#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS14	140766	genome.wustl.edu	37	10	72434406	72434407	+	Frame_Shift_Del	DEL	CC	CC	-	rs369056214		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr10:72434406_72434407delCC	ENST00000373207.1	+	2	177_178	c.177_178delCC	c.(175-180)ggcccafs	p.P60fs	ADAMTS14_ENST00000373208.1_Frame_Shift_Del_p.P60fs	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	60					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TGGTGTCTGGCCCAGCAGCAGC	0.624																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.177_178delCC	10.37:g.72434406_72434407delCC	ENSP00000362303:p.Pro60fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Frame_Shift_Del	DEL	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P60fs	ENST00000373207.1	37	c.177_178	CCDS7306.1	10																																																																																			ADAMTS14	-	pfam_Peptidase_M12B_N	ENSG00000138316		0.624	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	10	0.00	0	CC	NM_080722		72434406	72434407	+1	no_errors	ENST00000373208	ensembl	human	known	69_37n	frame_shift_del	9	43.75	7	DEL	0.840:0.994	-
AKR7A3	22977	genome.wustl.edu	37	1	19612756	19612756	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr1:19612756G>C	ENST00000361640.4	-	2	865	c.325C>G	c.(325-327)Ctc>Gtc	p.L109V		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	109					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGGTAGAAGAGGTCCACTCGG	0.612																																						dbGAP											0													71.0	75.0	73.0					1																	19612756		2199	4300	6499	-	-	-	SO:0001583	missense	0			AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.325C>G	1.37:g.19612756G>C	ENSP00000355377:p.Leu109Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.L109V	ENST00000361640.4	37	c.325	CCDS193.1	1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548111	0.45383	.	.	ENSG00000162482	ENST00000361640	T	0.29142	1.58	3.21	2.25	0.28309	NADP-dependent oxidoreductase domain (3);	0.059633	0.64402	D	0.000002	T	0.43033	0.1229	M	0.72576	2.205	0.48236	D	0.99961	P	0.43662	0.814	P	0.52031	0.688	T	0.31641	-0.9936	10	0.52906	T	0.07	.	10.1073	0.42541	0.0:0.0:0.7979:0.2021	.	109	O95154	ARK73_HUMAN	V	109	ENSP00000355377:L109V	ENSP00000355377:L109V	L	-	1	0	AKR7A3	19485343	1.000000	0.71417	1.000000	0.80357	0.544000	0.35116	2.986000	0.49370	0.507000	0.28148	0.194000	0.17425	CTC	AKR7A3	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000162482		0.612	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR7A3	HGNC	protein_coding	OTTHUMT00000007166.1	43	0.00	0	G	NM_012067		19612756	19612756	-1	no_errors	ENST00000361640	ensembl	human	known	69_37n	missense	53	23.19	16	SNP	1.000	C
ARHGEF17	9828	genome.wustl.edu	37	11	73022275	73022275	+	Silent	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr11:73022275C>T	ENST00000263674.3	+	1	2942	c.2592C>T	c.(2590-2592)ccC>ccT	p.P864P	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	864					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GCAGCGAGCCCATCCTTGTAG	0.672																																						dbGAP											0													37.0	40.0	39.0					11																	73022275		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.2592C>T	11.37:g.73022275C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.P864	ENST00000263674.3	37	c.2592	CCDS8221.1	11																																																																																			ARHGEF17	-	NULL	ENSG00000110237		0.672	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	HGNC	protein_coding	OTTHUMT00000397365.1	19	0.00	0	C	NM_014786		73022275	73022275	+1	no_errors	ENST00000263674	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	1.000	T
AWAT1	158833	genome.wustl.edu	37	X	69459689	69459689	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chrX:69459689G>A	ENST00000374521.3	+	6	778	c.737G>A	c.(736-738)cGt>cAt	p.R246H		NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	246					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						TGCTTCCGCCGTATCTTTGGT	0.502													G|||	1	0.000264901	0.0008	0.0	3775	,	,		13693	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													132.0	120.0	124.0					X																	69459689		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.737G>A	X.37:g.69459689G>A	ENSP00000363645:p.Arg246His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT21|Q6IEE4	Missense_Mutation	SNP	pfam_DAGAT	p.R246H	ENST00000374521.3	37	c.737	CCDS35321.1	X	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589780	0.28357	.	.	ENSG00000204195	ENST00000374521	T	0.15372	2.43	5.39	1.51	0.23008	.	0.893166	0.09691	N	0.768393	T	0.18718	0.0449	M	0.62016	1.91	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.26430	-1.0103	10	0.52906	T	0.07	0.0839	7.5678	0.27890	0.5028:0.0:0.4972:0.0	.	246	Q58HT5	AWAT1_HUMAN	H	246	ENSP00000363645:R246H	ENSP00000363645:R246H	R	+	2	0	AWAT1	69376414	0.282000	0.24268	0.000000	0.03702	0.881000	0.50899	1.623000	0.37008	-0.029000	0.13827	-0.245000	0.11935	CGT	AWAT1	-	pfam_DAGAT	ENSG00000204195		0.502	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT1	HGNC	protein_coding	OTTHUMT00000057066.3	367	0.00	0	G	NM_001013579		69459689	69459689	+1	no_errors	ENST00000374521	ensembl	human	known	69_37n	missense	287	23.26	87	SNP	0.000	A
BMS1	9790	genome.wustl.edu	37	10	43287948	43287948	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr10:43287948G>A	ENST00000374518.5	+	7	850	c.787G>A	c.(787-789)Gat>Aat	p.D263N		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	263					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TAGGATGGAAGATTTGACAAA	0.368																																						dbGAP											0													107.0	112.0	110.0					10																	43287948		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.787G>A	10.37:g.43287948G>A	ENSP00000363642:p.Asp263Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	pfam_BMS1_TSR1_C,pfam_AARP2CN,pfam_ProtSyn_GTP-bd,smart_AARP2CN	p.D263N	ENST00000374518.5	37	c.787	CCDS7199.1	10	.	.	.	.	.	.	.	.	.	.	g	34	5.320408	0.95682	.	.	ENSG00000165733	ENST00000374518	T	0.46063	0.88	5.48	5.48	0.80851	AARP2CN (2);	0.000000	0.85682	D	0.000000	T	0.72028	0.3410	M	0.91768	3.24	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.73062	-0.4101	10	0.28530	T	0.3	.	19.5109	0.95141	0.0:0.0:1.0:0.0	.	263	Q14692	BMS1_HUMAN	N	263	ENSP00000363642:D263N	ENSP00000363642:D263N	D	+	1	0	BMS1	42607954	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.167000	0.94773	2.614000	0.88457	0.573000	0.79308	GAT	BMS1	-	pfam_AARP2CN,smart_AARP2CN	ENSG00000165733		0.368	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMS1	HGNC	protein_coding	OTTHUMT00000047690.2	274	0.00	0	G	NM_014753		43287948	43287948	+1	no_errors	ENST00000374518	ensembl	human	known	69_37n	missense	226	20.42	58	SNP	1.000	A
CAPSL	133690	genome.wustl.edu	37	5	35921198	35921198	+	Nonsense_Mutation	SNP	G	G	A	rs575446116		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr5:35921198G>A	ENST00000397367.2	-	2	151	c.25C>T	c.(25-27)Cga>Tga	p.R9*	CAPSL_ENST00000514524.1_Nonsense_Mutation_p.R9*|CAPSL_ENST00000397366.1_Nonsense_Mutation_p.R9*	NM_144647.3	NP_653248.3	Q8WWF8	CAPSL_HUMAN	calcyphosine-like	9						cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(10)|skin(1)|urinary_tract(1)	19	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)			GCCATCTCTCGGTCATGGCGC	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16867	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													88.0	76.0	80.0					5																	35921198		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC017586	CCDS3912.2	5p13.2	2013-01-10			ENSG00000152611	ENSG00000152611		"""EF-hand domain containing"""	28375	protein-coding gene	gene with protein product						12477932	Standard	NM_001042625		Approved	MGC26610	uc003jju.1	Q8WWF8	OTTHUMG00000131109	ENST00000397367.2:c.25C>T	5.37:g.35921198G>A	ENSP00000380524:p.Arg9*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,prints_Recoverin,pfscan_EF_HAND_2	p.R9*	ENST00000397367.2	37	c.25	CCDS3912.2	5	.	.	.	.	.	.	.	.	.	.	G	28.4	4.920280	0.92249	.	.	ENSG00000152611	ENST00000397367;ENST00000397366;ENST00000513623;ENST00000514524	.	.	.	4.8	2.97	0.34412	.	0.000000	0.42294	U	0.000739	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-4.8307	13.426	0.61026	0.0:0.0:0.713:0.287	.	.	.	.	X	9	.	ENSP00000380523:R9X	R	-	1	2	CAPSL	35956955	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	3.827000	0.55745	0.521000	0.28445	-0.311000	0.09066	CGA	CAPSL	-	NULL	ENSG00000152611		0.612	CAPSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPSL	HGNC	protein_coding	OTTHUMT00000253772.2	135	0.00	0	G	NM_144647		35921198	35921198	-1	no_errors	ENST00000397366	ensembl	human	known	69_37n	nonsense	125	11.27	16	SNP	1.000	A
