0:1.0	.	647	Q9UPR0	PLCL2_HUMAN	P	521;648;521;521	ENSP00000409637:S521P;ENSP00000379979:S521P;ENSP00000412836:S521P	ENSP00000285094:S648P	S	+	1	0	PLCL2	17027781	1.000000	0.71417	0.370000	0.25965	0.503000	0.33858	8.040000	0.89188	2.149000	0.67028	0.528000	0.53228	TCC	PLCL2	-	pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pfscan_PLipase_C_Pinositol-sp_Y	ENSG00000154822		0.413	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	167	0.00	0	T			17052777	17052777	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	missense	126	27.17	47	SNP	1.000	C
PLEKHG4B	153478	genome.wustl.edu	37	5	151657	151657	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:151657C>T	ENST00000283426.6	+	5	917	c.867C>T	c.(865-867)atC>atT	p.I289I		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	289							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TTCATAGTATCTTGCTGTTGG	0.308																																						dbGAP											0													73.0	71.0	71.0					5																	151657		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.867C>T	5.37:g.151657C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.I289	ENST00000283426.6	37	c.867	CCDS34124.1	5																																																																																			PLEKHG4B	-	superfamily_CRAL-TRIO_dom	ENSG00000153404		0.308	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4B	HGNC	protein_coding	OTTHUMT00000365359.1	55	0.00	0	C	NM_052909		151657	151657	+1	no_errors	ENST00000283426	ensembl	human	known	69_37n	silent	191	19.41	46	SNP	0.079	T
PLOD2	5352	genome.wustl.edu	37	3	145794677	145794677	+	Silent	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:145794677T>A	ENST00000360060.3	-	14	1683	c.1506A>T	c.(1504-1506)gtA>gtT	p.V502V	PLOD2_ENST00000282903.5_Silent_p.V523V|PLOD2_ENST00000494950.1_Silent_p.V468V|PLOD2_ENST00000461497.1_Silent_p.V183V|RP11-274H2.2_ENST00000480247.1_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	502					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	TGTACATAAATACACCCTATA	0.279																																						dbGAP											0													65.0	69.0	68.0					3																	145794677		2202	4287	6489	-	-	-	SO:0001819	synonymous_variant	0			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1506A>T	3.37:g.145794677T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWS3|Q59ED2|Q8N170	Silent	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.V523	ENST00000360060.3	37	c.1569	CCDS3131.1	3																																																																																			PLOD2	-	NULL	ENSG00000152952		0.279	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD2	HGNC	protein_coding	OTTHUMT00000355185.1	150	0.00	0	T	NM_000935		145794677	145794677	-1	no_errors	ENST00000282903	ensembl	human	known	69_37n	silent	167	16.50	33	SNP	0.975	A
PLXNA4	91584	genome.wustl.edu	37	7	131982949	131982949	+	Silent	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:131982949G>T	ENST00000359827.3	-	4	2366	c.1404C>A	c.(1402-1404)ctC>ctA	p.L468L	PLXNA4_ENST00000321063.4_Silent_p.L468L			Q9HCM2	PLXA4_HUMAN	plexin A4	468	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TCTCATACTGGAGGGCGTTGC	0.592																																						dbGAP											0													64.0	69.0	67.0					7																	131982949		1998	4158	6156	-	-	-	SO:0001819	synonymous_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1404C>A	7.37:g.131982949G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.L468	ENST00000359827.3	37	c.1404	CCDS43646.1	7																																																																																			PLXNA4	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000221866		0.592	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	42	0.00	0	G	NM_181775		131982949	131982949	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	silent	61	16.44	12	SNP	0.967	T
PMS1	5378	genome.wustl.edu	37	2	190728500	190728500	+	Missense_Mutation	SNP	C	C	G	rs139932286		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:190728500C>G	ENST00000441310.2	+	10	2121	c.1888C>G	c.(1888-1890)Cga>Gga	p.R630G	PMS1_ENST00000432292.3_Missense_Mutation_p.R454G|PMS1_ENST00000447232.2_Intron|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000418224.3_Missense_Mutation_p.R454G|PMS1_ENST00000409823.3_Missense_Mutation_p.R591G	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	630					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AGACTTGGAACGATACAATAG	0.333			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0													89.0	98.0	95.0					2																	190728500		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.1888C>G	2.37:g.190728500C>G	ENSP00000406490:p.Arg630Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_superfamily,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,tigrfam_DNA_mismatch_repair_N	p.R630G	ENST00000441310.2	37	c.1888	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151878	0.57151	.	.	ENSG00000064933	ENST00000392338;ENST00000441310;ENST00000418224;ENST00000409823;ENST00000432292;ENST00000424307;ENST00000452382	D;D;D;D;D;T	0.98234	-4.81;-4.81;-4.81;-4.81;-4.81;1.45	5.49	3.63	0.41609	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.711393	0.14201	N	0.334710	D	0.98937	0.9639	M	0.87827	2.91	0.36364	D	0.860882	D;D;D;D	0.76494	0.999;0.994;0.999;0.999	D;D;D;D	0.72338	0.976;0.941;0.977;0.976	D	0.99897	1.1149	10	0.66056	D	0.02	-3.7195	13.6778	0.62465	0.4261:0.5739:0.0:0.0	.	630;591;591;630	Q4VAL4;Q5FBZ9;Q5FBZ3;P54277	.;.;.;PMS1_HUMAN	G	454;630;454;591;454;569;18	ENSP00000406490:R630G;ENSP00000404492:R454G;ENSP00000387125:R591G;ENSP00000398378:R454G;ENSP00000389938:R569G;ENSP00000396232:R18G	ENSP00000376149:R454G	R	+	1	2	PMS1	190436745	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	1.788000	0.38714	0.797000	0.33971	0.650000	0.86243	CGA	PMS1	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000064933		0.333	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	338	0.00	0	C			190728500	190728500	+1	no_errors	ENST00000441310	ensembl	human	known	69_37n	missense	482	18.58	110	SNP	0.999	G
POTEG	404785	genome.wustl.edu	37	14	19558994	19558994	+	Missense_Mutation	SNP	G	G	A	rs138773680		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr14:19558994G>A	ENST00000409832.3	+	3	692	c.640G>A	c.(640-642)Gta>Ata	p.V214I		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	214										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CTGACAGGCCGTACAATGCCG	0.383																																						dbGAP											0													161.0	182.0	175.0					14																	19558994		1924	3884	5808	-	-	-	SO:0001583	missense	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.640G>A	14.37:g.19558994G>A	ENSP00000386971:p.Val214Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V214I	ENST00000409832.3	37	c.640	CCDS32018.1	14	.	.	.	.	.	.	.	.	.	.	g	7.950	0.744672	0.15710	.	.	ENSG00000222036	ENST00000409832	T	0.66638	-0.22	1.87	0.387	0.16259	Ankyrin repeat-containing domain (4);	0.710225	0.12028	N	0.506284	T	0.47710	0.1460	L	0.28694	0.88	0.20926	N	0.999823	B	0.18968	0.032	B	0.16289	0.015	T	0.29488	-1.0010	10	0.35671	T	0.21	.	4.2876	0.10862	0.3015:0.0:0.6985:0.0	.	214	Q6S5H5	POTEG_HUMAN	I	214	ENSP00000386971:V214I	ENSP00000386971:V214I	V	+	1	0	POTEG	18628994	0.882000	0.30256	0.041000	0.18516	0.038000	0.13279	1.019000	0.30014	0.095000	0.17434	0.184000	0.17185	GTA	POTEG	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000222036		0.383	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEG	HGNC	protein_coding	OTTHUMT00000408579.1	79	0.00	0	G	NM_001005356		19558994	19558994	+1	no_errors	ENST00000409832	ensembl	human	known	69_37n	missense	16	15.00	3	SNP	0.835	A
PPP2R2C	5522	genome.wustl.edu	37	4	6325179	6325179	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr4:6325179delC	ENST00000382599.4	-	9	1410	c.1194delG	c.(1192-1194)aagfs	p.K398fs	PPP2R2C_ENST00000515571.1_Frame_Shift_Del_p.K381fs|PPP2R2C_ENST00000335585.5_Frame_Shift_Del_p.K398fs|PPP2R2C_ENST00000506140.1_Frame_Shift_Del_p.K391fs|PPP2R2C_ENST00000507294.1_Frame_Shift_Del_p.K391fs			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	398					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						CACGCCGGCGCTTGCCCCCCA	0.642																																						dbGAP											0													97.0	83.0	88.0					4																	6325179		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.1194delG	4.37:g.6325179delC	ENSP00000372042:p.Lys398fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.K398fs	ENST00000382599.4	37	c.1194		4																																																																																			PPP2R2C	-	superfamily_WD40_repeat_dom,pirsf_PP2A_PR55	ENSG00000074211		0.642	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	PPP2R2C	HGNC	protein_coding	OTTHUMT00000206889.2	13	0.00	0	C	NM_181876		6325179	6325179	-1	no_errors	ENST00000335585	ensembl	human	known	69_37n	frame_shift_del	8	33.33	4	DEL	1.000	-
POU4F2	5458	genome.wustl.edu	37	4	147561487	147561487	+	Missense_Mutation	SNP	G	G	T	rs3827593		TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr4:147561487G>T	ENST00000281321.3	+	2	1005	c.757G>T	c.(757-759)Gcc>Tcc	p.A253S	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	253	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					CGACGTGGACGCCGACCCGCG	0.687																																						dbGAP											0													18.0	19.0	19.0					4																	147561487		2199	4297	6496	-	-	-	SO:0001583	missense	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.757G>T	4.37:g.147561487G>T	ENSP00000281321:p.Ala253Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.A253S	ENST00000281321.3	37	c.757	CCDS34074.1	4	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122406	0.37436	.	.	ENSG00000151615	ENST00000281321	D	0.83506	-1.73	5.42	5.42	0.78866	POU-specific (3);	0.101707	0.64402	D	0.000002	T	0.68869	0.3048	N	0.04880	-0.145	0.80722	D	1	B	0.29671	0.254	B	0.24701	0.055	T	0.67126	-0.5749	10	0.33940	T	0.23	.	18.841	0.92184	0.0:0.0:1.0:0.0	.	253	Q12837	PO4F2_HUMAN	S	253	ENSP00000281321:A253S	ENSP00000281321:A253S	A	+	1	0	POU4F2	147780937	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.510000	0.73729	2.561000	0.86390	0.462000	0.41574	GCC	POU4F2	-	pfam_POU_specific,smart_POU_specific,pfscan_POU_specific	ENSG00000151615		0.687	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	23	0.00	0	G	NM_004575		147561487	147561487	+1	no_errors	ENST00000281321	ensembl	human	known	69_37n	missense	6	62.50	10	SNP	1.000	T
