#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADORA1	134	genome.wustl.edu	37	1	203098133	203098133	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr1:203098133A>T	ENST00000367236.4	+	2	1085	c.164A>T	c.(163-165)gAt>gTt	p.D55V	ADORA1_ENST00000337894.4_Missense_Mutation_p.D55V|ADORA1_ENST00000309502.3_Missense_Mutation_p.D55V|RP11-335O13.7_ENST00000421055.1_RNA|ADORA1_ENST00000367235.1_Missense_Mutation_p.D55V	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	55					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	GCGGTGGCTGATGTGGCCGTG	0.632																																						dbGAP											0													210.0	151.0	171.0					1																	203098133		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.164A>T	1.37:g.203098133A>T	ENSP00000356205:p.Asp55Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adenosn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Adeno_A1_rcpt	p.D55V	ENST00000367236.4	37	c.164	CCDS1434.1	1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615605	0.87359	.	.	ENSG00000163485	ENST00000309502;ENST00000367236;ENST00000337894;ENST00000367235	D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96895	0.8986	H	0.98786	4.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98539	1.0631	10	0.87932	D	0	-18.9724	15.0055	0.71510	1.0:0.0:0.0:0.0	.	88;55	B7Z379;P30542	.;AA1R_HUMAN	V	55	ENSP00000308549:D55V;ENSP00000356205:D55V;ENSP00000338435:D55V;ENSP00000356204:D55V	ENSP00000308549:D55V	D	+	2	0	ADORA1	201364756	1.000000	0.71417	0.987000	0.45799	0.984000	0.73092	9.332000	0.96446	1.935000	0.56089	0.533000	0.62120	GAT	ADORA1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000163485		0.632	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA1	HGNC	protein_coding	OTTHUMT00000100273.1	65	0.00	0	A	NM_000674		203098133	203098133	+1	no_errors	ENST00000309502	ensembl	human	known	69_37n	missense	170	10.26	20	SNP	1.000	T
AHNAK	79026	genome.wustl.edu	37	11	62284301	62284301	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr11:62284301G>A	ENST00000378024.4	-	5	17862	c.17588C>T	c.(17587-17589)tCc>tTc	p.S5863F	AHNAK_ENST00000525875.1_Intron|AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5863					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AGAAGAGGAGGACAGTCGGGA	0.512																																						dbGAP											0													172.0	157.0	162.0					11																	62284301		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17588C>T	11.37:g.62284301G>A	ENSP00000367263:p.Ser5863Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S5863F	ENST00000378024.4	37	c.17588	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599464	0.66332	.	.	ENSG00000124942	ENST00000378024	T	0.00730	5.77	4.87	4.87	0.63330	.	.	.	.	.	T	0.00906	0.0030	N	0.24115	0.695	0.41763	D	0.989721	P	0.40332	0.713	B	0.36845	0.234	T	0.78868	-0.2034	9	0.56958	D	0.05	-1.1147	17.6161	0.88068	0.0:0.0:1.0:0.0	.	5863	Q09666	AHNK_HUMAN	F	5863	ENSP00000367263:S5863F	ENSP00000367263:S5863F	S	-	2	0	AHNAK	62040877	1.000000	0.71417	0.926000	0.36857	0.945000	0.59286	5.998000	0.70653	2.245000	0.73994	0.549000	0.68633	TCC	AHNAK	-	NULL	ENSG00000124942		0.512	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	384	0.00	0	G	NM_024060		62284301	62284301	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	153	35.98	86	SNP	0.999	A
ALDH1B1	219	genome.wustl.edu	37	9	38395914	38395914	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr9:38395914G>T	ENST00000377698.3	+	2	322	c.169G>T	c.(169-171)Gtc>Ttc	p.V57F		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	57					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		CTTCCCGACGGTCAACCCTAC	0.597																																						dbGAP											0													96.0	88.0	91.0					9																	38395914		2203	4300	6503	-	-	-	SO:0001583	missense	0			M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.169G>T	9.37:g.38395914G>T	ENSP00000366927:p.Val57Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.V57F	ENST00000377698.3	37	c.169	CCDS6615.1	9	.	.	.	.	.	.	.	.	.	.	G	0.409	-0.914337	0.02415	.	.	