CASR	846	genome.wustl.edu	37	3	122003481	122003481	+	Missense_Mutation	SNP	G	G	A	rs200883282		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr3:122003481G>A	ENST00000490131.1	+	7	3052	c.2680G>A	c.(2680-2682)Gtc>Atc	p.V894I	CASR_ENST00000498619.1_Missense_Mutation_p.V904I|CASR_ENST00000296154.5_Missense_Mutation_p.V894I|AC068754.1_ENST00000408547.1_RNA	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	894	Interaction with RNF19A.				anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCGCAGCAACGTCTCCCGCAA	0.647																																						dbGAP											0													30.0	32.0	31.0					3																	122003481		2203	4299	6502	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2680G>A	3.37:g.122003481G>A	ENSP00000418685:p.Val894Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.V904I	ENST00000490131.1	37	c.2710	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	10.93	1.488811	0.26686	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.88664	-2.41;-2.41;-2.41	5.89	2.97	0.34412	.	0.272603	0.37219	N	0.002185	T	0.76054	0.3934	N	0.14661	0.345	0.27542	N	0.950777	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.61637	-0.7022	10	0.22706	T	0.39	.	7.7585	0.28938	0.1493:0.1344:0.7163:0.0	.	904;894	E7ENE0;P41180	.;CASR_HUMAN	I	894;904;894	ENSP00000418685:V894I;ENSP00000420194:V904I;ENSP00000296154:V894I	ENSP00000296154:V894I	V	+	1	0	CASR	123486171	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.293000	0.51779	0.812000	0.34326	0.561000	0.74099	GTC	CASR	-	NULL	ENSG00000036828		0.647	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	46	0.00	0	G	NM_000388		122003481	122003481	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	53	25.35	18	SNP	1.000	A
CHD8	57680	genome.wustl.edu	37	14	21871620	21871620	+	Silent	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr14:21871620G>A	ENST00000557364.1	-	17	3773	c.3510C>T	c.(3508-3510)atC>atT	p.I1170I	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Silent_p.I891I|CHD8_ENST00000399982.2_Silent_p.I1170I			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1170	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		ACCTCCTCTGGATTAAATAAT	0.423																																						dbGAP											0													26.0	26.0	26.0					14																	21871620		2006	4189	6195	-	-	-	SO:0001819	synonymous_variant	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3510C>T	14.37:g.21871620G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P396S	ENST00000557364.1	37	c.1186	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	G	6.909	0.537359	0.13188	.	.	ENSG00000100888	ENST00000555935	.	.	.	5.42	3.6	0.41247	.	.	.	.	.	T	0.58566	0.2131	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53690	-0.8403	4	.	.	.	-11.4279	8.5759	0.33598	0.238:0.0:0.762:0.0	.	.	.	.	S	396	.	.	P	-	1	0	CHD8	20941460	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.825000	0.27393	0.851000	0.35264	0.650000	0.86243	CCA	CHD8	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000100888		0.423	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	33	0.00	0	G	NM_020920		21871620	21871620	-1	no_start_codon:pseudogene:bad_bp_length_for_coding_region	ENST00000555935	ensembl	human	novel	69_37n	missense	43	24.56	14	SNP	1.000	A
DOCK8	81704	genome.wustl.edu	37	9	289557	289557	+	Missense_Mutation	SNP	G	G	C	rs150742426	byFrequency	TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr9:289557G>C	ENST00000453981.1	+	4	492	c.380G>C	c.(379-381)cGt>cCt	p.R127P	DOCK8_ENST00000469391.1_Missense_Mutation_p.R59P|DOCK8_ENST00000432829.2_Missense_Mutation_p.R59P			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	127					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ACCTACATCCGTGAGTGGCTA	0.323																																						dbGAP											0													193.0	185.0	187.0					9																	289557		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.380G>C	9.37:g.289557G>C	ENSP00000408464:p.Arg127Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.R127P	ENST00000453981.1	37	c.380	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205041	0.79127	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000479404;ENST00000487230;ENST00000469391	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.87	5.87	0.94306	.	0.067321	0.64402	D	0.000007	T	0.61085	0.2319	L	0.51422	1.61	0.51767	D	0.999933	D;D;P	0.89917	0.961;1.0;0.953	P;D;P	0.91635	0.886;0.999;0.826	T	0.55909	-0.8066	10	0.48119	T	0.1	.	18.7629	0.91860	0.0:0.0:1.0:0.0	.	59;127;127	E9PH09;A2A349;Q8NF50	.;.;DOCK8_HUMAN	P	127;127;59;59;59;59	ENSP00000408464:R127P;ENSP00000394888:R59P;ENSP00000417082:R59P;ENSP00000418318:R59P;ENSP00000419438:R59P	ENSP00000287364:R127P	R	+	2	0	DOCK8	279557	1.000000	0.71417	0.947000	0.38551	0.669000	0.39330	6.043000	0.71004	2.941000	0.99782	0.655000	0.94253	CGT	DOCK8	-	pfam_DUF3398	ENSG00000107099		0.323	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	656	0.00	0	G	XM_036307		289557	289557	+1	no_errors	ENST00000453981	ensembl	human	known	69_37n	missense	392	25.76	136	SNP	1.000	C
DSCAML1	57453	genome.wustl.edu	37	11	117375739	117375739	+	Silent	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr11:117375739C>T	ENST00000321322.6	-	10	2263	c.2262G>A	c.(2260-2262)gtG>gtA	p.V754V	DSCAML1_ENST00000527706.1_Silent_p.V484V	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	694	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGTTGGGTTGCACCACAAATC	0.552																																						dbGAP											0													99.0	86.0	90.0					11																	117375739		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2262G>A	11.37:g.117375739C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V754	ENST00000321322.6	37	c.2262	CCDS8384.1	11																																																																																			DSCAML1	-	pfam_Ig_I-set,pfscan_Ig-like	ENSG00000177103		0.552	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	169	0.00	0	C	NM_020693		117375739	117375739	-1	no_errors	ENST00000321322	ensembl	human	known	69_37n	silent	111	37.29	66	SNP	0.843	T
ENG	2022	genome.wustl.edu	37	9	130605384	130605384	+	Nonsense_Mutation	SNP	C	C	A	rs45605432		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr9:130605384C>A	ENST00000373203.4	-	2	608	c.208G>T	c.(208-210)Gag>Tag	p.E70*	ENG_ENST00000344849.3_Nonsense_Mutation_p.E70*|RNA5SP296_ENST00000410523.1_RNA	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	70	Required for interaction with EGL.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						GTTGGGAACTCCAGGAAGAGG	0.627									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																													dbGAP											0													155.0	157.0	156.0					9																	130605384		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.208G>T	9.37:g.130605384C>A	ENSP00000362299:p.Glu70*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14248|Q14926|Q5T9C0	Nonsense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105	p.E70*	ENST00000373203.4	37	c.208	CCDS48029.1	9	.	.	.	.	.	.	.	.	.	.	c	38	6.890824	0.97912	.	.	ENSG00000106991	ENST00000373203;ENST00000344849;ENST00000545345	.	.	.	5.12	-0.695	0.11291	.	1.068810	0.07236	N	0.863453	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-3.6988	7.4417	0.27187	0.0:0.3956:0.0:0.6044	.	.	.	.	X	70	.	ENSP00000341917:E70X	E	-	1	0	ENG	129645205	0.554000	0.26522	0.721000	0.30653	0.922000	0.55478	0.015000	0.13355	-0.028000	0.13850	-0.291000	0.09656	GAG	ENG	-	NULL	ENSG00000106991		0.627	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENG	HGNC	protein_coding	OTTHUMT00000054313.1	86	0.00	0	C			130605384	130605384	-1	no_errors	ENST00000373203	ensembl	human	known	69_37n	nonsense	105	15.32	19	SNP	0.688	A
FAM104A	84923	genome.wustl.edu	37	17	71205900	71205901	+	Frame_Shift_Ins	INS	-	-	G	rs34380643		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr17:71205900_71205901insG	ENST00000403627.3	-	3	388_389	c.328_329insC	c.(328-330)ggcfs	p.G110fs	FAM104A_ENST00000583178.1_5'UTR|FAM104A_ENST00000405159.3_Frame_Shift_Ins_p.G131fs|FAM104A_ENST00000580032.1_Frame_Shift_Ins_p.G20fs|FAM104A_ENST00000583024.1_Frame_Shift_Ins_p.A83fs|FAM104A_ENST00000581110.1_Frame_Shift_Ins_p.A77fs	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	110	Ser-rich.									endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			ACTGTCACTGCCTGAAGACTGG	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.328_329insC	17.37:g.71205900_71205901insG	ENSP00000384648:p.Gly110fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E339	Frame_Shift_Ins	INS	NULL	p.G131fs	ENST00000403627.3	37	c.392_391	CCDS11693.2	17																																																																																			FAM104A	-	NULL	ENSG00000133193		0.535	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM104A	HGNC	protein_coding	OTTHUMT00000318935.1	28	0.00	0	-	NM_032837		71205900	71205901	-1	no_errors	ENST00000405159	ensembl	human	known	69_37n	frame_shift_ins	40	51.22	42	INS	1.000:0.972	G
FGFR3	2261	genome.wustl.edu	37	4	1808375	1808375	+	Silent	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr4:1808375C>T	ENST00000260795.2	+	15	2235	c.2133C>T	c.(2131-2133)caC>caT	p.H711H	FGFR3_ENST00000412135.2_Silent_p.H599H|FGFR3_ENST00000440486.2_Silent_p.H711H|FGFR3_ENST00000481110.2_Missense_Mutation_p.P689S|FGFR3_ENST00000352904.1_Silent_p.H599H|FGFR3_ENST00000340107.4_Silent_p.H713H			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	711	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	AGGAGGGCCACCGCATGGACA	0.682		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																													dbGAP		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	0													34.0	37.0	36.0					4																	1808375		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.2133C>T	4.37:g.1808375C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P689S	ENST00000260795.2	37	c.2065	CCDS3353.1	4	.	.	.	.	.	.	.	.	.	.	c	12.44	1.939984	0.34283	.	.	ENSG00000068078	ENST00000481110	D	0.85773	-2.03	4.49	2.29	0.28610	.	0.928790	0.09015	N	0.860885	T	0.78285	0.4259	.	.	.	0.80722	D	1	B	0.19583	0.037	B	0.17433	0.018	T	0.73626	-0.3923	9	0.87932	D	0	.	5.8675	0.18783	0.0:0.6096:0.0:0.3904	.	689	F8W9L4	.	S	689	ENSP00000420533:P689S	ENSP00000420533:P689S	P	+	1	0	FGFR3	1778173	0.856000	0.29760	1.000000	0.80357	0.204000	0.24138	-0.071000	0.11505	1.009000	0.39289	0.561000	0.74099	CCG	FGFR3	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000068078		0.682	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FGFR3	HGNC	protein_coding	OTTHUMT00000241632.2	14	0.00	0	C	NM_000142		1808375	1808375	+1	no_errors	ENST00000481110	ensembl	human	putative	69_37n	missense	8	38.46	5	SNP	1.000	T
