#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCY1	107	genome.wustl.edu	37	7	45632382	45632382	+	Missense_Mutation	SNP	G	G	A	rs369079165		TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr7:45632382G>A	ENST00000297323.7	+	2	686	c.664G>A	c.(664-666)Gtc>Atc	p.V222I	ADCY1_ENST00000432715.1_5'UTR	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	222					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CTTGCTCTTCGTCGGTGTGAA	0.592																																						dbGAP											0													237.0	193.0	208.0					7																	45632382		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.664G>A	7.37:g.45632382G>A	ENSP00000297323:p.Val222Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2L8|Q75MI1	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V222I	ENST00000297323.7	37	c.664	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	G	2.139	-0.397205	0.04899	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.78246	-1.16	5.06	2.12	0.27331	.	0.473604	0.21911	N	0.067318	T	0.62282	0.2415	L	0.33485	1.01	0.28250	N	0.9253	B	0.18166	0.026	B	0.12837	0.008	T	0.46512	-0.9186	10	0.19147	T	0.46	.	7.8718	0.29571	0.0:0.1712:0.5411:0.2877	.	222	Q08828	ADCY1_HUMAN	I	222	ENSP00000297323:V222I	ENSP00000297323:V222I	V	+	1	0	ADCY1	45598907	1.000000	0.71417	0.107000	0.21349	0.233000	0.25261	1.300000	0.33436	0.111000	0.17947	-0.516000	0.04426	GTC	ADCY1	-	NULL	ENSG00000164742		0.592	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2	54	0.00	0	G	NM_021116		45632382	45632382	+1	no_errors	ENST00000297323	ensembl	human	known	69_37n	missense	94	32.37	45	SNP	0.988	A
AHNAK2	113146	genome.wustl.edu	37	14	105419083	105419083	+	Missense_Mutation	SNP	G	G	A	rs200145279	byFrequency	TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr14:105419083G>A	ENST00000333244.5	-	7	2824	c.2705C>T	c.(2704-2706)cCg>cTg	p.P902L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	902						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P902L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGGCCCTCCGGAAGTTTCAC	0.632													.|||	3	0.000599042	0.0008	0.0	5008	,	,		15808	0.001		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	NS(1)											118.0	140.0	133.0					14																	105419083		1871	4102	5973	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2705C>T	14.37:g.105419083G>A	ENSP00000353114:p.Pro902Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P902L	ENST00000333244.5	37	c.2705	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	11.61	1.688787	0.29962	.	.	ENSG00000185567	ENST00000333244	T	0.05717	3.4	3.95	-1.82	0.07857	.	.	.	.	.	T	0.08980	0.0222	M	0.86502	2.82	0.09310	N	1	B	0.23650	0.089	B	0.25140	0.058	T	0.48055	-0.9068	9	0.10636	T	0.68	-4.9816	5.4878	0.16759	0.3807:0.0:0.497:0.1224	.	902	Q8IVF2	AHNK2_HUMAN	L	902	ENSP00000353114:P902L	ENSP00000353114:P902L	P	-	2	0	AHNAK2	104490128	0.018000	0.18449	0.000000	0.03702	0.000000	0.00434	1.187000	0.32090	-0.478000	0.06823	-0.424000	0.05967	CCG	AHNAK2	-	NULL	ENSG00000185567		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	66	0.00	0	G	NM_138420		105419083	105419083	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	37	22.45	11	SNP	0.000	A
BAI3	577	genome.wustl.edu	37	6	70071317	70071317	+	Silent	SNP	G	G	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr6:70071317G>A	ENST00000370598.1	+	29	4973	c.4152G>A	c.(4150-4152)gtG>gtA	p.V1384V	BAI3_ENST00000238918.8_Silent_p.V590V|BAI3_ENST00000546190.1_Silent_p.V348V	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1384					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GCACAGCTGTGAAGAATTTCA	0.438																																						dbGAP											0													107.0	113.0	111.0					6																	70071317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4152G>A	6.37:g.70071317G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.V1384	ENST00000370598.1	37	c.4152	CCDS4968.1	6																																																																																			BAI3	-	NULL	ENSG00000135298		0.438	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	172	0.00	0	G			70071317	70071317	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	silent	236	20.27	60	SNP	0.998	A
CD300E	342510	genome.wustl.edu	37	17	72613482	72613482	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr17:72613482C>T	ENST00000328630.3	-	2	203	c.163G>A	c.(163-165)Gac>Aac	p.D55N	CD300E_ENST00000426295.2_Missense_Mutation_p.D96N|CD300E_ENST00000392619.1_Missense_Mutation_p.D82N			Q496F6	CLM2_HUMAN	CD300e molecule	55	Ig-like V-type.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	19						CATGACGTGTCGTACTGTCCT	0.562																																						dbGAP											0													222.0	141.0	168.0					17																	72613482		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648376	CCDS11702.1	17q25.1	2013-01-11	2006-03-28	2006-02-22	ENSG00000186407	ENSG00000186407		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	28874	protein-coding gene	gene with protein product		609801	"""CD300 antigen like family member E"", ""CD300e antigen"""	CD300LE		15549731, 15557162	Standard	NM_181449		Approved	IREM2, CLM2	uc002jlb.2	Q496F6	OTTHUMG00000067605	ENST00000328630.3:c.163G>A	17.37:g.72613482C>T	ENSP00000329942:p.Asp55Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNS1|Q7Z7I3	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.D96N	ENST00000328630.3	37	c.286	CCDS11702.1	17	.	.	.	.	.	.	.	.	.	.	C	9.147	1.015399	0.19355	.	.	ENSG00000186407	ENST00000392619;ENST00000426295;ENST00000328630;ENST00000412268	T;T;T;T	0.04083	3.71;3.71;3.71;3.71	4.78	1.24	0.21308	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.756766	0.11500	N	0.557839	T	0.04227	0.0117	L	0.28504	0.86	0.09310	N	1	B	0.16166	0.016	B	0.13407	0.009	T	0.42207	-0.9465	10	0.26408	T	0.33	-12.2639	10.065	0.42297	0.5817:0.4183:0.0:0.0	.	55	Q496F6	CLM2_HUMAN	N	82;96;55;57	ENSP00000376395:D82N;ENSP00000416642:D96N;ENSP00000329942:D55N;ENSP00000415488:D57N	ENSP00000329942:D55N	D	-	1	0	CD300E	70125077	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.216000	0.09266	0.617000	0.30160	-0.293000	0.09583	GAC	CD300E	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000186407		0.562	CD300E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CD300E	HGNC	protein_coding		215	0.00	0	C	NM_181449		72613482	72613482	-1	no_errors	ENST00000426295	ensembl	human	known	69_37n	missense	141	48.73	134	SNP	0.000	T