PRDM2	7799	genome.wustl.edu	37	1	14108179	14108179	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:14108179A>T	ENST00000235372.7	+	8	4745	c.3889A>T	c.(3889-3891)Agc>Tgc	p.S1297C	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.S1096C|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.S1096C|PRDM2_ENST00000311066.5_Missense_Mutation_p.S1297C|PRDM2_ENST00000376048.5_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1297					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GCATTACCCAAGCTTTAAACC	0.418																																						dbGAP											0													136.0	140.0	138.0					1																	14108179		2203	4300	6503	-	-	-	SO:0001583	missense	0			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.3889A>T	1.37:g.14108179A>T	ENSP00000235372:p.Ser1297Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_RIZ_retinblastoma-bd_prot,pfscan_SET_dom,pfscan_Znf_C2H2	p.S1297C	ENST00000235372.7	37	c.3889	CCDS150.1	1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967435	0.74131	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.02323	4.45;4.34;4.34;4.34	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.09730	0.0239	L	0.32530	0.975	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	T	0.08027	-1.0742	10	0.62326	D	0.03	.	15.6462	0.77055	1.0:0.0:0.0:0.0	.	1155;1297;1297	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	C	1297;1297;1297;1096;1096	ENSP00000235372:S1297C;ENSP00000312352:S1297C;ENSP00000411103:S1096C;ENSP00000341621:S1096C	ENSP00000235372:S1297C	S	+	1	0	PRDM2	13980766	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.281000	0.95811	2.371000	0.80710	0.533000	0.62120	AGC	PRDM2	-	pirsf_RIZ_retinblastoma-bd_prot	ENSG00000116731		0.418	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM2	HGNC	protein_coding	OTTHUMT00000021792.2	243	0.00	0	A	NM_012231		14108179	14108179	+1	no_errors	ENST00000235372	ensembl	human	known	69_37n	missense	265	18.71	61	SNP	1.000	T
PTPRU	10076	genome.wustl.edu	37	1	29642551	29642551	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:29642551C>T	ENST00000345512.3	+	25	3560	c.3431C>T	c.(3430-3432)gCc>gTc	p.A1144V	PTPRU_ENST00000373779.3_Missense_Mutation_p.A1134V|PTPRU_ENST00000356870.3_Missense_Mutation_p.A1140V|PTPRU_ENST00000323874.8_Missense_Mutation_p.A1140V|PTPRU_ENST00000460170.2_Missense_Mutation_p.A1140V|PTPRU_ENST00000428026.2_Missense_Mutation_p.A1131V	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1144	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ATCCTGGAGGCCTGCCTGTGT	0.547																																						dbGAP											0													126.0	101.0	110.0					1																	29642551		2203	4300	6503	-	-	-	SO:0001583	missense	0			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3431C>T	1.37:g.29642551C>T	ENSP00000334941:p.Ala1144Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.A1144V	ENST00000345512.3	37	c.3431	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.339185	0.95783	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	4.51	4.51	0.55191	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	M	0.89414	3.03	0.80722	D	1	D;D;D;D;D	0.69078	0.997;0.997;0.997;0.995;0.995	P;P;P;P;P	0.55222	0.771;0.771;0.771;0.595;0.595	T	0.66015	-0.6028	9	.	.	.	.	16.7651	0.85522	0.0:1.0:0.0:0.0	.	1131;1140;1134;1140;1144	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	V	1144;1134;1140;1140;1131;1140	ENSP00000334941:A1144V;ENSP00000362884:A1134V;ENSP00000349333:A1140V;ENSP00000314987:A1140V;ENSP00000392332:A1131V;ENSP00000432906:A1140V	.	A	+	2	0	PTPRU	29515138	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.645000	0.83430	2.498000	0.84270	0.561000	0.74099	GCC	PTPRU	-	smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000060656		0.547	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	26	0.00	0	C			29642551	29642551	+1	no_errors	ENST00000345512	ensembl	human	known	69_37n	missense	18	41.94	13	SNP	1.000	T
PRKAB2	5565	genome.wustl.edu	37	1	146639408	146639408	+	Silent	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:146639408G>T	ENST00000254101.3	-	3	399	c.261C>A	c.(259-261)ggC>ggA	p.G87G	PRKAB2_ENST00000425272.2_Intron	NM_005399.3	NP_005390.1	O43741	AAKB2_HUMAN	protein kinase, AMP-activated, beta 2 non-catalytic subunit	87					carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)|regulation of fatty acid biosynthetic process (GO:0042304)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.0487)				Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)	AGACCTCCTTGCCTCCTTCAG	0.512																																						dbGAP											0													199.0	201.0	200.0					1																	146639408		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC053610	CCDS925.1	1q21.2	2008-02-05			ENSG00000131791	ENSG00000131791			9379	protein-coding gene	gene with protein product	"""AMPK beta 2"""	602741				8557660	Standard	NM_005399		Approved		uc001epe.3	O43741	OTTHUMG00000014032	ENST00000254101.3:c.261C>A	1.37:g.146639408G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9V5|B4DH06|Q5VXY0	Silent	SNP	pfam_AMP_prot_kin_bsu_interact-dom,superfamily_Ig_E-set	p.G87	ENST00000254101.3	37	c.261	CCDS925.1	1																																																																																			PRKAB2	-	superfamily_Ig_E-set	ENSG00000131791		0.512	PRKAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAB2	HGNC	protein_coding	OTTHUMT00000039471.1	179	0.00	0	G	NM_005399		146639408	146639408	-1	no_errors	ENST00000254101	ensembl	human	known	69_37n	silent	245	11.83	33	SNP	1.000	T
QARS	5859	genome.wustl.edu	37	3	49139284	49139285	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:49139284_49139285insC	ENST00000306125.6	-	8	1016_1017	c.679_680insG	c.(679-681)gagfs	p.E227fs	QARS_ENST00000414533.1_Frame_Shift_Ins_p.E216fs|QARS_ENST00000420147.2_Frame_Shift_Ins_p.E245fs|QARS_ENST00000470225.1_5'UTR			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	227					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CTTAAGGGCCTCCCCCCGGAGC	0.554																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.680dupG	3.37:g.49139290_49139290dupC	ENSP00000307567:p.Glu227fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWJ2	Frame_Shift_Ins	INS	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_Gln-tRNA-synth_Ib_RNA-bd_N,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_Gln-tRNA-synth_Ib_RNA-bd_2,superfamily_Ribosomal_L25/Gln-tRNA_synth,prints_Glu/Gln-tRNA-synth_Ib,tigrfam_Gln-tRNA-synth_Ib	p.E227fs	ENST00000306125.6	37	c.680_679	CCDS2788.1	3																																																																																			QARS	-	pfam_Gln-tRNA-synth_Ib_RNA-bd_2	ENSG00000172053		0.554	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QARS	HGNC	protein_coding	OTTHUMT00000345689.2	34	0.00	0	-	NM_005051		49139284	49139285	-1	no_errors	ENST00000306125	ensembl	human	known	69_37n	frame_shift_ins	26	13.33	4	INS	1.000:1.000	C
REG3A	5068	genome.wustl.edu	37	2	79384383	79384383	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:79384383C>G	ENST00000409839.3	-	6	533	c.497G>C	c.(496-498)aGg>aCg	p.R166T	REG3A_ENST00000305165.2_Missense_Mutation_p.R166T|AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Missense_Mutation_p.R166T	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	166	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						ATAGGGTAACCTCACATTACA	0.478																																						dbGAP											0													112.0	105.0	108.0					2																	79384383		2203	4300	6503	-	-	-	SO:0001583	missense	0			S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.497G>C	2.37:g.79384383C>G	ENSP00000386630:p.Arg166Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Pancreatis_ac	p.R166T	ENST00000409839.3	37	c.497	CCDS1965.1	2	.	.	.	.	.	.	.	.	.	.	c	11.72	1.722674	0.30503	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.18810	2.19;2.19;2.19	3.96	-6.56	0.01848	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	2.121740	0.01951	N	0.042604	T	0.07503	0.0189	N	0.03948	-0.315	0.09310	N	1	B	0.15719	0.014	B	0.20577	0.03	T	0.18272	-1.0342	10	0.25751	T	0.34	.	2.0372	0.03542	0.1367:0.3809:0.2358:0.2467	.	166	Q06141	REG3A_HUMAN	T	166	ENSP00000386630:R166T;ENSP00000377456:R166T;ENSP00000304311:R166T	ENSP00000304311:R166T	R	-	2	0	REG3A	79237891	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-2.532000	0.00943	-1.261000	0.02462	-0.291000	0.09656	AGG	REG3A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Pancreatis_ac	ENSG00000172016		0.478	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3A	HGNC	protein_coding	OTTHUMT00000252290.2	110	0.00	0	C	NM_002580		79384383	79384383	-1	no_errors	ENST00000305165	ensembl	human	known	69_37n	missense	157	25.24	53	SNP	0.000	G
RP1	6101	genome.wustl.edu	37	8	55538958	55538958	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:55538958A>C	ENST00000220676.1	+	4	2664	c.2516A>C	c.(2515-2517)cAa>cCa	p.Q839P		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	839					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCGCAATCTCAAGCAGAAGTG	0.323																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													43.0	46.0	45.0					8																	55538958		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2516A>C	8.37:g.55538958A>C	ENSP00000220676:p.Gln839Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.Q839P	ENST00000220676.1	37	c.2516	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	A	8.108	0.778135	0.16120	.	.	ENSG00000104237	ENST00000220676	T	0.59083	0.29	4.91	2.35	0.29111	.	0.390405	0.21968	N	0.066494	T	0.55752	0.1940	M	0.64997	1.995	0.09310	N	1	D	0.54397	0.966	P	0.50440	0.641	T	0.52525	-0.8564	10	0.87932	D	0	.	2.7303	0.05225	0.6238:0.1382:0.0865:0.1515	.	839	P56715	RP1_HUMAN	P	839	ENSP00000220676:Q839P	ENSP00000220676:Q839P	Q	+	2	0	RP1	55701511	0.903000	0.30736	0.091000	0.20842	0.301000	0.27625	1.118000	0.31246	0.970000	0.38263	0.533000	0.62120	CAA	RP1	-	NULL	ENSG00000104237		0.323	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	128	0.00	0	A	NM_006269		55538958	55538958	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	115	17.27	24	SNP	0.033	C