FRYL	285527	genome.wustl.edu	37	4	48542836	48542836	+	Silent	SNP	T	T	C			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr4:48542836T>C	ENST00000503238.1	-	43	5828	c.5829A>G	c.(5827-5829)agA>agG	p.R1943R	FRYL_ENST00000358350.4_Silent_p.R1943R|FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000537810.1_Silent_p.R1943R|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	1943					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TCAAACTTAATCTCAAAGAGT	0.418																																						dbGAP											0													119.0	111.0	114.0					4																	48542836		1880	4107	5987	-	-	-	SO:0001819	synonymous_variant	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.5829A>G	4.37:g.48542836T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.I813V	ENST00000503238.1	37	c.2437	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	T	0.080	-1.185190	0.01620	.	.	ENSG00000075539	ENST00000514617	.	.	.	6.16	-3.11	0.05299	.	.	.	.	.	T	0.53094	0.1775	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49303	-0.8954	4	.	.	.	.	8.8408	0.35140	0.0:0.4852:0.1226:0.3923	.	.	.	.	V	813	.	.	I	-	1	0	FRYL	48237593	0.068000	0.21057	0.529000	0.27951	0.109000	0.19521	-0.369000	0.07533	-0.757000	0.04697	-0.417000	0.06048	ATT	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.418	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	109	0.00	0	T			48542836	48542836	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000514617	ensembl	human	novel	69_37n	missense	113	26.62	41	SNP	0.157	C
GRID1	2894	genome.wustl.edu	37	10	87407077	87407077	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr10:87407077C>T	ENST00000327946.7	-	13	2160	c.2075G>A	c.(2074-2076)cGa>cAa	p.R692Q	RN7SKP238_ENST00000516483.1_RNA|GRID1_ENST00000536331.1_Missense_Mutation_p.R263Q|RP11-93H12.4_ENST00000474115.2_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	692					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GCCCTTGGCTCGGAAGTACTC	0.547										Multiple Myeloma(13;0.14)																												dbGAP											0													276.0	258.0	264.0					10																	87407077		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2075G>A	10.37:g.87407077C>T	ENSP00000330148:p.Arg692Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R692Q	ENST00000327946.7	37	c.2075	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549347	0.65311	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.26067	1.76;1.76	5.7	4.79	0.61399	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.158856	0.52532	D	0.000061	T	0.19805	0.0476	L	0.44542	1.39	0.44275	D	0.997139	B	0.20261	0.043	B	0.08055	0.003	T	0.09596	-1.0667	10	0.87932	D	0	.	6.1724	0.20424	0.0:0.7663:0.0:0.2337	.	692	Q9ULK0	GRID1_HUMAN	Q	692;263	ENSP00000330148:R692Q;ENSP00000444455:R263Q	ENSP00000330148:R692Q	R	-	2	0	GRID1	87397057	0.994000	0.37717	0.998000	0.56505	0.998000	0.95712	1.839000	0.39220	2.693000	0.91896	0.650000	0.86243	CGA	GRID1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000182771		0.547	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	154	0.00	0	C	XM_043613		87407077	87407077	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	missense	128	13.51	20	SNP	1.000	T
HNRNPA2B1	3181	genome.wustl.edu	37	7	26233303	26233303	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr7:26233303C>A	ENST00000354667.4	-	9	937	c.769G>T	c.(769-771)Gga>Tga	p.G257*	HNRNPA2B1_ENST00000476233.1_5'Flank|HNRNPA2B1_ENST00000356674.7_Nonsense_Mutation_p.G245*	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	257	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						GGGCTACCTCCAAAATTGCCA	0.443			T	ETV1	prostate																																	dbGAP		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	0													61.0	64.0	63.0					7																	26233303		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.769G>T	7.37:g.26233303C>A	ENSP00000346694:p.Gly257*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K064|P22627|Q9UC98|Q9UDJ2	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.G257*	ENST00000354667.4	37	c.769	CCDS43557.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.151731|5.151731	0.94645|0.94645	.|.	.|.	ENSG00000122566|ENSG00000122566	ENST00000354667;ENST00000356674|ENST00000409814	.|.	.|.	.|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	0.000000|.	0.64402|.	D|.	0.000003|.	.|T	.|0.79701	.|0.4491	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.76386	.|-0.2978	.|4	0.33141|0.38643	T|T	0.24|0.18	.|.	19.9542|19.9542	0.97213|0.97213	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|F	257;245|190	.|.	ENSP00000346694:G257X|ENSP00000386735:L190F	G|L	-|-	1|3	0|2	HNRNPA2B1|HNRNPA2B1	26199828|26199828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.313000|0.313000	0.28021|0.28021	7.416000|7.416000	0.80143|0.80143	2.816000|2.816000	0.96949|0.96949	0.561000|0.561000	0.74099|0.74099	GGA|TTG	HNRNPA2B1	-	NULL	ENSG00000122566		0.443	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	HNRNPA2B1	HGNC	protein_coding	OTTHUMT00000214109.1	123	0.00	0	C	NM_002137		26233303	26233303	-1	no_errors	ENST00000354667	ensembl	human	known	69_37n	nonsense	109	19.85	27	SNP	1.000	A
GRM8	2918	genome.wustl.edu	37	7	126173066	126173066	+	Silent	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr7:126173066G>A	ENST00000339582.2	-	9	3178	c.2370C>T	c.(2368-2370)acC>acT	p.T790T	GRM8_ENST00000444921.2_Silent_p.T790T|GRM8_ENST00000358373.3_Silent_p.T790T|GRM8_ENST00000480995.1_5'Flank			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	790					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				AAATGATGCAGGTGGTATACA	0.408										HNSCC(24;0.065)																												dbGAP											0													132.0	115.0	121.0					7																	126173066		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2370C>T	7.37:g.126173066G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.T790	ENST00000339582.2	37	c.2370	CCDS5794.1	7																																																																																			GRM8	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000179603		0.408	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	139	0.00	0	G			126173066	126173066	-1	no_errors	ENST00000339582	ensembl	human	known	69_37n	silent	110	11.29	14	SNP	1.000	A
IFNL2	282616	genome.wustl.edu	37	19	39759482	39759482	+	Missense_Mutation	SNP	G	G	T	rs535520944	byFrequency	TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr19:39759482G>T	ENST00000331982.5	+	2	231	c.176G>T	c.(175-177)aGg>aTg	p.R59M		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	59					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											GCCTTTAAGAGGGCCAAAGAT	0.617																																						dbGAP											0													28.0	30.0	29.0					19																	39759482		2203	4294	6497	-	-	-	SO:0001583	missense	0			AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.176G>T	19.37:g.39759482G>T	ENSP00000333639:p.Arg59Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q45KQ8|Q6VN55|Q8IWL7	Missense_Mutation	SNP	NULL	p.R59M	ENST00000331982.5	37	c.176	CCDS42567.1	19	.	.	.	.	.	.	.	.	.	.	G	10.78	1.446338	0.25987	.	.	ENSG00000183709	ENST00000331982	T	0.36340	1.26	3.22	-4.16	0.03869	.	0.769868	0.11911	N	0.517691	T	0.20333	0.0489	L	0.40543	1.245	0.20403	N	0.999908	B	0.23937	0.094	B	0.19148	0.024	T	0.28554	-1.0040	10	0.87932	D	0	2.9441	0.551	0.00662	0.3885:0.1785:0.2526:0.1804	.	59	Q8IZJ0	IL28A_HUMAN	M	59	ENSP00000333639:R59M	ENSP00000333639:R59M	R	+	2	0	IL28A	44451322	0.001000	0.12720	0.309000	0.25155	0.309000	0.27889	-1.522000	0.02237	-0.429000	0.07329	0.423000	0.28283	AGG	IL28A	-	NULL	ENSG00000183709		0.617	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL28A	HGNC	protein_coding	OTTHUMT00000463833.1	134	0.74	1	G	NM_172138		39759482	39759482	+1	no_errors	ENST00000331982	ensembl	human	known	69_37n	missense	132	19.02	31	SNP	0.560	T
KCNG1	3755	genome.wustl.edu	37	20	49621081	49621081	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr20:49621081C>T	ENST00000371571.4	-	3	1322	c.1037G>A	c.(1036-1038)cGg>cAg	p.R346Q	RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000506387.1_5'UTR	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	346					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GCGCAGCGCCCGCAGCACGCG	0.736																																						dbGAP											0													10.0	15.0	13.0					20																	49621081		2149	4141	6290	-	-	-	SO:0001583	missense	0			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.1037G>A	20.37:g.49621081C>T	ENSP00000360626:p.Arg346Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.R346Q	ENST00000371571.4	37	c.1037	CCDS13436.1	20	.	.	.	.	.	.	.	.	.	.	C	35	5.467084	0.96257	.	.	ENSG00000026559	ENST00000371571	D	0.99220	-5.58	5.0	5.0	0.66597	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99600	0.9855	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97805	1.0247	9	.	.	.	.	18.3323	0.90274	0.0:1.0:0.0:0.0	.	346	Q9UIX4	KCNG1_HUMAN	Q	346	ENSP00000360626:R346Q	.	R	-	2	0	KCNG1	49054488	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.688000	0.84153	2.326000	0.78906	0.306000	0.20318	CGG	KCNG1	-	pfam_Ion_trans_dom	ENSG00000026559		0.736	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	HGNC	protein_coding	OTTHUMT00000079726.4	39	0.00	0	C	NM_002237		49621081	49621081	-1	no_errors	ENST00000371571	ensembl	human	known	69_37n	missense	51	23.88	16	SNP	1.000	T