CIC	23152	genome.wustl.edu	37	19	42796882	42796883	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr19:42796882_42796883insC	ENST00000575354.2	+	14	3380_3381	c.3340_3341insC	c.(3340-3342)gccfs	p.A1114fs	CIC_ENST00000572681.2_Frame_Shift_Ins_p.A2022fs|CIC_ENST00000160740.3_Frame_Shift_Ins_p.A1113fs	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1114	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S1117fs*34(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				GCCATCCCAGGCCCCCCCAAGC	0.683			"""Mis, F, S"""		oligodendroglioma																																	dbGAP		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.3347dupC	19.37:g.42796889_42796889dupC	ENSP00000458663:p.Ala1114fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LGI1|Q9UEG5|Q9Y6T1	Frame_Shift_Ins	INS	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.S1117fs	ENST00000575354.2	37	c.3340_3341	CCDS12601.1	19																																																																																			CIC	-	NULL	ENSG00000079432		0.683	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2	24	0.00	0	-			42796882	42796883	+1	no_errors	ENST00000160740	ensembl	human	known	69_37n	frame_shift_ins	5	37.50	3	INS	1.000:0.993	C
DNAJC19	131118	genome.wustl.edu	37	3	180702454	180702454	+	Silent	SNP	A	A	G			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr3:180702454A>G	ENST00000382564.2	-	6	495	c.325T>C	c.(325-327)Tta>Cta	p.L109L	DNAJC19_ENST00000486355.1_3'UTR|DNAJC19_ENST00000491873.1_Silent_p.L84L|DNAJC19_ENST00000479269.1_Silent_p.L84L	NM_145261.3	NP_660304.1	Q96DA6	TIM14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 19	109	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cellular protein metabolic process (GO:0044267)|genitalia development (GO:0048806)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				large_intestine(2)|lung(1)	3	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			CCTTCTAGTAAATCTTTAGCT	0.289																																						dbGAP											0													55.0	53.0	54.0					3																	180702454		2199	4287	6486	-	-	-	SO:0001819	synonymous_variant	0				CCDS33895.1, CCDS54684.1	3q26.33	2014-09-17			ENSG00000205981	ENSG00000205981		"""Heat shock proteins / DNAJ (HSP40)"""	30528	protein-coding gene	gene with protein product		608977				19564938	Standard	NM_145261		Approved	TIMM14, Tim14, Pam18	uc003fkt.3	Q96DA6	OTTHUMG00000158180	ENST00000382564.2:c.325T>C	3.37:g.180702454A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4B1|C9JBV1	Silent	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N	p.L109	ENST00000382564.2	37	c.325	CCDS33895.1	3																																																																																			DNAJC19	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N	ENSG00000205981		0.289	DNAJC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC19	HGNC	protein_coding	OTTHUMT00000350336.1	45	0.00	0	A	NM_145261		180702454	180702454	-1	no_errors	ENST00000382564	ensembl	human	known	69_37n	silent	18	41.94	13	SNP	1.000	G
FMO5	2330	genome.wustl.edu	37	1	146684013	146684013	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr1:146684013A>T	ENST00000254090.4	-	5	966	c.578T>A	c.(577-579)aTt>aAt	p.I193N	RP11-337C18.10_ENST00000606856.1_RNA|FMO5_ENST00000441068.2_Missense_Mutation_p.I193N|RP11-337C18.8_ENST00000606757.1_RNA|FMO5_ENST00000369272.3_Missense_Mutation_p.I193N|RP11-337C18.8_ENST00000607149.1_RNA|FMO5_ENST00000465173.1_5'UTR	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	193						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					AGAATTCCCAATGCCAATTAT	0.423																																						dbGAP											0													125.0	126.0	125.0					1																	146684013		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.578T>A	1.37:g.146684013A>T	ENSP00000254090:p.Ile193Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_5,prints_Flavin_mOase_2,prints_Flavin_mOase_1	p.I193N	ENST00000254090.4	37	c.578	CCDS926.1	1	.	.	.	.	.	.	.	.	.	.	.	28.7	4.941314	0.92526	.	.	ENSG00000131781	ENST00000441068;ENST00000254090;ENST00000369272	T;T;T	0.57907	0.37;0.37;0.37	5.91	5.91	0.95273	.	0.085531	0.85682	D	0.000000	T	0.57286	0.2043	L	0.43701	1.375	0.80722	D	1	D;P;D;D	0.67145	0.984;0.668;0.996;0.994	D;P;D;D	0.75020	0.949;0.63;0.985;0.985	T	0.63171	-0.6697	10	0.87932	D	0	-18.3684	14.3033	0.66368	1.0:0.0:0.0:0.0	.	193;193;193;193	Q9HA79;Q8IV22;P49326;C9JJD1	.;.;FMO5_HUMAN;.	N	193	ENSP00000416011:I193N;ENSP00000254090:I193N;ENSP00000358277:I193N	ENSP00000254090:I193N	I	-	2	0	FMO5	145150637	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.048000	0.76606	2.266000	0.75297	0.533000	0.62120	ATT	FMO5	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase	ENSG00000131781		0.423	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO5	HGNC	protein_coding	OTTHUMT00000040373.2	136	0.00	0	A	NM_001461		146684013	146684013	-1	no_errors	ENST00000254090	ensembl	human	known	69_37n	missense	275	28.20	108	SNP	1.000	T