SCN10A	6336	genome.wustl.edu	37	3	38802768	38802768	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:38802768T>A	ENST00000449082.2	-	6	797	c.798A>T	c.(796-798)caA>caT	p.Q266H		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	266					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CCTTGAAGAGTTGCAGCCCCA	0.468																																						dbGAP											0													113.0	98.0	103.0					3																	38802768		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.798A>T	3.37:g.38802768T>A	ENSP00000390600:p.Gln266His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.Q266H	ENST00000449082.2	37	c.798	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	T	17.15	3.315719	0.60524	.	.	ENSG00000185313	ENST00000449082	D	0.98996	-5.31	4.66	1.53	0.23141	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99287	0.9751	M	0.93594	3.435	0.37520	D	0.917515	D	0.76494	0.999	D	0.91635	0.999	D	0.99905	1.1178	10	0.87932	D	0	.	9.1028	0.36678	0.0:0.6888:0.0:0.3112	.	266	Q9Y5Y9	SCNAA_HUMAN	H	266	ENSP00000390600:Q266H	ENSP00000390600:Q266H	Q	-	3	2	SCN10A	38777772	0.997000	0.39634	1.000000	0.80357	0.981000	0.71138	0.547000	0.23299	0.220000	0.20860	-0.993000	0.02533	CAA	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.468	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	61	0.00	0	T	NM_006514		38802768	38802768	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	72	21.74	20	SNP	1.000	A
SCN11A	11280	genome.wustl.edu	37	3	38888484	38888484	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:38888484C>T	ENST00000302328.3	-	26	5275	c.5077G>A	c.(5077-5079)Gta>Ata	p.V1693I	SCN11A_ENST00000450244.1_Missense_Mutation_p.V1693I|SCN11A_ENST00000456224.3_Missense_Mutation_p.V1655I	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1693					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCACCGAGTACCCTAGCGGTG	0.448																																						dbGAP											0													127.0	127.0	127.0					3																	38888484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.5077G>A	3.37:g.38888484C>T	ENSP00000307599:p.Val1693Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.V1693I	ENST00000302328.3	37	c.5077	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725277	0.68959	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.96802	-4.13;-4.13;-4.09	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.97939	0.9322	M	0.78344	2.41	0.51482	D	0.999924	D	0.58620	0.983	D	0.67725	0.953	D	0.98931	1.0787	10	0.87932	D	0	.	18.4574	0.90725	0.0:1.0:0.0:0.0	.	1693	Q9UI33	SCNBA_HUMAN	I	1693;1693;1655	ENSP00000307599:V1693I;ENSP00000400945:V1693I;ENSP00000416757:V1655I	ENSP00000307599:V1693I	V	-	1	0	SCN11A	38863488	1.000000	0.71417	0.771000	0.31576	0.042000	0.13812	7.767000	0.85331	2.335000	0.79485	0.650000	0.86243	GTA	SCN11A	-	NULL	ENSG00000168356		0.448	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	192	0.00	0	C	NM_014139		38888484	38888484	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	95	65.33	179	SNP	1.000	T
SEMA3A	10371	genome.wustl.edu	37	7	83675755	83675755	+	Silent	SNP	T	T	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:83675755T>G	ENST00000265362.4	-	6	866	c.552A>C	c.(550-552)ggA>ggC	p.G184G	SEMA3A_ENST00000436949.1_Silent_p.G184G	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	184	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AGTATAATTCTCCATCTGTGT	0.388																																						dbGAP											0													158.0	146.0	150.0					7																	83675755		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.552A>C	7.37:g.83675755T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.G184	ENST00000265362.4	37	c.552	CCDS5599.1	7																																																																																			SEMA3A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075213		0.388	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	176	0.00	0	T	NM_006080		83675755	83675755	-1	no_errors	ENST00000265362	ensembl	human	known	69_37n	silent	222	43.22	169	SNP	0.999	G
SKIDA1	387640	genome.wustl.edu	37	10	21805345	21805345	+	Silent	SNP	G	G	A	rs547752540	byFrequency	TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:21805345G>A	ENST00000449193.2	-	4	3659	c.1407C>T	c.(1405-1407)acC>acT	p.T469T	SKIDA1_ENST00000444772.3_Silent_p.T390T	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	388						nucleus (GO:0005634)											TGCAGAAGCTGGTGCGCCTGA	0.637													G|||	2	0.000399361	0.0	0.0	5008	,	,		13547	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													24.0	28.0	27.0					10																	21805345		2082	4222	6304	-	-	-	SO:0001819	synonymous_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1407C>T	10.37:g.21805345G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.T469	ENST00000449193.2	37	c.1407	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.637	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2	12	0.00	0	G	NM_207371		21805345	21805345	-1	no_errors	ENST00000449193	ensembl	human	known	69_37n	silent	19	55.81	24	SNP	1.000	A
SLC9A4	389015	genome.wustl.edu	37	2	103095669	103095669	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:103095669G>T	ENST00000295269.4	+	2	1085	c.628G>T	c.(628-630)Gcc>Tcc	p.A210S		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	210					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GGACCCAGTGGCCGTGCTAGC	0.592																																						dbGAP											0													44.0	36.0	38.0					2																	103095669		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.628G>T	2.37:g.103095669G>T	ENSP00000295269:p.Ala210Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.A210S	ENST00000295269.4	37	c.628	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739137	0.69304	.	.	ENSG00000180251	ENST00000295269	T	0.17691	2.26	5.26	5.26	0.73747	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.43299	0.1241	M	0.81239	2.535	0.80722	D	1	D	0.59357	0.985	P	0.59357	0.856	T	0.46679	-0.9174	10	0.87932	D	0	.	18.881	0.92356	0.0:0.0:1.0:0.0	.	210	Q6AI14	SL9A4_HUMAN	S	210	ENSP00000295269:A210S	ENSP00000295269:A210S	A	+	1	0	SLC9A4	102462101	1.000000	0.71417	0.977000	0.42913	0.605000	0.37080	9.795000	0.99099	2.442000	0.82660	0.655000	0.94253	GCC	SLC9A4	-	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	ENSG00000180251		0.592	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	42	0.00	0	G	NM_001011552.3		103095669	103095669	+1	no_errors	ENST00000295269	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	1.000	T
SPAG17	200162	genome.wustl.edu	37	1	118535191	118535191	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:118535191C>T	ENST00000336338.5	-	36	5324	c.5259G>A	c.(5257-5259)ccG>ccA	p.P1753P		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1753						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GTATGGCACCCGGGGCACTCA	0.468																																						dbGAP											0													98.0	96.0	97.0					1																	118535191		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5259G>A	1.37:g.118535191C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAZ1|Q9NT21	Silent	SNP	NULL	p.P1753	ENST00000336338.5	37	c.5259	CCDS899.1	1																																																																																			SPAG17	-	NULL	ENSG00000155761		0.468	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	102	0.00	0	C	NM_206996		118535191	118535191	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	silent	205	29.31	85	SNP	0.000	T
SPINT1	6692	genome.wustl.edu	37	15	41148157	41148157	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr15:41148157C>T	ENST00000344051.4	+	9	1467	c.1233C>T	c.(1231-1233)ccC>ccT	p.P411P	SPINT1_ENST00000562057.1_Silent_p.P395P|SPINT1_ENST00000431806.1_Silent_p.P395P			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	411	BPTI/Kunitz inhibitor 2. {ECO:0000255|PROSITE-ProRule:PRU00031}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ACTACAACCCCTTCAGCGAAC	0.582																																						dbGAP											0													156.0	142.0	147.0					15																	41148157		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.1233C>T	15.37:g.41148157C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7D2	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_PKD_dom,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.P171L	ENST00000344051.4	37	c.512	CCDS10067.1	15																																																																																			SPINT1	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000166145		0.582	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPINT1	HGNC	protein_coding	OTTHUMT00000252359.2	66	0.00	0	C	NM_003710		41148157	41148157	+1	pseudogene	ENST00000566928	ensembl	human	novel	69_37n	missense	71	26.04	25	SNP	0.929	T