MAP10	54627	genome.wustl.edu	37	1	232940798	232940798	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr1:232940798G>A	ENST00000418460.1	+	1	156	c.29G>A	c.(28-30)tGg>tAg	p.W10*		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	0					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										TTAACTAACTGGCTCTGTTTA	0.473																																						dbGAP											0													154.0	151.0	152.0					1																	232940798		1924	4136	6060	-	-	-	SO:0001587	stop_gained	0			AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.29G>A	1.37:g.232940798G>A	ENSP00000403208:p.Trp10*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Nonsense_Mutation	SNP	NULL	p.W10*	ENST00000418460.1	37	c.29	CCDS44334.1	1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195991	0.58126	.	.	ENSG00000212916	ENST00000418460	.	.	.	2.84	-0.694	0.11294	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.163	0.15071	0.0:0.169:0.3006:0.5304	.	.	.	.	X	10	.	ENSP00000403208:W10X	W	+	2	0	KIAA1383	231007421	0.002000	0.14202	0.000000	0.03702	0.022000	0.10575	0.645000	0.24782	-0.133000	0.11537	0.313000	0.20887	TGG	KIAA1383	-	NULL	ENSG00000212916		0.473	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1383	HGNC	protein_coding	OTTHUMT00000092317.3	65	0.00	0	G	NM_019090		232940798	232940798	+1	no_errors	ENST00000418460	ensembl	human	known	69_37n	nonsense	103	14.88	18	SNP	0.000	A
KIT	3815	genome.wustl.edu	37	4	55565832	55565832	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr4:55565832C>T	ENST00000288135.5	+	4	753	c.656C>T	c.(655-657)gCa>gTa	p.A219V		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	219	Ig-like C2-type 3.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTGTCCAAAGCAAGCTATCTT	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													dbGAP	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													149.0	132.0	138.0					4																	55565832		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.656C>T	4.37:g.55565832C>T	ENSP00000288135:p.Ala219Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A219V	ENST00000288135.5	37	c.656	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	C	8.626	0.892630	0.17613	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	D;D	0.83837	-1.77;-1.77	5.92	5.08	0.68730	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.245770	0.05512	N	0.560432	T	0.77157	0.4089	L	0.33485	1.01	0.09310	N	1	B;B	0.21821	0.061;0.043	B;B	0.19391	0.025;0.012	T	0.60964	-0.7158	10	0.27082	T	0.32	.	9.9481	0.41623	0.0:0.776:0.1485:0.0755	.	219;219	P10721-2;P10721	.;KIT_HUMAN	V	219	ENSP00000288135:A219V;ENSP00000390987:A219V	ENSP00000288135:A219V	A	+	2	0	KIT	55260589	0.001000	0.12720	0.005000	0.12908	0.135000	0.20990	1.250000	0.32850	1.517000	0.48917	0.557000	0.71058	GCA	KIT	-	pfam_Ig_I-set,smart_Ig_sub,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Ig-like	ENSG00000157404		0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	205	0.00	0	C			55565832	55565832	+1	no_errors	ENST00000288135	ensembl	human	known	69_37n	missense	205	21.67	57	SNP	0.003	T
KRT6C	286887	genome.wustl.edu	37	12	52867484	52867484	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr12:52867484C>T	ENST00000252250.6	-	1	85	c.38G>A	c.(37-39)aGc>aAc	p.S13N		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	13	Head.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		CCGGCGGCTGCTGCTGTGGCT	0.662																																						dbGAP											0													14.0	17.0	16.0					12																	52867484		2090	4130	6220	-	-	-	SO:0001583	missense	0			L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.38G>A	12.37:g.52867484C>T	ENSP00000252250:p.Ser13Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L5|P48666|Q2TAZ9|Q7RTN9	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S13N	ENST00000252250.6	37	c.38	CCDS8829.1	12	.	.	.	.	.	.	.	.	.	.	c	14.66	2.601040	0.46423	.	.	ENSG00000170465	ENST00000252250;ENST00000411979	T	0.58797	0.31	2.71	0.615	0.17608	.	0.556998	0.17430	N	0.174498	T	0.51991	0.1707	M	0.64404	1.975	0.09310	N	1	B	0.19583	0.037	B	0.20955	0.032	T	0.51779	-0.8662	10	0.66056	D	0.02	.	10.3562	0.43964	0.458:0.542:0.0:0.0	.	13	P48668	K2C6C_HUMAN	N	13	ENSP00000252250:S13N	ENSP00000252250:S13N	S	-	2	0	KRT6C	51153751	0.000000	0.05858	0.011000	0.14972	0.714000	0.41099	0.141000	0.16076	0.123000	0.18342	0.514000	0.50259	AGC	KRT6C	-	NULL	ENSG00000170465		0.662	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6C	HGNC	protein_coding	OTTHUMT00000404976.1	48	0.00	0	C	NM_173086		52867484	52867484	-1	no_errors	ENST00000252250	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	0.004	T
MPP3	4356	genome.wustl.edu	37	17	41888564	41888564	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr17:41888564C>G	ENST00000398389.4	-	17	1430	c.1265G>C	c.(1264-1266)aGg>aCg	p.R422T	MPP3_ENST00000398393.1_Missense_Mutation_p.R447T|MPP3_ENST00000475450.1_5'Flank	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	422	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CTTTCGGGGCCTGGTGGTATC	0.478																																						dbGAP											0													81.0	79.0	80.0					17																	41888564		1940	4149	6089	-	-	-	SO:0001583	missense	0				CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1265G>C	17.37:g.41888564C>G	ENSP00000381425:p.Arg422Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_L27_C,pfam_PDZ,pfam_SH3_2,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.R422T	ENST00000398389.4	37	c.1265	CCDS42344.1	17	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798545	0.90538	.	.	ENSG00000161647	ENST00000398393;ENST00000398389	T;T	0.55052	0.54;0.54	5.38	5.38	0.77491	Guanylate kinase/L-type calcium channel (1);Guanylate kinase, conserved site (1);Guanylate kinase (2);	0.000000	0.85682	D	0.000000	D	0.82277	0.5002	H	0.96833	3.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.87841	0.2651	10	0.87932	D	0	.	17.5023	0.87735	0.0:1.0:0.0:0.0	.	422;447	Q13368;D3DX46	MPP3_HUMAN;.	T	447;422	ENSP00000381430:R447T;ENSP00000381425:R422T	ENSP00000381425:R422T	R	-	2	0	MPP3	39244090	0.999000	0.42202	1.000000	0.80357	0.898000	0.52572	6.863000	0.75489	2.793000	0.96121	0.655000	0.94253	AGG	MPP3	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin	ENSG00000161647		0.478	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP3	HGNC	protein_coding	OTTHUMT00000258371.1	104	0.00	0	C	NM_001932		41888564	41888564	-1	no_errors	ENST00000398389	ensembl	human	known	69_37n	missense	137	20.81	36	SNP	0.997	G
MTNR1B	4544	genome.wustl.edu	37	11	92714860	92714860	+	Silent	SNP	C	C	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr11:92714860C>A	ENST00000257068.2	+	2	477	c.471C>A	c.(469-471)acC>acA	p.T157T		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	157					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	GCTGGCACACCCCTCTGCACA	0.572																																						dbGAP											0													129.0	122.0	124.0					11																	92714860		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.471C>A	11.37:g.92714860C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Melatonin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,prints_Mel_1A_rcpt	p.T157	ENST00000257068.2	37	c.471	CCDS8290.1	11																																																																																			MTNR1B	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Melatonin_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000134640		0.572	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTNR1B	HGNC	protein_coding	OTTHUMT00000394323.1	222	0.45	1	C			92714860	92714860	+1	no_errors	ENST00000257068	ensembl	human	known	69_37n	silent	267	15.41	49	SNP	0.000	A
NLRC3	197358	genome.wustl.edu	37	16	3611702	3611702	+	RNA	SNP	C	C	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr16:3611702C>A	ENST00000301749.7	-	0	2421				NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTCTGTGTTACCTGATCTTCT	0.617																																						dbGAP											0													83.0	93.0	90.0					16																	3611702		2086	4199	6285	-	-	-			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3611702C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Splice_Site	SNP	-	e4+1	ENST00000301749.7	37	c.2156+1		16	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927867	0.73327	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0686	0.86567	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NLRC3	3551703	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.184000	0.77705	2.638000	0.89438	0.555000	0.69702	.	NLRC3	-	-	ENSG00000167984		0.617	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		21	0.00	0	C	NM_178844		3611702	3611702	-1	no_errors	ENST00000448023	ensembl	human	known	69_37n	splice_site	12	33.33	6	SNP	1.000	A