GPRIN3	285513	genome.wustl.edu	37	4	90170956	90170956	+	Silent	SNP	C	C	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr4:90170956C>A	ENST00000609438.1	-	2	824	c.306G>T	c.(304-306)ctG>ctT	p.L102L	GPRIN3_ENST00000333209.4_Silent_p.L102L	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	102										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TGCTCCCTGGCAGCTGGGGAT	0.562																																						dbGAP											0													98.0	105.0	103.0					4																	90170956		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.306G>T	4.37:g.90170956C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVE4	Silent	SNP	NULL	p.L102	ENST00000609438.1	37	c.306	CCDS34030.1	4																																																																																			GPRIN3	-	NULL	ENSG00000185477		0.562	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN3	HGNC	protein_coding	OTTHUMT00000363540.2	127	0.00	0	C	NM_198281		90170956	90170956	-1	no_errors	ENST00000333209	ensembl	human	known	69_37n	silent	93	25.00	31	SNP	0.000	A
HIST1H2AM	8336	genome.wustl.edu	37	6	27860570	27860570	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr6:27860570T>A	ENST00000359611.2	-	1	393	c.358A>T	c.(358-360)Aag>Tag	p.K120*	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	120						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						CTCTCAGTCTTCTTGGGGAGC	0.502																																						dbGAP											0													129.0	124.0	126.0					6																	27860570		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.358A>T	6.37:g.27860570T>A	ENSP00000352627:p.Lys120*	Somatic		WXS	Illumina GAIIx	Phase_IV	P02261|Q2M1R2|Q76PA6	Nonsense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.K120*	ENST00000359611.2	37	c.358	CCDS4639.1	6	.	.	.	.	.	.	.	.	.	.	T	14.43	2.532456	0.45073	.	.	ENSG00000233224	ENST00000359611	.	.	.	4.15	4.15	0.48705	.	0.000000	0.31392	U	0.007737	.	.	.	.	.	.	0.45427	D	0.998407	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9982	0.58660	0.0:0.0:0.0:1.0	.	.	.	.	X	120	.	ENSP00000352627:K120X	K	-	1	0	HIST1H2AM	27968549	1.000000	0.71417	1.000000	0.80357	0.184000	0.23303	5.867000	0.69597	2.103000	0.63969	0.533000	0.62120	AAG	HIST1H2AM	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000233224		0.502	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AM	HGNC	protein_coding	OTTHUMT00000040162.1	116	0.00	0	T	NM_003514		27860570	27860570	-1	no_errors	ENST00000359611	ensembl	human	known	69_37n	nonsense	128	17.83	28	SNP	1.000	A
HTR2C	3358	genome.wustl.edu	37	X	114082686	114082686	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chrX:114082686G>A	ENST00000276198.1	+	5	1198	c.470G>A	c.(469-471)cGt>cAt	p.R157H	HTR2C_ENST00000371950.3_Intron|HTR2C_ENST00000371951.1_Missense_Mutation_p.R157H	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	157					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTAGCAATACGTAATCCTATT	0.408																																						dbGAP											0													156.0	131.0	140.0					X																	114082686		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.470G>A	X.37:g.114082686G>A	ENSP00000276198:p.Arg157His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT2C_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.R157H	ENST00000276198.1	37	c.470	CCDS14564.1	X	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076929	0.76415	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.19806	2.12;2.12	4.41	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.20706	-1.0267	10	0.46703	T	0.11	.	13.6001	0.62013	0.0:0.0:1.0:0.0	.	157	P28335	5HT2C_HUMAN	H	157	ENSP00000276198:R157H;ENSP00000361019:R157H	ENSP00000276198:R157H	R	+	2	0	HTR2C	113988942	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.635000	0.74295	1.771000	0.52183	0.544000	0.68410	CGT	HTR2C	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000147246		0.408	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2C	HGNC	protein_coding	OTTHUMT00000057962.1	273	0.00	0	G	NM_000868		114082686	114082686	+1	no_errors	ENST00000276198	ensembl	human	known	69_37n	missense	165	21.05	44	SNP	1.000	A
ITPKB	3707	genome.wustl.edu	37	1	226923335	226923335	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr1:226923335A>G	ENST00000272117.3	-	1	1824	c.1825T>C	c.(1825-1827)Tcc>Ccc	p.S609P	ITPKB_ENST00000429204.1_Missense_Mutation_p.S609P|ITPKB_ENST00000366784.1_Missense_Mutation_p.S609P			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	609					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TAGGATGAGGAGAAGCCCGTG	0.627																																					Colon(84;110 1851 5306 33547)	dbGAP											0													83.0	78.0	80.0					1																	226923335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1825T>C	1.37:g.226923335A>G	ENSP00000272117:p.Ser609Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	pfam_IPK	p.S609P	ENST00000272117.3	37	c.1825	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.876488	0.91664	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.53857	1.31;1.31;0.6	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.61274	0.2334	L	0.27053	0.805	0.53005	D	0.999961	D	0.89917	1.0	D	0.85130	0.997	T	0.61816	-0.6985	10	0.42905	T	0.14	-24.775	16.2119	0.82168	1.0:0.0:0.0:0.0	.	609	P27987	IP3KB_HUMAN	P	609	ENSP00000272117:S609P;ENSP00000411152:S609P;ENSP00000355748:S609P	ENSP00000272117:S609P	S	-	1	0	ITPKB	224989958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.744000	0.85034	2.288000	0.76882	0.482000	0.46254	TCC	ITPKB	-	NULL	ENSG00000143772		0.627	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	25	0.00	0	A	NM_002221		226923335	226923335	-1	no_errors	ENST00000272117	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	G