SPRTN	83932	genome.wustl.edu	37	1	231489020	231489020	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:231489020T>A	ENST00000295050.7	+	5	1719	c.1383T>A	c.(1381-1383)aaT>aaA	p.N461K		NM_001010984.2|NM_032018.5	NP_001010984.1|NP_114407.3	Q9H040	SPRTN_HUMAN	SprT-like N-terminal domain	461					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of protein ubiquitination (GO:0031398)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|ubiquitin binding (GO:0043130)										TTTGTCAGAATGAAGTTCTGG	0.408																																						dbGAP											0													54.0	52.0	53.0					1																	231489020		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL512744	CCDS1594.1, CCDS31054.1, CCDS58066.1	1q42.12-q43	2013-01-30	2012-06-18	2012-06-18	ENSG00000010072	ENSG00000010072			25356	protein-coding gene	gene with protein product	"""SprT-like domain at the N terminus"", ""DNA damage-targeting VCP (p97) adaptor"""		"""chromosome 1 open reading frame 124"""	C1orf124		22681887	Standard	NM_032018		Approved	DKFZP547N043, Spartan, DVC1	uc001hur.4	Q9H040	OTTHUMG00000038022	ENST00000295050.7:c.1383T>A	1.37:g.231489020T>A	ENSP00000295050:p.Asn461Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKT0|B5MEF7|Q5TE78|Q6UWW6|Q96BC5|Q96KA0	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain,smart_Znf_Rad18_put	p.N461K	ENST00000295050.7	37	c.1383	CCDS1594.1	1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.871530	0.33069	.	.	ENSG00000010072	ENST00000295050	T	0.39406	1.08	6.04	-12.1	0.00011	Zinc finger, Rad18-type putative (1);	1.010860	0.07920	N	0.975706	T	0.21550	0.0519	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06041	-1.0849	10	0.30854	T	0.27	0.174	3.1283	0.06414	0.1547:0.3148:0.3333:0.1972	.	461	Q9H040	CA124_HUMAN	K	461	ENSP00000295050:N461K	ENSP00000295050:N461K	N	+	3	2	C1orf124	229555643	0.000000	0.05858	0.000000	0.03702	0.152000	0.21847	-1.302000	0.02746	-2.557000	0.00476	-1.178000	0.01721	AAT	SPRTN	-	smart_Znf_Rad18_put	ENSG00000010072		0.408	SPRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRTN	HGNC	protein_coding	OTTHUMT00000092858.1	71	0.00	0	T	NM_032018		231489020	231489020	+1	no_errors	ENST00000295050	ensembl	human	known	69_37n	missense	131	14.38	22	SNP	0.000	A
SRCAP	10847	genome.wustl.edu	37	16	30724858	30724858	+	Silent	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:30724858G>A	ENST00000262518.4	+	16	2704	c.2319G>A	c.(2317-2319)ctG>ctA	p.L773L	SRCAP_ENST00000344771.4_Silent_p.L773L|SRCAP_ENST00000395059.2_Silent_p.L773L|SNORA30_ENST00000384028.1_RNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	773	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GCCTGCTCCTGACAGGAACTC	0.517																																						dbGAP											0													150.0	129.0	136.0					16																	30724858		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2319G>A	16.37:g.30724858G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.L773	ENST00000262518.4	37	c.2319	CCDS10689.2	16																																																																																			SRCAP	-	pfam_SNF2_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000080603		0.517	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	212	0.00	0	G	NM_006662		30724858	30724858	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	silent	425	17.15	88	SNP	0.948	A
STRN	6801	genome.wustl.edu	37	2	37121173	37121173	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:37121173C>T	ENST00000263918.4	-	7	807	c.799G>A	c.(799-801)Gtt>Att	p.V267I	STRN_ENST00000379213.2_Missense_Mutation_p.V255I	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	267					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				TTTTTCCTAACAATCTAATGA	0.333																																						dbGAP											0													95.0	86.0	89.0					2																	37121173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.799G>A	2.37:g.37121173C>T	ENSP00000263918:p.Val267Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V267I	ENST00000263918.4	37	c.799	CCDS1784.1	2	.	.	.	.	.	.	.	.	.	.	C	12.67	2.007284	0.35415	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	T;T	0.64803	-0.12;-0.11	5.61	4.72	0.59763	.	0.118971	0.56097	D	0.000036	T	0.54464	0.1860	L	0.42245	1.32	0.40892	D	0.984084	B;B	0.33171	0.4;0.007	B;B	0.30855	0.121;0.009	T	0.54622	-0.8266	10	0.36615	T	0.2	-18.2007	15.8358	0.78796	0.137:0.863:0.0:0.0	.	255;267	O43815-2;O43815	.;STRN_HUMAN	I	267;242;255	ENSP00000263918:V267I;ENSP00000368513:V255I	ENSP00000263918:V267I	V	-	1	0	STRN	36974677	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.129000	0.50500	1.328000	0.45358	0.655000	0.94253	GTT	STRN	-	NULL	ENSG00000115808		0.333	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRN	HGNC	protein_coding	OTTHUMT00000218568.1	183	0.00	0	C			37121173	37121173	-1	no_errors	ENST00000263918	ensembl	human	known	69_37n	missense	162	31.65	75	SNP	1.000	T
SYNE2	23224	genome.wustl.edu	37	14	64445702	64445702	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr14:64445702A>C	ENST00000344113.4	+	14	1751	c.1539A>C	c.(1537-1539)gaA>gaC	p.E513D	SYNE2_ENST00000358025.3_Missense_Mutation_p.E513D|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.E513D	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	513					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGAGCAGAGAATCTGTGGAAT	0.373																																						dbGAP											0													119.0	113.0	115.0					14																	64445702		1847	4093	5940	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.1539A>C	14.37:g.64445702A>C	ENSP00000341781:p.Glu513Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E513D	ENST00000344113.4	37	c.1539	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	A	16.13	3.036593	0.54896	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.69926	-0.15;-0.14;-0.44	5.94	-0.382	0.12481	.	0.376269	0.22087	N	0.064815	T	0.50871	0.1641	L	0.45422	1.42	0.80722	D	1	B;B	0.25048	0.071;0.117	B;B	0.25759	0.028;0.063	T	0.26573	-1.0099	10	0.39692	T	0.17	.	5.4203	0.16396	0.4103:0.2942:0.2955:0.0	.	513;513	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	D	513	ENSP00000350719:E513D;ENSP00000341781:E513D;ENSP00000452570:E513D	ENSP00000261678:E513D	E	+	3	2	SYNE2	63515455	0.949000	0.32298	0.996000	0.52242	0.978000	0.69477	-0.064000	0.11636	-0.067000	0.12976	-0.472000	0.04984	GAA	SYNE2	-	NULL	ENSG00000054654		0.373	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	128	0.00	0	A	NM_182914		64445702	64445702	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	140	27.18	53	SNP	0.992	C
TAF3	83860	genome.wustl.edu	37	10	8005972	8005972	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:8005972G>T	ENST00000344293.5	+	3	705	c.499G>T	c.(499-501)Gaa>Taa	p.E167*		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	167	Poly-Glu.				maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						ATTGGAGGAGGAAGAAATTAT	0.483																																						dbGAP											0													56.0	55.0	55.0					10																	8005972		1875	4114	5989	-	-	-	SO:0001587	stop_gained	0			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.499G>T	10.37:g.8005972G>T	ENSP00000340271:p.Glu167*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Nonsense_Mutation	SNP	pfam_BTP,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Histone-fold,smart_BTP,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E167*	ENST00000344293.5	37	c.499	CCDS41487.1	10	.	.	.	.	.	.	.	.	.	.	G	38	6.712014	0.97780	.	.	ENSG00000165632	ENST00000344293;ENST00000542889	.	.	.	5.57	5.57	0.84162	.	0.249998	0.33772	N	0.004570	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-30.0932	19.5521	0.95324	0.0:0.0:1.0:0.0	.	.	.	.	X	167	.	ENSP00000340271:E167X	E	+	1	0	TAF3	8045978	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.402000	0.97298	2.639000	0.89480	0.655000	0.94253	GAA	TAF3	-	NULL	ENSG00000165632		0.483	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF3	HGNC	protein_coding	OTTHUMT00000046725.1	142	0.00	0	G	NM_031923		8005972	8005972	+1	no_errors	ENST00000344293	ensembl	human	known	69_37n	nonsense	227	22.97	68	SNP	1.000	T
TARDBP	23435	genome.wustl.edu	37	1	11082428	11082428	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:11082428C>T	ENST00000240185.3	+	6	1076	c.962C>T	c.(961-963)gCc>gTc	p.A321V	TARDBP_ENST00000439080.2_Missense_Mutation_p.A205V|TARDBP_ENST00000315091.3_Intron	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	321	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A321G(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		ATTAATCCAGCCATGATGGCT	0.522																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											68.0	66.0	66.0					1																	11082428		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.962C>T	1.37:g.11082428C>T	ENSP00000240185:p.Ala321Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A321V	ENST00000240185.3	37	c.962	CCDS122.1	1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652702	0.47362	.	.	ENSG00000120948	ENST00000240185;ENST00000439080	D;D	0.96104	-3.91;-3.91	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.91314	0.7261	N	0.20685	0.6	0.80722	D	1	B;B	0.24043	0.096;0.002	B;B	0.15870	0.014;0.003	D	0.86683	0.1918	10	0.30854	T	0.27	-11.4687	20.0826	0.97783	0.0:1.0:0.0:0.0	.	205;321	B4DJ45;Q13148	.;TADBP_HUMAN	V	321;205	ENSP00000240185:A321V;ENSP00000404666:A205V	ENSP00000240185:A321V	A	+	2	0	TARDBP	11005015	1.000000	0.71417	0.969000	0.41365	0.991000	0.79684	7.544000	0.82117	2.746000	0.94184	0.655000	0.94253	GCC	TARDBP	-	NULL	ENSG00000120948		0.522	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARDBP	HGNC	protein_coding	OTTHUMT00000006063.1	48	0.00	0	C	NM_007375		11082428	11082428	+1	no_errors	ENST00000240185	ensembl	human	known	69_37n	missense	120	23.57	37	SNP	1.000	T
TAS1R2	80834	genome.wustl.edu	37	1	19180890	19180890	+	Silent	SNP	G	G	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:19180890G>C	ENST00000375371.3	-	3	1095	c.1074C>G	c.(1072-1074)acC>acG	p.T358T	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	358					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CCTGGTTGCAGGTATAGCTCT	0.627																																						dbGAP											0													112.0	100.0	104.0					1																	19180890		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1074C>G	1.37:g.19180890G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZ19	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.T358	ENST00000375371.3	37	c.1074	CCDS187.1	1																																																																																			TAS1R2	-	pfam_ANF_lig-bd_rcpt	ENSG00000179002		0.627	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	29	0.00	0	G			19180890	19180890	-1	no_errors	ENST00000375371	ensembl	human	novel	69_37n	silent	15	44.44	12	SNP	1.000	C