OAZ2	4947	genome.wustl.edu	37	15	64995230	64995230	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr15:64995230G>T	ENST00000326005.6	-	1	250	c.18C>A	c.(16-18)gaC>gaA	p.D6E	AC100830.3_ENST00000560387.1_RNA|OAZ2_ENST00000559753.1_5'UTR|OAZ2_ENST00000560258.2_Missense_Mutation_p.D6E|OAZ2_ENST00000560837.1_5'UTR			O95190	OAZ2_HUMAN	ornithine decarboxylase antizyme 2	6					cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein catabolic process (GO:0045732)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ornithine decarboxylase inhibitor activity (GO:0008073)									L-Ornithine(DB00129)	GCCGTTACCTGTCCTGGGTGT	0.706																																						dbGAP											0													32.0	43.0	40.0					15																	64995230		1953	4115	6068	-	-	-	SO:0001583	missense	0			AF057297	CCDS58372.1	15q22.31	2006-05-11				ENSG00000180304			8096	protein-coding gene	gene with protein product		604152				9782076, 10352227	Standard	NM_002537		Approved		uc002ano.2	O95190		ENST00000326005.6:c.18C>A	15.37:g.64995230G>T	ENSP00000463013:p.Asp6Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ODC_AZ,superfamily_Acyl_CoA_acyltransferase	p.D6E	ENST00000326005.6	37	c.18	CCDS58372.1	15																																																																																			OAZ2	-	NULL	ENSG00000180304		0.706	OAZ2-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	OAZ2	HGNC	protein_coding	OTTHUMT00000418707.2	184	0.00	0	G	NM_002537		64995230	64995230	-1	no_errors	ENST00000326005	ensembl	human	known	69_37n	missense	235	14.86	41	SNP	1.000	T
ODF2	4957	genome.wustl.edu	37	9	131247096	131247097	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr9:131247096_131247097insC	ENST00000434106.3	+	12	1584_1585	c.1221_1222insC	c.(1222-1224)gccfs	p.A408fs	ODF2_ENST00000393533.2_Frame_Shift_Ins_p.A408fs|ODF2_ENST00000448249.3_Frame_Shift_Ins_p.A327fs|ODF2_ENST00000372791.3_Frame_Shift_Ins_p.A389fs|ODF2_ENST00000546203.1_Frame_Shift_Ins_p.A389fs|ODF2_ENST00000604420.1_Frame_Shift_Ins_p.A408fs|ODF2_ENST00000372814.3_Frame_Shift_Ins_p.A452fs|ODF2_ENST00000372807.5_Frame_Shift_Ins_p.A403fs|ODF2_ENST00000351030.3_Frame_Shift_Ins_p.A403fs|ODF2_ENST00000444119.2_Frame_Shift_Ins_p.A384fs|ODF2_ENST00000393527.3_Frame_Shift_Ins_p.A384fs	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	408					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						AGGCCATCCGAGCCCAGAAGGA	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	Exception_encountered	9.37:g.131247096_131247097insC	ENSP00000403453:p.Ala408fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Frame_Shift_Ins	INS	NULL	p.A407fs	ENST00000434106.3	37	c.1221_1222	CCDS56588.1	9																																																																																			ODF2	-	NULL	ENSG00000136811		0.584	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3	155	0.00	0	-			131247096	131247097	+1	no_errors	ENST00000372796	ensembl	human	known	69_37n	frame_shift_ins	132	39.17	85	INS	0.929:1.000	C
OR4L1	122742	genome.wustl.edu	37	14	20528300	20528300	+	Silent	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr14:20528300C>T	ENST00000315683.1	+	1	97	c.97C>T	c.(97-99)Ctg>Ttg	p.L33L		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GACATTTTCCCTGATCTACGG	0.383																																						dbGAP											0													174.0	179.0	177.0					14																	20528300		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.97C>T	14.37:g.20528300C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEZ5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L33	ENST00000315683.1	37	c.97	CCDS32029.1	14																																																																																			OR4L1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000176246		0.383	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4L1	HGNC	protein_coding	OTTHUMT00000404381.1	101	0.00	0	C			20528300	20528300	+1	no_errors	ENST00000315683	ensembl	human	known	69_37n	silent	117	28.66	47	SNP	0.000	T
OR56A4	120793	genome.wustl.edu	37	11	6023911	6023911	+	Missense_Mutation	SNP	C	C	A	rs148541960		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr11:6023911C>A	ENST00000330728.4	-	1	513	c.468G>T	c.(466-468)atG>atT	p.M156I		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCATGATGAACATCTGGAGGA	0.527																																						dbGAP											0													87.0	79.0	81.0					11																	6023911		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.468G>T	11.37:g.6023911C>A	ENSP00000328215:p.Met156Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH17	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M156I	ENST00000330728.4	37	c.468	CCDS31404.1	11	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177840	0.38413	.	.	ENSG00000183389	ENST00000330728	T	0.02944	4.1	3.34	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40222	U	0.001153	T	0.04407	0.0121	L	0.39566	1.225	0.28297	N	0.923284	B	0.28713	0.22	B	0.35312	0.2	T	0.16188	-1.0411	10	0.72032	D	0.01	.	13.7401	0.62842	0.0:1.0:0.0:0.0	.	104	Q8NGH8	O56A4_HUMAN	I	156	ENSP00000328215:M156I	ENSP00000328215:M156I	M	-	3	0	OR56A4	5980487	0.753000	0.28349	1.000000	0.80357	0.915000	0.54546	-0.026000	0.12392	1.857000	0.53885	0.555000	0.69702	ATG	OR56A4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000183389		0.527	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A4	HGNC	protein_coding	OTTHUMT00000383756.2	246	0.00	0	C	NM_001005179		6023911	6023911	-1	no_errors	ENST00000330728	ensembl	human	known	69_37n	missense	219	25.34	75	SNP	1.000	A
PCDHGB1	56104	genome.wustl.edu	37	5	140730761	140730761	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr5:140730761G>T	ENST00000523390.1	+	1	934	c.934G>T	c.(934-936)Gtg>Ttg	p.V312L	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	312	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGTAGATATGTGTTGAGTGT	0.423																																						dbGAP											0													112.0	113.0	112.0					5																	140730761		1958	4160	6118	-	-	-	SO:0001583	missense	0			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.934G>T	5.37:g.140730761G>T	ENSP00000429273:p.Val312Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V312L	ENST00000523390.1	37	c.934	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	5.556	0.287516	0.10513	.	.	ENSG00000254221	ENST00000523390	T	0.01745	4.66	5.43	-5.53	0.02552	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01627	0.0052	L	0.37800	1.135	0.09310	N	1	B;B	0.12630	0.003;0.006	B;B	0.19666	0.008;0.026	T	0.46569	-0.9182	9	0.51188	T	0.08	.	6.1693	0.20408	0.2287:0.0:0.5522:0.2191	.	312;312	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	L	312	ENSP00000429273:V312L	ENSP00000429273:V312L	V	+	1	0	PCDHGB1	140710945	0.000000	0.05858	0.000000	0.03702	0.238000	0.25445	0.010000	0.13242	-0.604000	0.05760	0.563000	0.77884	GTG	PCDHGB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000254221		0.423	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	95	0.00	0	G	NM_018922		140730761	140730761	+1	no_errors	ENST00000523390	ensembl	human	known	69_37n	missense	100	12.28	14	SNP	0.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	70	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	96	66.67	194	SNP	1.000	G
PLA2G4A	5321	genome.wustl.edu	37	1	186925327	186925327	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr1:186925327C>G	ENST00000367466.3	+	14	1582	c.1430C>G	c.(1429-1431)gCt>gGt	p.A477G	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.A417G	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	477	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	AGTGATTCAGCTTTATTCAAT	0.418																																						dbGAP											0													155.0	137.0	143.0					1																	186925327		2203	4300	6503	-	-	-	SO:0001583	missense	0			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1430C>G	1.37:g.186925327C>G	ENSP00000356436:p.Ala477Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG4|Q29R80	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.A477G	ENST00000367466.3	37	c.1430	CCDS1372.1	1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822587	0.32237	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.04502	3.61;3.61	5.45	5.45	0.79879	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.612873	0.18600	N	0.136469	T	0.10252	0.0251	M	0.65975	2.015	0.09310	N	0.999999	B;B	0.22541	0.071;0.034	B;B	0.26969	0.061;0.075	T	0.08659	-1.0711	10	0.39692	T	0.17	-3.2127	18.6433	0.91402	0.0:1.0:0.0:0.0	.	417;477	E7EU42;P47712	.;PA24A_HUMAN	G	477;417	ENSP00000356436:A477G;ENSP00000406892:A417G	ENSP00000356436:A477G	A	+	2	0	PLA2G4A	185191950	0.876000	0.30132	0.230000	0.23976	0.948000	0.59901	4.471000	0.60182	2.725000	0.93324	0.655000	0.94253	GCT	PLA2G4A	-	pfam_LysoPLipase_cat_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000116711		0.418	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4A	HGNC	protein_coding	OTTHUMT00000086236.1	197	0.00	0	C	NM_024420		186925327	186925327	+1	no_errors	ENST00000367466	ensembl	human	known	69_37n	missense	232	15.64	43	SNP	0.038	G
POM121	9883	genome.wustl.edu	37	7	72413723	72413724	+	In_Frame_Ins	INS	-	-	CTC	rs67569765|rs148686669	byFrequency	TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr7:72413723_72413724insCTC	ENST00000434423.2	+	11	3191_3192	c.3191_3192insCTC	c.(3190-3195)ttcttc>ttCTCcttc	p.1064_1065FF>FSF	POM121_ENST00000446813.1_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000257622.4_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000395270.1_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000358357.3_In_Frame_Ins_p.799_800FF>FSF			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1064	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ACTGCTGTCTTCTTCGGTGCAG	0.663																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	Exception_encountered	7.37:g.72413723_72413724insCTC	ENSP00000405562:p.Phe1064_Phe1065insSer	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	In_Frame_Ins	INS	NULL	p.1065in_frame_insS	ENST00000434423.2	37	c.3191_3192		7																																																																																			POM121	-	NULL	ENSG00000196313		0.663	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	24	0.00	0	-			72413723	72413724	+1	no_errors	ENST00000434423	ensembl	human	known	69_37n	in_frame_ins	18	18.18	4	INS	0.980:0.870	CTC