KIAA1462	57608	genome.wustl.edu	37	10	30336579	30336579	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr10:30336579C>T	ENST00000375377.1	-	2	264	c.163G>A	c.(163-165)Gca>Aca	p.A55T		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	55					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						TTACGATGTGCGAGGGCCGCA	0.662																																						dbGAP											0													46.0	52.0	50.0					10																	30336579		2030	4176	6206	-	-	-	SO:0001583	missense	0			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.163G>A	10.37:g.30336579C>T	ENSP00000364526:p.Ala55Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	NULL	p.A55T	ENST00000375377.1	37	c.163	CCDS41500.1	10	.	.	.	.	.	.	.	.	.	.	C	10.52	1.374521	0.24857	.	.	ENSG00000165757	ENST00000375377	T	0.12774	2.65	5.06	2.14	0.27477	.	0.629960	0.13893	N	0.355473	T	0.06050	0.0157	N	0.14661	0.345	0.09310	N	1	B	0.32893	0.389	B	0.24269	0.052	T	0.39623	-0.9605	10	0.21540	T	0.41	-6.5991	6.2449	0.20811	0.0:0.5963:0.21:0.1937	.	55	Q9P266	K1462_HUMAN	T	55	ENSP00000364526:A55T	ENSP00000364526:A55T	A	-	1	0	KIAA1462	30376585	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.446000	0.21694	0.246000	0.21394	0.467000	0.42956	GCA	KIAA1462	-	NULL	ENSG00000165757		0.662	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	HGNC	protein_coding	OTTHUMT00000047409.1	39	0.00	0	C	NM_020848		30336579	30336579	-1	no_errors	ENST00000375377	ensembl	human	known	69_37n	missense	32	30.43	14	SNP	0.001	T
LRP11	84918	genome.wustl.edu	37	6	150174187	150174187	+	Silent	SNP	G	G	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr6:150174187G>A	ENST00000239367.2	-	2	728	c.723C>T	c.(721-723)gtC>gtT	p.V241V	LRP11_ENST00000367368.2_Silent_p.V241V|RP11-350J20.12_ENST00000472053.2_RNA|LRP11_ENST00000546019.1_5'UTR	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	241	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.					integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		ACTCATACTGGACGATGGCGT	0.562																																						dbGAP											0													92.0	79.0	83.0					6																	150174187		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.723C>T	6.37:g.150174187G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYC0|Q96SN6	Silent	SNP	pfam_MANSC_N,pfam_LDrepeatLR_classA_rpt,superfamily_PKD_dom,superfamily_LDrepeatLR_classA_rpt,smart_MANSC_N,smart_PKD/Chitinase_dom,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_MANSC,pfscan_PKD_dom	p.V241	ENST00000239367.2	37	c.723	CCDS5220.1	6																																																																																			LRP11	-	superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	ENSG00000120256		0.562	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP11	HGNC	protein_coding	OTTHUMT00000042664.1	53	0.00	0	G	NM_032832		150174187	150174187	-1	no_errors	ENST00000239367	ensembl	human	known	69_37n	silent	70	38.79	45	SNP	0.764	A
MAP3K1	4214	genome.wustl.edu	37	5	56178146	56178146	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr5:56178146delA	ENST00000399503.3	+	14	3119	c.3119delA	c.(3118-3120)gatfs	p.D1040fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1040					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AAAGACTCAGATAAACTTTCC	0.448																																						dbGAP											0													67.0	67.0	67.0					5																	56178146		1861	4091	5952	-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3119delA	5.37:g.56178146delA	ENSP00000382423:p.Asp1040fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.D1040fs	ENST00000399503.3	37	c.3119	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.448	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	168	0.00	0	A	XM_042066		56178146	56178146	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	79	43.92	65	DEL	0.989	-
MAP3K1	4214	genome.wustl.edu	37	5	56178150	56178153	+	Frame_Shift_Del	DEL	ACTT	ACTT	-			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	ACTT	ACTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr5:56178150_56178153delACTT	ENST00000399503.3	+	14	3123_3126	c.3123_3126delACTT	c.(3121-3126)aaacttfs	p.KL1041fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1041					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		ACTCAGATAAACTTTCCCCAGTCT	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3123_3126delACTT	5.37:g.56178150_56178153delACTT	ENSP00000382423:p.Lys1041fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.K1041fs	ENST00000399503.3	37	c.3123_3126	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.446	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	171	0.00	0	ACTT	XM_042066		56178150	56178153	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	82	43.92	65	DEL	1.000:1.000:1.000:1.000	-
MRPL15	29088	genome.wustl.edu	37	8	55049108	55049108	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr8:55049108G>A	ENST00000260102.4	+	2	220	c.146G>A	c.(145-147)tGt>tAt	p.C49Y		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	49	Arg-rich.				translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			GGTAGAAAATGTGGCAGAGGC	0.458																																						dbGAP											0													58.0	64.0	62.0					8																	55049108		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.146G>A	8.37:g.55049108G>A	ENSP00000260102:p.Cys49Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96Q54|Q9H0Y1	Missense_Mutation	SNP	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	p.C49Y	ENST00000260102.4	37	c.146	CCDS6158.1	8	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575356	0.65878	.	.	ENSG00000137547	ENST00000260102;ENST00000519831	.	.	.	5.71	5.71	0.89125	Ribosomal protein L18e/L15P (2);	0.087785	0.85682	D	0.000000	T	0.76912	0.4054	M	0.86953	2.85	0.53688	D	0.999972	P	0.38195	0.622	B	0.42245	0.381	T	0.77918	-0.2408	9	0.42905	T	0.14	-37.703	19.8772	0.96880	0.0:0.0:1.0:0.0	.	49	Q9P015	RM15_HUMAN	Y	49	.	ENSP00000260102:C49Y	C	+	2	0	MRPL15	55211661	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.712000	0.98738	2.686000	0.91538	0.650000	0.86243	TGT	MRPL15	-	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	ENSG00000137547		0.458	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL15	HGNC	protein_coding	OTTHUMT00000378254.1	80	0.00	0	G	NM_014175		55049108	55049108	+1	no_errors	ENST00000260102	ensembl	human	known	69_37n	missense	96	17.24	20	SNP	1.000	A