TFPI2	7980	genome.wustl.edu	37	7	93519536	93519536	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:93519536G>A	ENST00000222543.5	-	2	496	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C	AC002076.10_ENST00000435257.1_RNA|TFPI2_ENST00000545378.1_Missense_Mutation_p.R62C|GNGT1_ENST00000455502.1_Intron	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	62	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			AGGAACTGGCGGCAGCTCTGC	0.577																																						dbGAP											0													36.0	40.0	39.0					7																	93519536		2203	4300	6503	-	-	-	SO:0001583	missense	0			L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.184C>T	7.37:g.93519536G>A	ENSP00000222543:p.Arg62Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q66ME8|Q8NAK6|Q9UC86	Missense_Mutation	SNP	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.R62C	ENST00000222543.5	37	c.184	CCDS5632.1	7	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805867	0.50421	.	.	ENSG00000105825	ENST00000222543;ENST00000545378	T;T	0.58506	0.33;0.33	5.07	2.06	0.26882	Proteinase inhibitor I2, Kunitz metazoa (6);	1.160040	0.06013	N	0.649780	T	0.78136	0.4236	M	0.87827	2.91	0.47905	D	0.99954	D;D;D;D	0.89917	1.0;0.997;1.0;0.997	D;P;D;P	0.65874	0.939;0.761;0.931;0.761	T	0.66156	-0.5994	10	0.72032	D	0.01	.	10.1095	0.42555	0.0:0.1208:0.4669:0.4123	.	33;51;62;62	A4ZVU7;Q8NAK6;F5H3J8;P48307	.;.;.;TFPI2_HUMAN	C	62	ENSP00000222543:R62C;ENSP00000438861:R62C	ENSP00000222543:R62C	R	-	1	0	TFPI2	93357472	0.192000	0.23301	0.104000	0.21259	0.316000	0.28119	0.397000	0.20883	0.177000	0.19895	0.313000	0.20887	CGC	TFPI2	-	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000105825		0.577	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI2	HGNC	protein_coding	OTTHUMT00000254720.2	57	0.00	0	G	NM_006528		93519536	93519536	-1	no_errors	ENST00000222543	ensembl	human	known	69_37n	missense	24	31.43	11	SNP	0.629	A
THRB	7068	genome.wustl.edu	37	3	24169035	24169035	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr3:24169035C>T	ENST00000356447.4	-	9	1383	c.1099G>A	c.(1099-1101)Gac>Aac	p.D367N	THRB_ENST00000396671.2_Missense_Mutation_p.D367N|THRB_ENST00000280696.5_Missense_Mutation_p.D382N|THRB_ENST00000416420.1_Missense_Mutation_p.D367N	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	367	Interaction with NR2F6.|Ligand-binding.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ACTTCAGTGTCATCCAGGTTG	0.537																																					Melanoma(21;896 1043 15021 37958)	dbGAP											0													103.0	98.0	100.0					3																	24169035		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.1099G>A	3.37:g.24169035C>T	ENSP00000348827:p.Asp367Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.D367N	ENST00000356447.4	37	c.1099	CCDS2641.1	3	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716076	0.89205	.	.	ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000280696	D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71	5.97	5.97	0.96955	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.64402	D	0.000001	D	0.93452	0.7911	L	0.38692	1.165	0.80722	D	1	B	0.17268	0.021	B	0.19391	0.025	D	0.88774	0.3266	10	0.87932	D	0	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	367	P10828	THB_HUMAN	N	367;367;367;382	ENSP00000379904:D367N;ENSP00000348827:D367N;ENSP00000414444:D367N;ENSP00000280696:D382N	ENSP00000280696:D382N	D	-	1	0	THRB	24144039	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.836000	0.97738	0.655000	0.94253	GAC	THRB	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt	ENSG00000151090		0.537	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	THRB	HGNC	protein_coding	OTTHUMT00000252877.3	81	0.00	0	C	NM_000461		24169035	24169035	-1	no_errors	ENST00000356447	ensembl	human	known	69_37n	missense	92	56.40	119	SNP	1.000	T
TMPRSS15	5651	genome.wustl.edu	37	21	19713777	19713777	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr21:19713777A>T	ENST00000284885.3	-	13	1550	c.1517T>A	c.(1516-1518)cTt>cAt	p.L506H		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	506						brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TTCTGGATAAAGACTCCCATT	0.383																																						dbGAP											0													168.0	159.0	162.0					21																	19713777		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1517T>A	21.37:g.19713777A>T	ENSP00000284885:p.Leu506His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_MAM_dom,pfam_SEA,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_Srcr_rcpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_ConA-like_lec_gl,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_CUB,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.L506H	ENST00000284885.3	37	c.1517	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	A	15.69	2.909406	0.52439	.	.	ENSG00000154646	ENST00000284885	D	0.87179	-2.22	5.64	-0.62	0.11567	.	0.372124	0.26390	N	0.024651	T	0.75729	0.3889	L	0.34521	1.04	0.09310	N	1	P	0.47604	0.898	P	0.44447	0.45	T	0.67063	-0.5765	9	.	.	.	.	1.4015	0.02272	0.3043:0.2502:0.3093:0.1362	.	506	P98073	ENTK_HUMAN	H	506	ENSP00000284885:L506H	.	L	-	2	0	TMPRSS15	18635648	0.003000	0.15002	0.919000	0.36401	0.963000	0.63663	0.087000	0.14958	0.095000	0.17434	0.397000	0.26171	CTT	TMPRSS15	-	NULL	ENSG00000154646		0.383	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	141	0.00	0	A	NM_002772		19713777	19713777	-1	no_errors	ENST00000284885	ensembl	human	known	69_37n	missense	60	67.55	127	SNP	0.001	T
TMPRSS15	5651	genome.wustl.edu	37	21	19770634	19770634	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr21:19770634C>G	ENST00000284885.3	-	2	191	c.158G>C	c.(157-159)gGa>gCa	p.G53A		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	53						brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						ATGACTCTGTCCAAGTGCTGC	0.343																																						dbGAP											0													68.0	69.0	68.0					21																	19770634		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.158G>C	21.37:g.19770634C>G	ENSP00000284885:p.Gly53Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_MAM_dom,pfam_SEA,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_Srcr_rcpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_ConA-like_lec_gl,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_CUB,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G53A	ENST00000284885.3	37	c.158	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704785	0.68615	.	.	ENSG00000154646	ENST00000284885;ENST00000422787	D;T	0.86297	-2.1;1.1	5.23	0.187	0.15109	SEA (2);	0.847400	0.10630	N	0.652310	T	0.82217	0.4989	L	0.57536	1.79	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.66697	-0.5858	9	.	.	.	.	8.0312	0.30465	0.0:0.5595:0.0:0.4405	.	53	P98073	ENTK_HUMAN	A	53;8	ENSP00000284885:G53A;ENSP00000398253:G8A	.	G	-	2	0	TMPRSS15	18692505	0.016000	0.18221	0.033000	0.17914	0.814000	0.46013	0.004000	0.13106	0.085000	0.17107	0.643000	0.83706	GGA	TMPRSS15	-	smart_SEA,pfscan_SEA	ENSG00000154646		0.343	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	140	0.00	0	C	NM_002772		19770634	19770634	-1	no_errors	ENST00000284885	ensembl	human	known	69_37n	missense	67	62.57	112	SNP	0.011	G
TMTC1	83857	genome.wustl.edu	37	12	29904777	29904777	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:29904777G>T	ENST00000539277.1	-	5	818	c.760C>A	c.(760-762)Cca>Aca	p.P254T	TMTC1_ENST00000381224.2_Missense_Mutation_p.P146T|TMTC1_ENST00000551659.1_Missense_Mutation_p.P254T|TMTC1_ENST00000552618.1_Missense_Mutation_p.P254T|TMTC1_ENST00000256062.5_Missense_Mutation_p.P146T	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	254						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GGCTGCTGTGGGCTGCGTGGA	0.582																																						dbGAP											0													27.0	25.0	25.0					12																	29904777		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.760C>A	12.37:g.29904777G>T	ENSP00000442046:p.Pro254Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P146T	ENST00000539277.1	37	c.436	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	G	4.561	0.104179	0.08731	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.67171	-0.25;-0.01;-0.25;-0.11;1.57	4.56	2.67	0.31697	.	1.006310	0.07985	N	0.986244	T	0.55481	0.1923	L	0.36672	1.1	0.09310	N	1	B;B	0.24317	0.002;0.101	B;B	0.25506	0.003;0.061	T	0.43097	-0.9412	9	.	.	.	-0.9414	8.3515	0.32305	0.1927:0.0:0.8073:0.0	.	146;254	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	T	146;254;254;254;146	ENSP00000256062:P146T;ENSP00000448112:P254T;ENSP00000449043:P254T;ENSP00000442046:P254T;ENSP00000370622:P146T	.	P	-	1	0	TMTC1	29796044	0.001000	0.12720	0.009000	0.14445	0.048000	0.14542	0.548000	0.23314	1.195000	0.43115	0.561000	0.74099	CCA	TMTC1	-	NULL	ENSG00000133687		0.582	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	25	0.00	0	G	NM_031920		29904777	29904777	-1	no_errors	ENST00000256062	ensembl	human	known	69_37n	missense	25	43.18	19	SNP	0.004	T
TNKS2	80351	genome.wustl.edu	37	10	93579042	93579042	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:93579042A>T	ENST00000371627.4	+	4	915	c.536A>T	c.(535-537)gAt>gTt	p.D179V		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	179					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				TATAAGAAAGATGAACTCTTA	0.249																																						dbGAP											0													25.0	29.0	27.0					10																	93579042		2171	4272	6443	-	-	-	SO:0001583	missense	0			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.536A>T	10.37:g.93579042A>T	ENSP00000360689:p.Asp179Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.D179V	ENST00000371627.4	37	c.536	CCDS7417.1	10	.	.	.	.	.	.	.	.	.	.	A	24.1	4.488266	0.84854	.	.	ENSG00000107854	ENST00000371627	T	0.15256	2.44	5.97	5.97	0.96955	Ankyrin repeat-containing domain (2);	0.000000	0.64402	D	0.000006	T	0.42743	0.1216	M	0.77820	2.39	0.80722	D	1	D	0.69078	0.997	D	0.65874	0.939	T	0.25187	-1.0139	10	0.42905	T	0.14	.	16.4461	0.83932	1.0:0.0:0.0:0.0	.	179	Q9H2K2	TNKS2_HUMAN	V	179	ENSP00000360689:D179V	ENSP00000360689:D179V	D	+	2	0	TNKS2	93569022	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.232000	0.78116	2.285000	0.76669	0.528000	0.53228	GAT	TNKS2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000107854		0.249	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1	47	0.00	0	A	NM_025235		93579042	93579042	+1	no_errors	ENST00000371627	ensembl	human	known	69_37n	missense	48	34.25	25	SNP	1.000	T