ENSG00000137124	ENST00000377698	T	0.77098	-1.07	5.81	1.98	0.26296	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.314820	0.25768	N	0.028424	T	0.67297	0.2878	L	0.44542	1.39	0.38479	D	0.947665	B	0.13594	0.008	B	0.17979	0.02	T	0.58907	-0.7553	10	0.39692	T	0.17	.	8.7571	0.34652	0.311:0.0:0.689:0.0	.	57	P30837	AL1B1_HUMAN	F	57	ENSP00000366927:V57F	ENSP00000366927:V57F	V	+	1	0	ALDH1B1	38385914	0.073000	0.21202	0.129000	0.21949	0.099000	0.18886	0.461000	0.21940	0.108000	0.17862	-0.136000	0.14681	GTC	ALDH1B1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000137124		0.597	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1B1	HGNC	protein_coding	OTTHUMT00000052492.1	85	0.00	0	G			38395914	38395914	+1	no_errors	ENST00000377698	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	0.567	T
AOAH	313	genome.wustl.edu	37	7	36661342	36661342	+	Silent	SNP	G	G	A	rs200510886		TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr7:36661342G>A	ENST00000258749.5	-	8	1026	c.627C>T	c.(625-627)agC>agT	p.S209S	AOAH_ENST00000535891.1_Silent_p.S177S|AOAH_ENST00000431169.1_Silent_p.S209S	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	209					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						CTGACTCGTCGCTGTCATTAC	0.483																																						dbGAP											0													138.0	129.0	132.0					7																	36661342		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.627C>T	7.37:g.36661342G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Y5|B7Z490|Q53F13	Silent	SNP	pfam_Lipase_GDSL,pfam_SapB_2,superfamily_Saposin-like,superfamily_Esterase_SGNH_hydro-type,smart_SaposinB,pfscan_SaposinB	p.S209	ENST00000258749.5	37	c.627	CCDS5448.1	7																																																																																			AOAH	-	NULL	ENSG00000136250		0.483	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AOAH	HGNC	protein_coding	OTTHUMT00000219829.2	206	0.00	0	G	NM_001637		36661342	36661342	-1	no_errors	ENST00000258749	ensembl	human	known	69_37n	silent	83	36.15	47	SNP	0.000	A
ARHGAP12	94134	genome.wustl.edu	37	10	32197496	32197496	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr10:32197496C>G	ENST00000344936.2	-	3	522	c.288G>C	c.(286-288)caG>caC	p.Q96H	ARHGAP12_ENST00000375245.4_Missense_Mutation_p.Q96H|ARHGAP12_ENST00000396144.4_Missense_Mutation_p.Q96H|ARHGAP12_ENST00000311380.4_Missense_Mutation_p.Q96H|ARHGAP12_ENST00000375250.5_Missense_Mutation_p.Q96H	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	96					morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				GATGCAAACTCTGCATTATTT	0.453																																						dbGAP											0													84.0	78.0	80.0					10																	32197496		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.288G>C	10.37:g.32197496C>G	ENSP00000345808:p.Gln96His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_Rsp5_WWP,smart_SH3_domain,smart_WW_Rsp5_WWP,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.Q96H	ENST00000344936.2	37	c.288	CCDS7170.1	10	.	.	.	.	.	.	.	.	.	.	C	10.28	1.306448	0.23736	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.08008	3.19;3.14;3.19;3.19;3.19	5.53	5.53	0.82687	.	0.259259	0.38605	N	0.001630	T	0.04998	0.0134	N	0.08118	0	0.30302	N	0.789385	B;B;B;B;B;B	0.11235	0.002;0.002;0.004;0.002;0.002;0.002	B;B;B;B;B;B	0.09377	0.002;0.002;0.004;0.002;0.002;0.003	T	0.16837	-1.0389	10	0.31617	T	0.26	.	12.6466	0.56738	0.2064:0.7936:0.0:0.0	.	96;96;96;96;96;96	Q1RLN5;B3KR88;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3	.;.;.;.;RHG12_HUMAN;.	H	96	ENSP00000310984:Q96H;ENSP00000364399:Q96H;ENSP00000345808:Q96H;ENSP00000379448:Q96H;ENSP00000364394:Q96H	ENSP00000310984:Q96H	Q	-	3	2	ARHGAP12	32237502	0.998000	0.40836	1.000000	0.80357	0.819000	0.46315	1.346000	0.33964	2.761000	0.94854	0.650000	0.86243	CAG	ARHGAP12	-	NULL	ENSG00000165322		0.453	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	HGNC	protein_coding	OTTHUMT00000047465.1	246	0.00	0	C			32197496	32197496	-1	no_errors	ENST00000344936	ensembl	human	known	69_37n	missense	93	47.75	85	SNP	1.000	G