NBPF14	25832	genome.wustl.edu	37	1	148005450	148005451	+	In_Frame_Ins	INS	-	-	CTC			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr1:148005450_148005451insCTC	ENST00000369219.1	-	21	2490_2491	c.2474_2475insGAG	c.(2473-2475)aga>agGAGa	p.825_825R>RR				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	825	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					ttcttccccttcttctttcctt	0.426																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2474_2475insGAG	1.37:g.148005450_148005451insCTC	ENSP00000358221:p.Arg826dup	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TI23|Q8IX76|Q9UJI9	In_Frame_Ins	INS	pfam_NBPF_dom	p.827in_frame_insR	ENST00000369219.1	37	c.2475_2474		1																																																																																			NBPF14	-	NULL	ENSG00000122497		0.426	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	NBPF14	HGNC	protein_coding		46	0.00	0	-	NM_015383		148005450	148005451	-1	no_errors	ENST00000369219	ensembl	human	known	69_37n	in_frame_ins	37	17.78	8	INS	0.028:0.027	CTC
NBPF9	400818	genome.wustl.edu	37	1	144827098	144827098	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr1:144827098C>T	ENST00000440491.2	+	14	1691	c.1691C>T	c.(1690-1692)aCg>aTg	p.T564M	NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000338347.4_Silent_p.D490D|NBPF9_ENST00000281815.8_Intron	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	0	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						TTTCTCTTGACGTGGGAGGTG	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000440491.2:c.1691C>T	1.37:g.144827098C>T	ENSP00000390934:p.Thr564Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NBPF_dom	p.T564M	ENST00000440491.2	37	c.1691		1	.	.	.	.	.	.	.	.	.	.	.	7.494	0.651255	0.14516	.	.	ENSG00000168614	ENST00000440491;ENST00000375552	T	0.07114	3.22	0.56	-1.05	0.10036	.	.	.	.	.	T	0.01661	0.0053	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47446	-0.9117	4	.	.	.	.	.	.	.	.	.	.	.	M	564	ENSP00000390934:T564M	.	T	+	2	0	NBPF9	143538455	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-0.614000	0.05604	-0.340000	0.08388	0.134000	0.15878	ACG	NBPF9	-	pfam_NBPF_dom	ENSG00000168614		0.448	NBPF9-203	KNOWN	basic	protein_coding	NBPF9	HGNC	protein_coding		40	0.00	0	C	NM_001037675		144827098	144827098	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000375552	ensembl	human	known	69_37n	missense	18	14.29	3	SNP	0.002	T
OTOA	146183	genome.wustl.edu	37	16	21728239	21728239	+	Silent	SNP	G	G	A	rs199908646		TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr16:21728239G>A	ENST00000286149.4	+	14	1543	c.1542G>A	c.(1540-1542)gcG>gcA	p.A514A	OTOA_ENST00000388958.3_Silent_p.A500A|OTOA_ENST00000388956.4_Silent_p.A421A|OTOA_ENST00000388957.3_Silent_p.A176A			Q7RTW8	OTOAN_HUMAN	otoancorin	514					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TGGTCCAAGCGGAAGACACTG	0.463																																						dbGAP											0													144.0	135.0	138.0					16																	21728239		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1542G>A	16.37:g.21728239G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Silent	SNP	NULL	p.A514	ENST00000286149.4	37	c.1542		16																																																																																			OTOA	-	NULL	ENSG00000155719		0.463	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	194	0.00	0	G			21728239	21728239	+1	no_errors	ENST00000286149	ensembl	human	known	69_37n	silent	297	21.32	81	SNP	0.001	A
P2RY6	5031	genome.wustl.edu	37	11	73008182	73008182	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr11:73008182G>T	ENST00000393590.2	+	2	918	c.619G>T	c.(619-621)Gcc>Tcc	p.A207S	P2RY6_ENST00000540342.1_Missense_Mutation_p.A207S|P2RY6_ENST00000393591.1_Missense_Mutation_p.A207S|P2RY6_ENST00000349767.2_Missense_Mutation_p.A207S|P2RY6_ENST00000540124.1_Missense_Mutation_p.A207S|P2RY6_ENST00000538328.1_Missense_Mutation_p.A207S|P2RY6_ENST00000542092.1_Missense_Mutation_p.A207S|P2RY6_ENST00000393592.2_Missense_Mutation_p.A207S	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	207					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						GCCCTTTGCTGCCCTGCTGGC	0.677																																						dbGAP											0													81.0	78.0	79.0					11																	73008182		2187	4280	6467	-	-	-	SO:0001583	missense	0				CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.619G>T	11.37:g.73008182G>T	ENSP00000377215:p.Ala207Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15754	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_P2Y6_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_P2Y3_purnocptor,prints_Protea_act_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.A207S	ENST00000393590.2	37	c.619	CCDS8220.1	11	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767394	0.69878	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000536225;ENST00000535931;ENST00000538328	T;T;T;T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83	4.51	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.125505	0.53938	D	0.000055	T	0.17704	0.0425	L	0.31371	0.925	0.35312	D	0.784028	P	0.36354	0.549	B	0.34536	0.185	T	0.22208	-1.0223	10	0.87932	D	0	.	10.2846	0.43560	0.0:0.1384:0.6983:0.1633	.	207	Q15077	P2RY6_HUMAN	S	207;207;207;207;207;207;207;46;207;207	ENSP00000443427:A207S;ENSP00000445652:A207S;ENSP00000309771:A207S;ENSP00000377217:A207S;ENSP00000377216:A207S;ENSP00000442551:A207S;ENSP00000377215:A207S;ENSP00000442509:A46S;ENSP00000440770:A207S;ENSP00000442990:A207S	ENSP00000309771:A207S	A	+	1	0	P2RY6	72685830	0.961000	0.32948	0.319000	0.25293	0.995000	0.86356	2.646000	0.46630	0.522000	0.28464	0.561000	0.74099	GCC	P2RY6	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171631		0.677	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	P2RY6	HGNC	protein_coding	OTTHUMT00000397349.1	31	0.00	0	G			73008182	73008182	+1	no_errors	ENST00000349767	ensembl	human	known	69_37n	missense	23	45.24	19	SNP	0.960	T