POM121L12	285877	genome.wustl.edu	37	7	53103840	53103840	+	Missense_Mutation	SNP	G	G	A	rs565383229	byFrequency	TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr7:53103840G>A	ENST00000408890.4	+	1	492	c.476G>A	c.(475-477)cGc>cAc	p.R159H		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	159								p.R159H(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CAGAGAgcccgccccgcaggc	0.726													G|||	2	0.000399361	0.0	0.0	5008	,	,		10797	0.0		0.0	False		,,,				2504	0.002					dbGAP											1	Substitution - Missense(1)	lung(1)											13.0	16.0	15.0					7																	53103840		1848	4065	5913	-	-	-	SO:0001583	missense	0				CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.476G>A	7.37:g.53103840G>A	ENSP00000386133:p.Arg159His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDI9	Missense_Mutation	SNP	NULL	p.R159H	ENST00000408890.4	37	c.476	CCDS43584.1	7	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029590	0.35797	.	.	ENSG00000221900	ENST00000408890	T	0.23552	1.9	2.08	-4.17	0.03857	.	.	.	.	.	T	0.12902	0.0313	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.48304	0.573	T	0.10776	-1.0615	9	0.40728	T	0.16	.	4.4869	0.11794	0.2735:0.3869:0.3396:0.0	.	159	Q8N7R1	P1L12_HUMAN	H	159	ENSP00000386133:R159H	ENSP00000386133:R159H	R	+	2	0	POM121L12	53071334	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.533000	0.02215	-1.234000	0.02548	0.555000	0.69702	CGC	POM121L12	-	NULL	ENSG00000221900		0.726	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L12	HGNC	protein_coding	OTTHUMT00000342656.1	44	0.00	0	G	NM_182595		53103840	53103840	+1	no_errors	ENST00000408890	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	0.000	A
PSD	5662	genome.wustl.edu	37	10	104175780	104175781	+	Frame_Shift_Ins	INS	-	-	G	rs561554640		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr10:104175780_104175781insG	ENST00000020673.5	-	3	1276_1277	c.750_751insC	c.(748-753)cccagcfs	p.S251fs	PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_Frame_Shift_Ins_p.S251fs	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	251					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TTACCTGAGCTGGGGGGGTCCA	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.751dupC	10.37:g.104175787_104175787dupG	ENSP00000020673:p.Ser251fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKX7|D3DR87|Q15673|Q8IVG0	Frame_Shift_Ins	INS	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.S250fs	ENST00000020673.5	37	c.751_750	CCDS31272.1	10																																																																																			PSD	-	NULL	ENSG00000059915		0.604	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	36	0.00	0	-			104175780	104175781	-1	no_errors	ENST00000020673	ensembl	human	known	69_37n	frame_shift_ins	30	11.76	4	INS	1.000:1.000	G
RAB40A	142684	genome.wustl.edu	37	X	102755366	102755366	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chrX:102755366G>A	ENST00000372633.1	-	1	2437	c.319C>T	c.(319-321)Cga>Tga	p.R107*	RAB40A_ENST00000304236.1_Nonsense_Mutation_p.R107*|LL0XNC01-250H12.3_ENST00000445990.1_RNA			Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	107					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						TTAATCCATCGATCCATACCC	0.517																																						dbGAP											0													33.0	28.0	30.0					X																	102755366		2201	4272	6473	-	-	-	SO:0001587	stop_gained	0			AF132748	CCDS35357.1	Xq22.1	2009-08-25			ENSG00000172476	ENSG00000172476		"""RAB, member RAS oncogene"""	18283	protein-coding gene	gene with protein product						11697911	Standard	NM_080879		Approved	RAR2A, Rar-2	uc004ekk.3	Q8WXH6	OTTHUMG00000022100	ENST00000372633.1:c.319C>T	X.37:g.102755366G>A	ENSP00000361716:p.Arg107*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00407|Q17RQ5|Q6DK06|Q8TF06	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_SOCS_C,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_SOCS_C,prints_Small_GTPase,pfscan_SOCS_C,tigrfam_Small_GTP-bd_dom	p.R107*	ENST00000372633.1	37	c.319	CCDS35357.1	X	.	.	.	.	.	.	.	.	.	.	.	35	5.558702	0.96514	.	.	ENSG00000172476	ENST00000372633;ENST00000304236	.	.	.	0.225	0.225	0.15325	.	0.000000	0.41712	U	0.000830	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.1796	0.20463	4.0E-4:0.0:0.9996:0.0	.	.	.	.	X	107	.	ENSP00000305648:R107X	R	-	1	2	RAB40A	102642022	1.000000	0.71417	0.839000	0.33178	0.840000	0.47671	1.347000	0.33975	0.280000	0.22209	0.284000	0.19432	CGA	RAB40A	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000172476		0.517	RAB40A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40A	HGNC	protein_coding	OTTHUMT00000057714.1	132	0.00	0	G			102755366	102755366	-1	no_errors	ENST00000304236	ensembl	human	known	69_37n	nonsense	92	17.12	19	SNP	0.996	A
RPTN	126638	genome.wustl.edu	37	1	152128071	152128071	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr1:152128071G>A	ENST00000316073.3	-	3	1568	c.1504C>T	c.(1504-1506)Cca>Tca	p.P502S		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	502	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TGTCCGTCTGGCTGACCATAA	0.502																																						dbGAP											0													826.0	714.0	748.0					1																	152128071		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1504C>T	1.37:g.152128071G>A	ENSP00000317895:p.Pro502Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.P502S	ENST00000316073.3	37	c.1504	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	g	1.166	-0.642426	0.03531	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.11495	2.77	4.77	-7.77	0.01227	.	0.579784	0.13015	U	0.420586	T	0.00580	0.0019	N	0.02539	-0.55	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.44298	-0.9337	10	0.09084	T	0.74	0.0746	0.8588	0.01188	0.3402:0.1675:0.314:0.1783	.	502	Q6XPR3	RPTN_HUMAN	S	502;157	ENSP00000317895:P502S	ENSP00000317895:P502S	P	-	1	0	RPTN	150394695	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.298000	0.01140	-0.862000	0.04089	-2.286000	0.00268	CCA	RPTN	-	NULL	ENSG00000215853		0.502	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	743	0.00	0	G	XM_371312		152128071	152128071	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	missense	814	43.88	638	SNP	0.000	A
RSAD2	91543	genome.wustl.edu	37	2	7018164	7018164	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr2:7018164A>C	ENST00000382040.3	+	1	369	c.233A>C	c.(232-234)cAc>cCc	p.H78P	RSAD2_ENST00000541728.1_5'Flank	NM_080657.4	NP_542388.2			radical S-adenosyl methionine domain containing 2											endometrium(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)	20	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		GTCAACTATCACTTCACTCGC	0.532																																						dbGAP											0													153.0	130.0	138.0					2																	7018164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF442151	CCDS1656.1	2p25.2	2008-02-05			ENSG00000134321	ENSG00000134321			30908	protein-coding gene	gene with protein product		607810				11752458	Standard	NM_080657		Approved	cig5, viperin, vig1	uc002qyp.1	Q8WXG1	OTTHUMG00000090352	ENST00000382040.3:c.233A>C	2.37:g.7018164A>C	ENSP00000371471:p.His78Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_rSAM,smart_Elp3/MiaB/NifB	p.H78P	ENST00000382040.3	37	c.233	CCDS1656.1	2	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497253	0.85069	.	.	ENSG00000134321	ENST00000382040	D	0.93307	-3.2	5.51	5.51	0.81932	Elongator protein 3/MiaB/NifB (1);	0.089341	0.85682	D	0.000000	D	0.97281	0.9111	M	0.91090	3.175	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	D	0.98124	1.0427	10	0.72032	D	0.01	-42.2062	15.9261	0.79618	1.0:0.0:0.0:0.0	.	78	Q8WXG1	RSAD2_HUMAN	P	78	ENSP00000371471:H78P	ENSP00000371471:H78P	H	+	2	0	RSAD2	6935615	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.162000	0.89657	2.231000	0.72958	0.455000	0.32223	CAC	RSAD2	-	smart_Elp3/MiaB/NifB	ENSG00000134321		0.532	RSAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSAD2	HGNC	protein_coding	OTTHUMT00000206724.2	195	0.00	0	A	NM_080657		7018164	7018164	+1	no_errors	ENST00000382040	ensembl	human	known	69_37n	missense	206	28.87	84	SNP	1.000	C
RXFP1	59350	genome.wustl.edu	37	4	159559201	159559201	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr4:159559201delA	ENST00000307765.5	+	13	1264	c.1013delA	c.(1012-1014)caafs	p.Q338fs	RXFP1_ENST00000448688.2_Frame_Shift_Del_p.Q233fs|RXFP1_ENST00000460056.2_Frame_Shift_Del_p.Q257fs|RXFP1_ENST00000470033.1_Frame_Shift_Del_p.Q305fs|RXFP1_ENST00000343542.5_Intron	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	338					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CAAGCAAACCAATTTGATTAT	0.274																																						dbGAP											0													58.0	58.0	58.0					4																	159559201		1784	4052	5836	-	-	-	SO:0001589	frameshift_variant	0			AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1013delA	4.37:g.159559201delA	ENSP00000303248:p.Gln338fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_supfam,prints_Relaxin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Gphrmn_rcpt	p.Q338fs	ENST00000307765.5	37	c.1013	CCDS43276.1	4																																																																																			RXFP1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000171509		0.274	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP1	HGNC	protein_coding	OTTHUMT00000314865.1	123	0.00	0	A	NM_021634		159559201	159559201	+1	no_errors	ENST00000307765	ensembl	human	known	69_37n	frame_shift_del	98	15.97	19	DEL	1.000	-