ARID1A	8289	genome.wustl.edu	37	1	27106136	27106136	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr1:27106136C>G	ENST00000324856.7	+	20	6118	c.5747C>G	c.(5746-5748)tCt>tGt	p.S1916C	ARID1A_ENST00000457599.2_Missense_Mutation_p.S1699C|ARID1A_ENST00000374152.2_Missense_Mutation_p.S1533C|ARID1A_ENST00000540690.1_Missense_Mutation_p.S244C	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1916					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GACATGTTGTCTACTCGGTCT	0.542			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													96.0	99.0	98.0					1																	27106136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5747C>G	1.37:g.27106136C>G	ENSP00000320485:p.Ser1916Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S1916C	ENST00000324856.7	37	c.5747	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.874040	0.33069	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.10763	4.38;4.22;4.21;2.84	4.84	4.84	0.62591	.	0.187952	0.47852	D	0.000205	T	0.07593	0.0191	N	0.16066	0.365	0.43263	D	0.995208	B;B;B	0.22003	0.002;0.037;0.063	B;B;B	0.17433	0.003;0.008;0.018	T	0.27839	-1.0062	10	0.40728	T	0.16	-11.4079	14.1417	0.65325	0.0:0.85:0.15:0.0	.	1533;1916;1699	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	C	1916;1699;1533;244	ENSP00000320485:S1916C;ENSP00000387636:S1699C;ENSP00000363267:S1533C;ENSP00000442437:S244C	ENSP00000320485:S1916C	S	+	2	0	ARID1A	26978723	0.871000	0.30034	0.989000	0.46669	0.983000	0.72400	1.565000	0.36386	2.667000	0.90743	0.491000	0.48974	TCT	ARID1A	-	NULL	ENSG00000117713		0.542	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	230	0.00	0	C	NM_139135		27106136	27106136	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	missense	115	34.83	62	SNP	1.000	G
ASAH2C	653365	genome.wustl.edu	37	10	48033003	48033003	+	Silent	SNP	T	T	C			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr10:48033003T>C	ENST00000426610.2	-	5	521	c.522A>G	c.(520-522)aaA>aaG	p.K174K				P0C7U2	ASA2C_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2C	174					sphingolipid metabolic process (GO:0006665)		ceramidase activity (GO:0017040)			lung(3)	3						GTAGATATCCTTTGTTCTTCT	0.418																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					10q11.22	2013-01-14			ENSG00000072444				23457	other	unknown						17334805	Standard			Approved	bA98I6.3		P0C7U2	OTTHUMG00000018134	ENST00000426610.2:c.522A>G	10.37:g.48033003T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ceramidase_alk	p.K174	ENST00000426610.2	37	c.522		10																																																																																			ASAH2C	-	pfam_Ceramidase_alk	ENSG00000072444		0.418	ASAH2C-201	KNOWN	basic|appris_principal	protein_coding	ASAH2C	HGNC	protein_coding		184	0.00	0	T	NG_012763		48033003	48033003	-1	no_errors	ENST00000426610	ensembl	human	known	69_37n	silent	81	35.71	45	SNP	0.987	C
BRCA2	675	genome.wustl.edu	37	13	32912555	32912555	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr13:32912555G>T	ENST00000380152.3	+	11	4296	c.4063G>T	c.(4063-4065)Gac>Tac	p.D1355Y	BRCA2_ENST00000544455.1_Missense_Mutation_p.D1355Y			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1355	Interaction with POLH.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.E1353fs*5(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGATGAAACGGACTTGCTATT	0.323			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Deletion - Frameshift(1)	ovary(1)											62.0	64.0	63.0					13																	32912555		2203	4298	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4063G>T	13.37:g.32912555G>T	ENSP00000369497:p.Asp1355Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2,pfscan_BRCA2_repeat	p.D1355Y	ENST00000380152.3	37	c.4063	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	8.383	0.838068	0.16891	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00824	5.65;5.65	5.75	4.9	0.64082	.	0.587964	0.17048	N	0.189052	T	0.01592	0.0051	L	0.39898	1.24	0.09310	N	1	D	0.56521	0.976	P	0.47744	0.556	T	0.52631	-0.8550	10	0.66056	D	0.02	.	9.7652	0.40557	0.1697:0.0:0.8303:0.0	.	1355	P51587	BRCA2_HUMAN	Y	1355	ENSP00000369497:D1355Y;ENSP00000439902:D1355Y	ENSP00000369497:D1355Y	D	+	1	0	BRCA2	31810555	0.004000	0.15560	0.006000	0.13384	0.283000	0.27025	1.304000	0.33482	1.429000	0.47314	0.563000	0.77884	GAC	BRCA2	-	pirsf_DNA_recomb/repair_BRCA2	ENSG00000139618		0.323	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	100	0.00	0	G	NM_000059		32912555	32912555	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	missense	60	24.69	20	SNP	0.011	T