PCDHA6	56142	genome.wustl.edu	37	5	140209877	140209877	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr5:140209877C>T	ENST00000529310.1	+	1	2315	c.2201C>T	c.(2200-2202)gCg>gTg	p.A734V	PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	734					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGTGCACGGCGGACAAGCCC	0.687																																						dbGAP											0													45.0	44.0	44.0					5																	140209877		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2201C>T	5.37:g.140209877C>T	ENSP00000433378:p.Ala734Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A734V	ENST00000529310.1	37	c.2201	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	C	4.817	0.151934	0.09185	.	.	ENSG00000081842	ENST00000529310	T	0.11712	2.75	4.12	3.25	0.37280	.	0.235442	0.21287	U	0.077055	T	0.07954	0.0199	L	0.40543	1.245	0.09310	N	0.999999	B;B	0.13145	0.0;0.007	B;B	0.06405	0.001;0.002	T	0.25537	-1.0129	10	0.36615	T	0.2	.	4.0399	0.09746	0.1863:0.6148:0.0:0.1988	.	734;734	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	V	734	ENSP00000433378:A734V	ENSP00000433378:A734V	A	+	2	0	PCDHA6	140190061	0.512000	0.26186	0.002000	0.10522	0.002000	0.02628	1.398000	0.34554	1.090000	0.41315	-0.683000	0.03753	GCG	PCDHA6	-	NULL	ENSG00000081842		0.687	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	29	0.00	0	C	NM_018909		140209877	140209877	+1	no_errors	ENST00000529310	ensembl	human	known	69_37n	missense	23	34.29	12	SNP	0.000	T
PIK3AP1	118788	genome.wustl.edu	37	10	98469721	98469721	+	Silent	SNP	G	G	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr10:98469721G>A	ENST00000339364.5	-	2	152	c.33C>T	c.(31-33)gaC>gaT	p.D11D		NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	11	Necessary and sufficent to mediate inhibition of NF-kappa-B downstream of activated TLRs; may mediate interaction with MYD88 and TIRAP. {ECO:0000250}.				negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		CGATGAGGATGTCGCATCCTC	0.582																																						dbGAP											0													56.0	48.0	51.0					10																	98469721		2176	4263	6439	-	-	-	SO:0001819	synonymous_variant	0			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.33C>T	10.37:g.98469721G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Silent	SNP	superfamily_Ankyrin_rpt-contain_dom	p.D11	ENST00000339364.5	37	c.33	CCDS31259.1	10																																																																																			PIK3AP1	-	NULL	ENSG00000155629		0.582	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3AP1	HGNC	protein_coding	OTTHUMT00000049619.2	43	0.00	0	G	NM_152309		98469721	98469721	-1	no_errors	ENST00000339364	ensembl	human	known	69_37n	silent	29	46.30	25	SNP	1.000	A
POM121L12	285877	genome.wustl.edu	37	7	53104223	53104223	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr7:53104223G>T	ENST00000408890.4	+	1	875	c.859G>T	c.(859-861)Gtc>Ttc	p.V287F		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	287										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CGCCCTCGAGGTCACCCAGTC	0.612																																						dbGAP											0													42.0	47.0	45.0					7																	53104223		2009	4172	6181	-	-	-	SO:0001583	missense	0				CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.859G>T	7.37:g.53104223G>T	ENSP00000386133:p.Val287Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDI9	Missense_Mutation	SNP	NULL	p.V287F	ENST00000408890.4	37	c.859	CCDS43584.1	7	.	.	.	.	.	.	.	.	.	.	G	7.942	0.742933	0.15642	.	.	ENSG00000221900	ENST00000408890	T	0.26957	1.7	1.97	1.97	0.26223	.	.	.	.	.	T	0.12944	0.0314	N	0.08118	0	0.09310	N	1	B	0.30114	0.269	B	0.31245	0.126	T	0.20042	-1.0287	9	0.46703	T	0.11	.	7.4708	0.27347	0.0:0.0:1.0:0.0	.	287	Q8N7R1	P1L12_HUMAN	F	287	ENSP00000386133:V287F	ENSP00000386133:V287F	V	+	1	0	POM121L12	53071717	0.129000	0.22400	0.003000	0.11579	0.001000	0.01503	1.279000	0.33191	1.446000	0.47643	0.561000	0.74099	GTC	POM121L12	-	NULL	ENSG00000221900		0.612	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L12	HGNC	protein_coding	OTTHUMT00000342656.1	39	0.00	0	G	NM_182595		53104223	53104223	+1	no_errors	ENST00000408890	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	0.003	T
PRND	23627	genome.wustl.edu	37	20	4705388	4705388	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr20:4705388G>A	ENST00000305817.2	+	2	262	c.191G>A	c.(190-192)cGc>cAc	p.R64H		NM_012409.2	NP_036541.2	Q9UKY0	PRND_HUMAN	prion protein 2 (dublet)	64	Globular.				protein homooligomerization (GO:0051260)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	13						AAGCAAGGCCGCAAGCTCGAC	0.607																																						dbGAP											0													72.0	54.0	60.0					20																	4705388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106918	CCDS13081.1	20p13	2013-09-19			ENSG00000171864	ENSG00000171864			15748	protein-coding gene	gene with protein product	"""prion-like protein doppel"""	604263				10525406, 10577243	Standard	NM_012409		Approved	DPL, dJ1068H6.4, DOPPEL, PrPLP	uc002wkz.3	Q9UKY0	OTTHUMG00000031789	ENST00000305817.2:c.191G>A	20.37:g.4705388G>A	ENSP00000306900:p.Arg64His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7U7M5|Q9H311|Q9H312|Q9NTM4	Missense_Mutation	SNP	pfam_Prion/Doppel_prot_b-ribbon_dom,pfam_Doppel,superfamily_Prion/Doppel_prot_b-ribbon_dom	p.R64H	ENST00000305817.2	37	c.191	CCDS13081.1	20	.	