SHC4	399694	genome.wustl.edu	37	15	49148314	49148314	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr15:49148314C>A	ENST00000332408.4	-	8	1506	c.1078G>T	c.(1078-1080)Gtg>Ttg	p.V360L	SHC4_ENST00000396535.3_Missense_Mutation_p.V117L|SHC4_ENST00000537958.1_Missense_Mutation_p.V74L	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	360	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TCAATATGCACCTCCTCACTG	0.443																																						dbGAP											0													120.0	113.0	115.0					15																	49148314		2197	4295	6492	-	-	-	SO:0001583	missense	0			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1078G>T	15.37:g.49148314C>A	ENSP00000329668:p.Val360Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_SH2,smart_PTyr_interaction_dom,smart_SH2,prints_PID_domain,prints_SH2,pfscan_PTyr_interaction_dom,pfscan_SH2	p.V360L	ENST00000332408.4	37	c.1078	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325174	0.24080	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.29142	3.59;1.58;1.59	5.14	4.22	0.49857	.	0.422761	0.21797	N	0.068963	T	0.16727	0.0402	N	0.14661	0.345	0.32560	N	0.531264	B;B	0.09022	0.002;0.0	B;B	0.12837	0.008;0.002	T	0.13845	-1.0494	10	0.26408	T	0.33	-6.7894	8.2349	0.31620	0.0:0.7573:0.1585:0.0842	.	117;360	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	L	360;117;74	ENSP00000329668:V360L;ENSP00000379786:V117L;ENSP00000443300:V74L	ENSP00000329668:V360L	V	-	1	0	SHC4	46935606	0.014000	0.17966	0.909000	0.35828	0.640000	0.38277	-0.197000	0.09518	1.394000	0.46624	0.655000	0.94253	GTG	SHC4	-	NULL	ENSG00000185634		0.443	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	HGNC	protein_coding	OTTHUMT00000254371.1	112	0.00	0	C	NM_203349		49148314	49148314	-1	no_errors	ENST00000332408	ensembl	human	known	69_37n	missense	116	27.95	45	SNP	0.917	A
SPTB	6710	genome.wustl.edu	37	14	65253821	65253821	+	Silent	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr14:65253821G>A	ENST00000389721.5	-	15	2894	c.2862C>T	c.(2860-2862)ctC>ctT	p.L954L	SPTB_ENST00000389720.3_Silent_p.L954L|SPTB_ENST00000556626.1_Silent_p.L954L|SPTB_ENST00000542895.1_Silent_p.L954L|SPTB_ENST00000389722.3_Silent_p.L954L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	954					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGTGCACTCGGAGGGCTGAGT	0.612																																						dbGAP											0													37.0	39.0	38.0					14																	65253821		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.2862C>T	14.37:g.65253821G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15510|Q15519	Silent	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L954	ENST00000389721.5	37	c.2862	CCDS32100.1	14																																																																																			SPTB	-	pirsf_Spectrin_bsu	ENSG00000070182		0.612	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	24	0.00	0	G			65253821	65253821	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	silent	17	43.33	13	SNP	0.989	A
SREBF1	6720	genome.wustl.edu	37	17	17719341	17719341	+	Splice_Site	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr17:17719341C>T	ENST00000261646.5	-	12	2400	c.2216G>A	c.(2215-2217)cGc>cAc	p.R739H	SREBF1_ENST00000395757.1_Splice_Site_p.R485H|SREBF1_ENST00000338854.5_Splice_Site_p.R739H|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000355815.4_Splice_Site_p.R769H	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	739					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CAGGAAGAAGCGCTGTAGGGG	0.672																																						dbGAP											0													37.0	41.0	39.0					17																	17719341		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2215-1G>A	17.37:g.17719341C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.R769H	ENST00000261646.5	37	c.2306	CCDS11189.1	17	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359018	0.61403	.	.	ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161;ENST00000447641	T;T;T;T	0.15139	2.45;2.45;2.45;2.45	5.2	5.2	0.72013	.	0.197908	0.43260	D	0.000584	T	0.46718	0.1407	M	0.84326	2.69	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.68765	0.912;0.96;0.947	T	0.50303	-0.8844	10	0.62326	D	0.03	-16.5363	18.7259	0.91713	0.0:1.0:0.0:0.0	.	739;769;358	P36956;P36956-4;A8MTU8	SRBP1_HUMAN;.;.	H	739;769;739;485;358;576;665;64	ENSP00000345822:R739H;ENSP00000348069:R769H;ENSP00000261646:R739H;ENSP00000379106:R485H	ENSP00000261646:R739H	R	-	2	0	SREBF1	17660066	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.576000	0.82467	2.599000	0.87857	0.561000	0.74099	CGC	SREBF1	-	NULL	ENSG00000072310		0.672	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	HGNC	protein_coding	OTTHUMT00000131771.1	11	0.00	0	C	NM_004176	Missense_Mutation	17719341	17719341	-1	no_errors	ENST00000355815	ensembl	human	known	69_37n	missense	2	66.67	4	SNP	1.000	T
TAB2	23118	genome.wustl.edu	37	6	149699358	149699359	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr6:149699358_149699359insT	ENST00000367456.1	+	4	884_885	c.307_308insT	c.(307-309)ctafs	p.L103fs	TAB2_ENST00000536230.1_Frame_Shift_Ins_p.L71fs|TAB2_ENST00000286332.5_Frame_Shift_Ins_p.L103fs|TAB2_ENST00000392282.1_Frame_Shift_Ins_p.L103fs|TAB2_ENST00000538427.1_Frame_Shift_Ins_p.L103fs			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	103					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						AAGTAGGACTCTAACGCACAGC	0.465																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.308dupT	6.37:g.149699359_149699359dupT	ENSP00000356426:p.Leu103fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Frame_Shift_Ins	INS	pfam_CUE,pfam_Znf_RanBP2,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.T104fs	ENST00000367456.1	37	c.307_308	CCDS5214.1	6																																																																																			TAB2	-	NULL	ENSG00000055208		0.465	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB2	HGNC	protein_coding	OTTHUMT00000042633.3	164	0.00	0	-			149699358	149699359	+1	no_errors	ENST00000286332	ensembl	human	known	69_37n	frame_shift_ins	127	22.56	37	INS	1.000:1.000	T
TET3	200424	genome.wustl.edu	37	2	74329151	74329152	+	Frame_Shift_Ins	INS	-	-	G	rs190925009	byFrequency	TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr2:74329151_74329152insG	ENST00000409262.3	+	9	4831_4832	c.4831_4832insG	c.(4831-4833)tggfs	p.W1611fs		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1611					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAGCGCAAGTGGGGGGGCACT	0.688																																						dbGAP											0										17,3831		0,17,1907						5.2	1.0			13	13,7927		0,13,3957	no	frameshift	TET3	NM_144993.1		0,30,5864	A1A1,A1R,RR		0.1637,0.4418,0.2545				30,11758				-	-	-	SO:0001589	frameshift_variant	0				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.4838dupG	2.37:g.74329158_74329158dupG	ENSP00000386869:p.Trp1611fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI3|Q86Z24|Q8TBM9	Frame_Shift_Ins	INS	NULL	p.T1614fs	ENST00000409262.3	37	c.4831_4832	CCDS46339.1	2																																																																																			TET3	-	NULL	ENSG00000187605		0.688	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	52	0.00	0	-			74329151	74329152	+1	no_errors	ENST00000409262	ensembl	human	known	69_37n	frame_shift_ins	32	11.11	4	INS	1.000:1.000	G
THEG	51298	genome.wustl.edu	37	19	362223	362223	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr19:362223C>G	ENST00000342640.4	-	8	1159	c.1117G>C	c.(1117-1119)Gat>Cat	p.D373H	THEG_ENST00000346878.2_Missense_Mutation_p.D349H	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	373					cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)				NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGGTTGATCACACTTTTCT	0.562																																						dbGAP											0													172.0	171.0	171.0					19																	362223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.1117G>C	19.37:g.362223C>G	ENSP00000340088:p.Asp373His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMJ8	Missense_Mutation	SNP	smart_THEG	p.D373H	ENST00000342640.4	37	c.1117	CCDS12025.1	19	.	.	.	.	.	.	.	.	.	.	C	8.778	0.927580	0.18056	.	.	ENSG00000105549	ENST00000342640;ENST00000346878	T;T	0.18810	2.19;2.2	4.05	1.84	0.25277	.	0.440255	0.21221	N	0.078154	T	0.15782	0.0380	N	0.08118	0	0.09310	N	1	D;D	0.59767	0.986;0.986	P;P	0.54590	0.756;0.756	T	0.04522	-1.0945	10	0.72032	D	0.01	-19.9713	6.4994	0.22160	0.0:0.7663:0.0:0.2337	.	349;373	Q9P2T0-2;Q9P2T0	.;THEG_HUMAN	H	373;349	ENSP00000340088:D373H;ENSP00000264820:D349H	ENSP00000340088:D373H	D	-	1	0	THEG	313223	0.873000	0.30073	0.286000	0.24833	0.010000	0.07245	1.534000	0.36051	0.912000	0.36772	0.650000	0.86243	GAT	THEG	-	NULL	ENSG00000105549		0.562	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THEG	HGNC	protein_coding	OTTHUMT00000384431.2	170	0.00	0	C			362223	362223	-1	no_errors	ENST00000342640	ensembl	human	known	69_37n	missense	259	10.69	31	SNP	0.144	G