TPI1	7167	genome.wustl.edu	37	12	6979542	6979542	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:6979542C>A	ENST00000229270.4	+	7	1193	c.856C>A	c.(856-858)Caa>Aaa	p.Q286K	TPI1_ENST00000488464.2_Missense_Mutation_p.Q167K|TPI1_ENST00000396705.5_Missense_Mutation_p.Q249K|TPI1_ENST00000535434.1_Missense_Mutation_p.Q167K	NM_001159287.1	NP_001152759.1	P60174	TPIS_HUMAN	triosephosphate isomerase 1	286					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|glycolytic process (GO:0006096)|multicellular organismal development (GO:0007275)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	triose-phosphate isomerase activity (GO:0004807)			endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|skin(2)	19						CAATGCCAAACAATGAGCCCC	0.562											OREG0021638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													74.0	66.0	69.0					12																	6979542		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS8566.1, CCDS53740.1, CCDS58206.1	12p13.31	2012-10-02			ENSG00000111669	ENSG00000111669	5.3.1.1		12009	protein-coding gene	gene with protein product		190450					Standard	NM_000365		Approved		uc001qrk.4	P60174	OTTHUMG00000133767	ENST00000229270.4:c.856C>A	12.37:g.6979542C>A	ENSP00000229270:p.Gln286Lys	Somatic	638	WXS	Illumina GAIIx	Phase_IV	B7Z5D8|D3DUS9|P00938|Q6FHP9|Q6IS07|Q8WWD0|Q96AG5	Missense_Mutation	SNP	pfam_Triosephosphate_isomerase,superfamily_Triosephosphate_isomerase,tigrfam_Triosephosphate_isomerase	p.Q286K	ENST00000229270.4	37	c.856	CCDS53740.1	12	.	.	.	.	.	.	.	.	.	.	C	9.696	1.153289	0.21371	.	.	ENSG00000111669	ENST00000229270;ENST00000396705;ENST00000535434	.	.	.	5.57	2.42	0.29668	.	0.463630	0.21508	U	0.073403	T	0.33876	0.0878	L	0.36672	1.1	0.31838	N	0.623901	B	0.02656	0.0	B	0.01281	0.0	T	0.32428	-0.9907	9	0.24483	T	0.36	.	9.6555	0.39923	0.1236:0.7369:0.0:0.1395	.	286	P60174	TPIS_HUMAN	K	286;249;167	.	ENSP00000229270:Q286K	Q	+	1	0	TPI1	6849803	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	1.285000	0.33261	0.715000	0.32103	0.561000	0.74099	CAA	TPI1	-	NULL	ENSG00000111669		0.562	TPI1-001	KNOWN	basic|CCDS	protein_coding	TPI1	HGNC	protein_coding	OTTHUMT00000258252.1	32	0.00	0	C	NM_000365		6979542	6979542	+1	no_errors	ENST00000229270	ensembl	human	known	69_37n	missense	40	55.56	50	SNP	1.000	A
TRIM56	81844	genome.wustl.edu	37	7	100732118	100732118	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:100732118C>G	ENST00000306085.6	+	3	1822	c.1525C>G	c.(1525-1527)Cgg>Ggg	p.R509G		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	509					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					GCGGTCCCCCCGGATCACCGG	0.652																																					Ovarian(89;1092 1379 22756 38989 39611)	dbGAP											0													59.0	68.0	65.0					7																	100732118		2000	4160	6160	-	-	-	SO:0001583	missense	0			BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1525C>G	7.37:g.100732118C>G	ENSP00000305161:p.Arg509Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_CheY-like_superfamily,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.R509G	ENST00000306085.6	37	c.1525	CCDS43625.1	7	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058664	0.36277	.	.	ENSG00000169871	ENST00000306085	T	0.50277	0.75	3.88	3.88	0.44766	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	T	0.29556	0.0737	N	0.19112	0.55	0.26381	N	0.976735	P	0.43024	0.798	B	0.36989	0.238	T	0.03795	-1.1003	9	0.19590	T	0.45	.	11.6346	0.51196	0.0:1.0:0.0:0.0	.	509	Q9BRZ2	TRI56_HUMAN	G	509	ENSP00000305161:R509G	ENSP00000305161:R509G	R	+	1	2	TRIM56	100518838	0.862000	0.29867	0.533000	0.28001	0.276000	0.26787	1.780000	0.38634	2.449000	0.82847	0.591000	0.81541	CGG	TRIM56	-	NULL	ENSG00000169871		0.652	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM56	HGNC	protein_coding	OTTHUMT00000347185.1	45	0.00	0	C	NM_030961		100732118	100732118	+1	no_errors	ENST00000306085	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	0.659	G
TTN	7273	genome.wustl.edu	37	2	179613547	179613547	+	Intron	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:179613547T>C	ENST00000591111.1	-	45	10585				TTN_ENST00000360870.5_Missense_Mutation_p.N4527S|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTGCAATGTTAGATGAATC	0.323																																						dbGAP											0													104.0	102.0	103.0					2																	179613547		2203	4297	6500	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4303A>G	2.37:g.179613547T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.N4527S	ENST00000591111.1	37	c.13580		2	.	.	.	.	.	.	.	.	.	.	T	4.918	0.170547	0.09391	.	.	ENSG00000155657	ENST00000360870	T	0.57595	0.39	6.04	3.66	0.41972	.	.	.	.	.	T	0.30665	0.0772	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.13202	-1.0518	9	0.36615	T	0.2	.	3.2207	0.06715	0.14:0.0746:0.1461:0.6393	.	4527	Q8WZ42-6	.	S	4527	ENSP00000354117:N4527S	ENSP00000354117:N4527S	N	-	2	0	TTN	179321792	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	0.384000	0.20668	1.073000	0.40885	0.460000	0.39030	AAC	TTN	-	NULL	ENSG00000155657		0.323	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	289	0.00	0	T	NM_133378		179613547	179613547	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	missense	343	10.39	40	SNP	0.000	C
TYK2	7297	genome.wustl.edu	37	19	10475418	10475418	+	Silent	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:10475418C>T	ENST00000525621.1	-	9	1720	c.1239G>A	c.(1237-1239)gcG>gcA	p.A413A	TYK2_ENST00000529370.1_Silent_p.A413A|TYK2_ENST00000264818.6_Silent_p.A413A|TYK2_ENST00000524462.1_Silent_p.A228A	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	413	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CGAAGGACAGCGCCGCAGCCC	0.682																																						dbGAP											0													41.0	51.0	47.0					19																	10475418		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1239G>A	19.37:g.10475418C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6QB10|Q96CH0	Missense_Mutation	SNP	NULL	p.R126H	ENST00000525621.1	37	c.377	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	C	6.715	0.500545	0.12822	.	.	ENSG00000105397	ENST00000525220	.	.	.	5.24	0.507	0.16967	.	.	.	.	.	T	0.53706	0.1813	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43972	-0.9358	4	.	.	.	-32.8988	6.8864	0.24202	0.1611:0.2779:0.561:0.0	.	.	.	.	H	126	.	.	R	-	2	0	TYK2	10336418	1.000000	0.71417	0.991000	0.47740	0.380000	0.30137	0.635000	0.24629	0.206000	0.20587	-0.529000	0.04317	CGC	TYK2	-	NULL	ENSG00000105397		0.682	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	15	0.00	0	C			10475418	10475418	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525220	ensembl	human	novel	69_37n	missense	29	27.50	11	SNP	1.000	T
ULK1	8408	genome.wustl.edu	37	12	132391450	132391452	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:132391450_132391452delCTG	ENST00000321867.4	+	4	611_613	c.260_262delCTG	c.(259-264)tctgtc>ttc	p.87_88SV>F		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	87	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		ATGGCTAATTCTGTCTACCTGGT	0.621																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.260_262delCTG	12.37:g.132391450_132391452delCTG	ENSP00000324560:p.Ser87_Val88delinsPhe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQ28	In_Frame_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.SV87in_frame_delF	ENST00000321867.4	37	c.260_262	CCDS9274.1	12																																																																																			ULK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_cat_dom	ENSG00000177169		0.621	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK1	HGNC	protein_coding	OTTHUMT00000397769.3	13	0.00	0	CTG			132391450	132391452	+1	no_errors	ENST00000321867	ensembl	human	known	69_37n	in_frame_del	20	56.52	26	DEL	0.996:0.667:1.000	-
USP34	9736	genome.wustl.edu	37	2	61528234	61528234	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr2:61528234G>T	ENST00000398571.2	-	29	4056	c.3980C>A	c.(3979-3981)cCa>cAa	p.P1327Q		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1327					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GCAAGATGCTGGCAGCTGAAC	0.403																																						dbGAP											0													166.0	166.0	166.0					2																	61528234		1919	4127	6046	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.3980C>A	2.37:g.61528234G>T	ENSP00000381577:p.Pro1327Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.P1327Q	ENST00000398571.2	37	c.3980	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866652	0.91511	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.06849	3.25	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.28134	0.0694	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.00200	-1.1927	10	0.66056	D	0.02	.	19.6975	0.96031	0.0:0.0:1.0:0.0	.	1327	Q70CQ2	UBP34_HUMAN	Q	1175;1175;1327	ENSP00000381577:P1327Q	ENSP00000263989:P1175Q	P	-	2	0	USP34	61381738	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.567000	0.98161	2.729000	0.93468	0.557000	0.71058	CCA	USP34	-	NULL	ENSG00000115464		0.403	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	167	0.00	0	G			61528234	61528234	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	399	26.06	141	SNP	1.000	T