.	.	.	.	.	.	.	.	.	G	8.897	0.955366	0.18507	.	.	ENSG00000171864	ENST00000305817	D	0.89810	-2.57	5.37	1.13	0.20643	Prion/Doppel protein, beta-ribbon domain (3);	0.565431	0.13974	N	0.349984	D	0.83672	0.5305	L	0.53249	1.67	0.09310	N	0.999992	B	0.22211	0.066	B	0.23574	0.047	T	0.73767	-0.3879	10	0.66056	D	0.02	-19.87	4.6094	0.12395	0.2707:0.161:0.5683:0.0	.	64	Q9UKY0	PRND_HUMAN	H	64	ENSP00000306900:R64H	ENSP00000306900:R64H	R	+	2	0	PRND	4653388	0.011000	0.17503	0.104000	0.21259	0.047000	0.14425	0.065000	0.14466	-0.014000	0.14175	0.557000	0.71058	CGC	PRND	-	pfam_Prion/Doppel_prot_b-ribbon_dom,superfamily_Prion/Doppel_prot_b-ribbon_dom	ENSG00000171864		0.607	PRND-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRND	HGNC	protein_coding	OTTHUMT00000077827.2	32	0.00	0	G	NM_012409		4705388	4705388	+1	no_errors	ENST00000305817	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.140	A
RIPK1	8737	genome.wustl.edu	37	6	3077011	3077012	+	5'UTR	INS	-	-	G	rs375497021|rs202096237|rs368197023	byFrequency	TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr6:3077011_3077012insG	ENST00000259808.4	+	0	252_253				RIPK1_ENST00000479389.1_Intron|RIPK1_ENST00000380409.2_5'Flank|RIPK1_ENST00000541791.1_5'Flank			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				ACAGCTCTGCCGGGGGGGGAAA	0.391																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.-46->G	6.37:g.3077019_3077019dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	RNA	INS	-	NULL	ENST00000259808.4	37	NULL	CCDS4482.1	6																																																																																			RIPK1	-	-	ENSG00000137275		0.391	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	24	0.00	0	-	NM_003804		3077011	3077012	+1	no_errors	ENST00000490396	ensembl	human	known	69_37n	rna	31	13.89	5	INS	0.000:0.000	G
SFSWAP	6433	genome.wustl.edu	37	12	132281853	132281854	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr12:132281853_132281854insC	ENST00000261674.4	+	16	2806_2807	c.2665_2666insC	c.(2665-2667)tcafs	p.S889fs	SFSWAP_ENST00000539506.1_3'UTR|SFSWAP_ENST00000541286.1_Frame_Shift_Ins_p.S941fs	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	889	Arg/Ser-rich (RS domain).				mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						CTCGGCGCACTCAGCCAGCGTC	0.718																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.2666dupC	12.37:g.132281854_132281854dupC	ENSP00000261674:p.Ser889fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Frame_Shift_Ins	INS	pfam_SWAP_N_domain,pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	p.A890fs	ENST00000261674.4	37	c.2665_2666	CCDS9273.1	12																																																																																			SFSWAP	-	NULL	ENSG00000061936		0.718	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SFSWAP	HGNC	protein_coding	OTTHUMT00000399276.1	50	0.00	0	-	NM_004592		132281853	132281854	+1	no_errors	ENST00000261674	ensembl	human	known	69_37n	frame_shift_ins	45	15.09	8	INS	1.000:1.000	C
SLC26A6	65010	genome.wustl.edu	37	3	48664481	48664481	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr3:48664481C>G	ENST00000395550.2	-	18	1948	c.1901G>C	c.(1900-1902)aGc>aCc	p.S634T	SLC26A6_ENST00000358747.6_Missense_Mutation_p.S613T|SLC26A6_ENST00000383733.3_Missense_Mutation_p.S615T|SLC26A6_ENST00000420764.2_Missense_Mutation_p.S633T|SLC26A6_ENST00000337000.8_Missense_Mutation_p.S526T|SLC26A6_ENST00000455886.2_Missense_Mutation_p.S598T			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	634	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		ATCTCCTGAGCTCACCTGCTG	0.597																																					NSCLC(13;369 479 28271 30152 44026)	dbGAP											0													83.0	89.0	87.0					3																	48664481		2065	4204	6269	-	-	-	SO:0001583	missense	0			AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.1901G>C	3.37:g.48664481C>G	ENSP00000378920:p.Ser634Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.S634T	ENST00000395550.2	37	c.1901	CCDS43087.1	3	.	.	.	.	.	.	.	.	.	.	C	5.805	0.332827	0.11013	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886	D;D;D;D;D;D	0.93076	-2.99;-3.01;-3.09;-3.0;-3.01;-3.16	3.63	0.247	0.15521	Sulphate transporter/antisigma-factor antagonist STAS (3);	.	.	.	.	D	0.89722	0.6797	L	0.33189	0.99	0.09310	N	1	B;B;B;B;B;B;D	0.53885	0.116;0.007;0.046;0.027;0.006;0.004;0.963	B;B;B;B;B;B;P	0.57425	0.126;0.012;0.045;0.012;0.049;0.012;0.82	T	0.80046	-0.1546	9	0.07990	T	0.79	.	3.272	0.06886	0.0:0.4189:0.2156:0.3655	.	598;628;526;615;633;634;4020	B4DMZ1;Q86YZ4;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;.;S26A6_HUMAN;.	T	633;634;615;526;628;613;598	ENSP00000404684:S633T;ENSP00000378920:S634T;ENSP00000373239:S615T;ENSP00000337648:S526T;ENSP00000351597:S613T;ENSP00000401066:S598T	ENSP00000337648:S526T	S	-	2	0	SLC26A6	48639485	0.000000	0.05858	0.006000	0.13384	0.296000	0.27459	-0.522000	0.06237	0.030000	0.15379	0.491000	0.48974	AGC	SLC26A6	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	ENSG00000225697		0.597	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC26A6	HGNC	protein_coding	OTTHUMT00000345040.1	47	0.00	0	C	NM_022911		48664481	48664481	-1	no_errors	ENST00000395550	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	0.032	G