TOX3	27324	genome.wustl.edu	37	16	52473645	52473645	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr16:52473645G>A	ENST00000219746.9	-	7	1507	c.1223C>T	c.(1222-1224)cCc>cTc	p.P408L	TOX3_ENST00000407228.3_Missense_Mutation_p.P403L	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	408					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						AATGTTCGAGGGCATGTTGGC	0.547																																						dbGAP											0													231.0	225.0	227.0					16																	52473645		2149	4263	6412	-	-	-	SO:0001583	missense	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1223C>T	16.37:g.52473645G>A	ENSP00000219746:p.Pro408Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.P408L	ENST00000219746.9	37	c.1223	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856389	0.71834	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.11821	2.74;2.75	5.75	5.75	0.90469	.	0.211440	0.41294	D	0.000910	T	0.12860	0.0312	L	0.27053	0.805	0.80722	D	1	P;P	0.49090	0.919;0.919	B;B	0.40165	0.321;0.321	T	0.02257	-1.1187	10	0.41790	T	0.15	.	19.9449	0.97179	0.0:0.0:1.0:0.0	.	403;408	B4DRD0;O15405	.;TOX3_HUMAN	L	408;403	ENSP00000219746:P408L;ENSP00000385705:P403L	ENSP00000219746:P408L	P	-	2	0	TOX3	51031146	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.509000	0.81698	2.696000	0.92011	0.655000	0.94253	CCC	TOX3	-	NULL	ENSG00000103460		0.547	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	343	0.00	0	G	XM_049037		52473645	52473645	-1	no_errors	ENST00000219746	ensembl	human	known	69_37n	missense	264	23.92	83	SNP	1.000	A
TPO	7173	genome.wustl.edu	37	2	1546242	1546242	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr2:1546242T>A	ENST00000345913.4	+	17	2889	c.2798T>A	c.(2797-2799)cTc>cAc	p.L933H	TPO_ENST00000382198.1_Missense_Mutation_p.L760H|TPO_ENST00000349624.3_Missense_Mutation_p.L760H|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000337415.3_Missense_Mutation_p.S890T|TPO_ENST00000346956.3_Missense_Mutation_p.L889H|TPO_ENST00000329066.4_Missense_Mutation_p.L933H|TPO_ENST00000382201.3_Missense_Mutation_p.L876H	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	933					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CCGAGAGCCCTCTGAGGGCAA	0.502																																						dbGAP											0													89.0	84.0	86.0					2																	1546242		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2798T>A	2.37:g.1546242T>A	ENSP00000318820:p.Leu933His	Somatic		WXS	Illumina GAIIx	Phase_IV	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd,superfamily_Haem_peroxidase,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.L933H	ENST00000345913.4	37	c.2798	CCDS1643.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.01|10.01	1.234252|1.234252	0.22626|0.22626	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000469607;ENST00000425083|ENST00000337415	T;T;T;T;T;T;T;T|T	0.73575|0.66995	-0.36;-0.52;-0.13;-0.36;-0.34;-0.13;0.24;-0.76|-0.24	0.961|0.961	-0.0899|-0.0899	0.13667|0.13667	.|.	.|.	.|.	.|.	.|.	T|T	0.35248|0.35248	0.0925|0.0925	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	D;D;D;D|.	0.71674|.	0.991;0.998;0.991;0.996|.	D;D;D;D|.	0.79784|.	0.938;0.993;0.938;0.926|.	T|T	0.18493|0.18493	-1.0335|-1.0335	9|7	0.87932|0.09590	D|T	0|0.72	.|.	4.0428|4.0428	0.09760|0.09760	0.0:0.0:0.5573:0.4427|0.0:0.0:0.5573:0.4427	.|.	889;760;876;933|.	P07202-4;P07202-5;P07202-2;P07202|.	.;.;.;PERT_HUMAN|.	H|T	933;889;760;933;876;760;363;154|890	ENSP00000318820:L933H;ENSP00000263886:L889H;ENSP00000332044:L760H;ENSP00000329869:L933H;ENSP00000371636:L876H;ENSP00000371633:L760H;ENSP00000419461:L363H;ENSP00000389659:L154H|ENSP00000337263:S890T	ENSP00000329869:L933H|ENSP00000337263:S890T	L|S	+|+	2|1	0|0	TPO|TPO	1525249|1525249	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.750000|-0.750000	0.04808|0.04808	-0.055000|-0.055000	0.13244|0.13244	-0.636000|-0.636000	0.03981|0.03981	CTC|TCT	TPO	-	NULL	ENSG00000115705		0.502	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	83	0.00	0	T	NM_000547		1546242	1546242	+1	no_errors	ENST00000329066	ensembl	human	known	69_37n	missense	90	26.83	33	SNP	0.000	A
VCX	26609	genome.wustl.edu	37	X	7811288	7811288	+	Missense_Mutation	SNP	C	C	G	rs150891675		TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chrX:7811288C>G	ENST00000381059.3	+	2	263	c.44C>G	c.(43-45)aCg>aGg	p.T15R	VCX_ENST00000341408.4_Missense_Mutation_p.T15R	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	15				TEA -> KET (in Ref. 3; AAH98123). {ECO:0000305}.	chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GCCAAGGCCACGGAGGCAGGA	0.637													-|||	173	0.0458278	0.0083	0.0447	3775	,	,		12575	0.0288		0.0577	False		,,,				2504	0.045					dbGAP											0													17.0	15.0	16.0					X																	7811288		2101	4058	6159	-	-	-	SO:0001583	missense	0			AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.44C>G	X.37:g.7811288C>G	ENSP00000370447:p.Thr15Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JNS5|Q4V774|Q9P0H3	Missense_Mutation	SNP	NULL	p.T15R	ENST00000381059.3	37	c.44	CCDS14128.1	X	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.073016	0.00379	.	.	ENSG00000182583	ENST00000381059;ENST00000341408	T;T	0.16196	2.36;2.36	0.167	-0.333	0.12671	.	.	.	.	.	T	0.04003	0.0112	N	0.01352	-0.895	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.30504	-0.9976	8	0.16896	T	0.51	.	.	.	.	.	15	Q9H320	VCX1_HUMAN	R	15	ENSP00000370447:T15R;ENSP00000344144:T15R	ENSP00000344144:T15R	T	+	2	0	VCX	7771288	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.305000	0.01133	-2.647000	0.00426	-2.609000	0.00160	ACG	VCX	-	NULL	ENSG00000182583		0.637	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VCX	HGNC	protein_coding	OTTHUMT00000071474.1	39	0.00	0	C	NM_013452		7811288	7811288	+1	no_errors	ENST00000381059	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.000	G
WSCD2	9671	genome.wustl.edu	37	12	108604055	108604055	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr12:108604055C>T	ENST00000332082.4	+	5	1473	c.655C>T	c.(655-657)Cag>Tag	p.Q219*	WSCD2_ENST00000547525.1_Nonsense_Mutation_p.Q219*|WSCD2_ENST00000549903.1_Nonsense_Mutation_p.Q219*|WSCD2_ENST00000261400.3_Nonsense_Mutation_p.Q219*			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	219	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CTACCGGCTGCAGCTGGCCCA	0.682																																						dbGAP											0													11.0	16.0	14.0					12																	108604055		2174	4260	6434	-	-	-	SO:0001587	stop_gained	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.655C>T	12.37:g.108604055C>T	ENSP00000331933:p.Gln219*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Nonsense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.Q219*	ENST00000332082.4	37	c.655	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.531306	0.97641	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000551638;ENST00000332082;ENST00000549903	.	.	.	5.12	4.2	0.49525	.	0.114616	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-28.1712	11.4221	0.49987	0.0:0.6141:0.3859:0.0	.	.	.	.	X	219;219;66;219;219	.	ENSP00000261400:Q219X	Q	+	1	0	WSCD2	107128185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.425000	0.73370	2.379000	0.81126	0.555000	0.69702	CAG	WSCD2	-	smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000075035		0.682	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	68	0.00	0	C	NM_014653		108604055	108604055	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	nonsense	43	14.00	7	SNP	1.000	T
XPO4	64328	genome.wustl.edu	37	13	21371027	21371027	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr13:21371027delA	ENST00000255305.6	-	17	2563	c.2492delT	c.(2491-2493)ttafs	p.L831fs	XPO4_ENST00000400602.2_Frame_Shift_Del_p.L831fs			Q9C0E2	XPO4_HUMAN	exportin 4	831					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		GAAGTCCATTAAAAAATTAAA	0.413																																						dbGAP											0													62.0	60.0	60.0					13																	21371027		1847	4093	5940	-	-	-	SO:0001589	frameshift_variant	0			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.2492delT	13.37:g.21371027delA	ENSP00000255305:p.Leu831fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUZ5|Q8N3V6|Q9H934	Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.L831fs	ENST00000255305.6	37	c.2492	CCDS41872.1	13																																																																																			XPO4	-	superfamily_ARM-type_fold	ENSG00000132953		0.413	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	79	0.00	0	A	NM_022459		21371027	21371027	-1	no_errors	ENST00000255305	ensembl	human	known	69_37n	frame_shift_del	66	10.81	8	DEL	1.000	-
ZNRF4	148066	genome.wustl.edu	37	19	5456459	5456460	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A07G-01A-11W-A050-09	TCGA-A8-A07G-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	49f77aa5-446b-49f6-bd1b-02d3ff7b9dfc	a50c80c4-329f-456f-b86c-c97d2443ab75	g.chr19:5456459_5456460insT	ENST00000222033.4	+	1	1034_1035	c.957_958insT	c.(958-960)gacfs	p.D320fs		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	320						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		ATGAGGAGGGCGACCAACTCAA	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		Exception_encountered	19.37:g.5456459_5456460insT	ENSP00000222033:p.Asp320fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K886|O75866	Frame_Shift_Ins	INS	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D319fs	ENST00000222033.4	37	c.957_958	CCDS42475.1	19																																																																																			ZNRF4	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000105428		0.619	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF4	HGNC	protein_coding	OTTHUMT00000450924.1	110	0.00	0	-	NM_181710		5456459	5456460	+1	no_errors	ENST00000222033	ensembl	human	known	69_37n	frame_shift_ins	155	44.04	122	INS	0.705:0.790	T