VASH2	79805	genome.wustl.edu	37	1	213146056	213146056	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:213146056G>A	ENST00000517399.1	+	5	632	c.632G>A	c.(631-633)cGc>cAc	p.R211H	VASH2_ENST00000366965.2_Missense_Mutation_p.R167H|VASH2_ENST00000271776.4_3'UTR|VASH2_ENST00000366964.3_Missense_Mutation_p.R69H|VASH2_ENST00000366967.2_Missense_Mutation_p.R107H|VASH2_ENST00000366968.4_Missense_Mutation_p.R146H|VASH2_ENST00000366966.2_Missense_Mutation_p.R146H			Q86V25	VASH2_HUMAN	vasohibin 2	211					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)	cytoplasm (GO:0005737)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)		GGCATGAGCCGCAGGGCTGAG	0.483																																						dbGAP											0													109.0	98.0	102.0					1																	213146056		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022567	CCDS1511.1, CCDS44315.1, CCDS44316.1, CCDS73026.1	1q23	2008-02-05			ENSG00000143494	ENSG00000143494			25723	protein-coding gene	gene with protein product		610471				16528006	Standard	XR_247041		Approved	FLJ12505	uc001hjw.3	Q86V25	OTTHUMG00000036925	ENST00000517399.1:c.632G>A	1.37:g.213146056G>A	ENSP00000428324:p.Arg211His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYZ5|Q2VT46|Q5VTE7|Q5VTE9|Q7Z6E3|Q8IZ24|Q9H9W5	Missense_Mutation	SNP	NULL	p.R211H	ENST00000517399.1	37	c.632	CCDS1511.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.225300	0.95173	.	.	ENSG00000143494	ENST00000366966;ENST00000366964;ENST00000366968;ENST00000366965;ENST00000366967;ENST00000517399	.	.	.	5.26	5.26	0.73747	.	0.060270	0.64402	D	0.000015	D	0.82683	0.5090	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.74023	0.982;0.917	D	0.84681	0.0717	9	0.87932	D	0	-10.5992	19.2409	0.93883	0.0:0.0:1.0:0.0	.	211;167	Q86V25;Q86V25-5	VASH2_HUMAN;.	H	146;69;146;167;107;211	.	ENSP00000355931:R69H	R	+	2	0	VASH2	211212679	1.000000	0.71417	0.992000	0.48379	0.969000	0.65631	9.602000	0.98312	2.620000	0.88729	0.655000	0.94253	CGC	VASH2	-	NULL	ENSG00000143494		0.483	VASH2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH2	HGNC	protein_coding	OTTHUMT00000381686.1	67	0.00	0	G	NM_024749		213146056	213146056	+1	no_errors	ENST00000517399	ensembl	human	known	69_37n	missense	156	22.39	45	SNP	1.000	A
WAC	51322	genome.wustl.edu	37	10	28897337	28897337	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr10:28897337T>C	ENST00000354911.4	+	8	1303	c.1142T>C	c.(1141-1143)gTg>gCg	p.V381A	WAC_ENST00000375664.4_Missense_Mutation_p.V336A|WAC_ENST00000347934.4_Missense_Mutation_p.V278A|WAC_ENST00000375646.1_Missense_Mutation_p.V233A|WAC_ENST00000428935.1_Missense_Mutation_p.V336A	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	381					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						AATTCTAATGTGGACATATCT	0.353																																						dbGAP											0													28.0	26.0	26.0					10																	28897337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1142T>C	10.37:g.28897337T>C	ENSP00000346986:p.Val381Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.V381A	ENST00000354911.4	37	c.1142	CCDS7159.1	10	.	.	.	.	.	.	.	.	.	.	T	12.27	1.886218	0.33348	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911;ENST00000428935;ENST00000424454	T;T;T;T;T	0.46451	1.45;1.71;1.62;1.44;0.87	5.47	5.47	0.80525	.	0.210105	0.49916	D	0.000136	T	0.48892	0.1525	L	0.29908	0.895	0.58432	D	0.999991	P;P;P;P	0.52577	0.919;0.935;0.93;0.954	P;P;P;P	0.60541	0.699;0.574;0.504;0.876	T	0.35400	-0.9790	10	0.26408	T	0.33	-1.4041	15.8499	0.78921	0.0:0.0:0.0:1.0	.	336;278;381;336	Q9BTA9-2;Q9BTA9-5;Q9BTA9;Q9BTA9-3	.;.;WAC_HUMAN;.	A	336;233;278;381;336;336	ENSP00000364816:V336A;ENSP00000364797:V233A;ENSP00000311106:V278A;ENSP00000346986:V381A;ENSP00000399706:V336A	ENSP00000311106:V278A	V	+	2	0	WAC	28937343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.872000	0.69636	2.203000	0.70933	0.482000	0.46254	GTG	WAC	-	NULL	ENSG00000095787		0.353	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	WAC	HGNC	protein_coding	OTTHUMT00000047371.1	79	0.00	0	T	NM_100264		28897337	28897337	+1	no_errors	ENST00000354911	ensembl	human	known	69_37n	missense	66	52.86	74	SNP	1.000	C
WDR66	144406	genome.wustl.edu	37	12	122404947	122404947	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr12:122404947G>A	ENST00000288912.4	+	16	3433	c.2579G>A	c.(2578-2580)cGc>cAc	p.R860H	WDR66_ENST00000545752.1_3'UTR|WDR66_ENST00000397454.2_Missense_Mutation_p.R860H	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	860							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CTACAGAAACGCTACTTGGTG	0.488																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													107.0	108.0	108.0					12																	122404947		1937	4136	6073	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.2579G>A	12.37:g.122404947G>A	ENSP00000288912:p.Arg860His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.R860H	ENST00000288912.4	37	c.2579	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	G	11.25	1.584184	0.28268	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.56103	0.48;1.22	4.61	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.385177	0.27415	N	0.019473	T	0.44561	0.1299	L	0.45051	1.395	0.30877	N	0.731833	B	0.13594	0.008	B	0.11329	0.006	T	0.50767	-0.8789	10	0.51188	T	0.08	.	11.5354	0.50634	0.0952:0.0:0.9048:0.0	.	860	Q8TBY9	WDR66_HUMAN	H	860	ENSP00000288912:R860H;ENSP00000380595:R860H	ENSP00000288912:R860H	R	+	2	0	WDR66	120889330	0.997000	0.39634	1.000000	0.80357	0.245000	0.25701	2.438000	0.44837	2.124000	0.65301	0.551000	0.68910	CGC	WDR66	-	superfamily_WD40_repeat_dom	ENSG00000158023		0.488	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	41	0.00	0	G	NM_144668		122404947	122404947	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	16	33.33	8	SNP	0.981	A
XPO7	23039	genome.wustl.edu	37	8	21842351	21842351	+	Splice_Site	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr8:21842351G>A	ENST00000252512.9	+	12	1571		c.e12+1		XPO7_ENST00000433566.4_Splice_Site|XPO7_ENST00000434536.1_Splice_Site	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7						mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		GTGCAGGAGGGTGAGTGTGCA	0.562																																						dbGAP											0													65.0	69.0	68.0					8																	21842351		2152	4267	6419	-	-	-	SO:0001630	splice_region_variant	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1471+1G>A	8.37:g.21842351G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94846|Q6PJK9|Q8NEK7	Splice_Site	SNP	-	e12+1	ENST00000252512.9	37	c.1498+1	CCDS47818.1	8	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843108	0.91197	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7947	0.91990	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	XPO7	21898297	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.808000	0.99193	2.537000	0.85549	0.585000	0.79938	.	XPO7	-	-	ENSG00000130227		0.562	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1	40	0.00	0	G	NM_015024	Intron	21842351	21842351	+1	no_errors	ENST00000434536	ensembl	human	known	69_37n	splice_site	24	27.27	9	SNP	1.000	A
ZBTB2	57621	genome.wustl.edu	37	6	151687437	151687437	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr6:151687437G>A	ENST00000325144.4	-	3	904	c.764C>T	c.(763-765)gCc>gTc	p.A255V		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		CAGGTGGCAGGCATAGTACTT	0.542																																						dbGAP											0													169.0	142.0	151.0					6																	151687437		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.764C>T	6.37:g.151687437G>A	ENSP00000323183:p.Ala255Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A255V	ENST00000325144.4	37	c.764	CCDS5231.1	6	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469236	0.63625	.	.	ENSG00000181472	ENST00000325144	T	0.46819	0.86	5.76	5.76	0.90799	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.097790	0.64402	D	0.000001	T	0.21145	0.0509	N	0.10874	0.06	0.50813	D	0.999898	B	0.29909	0.261	B	0.26517	0.07	T	0.10613	-1.0622	10	0.54805	T	0.06	-35.4575	19.9759	0.97304	0.0:0.0:1.0:0.0	.	255	Q8N680	ZBTB2_HUMAN	V	255	ENSP00000323183:A255V	ENSP00000323183:A255V	A	-	2	0	ZBTB2	151729130	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.574000	0.74014	2.713000	0.92767	0.655000	0.94253	GCC	ZBTB2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181472		0.542	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB2	HGNC	protein_coding	OTTHUMT00000042715.1	85	0.00	0	G	NM_020861		151687437	151687437	-1	no_errors	ENST00000325144	ensembl	human	known	69_37n	missense	162	11.89	22	SNP	1.000	A
ZBTB46	140685	genome.wustl.edu	37	20	62421927	62421928	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr20:62421927_62421928insT	ENST00000245663.4	-	2	333_334	c.183_184insA	c.(181-186)tgccagfs	p.Q62fs	ZBTB46_ENST00000302995.2_Frame_Shift_Ins_p.Q62fs|ZBTB46_ENST00000395104.1_Frame_Shift_Ins_p.Q62fs|ZBTB46_ENST00000480766.1_5'Flank	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	62	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					TTCTGCACCTGGCAGTAGAGCG	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.183_184insA	20.37:g.62421927_62421928insT	ENSP00000245663:p.Gln62fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Frame_Shift_Ins	INS	pfam_BTB_POZ,pfam_DUF3342,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q61fs	ENST00000245663.4	37	c.184_183	CCDS13538.1	20																																																																																			ZBTB46	-	pfam_BTB_POZ,pfam_DUF3342,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000130584		0.619	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB46	HGNC	protein_coding	OTTHUMT00000080232.2	12	0.00	0	-	NM_025224		62421927	62421928	-1	no_errors	ENST00000245663	ensembl	human	known	69_37n	frame_shift_ins	9	40.00	6	INS	1.000:1.000	T