SOWAHC	65124	genome.wustl.edu	37	2	110373219	110373220	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr2:110373219_110373220insG	ENST00000356454.3	+	1	1309_1310	c.1153_1154insG	c.(1153-1155)agcfs	p.S385fs	SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000415095.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	385																	CCTGAGTCGGAGCATCGCCGAG	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.1154dupG	2.37:g.110373220_110373220dupG	ENSP00000365830:p.Ser385fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NE15|Q9H6U1	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S385fs	ENST00000356454.3	37	c.1153_1154	CCDS33270.1	2																																																																																			SOWAHC	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000198142		0.653	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOWAHC	HGNC	protein_coding	OTTHUMT00000330168.1	21	0.00	0	-	NM_023016		110373219	110373220	+1	no_errors	ENST00000356454	ensembl	human	known	69_37n	frame_shift_ins	5	88.37	38	INS	0.641:0.650	G
WDR17	116966	genome.wustl.edu	37	4	177071638	177071638	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr4:177071638A>G	ENST00000280190.4	+	17	2426	c.2270A>G	c.(2269-2271)aAt>aGt	p.N757S	WDR17_ENST00000508596.1_Missense_Mutation_p.N733S|WDR17_ENST00000393643.2_Missense_Mutation_p.N733S|WDR17_ENST00000507824.2_Missense_Mutation_p.N740S			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	757										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GGCAGTGACAATTTATGGAAC	0.318																																						dbGAP											0													106.0	104.0	105.0					4																	177071638		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2270A>G	4.37:g.177071638A>G	ENSP00000280190:p.Asn757Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.N757S	ENST00000280190.4	37	c.2270	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	A	18.98	3.737997	0.69304	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.61158	0.17;0.2;0.13	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.75860	0.3907	M	0.76574	2.34	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	T	0.78974	-0.1992	10	0.72032	D	0.01	-22.2725	15.7711	0.78170	1.0:0.0:0.0:0.0	.	733;757	E7EQX0;Q8IZU2	.;WDR17_HUMAN	S	733;733;757;740	ENSP00000422763:N733S;ENSP00000377258:N733S;ENSP00000280190:N757S	ENSP00000280190:N757S	N	+	2	0	WDR17	177308632	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	8.619000	0.90938	2.136000	0.66102	0.460000	0.39030	AAT	WDR17	-	NULL	ENSG00000150627		0.318	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	80	0.00	0	A			177071638	177071638	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	72	16.28	14	SNP	1.000	G
WTAP	9589	genome.wustl.edu	37	6	160163165	160163165	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr6:160163165C>A	ENST00000358372.4	+	4	1889	c.132C>A	c.(130-132)taC>taA	p.Y44*	SOD2_ENST00000546087.1_Intron|WTAP_ENST00000337387.4_Nonsense_Mutation_p.Y44*	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	44					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		AGGGCAAGTACACAGATCTTA	0.269																																						dbGAP											0													87.0	92.0	90.0					6																	160163165		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.132C>A	6.37:g.160163165C>A	ENSP00000351141:p.Tyr44*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Nonsense_Mutation	SNP	NULL	p.Y44*	ENST00000358372.4	37	c.132	CCDS5266.1	6	.	.	.	.	.	.	.	.	.	.	C	51	17.501438	0.99887	.	.	ENSG00000146457	ENST00000358372;ENST00000337387	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4289	19.3072	0.94167	0.0:1.0:0.0:0.0	.	.	.	.	X	44	.	ENSP00000336911:Y44X	Y	+	3	2	WTAP	160083155	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.625000	0.54238	2.561000	0.86390	0.585000	0.79938	TAC	WTAP	-	NULL	ENSG00000146457		0.269	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTAP	HGNC	protein_coding	OTTHUMT00000042905.1	37	0.00	0	C	NM_152857		160163165	160163165	+1	no_errors	ENST00000358372	ensembl	human	known	69_37n	nonsense	14	75.44	43	SNP	1.000	A
ZFP36L1	677	genome.wustl.edu	37	14	69256761	69256761	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07F-01A-11W-A019-09	TCGA-A8-A07F-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	73d907e6-4ba0-431f-a009-8366644ffaf0	5281a45b-e0b8-404f-ae25-91cd7ae5bf30	g.chr14:69256761T>G	ENST00000439696.2	-	2	807	c.506A>C	c.(505-507)tAc>tCc	p.Y169S	ZFP36L1_ENST00000336440.3_Missense_Mutation_p.Y169S|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	169					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GCGGGGCCCGTAGGGGCAAAA	0.672											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													37.0	43.0	41.0					14																	69256761		2203	4300	6503	-	-	-	SO:0001583	missense	0			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.506A>C	14.37:g.69256761T>G	ENSP00000388402:p.Tyr169Ser	Somatic	1113	WXS	Illumina GAIIx	Phase_IV	Q13851	Missense_Mutation	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.Y169S	ENST00000439696.2	37	c.506	CCDS9791.1	14	.	.	.	.	.	.	.	.	.	.	T	17.89	3.500526	0.64298	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246;ENST00000557086;ENST00000557022	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	4.5	3.34	0.38264	Zinc finger, CCCH-type (3);	0.379769	0.24436	N	0.038549	T	0.78477	0.4289	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80358	-0.1416	10	0.87932	D	0	0.6589	10.0498	0.42208	0.0:0.0803:0.0:0.9197	.	169	Q07352	TISB_HUMAN	S	169;169;152;175;147	ENSP00000388402:Y169S;ENSP00000337386:Y169S;ENSP00000450784:Y175S;ENSP00000450600:Y147S	ENSP00000337386:Y169S	Y	-	2	0	ZFP36L1	68326514	1.000000	0.71417	0.818000	0.32626	0.995000	0.86356	5.009000	0.63998	0.743000	0.32719	0.477000	0.44152	TAC	ZFP36L1	-	pfam_Znf_CCCH,smart_Znf_CCCH	ENSG00000185650		0.672	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L1	HGNC	protein_coding	OTTHUMT00000413227.1	32	0.00	0	T			69256761	69256761	-1	no_errors	ENST00000336440	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	G