ZDHHC11	79844	genome.wustl.edu	37	5	843815	843815	+	Silent	SNP	C	C	T	rs71591190	byFrequency	TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr5:843815C>T	ENST00000283441.8	-	4	911	c.528G>A	c.(526-528)tcG>tcA	p.S176S	ZDHHC11_ENST00000503758.2_5'Flank|ZDHHC11_ENST00000511539.1_5'UTR|ZDHHC11_ENST00000424784.2_Silent_p.S176S	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	176						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CAGCTGTGGCCGAGGCCACAG	0.667																																						dbGAP											0													27.0	22.0	23.0					5																	843815		2199	4276	6475	-	-	-	SO:0001819	synonymous_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.528G>A	5.37:g.843815C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWR9	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.S176	ENST00000283441.8	37	c.528	CCDS3857.1	5																																																																																			ZDHHC11	-	pfam_Znf_DHHC_palmitoyltrfase	ENSG00000188818		0.667	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11	HGNC	protein_coding	OTTHUMT00000206681.3	8	0.00	0	C	NM_024786		843815	843815	-1	no_errors	ENST00000283441	ensembl	human	known	69_37n	silent	2	66.67	4	SNP	0.590	T
ZMPSTE24	10269	genome.wustl.edu	37	1	40751696	40751696	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr1:40751696A>G	ENST00000372759.3	+	8	1219	c.1054A>G	c.(1054-1056)Agc>Ggc	p.S352G		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	352					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			TATCATTATTAGCCAGGTAAG	0.413																																						dbGAP											0													103.0	101.0	101.0					1																	40751696		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.1054A>G	1.37:g.40751696A>G	ENSP00000361845:p.Ser352Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Missense_Mutation	SNP	pfam_Peptidase_M48	p.S352G	ENST00000372759.3	37	c.1054	CCDS449.1	1	.	.	.	.	.	.	.	.	.	.	A	13.03	2.114117	0.37339	.	.	ENSG00000084073	ENST00000372759	T	0.73363	-0.74	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.69522	0.3120	L	0.46885	1.475	0.80722	D	1	B	0.15141	0.012	B	0.28465	0.09	T	0.64453	-0.6404	10	0.23891	T	0.37	-30.8648	14.7069	0.69198	1.0:0.0:0.0:0.0	.	352	O75844	FACE1_HUMAN	G	352	ENSP00000361845:S352G	ENSP00000361845:S352G	S	+	1	0	ZMPSTE24	40524283	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.879000	0.92398	1.877000	0.54381	0.460000	0.39030	AGC	ZMPSTE24	-	pfam_Peptidase_M48	ENSG00000084073		0.413	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMPSTE24	HGNC	protein_coding	OTTHUMT00000015766.1	54	0.00	0	A			40751696	40751696	+1	no_errors	ENST00000372759	ensembl	human	known	69_37n	missense	61	25.61	21	SNP	1.000	G
ZNF174	7727	genome.wustl.edu	37	16	3452203	3452203	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr16:3452203C>G	ENST00000268655.4	+	1	784	c.199C>G	c.(199-201)Ctc>Gtc	p.L67V	ZSCAN32_ENST00000304926.3_5'Flank|ZNF174_ENST00000571936.1_Missense_Mutation_p.L67V|ZNF174_ENST00000572544.1_Missense_Mutation_p.L67V|ZSCAN32_ENST00000573830.1_5'Flank|ZSCAN32_ENST00000422427.2_5'Flank|ZNF174_ENST00000344823.5_Missense_Mutation_p.L67V|ZNF174_ENST00000575752.1_Missense_Mutation_p.L67V|ZSCAN32_ENST00000439568.2_5'Flank|ZSCAN32_ENST00000396852.4_5'Flank	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	67	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						TCTCTCCCAGCTCCGACAGCT	0.567																																						dbGAP											0													79.0	88.0	85.0					16																	3452203		2197	4300	6497	-	-	-	SO:0001583	missense	0			U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.199C>G	16.37:g.3452203C>G	ENSP00000268655:p.Leu67Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Y68|Q9BQ34	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L67V	ENST00000268655.4	37	c.199	CCDS10504.1	16	.	.	.	.	.	.	.	.	.	.	C	16.07	3.019226	0.54576	.	.	ENSG00000103343	ENST00000344823;ENST00000268655	T;T	0.14640	2.49;2.49	4.5	4.5	0.54988	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.42821	D	0.000645	T	0.48333	0.1494	H	0.95079	3.62	0.09310	N	0.999997	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.85130	0.992;0.996;0.997	T	0.52881	-0.8516	10	0.87932	D	0	.	13.0169	0.58762	0.0:1.0:0.0:0.0	.	67;67;67	Q15697;Q15697-2;Q8IZN5	ZN174_HUMAN;.;.	V	67	ENSP00000339781:L67V;ENSP00000268655:L67V	ENSP00000268655:L67V	L	+	1	0	ZNF174	3392204	0.960000	0.32886	0.098000	0.21074	0.567000	0.35839	4.243000	0.58721	2.790000	0.95986	0.655000	0.94253	CTC	ZNF174	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000103343		0.567	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF174	HGNC	protein_coding	OTTHUMT00000251510.1	145	0.00	0	C	NM_003450		3452203	3452203	+1	no_errors	ENST00000268655	ensembl	human	known	69_37n	missense	120	47.37	108	SNP	0.107	G
ZNF398	57541	genome.wustl.edu	37	7	148876070	148876070	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr7:148876070C>A	ENST00000475153.1	+	6	1373	c.1106C>A	c.(1105-1107)cCc>cAc	p.P369H	ZNF398_ENST00000540950.1_Missense_Mutation_p.P374H|ZNF398_ENST00000426851.2_Missense_Mutation_p.P198H|ZNF398_ENST00000491174.1_Missense_Mutation_p.P198H|ZNF398_ENST00000483892.1_Missense_Mutation_p.P198H|ZNF398_ENST00000335901.4_Missense_Mutation_p.P198H|ZNF398_ENST00000420008.2_Missense_Mutation_p.P198H			Q8TD17	ZN398_HUMAN	zinc finger protein 398	369					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			ACTGAGCACCCCTTACCCTGT	0.597																																						dbGAP											0													141.0	127.0	132.0					7																	148876070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.1106C>A	7.37:g.148876070C>A	ENSP00000420418:p.Pro369His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.P374H	ENST00000475153.1	37	c.1121	CCDS5894.1	7	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491352	0.44249	.	.	ENSG00000197024	ENST00000426851;ENST00000420008;ENST00000475153;ENST00000483892;ENST00000491174;ENST00000540950;ENST00000335901	T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	4.98	3.11	0.35812	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.131907	0.35151	N	0.003401	T	0.72518	0.3470	M	0.84773	2.715	0.31423	N	0.674128	D;D	0.58970	0.975;0.984	P;P	0.54706	0.498;0.759	T	0.76250	-0.3028	10	0.87932	D	0	-9.8054	8.0176	0.30389	0.0:0.7487:0.1619:0.0894	.	374;369	B4DXA9;Q8TD17	.;ZN398_HUMAN	H	198;198;369;198;198;374;198	ENSP00000389972:P198H;ENSP00000416751:P198H;ENSP00000420418:P369H;ENSP00000418564:P198H;ENSP00000419391:P198H;ENSP00000439340:P374H;ENSP00000338984:P198H	ENSP00000338984:P198H	P	+	2	0	ZNF398	148507003	0.998000	0.40836	0.028000	0.17463	0.564000	0.35744	5.421000	0.66447	0.643000	0.30638	0.650000	0.86243	CCC	ZNF398	-	NULL	ENSG00000197024		0.597	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF398	HGNC	protein_coding	OTTHUMT00000352722.2	145	0.00	0	C			148876070	148876070	+1	no_errors	ENST00000540950	ensembl	human	known	69_37n	missense	265	23.19	80	SNP	0.706	A
ZNF565	147929	genome.wustl.edu	37	19	36674042	36674042	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:36674042C>T	ENST00000355114.5	-	5	1672	c.946G>A	c.(946-948)Gag>Aag	p.E316K	ZNF565_ENST00000392173.2_Missense_Mutation_p.E276K|ZNF565_ENST00000304116.5_Missense_Mutation_p.E276K			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	316					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E276K(1)		large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			TAGGGTTTCTCGCCTGTGTGA	0.478																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											86.0	79.0	82.0					19																	36674042		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.946G>A	19.37:g.36674042C>T	ENSP00000347234:p.Glu316Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ35|Q6NUS2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E276K	ENST00000355114.5	37	c.826		19	.	.	.	.	.	.	.	.	.	.	c	17.41	3.381723	0.61845	.	.	ENSG00000196357	ENST00000392173;ENST00000304116;ENST00000355114	T;T;T	0.24350	1.86;1.86;1.86	4.36	4.36	0.52297	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40554	N	0.001067	T	0.33030	0.0849	L	0.50847	1.595	0.41878	D	0.990304	D	0.61080	0.989	P	0.49477	0.612	T	0.17107	-1.0380	10	0.72032	D	0.01	.	14.8205	0.70068	0.0:1.0:0.0:0.0	.	276	Q8N9K5	ZN565_HUMAN	K	276;276;316	ENSP00000376013:E276K;ENSP00000306869:E276K;ENSP00000347234:E316K	ENSP00000306869:E276K	E	-	1	0	ZNF565	41365882	0.976000	0.34144	0.998000	0.56505	0.051000	0.14879	2.912000	0.48782	2.437000	0.82529	0.585000	0.79938	GAG	ZNF565	-	pfscan_Znf_C2H2	ENSG00000196357		0.478	ZNF565-003	PUTATIVE	basic	protein_coding	ZNF565	HGNC	protein_coding	OTTHUMT00000451697.1	106	0.00	0	C	NM_152477		36674042	36674042	-1	no_errors	ENST00000304116	ensembl	human	known	69_37n	missense	245	25.45	84	SNP	1.000	T
ZNF835	90485	genome.wustl.edu	37	19	57176288	57176288	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A06X-01A-21W-A019-09	TCGA-A8-A06X-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dc306402-3a55-4996-b786-f3f738f13dd3	09c30f57-516c-4a4f-bf63-943f09904d21	g.chr19:57176288C>A	ENST00000537055.2	-	2	510	c.279G>T	c.(277-279)agG>agT	p.R93S		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						TGTCAGGATGCCTCTCCTTCG	0.637																																						dbGAP											0													49.0	57.0	54.0					19																	57176288		2114	4246	6360	-	-	-	SO:0001583	missense	0			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.279G>T	19.37:g.57176288C>A	ENSP00000444747:p.Arg93Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R93S	ENST00000537055.2	37	c.279	CCDS56105.1	19	.	.	.	.	.	.	.	.	.	.	C	5.486	0.274733	0.10403	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.06687	3.27	1.64	0.586	0.17434	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B	0.19935	0.04	B	0.18263	0.021	T	0.42275	-0.9461	9	0.39692	T	0.17	.	4.037	0.09733	0.0:0.7782:0.0:0.2218	.	115	Q9Y2P0	ZN835_HUMAN	S	115;93	ENSP00000444747:R93S	ENSP00000341756:R115S	R	-	3	2	ZNF835	61868100	0.000000	0.05858	0.048000	0.18961	0.019000	0.09904	0.423000	0.21313	0.273000	0.22049	-0.258000	0.10820	AGG	ZNF835	-	NULL	ENSG00000127903		0.637	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	26	0.00	0	C	NM_001005850		57176288	57176288	-1	no_errors	ENST00000537055	ensembl	human	known	69_37n	missense	36	19.57	9	SNP	0.004	A