CDK14	5218	genome.wustl.edu	37	7	90377067	90377067	+	Silent	SNP	T	T	C			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr7:90377067T>C	ENST00000380050.3	+	4	572	c.441T>C	c.(439-441)gcT>gcC	p.A147A	CDK14_ENST00000436577.2_Intron|CDK14_ENST00000265741.3_Silent_p.A129A|CDK14_ENST00000406263.1_Silent_p.A101A			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	147	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						GATCTTATGCTACAGTATACA	0.333																																					GBM(83;1228 1256 8311 16577 31299)	dbGAP											0													120.0	123.0	122.0					7																	90377067		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.441T>C	7.37:g.90377067T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A147	ENST00000380050.3	37	c.441		7																																																																																			CDK14	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000058091		0.333	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	348	0.00	0	T	NM_012395		90377067	90377067	+1	no_errors	ENST00000380050	ensembl	human	known	69_37n	silent	52	56.67	68	SNP	1.000	C
CR1	1378	genome.wustl.edu	37	1	207669639	207669639	+	Silent	SNP	G	G	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr1:207669639G>A	ENST00000367049.4	+	1	27	c.27G>A	c.(25-27)ccG>ccA	p.P9P	CR1_ENST00000367050.4_3'UTR|CR1_ENST00000400960.2_Silent_p.P9P|CR1_ENST00000367051.1_Silent_p.P9P|CR1_ENST00000367053.1_Silent_p.P9P|CR1_ENST00000367052.1_Silent_p.P9P	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	9					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CAAGAAGCCCGGAGCCTGTCG	0.592																																						dbGAP											0													24.0	29.0	27.0					1																	207669639		1830	4078	5908	-	-	-	SO:0001819	synonymous_variant	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.27G>A	1.37:g.207669639G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.P9	ENST00000367049.4	37	c.27	CCDS44308.1	1																																																																																			CR1	-	NULL	ENSG00000203710		0.592	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	30	0.00	0	G	NM_000573		207669639	207669639	+1	no_errors	ENST00000367049	ensembl	human	known	69_37n	silent	21	19.23	5	SNP	0.000	A
CXorf36	79742	genome.wustl.edu	37	X	45013241	45013241	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chrX:45013241A>G	ENST00000398000.2	-	4	949	c.875T>C	c.(874-876)aTt>aCt	p.I292T	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	292						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						GCCTGCATCAATGTGGGTGAA	0.547																																						dbGAP											0													97.0	79.0	85.0					X																	45013241		1568	3582	5150	-	-	-	SO:0001583	missense	0			AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.875T>C	X.37:g.45013241A>G	ENSP00000381086:p.Ile292Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	NULL	p.I292T	ENST00000398000.2	37	c.875	CCDS48096.1	X	.	.	.	.	.	.	.	.	.	.	A	13.29	2.194508	0.38806	.	.	ENSG00000147113	ENST00000398000	T	0.34472	1.36	5.49	5.49	0.81192	.	0.474289	0.20973	N	0.082355	T	0.30978	0.0782	L	0.43152	1.355	0.80722	D	1	P	0.35272	0.493	B	0.31101	0.124	T	0.10314	-1.0635	10	0.49607	T	0.09	.	13.4549	0.61193	1.0:0.0:0.0:0.0	.	292	Q9H7Y0	CX036_HUMAN	T	292	ENSP00000381086:I292T	ENSP00000381086:I292T	I	-	2	0	CXorf36	44898185	0.705000	0.27846	0.067000	0.19924	0.594000	0.36715	3.820000	0.55693	1.963000	0.57068	0.430000	0.28490	ATT	CXorf36	-	NULL	ENSG00000147113		0.547	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf36	HGNC	protein_coding	OTTHUMT00000056333.2	76	0.00	0	A	NM_024689		45013241	45013241	-1	no_errors	ENST00000398000	ensembl	human	known	69_37n	missense	50	36.71	29	SNP	0.328	G
F8	2157	genome.wustl.edu	37	X	154157239	154157240	+	Frame_Shift_Ins	INS	-	-	T	rs397514036		TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chrX:154157239_154157240insT	ENST00000360256.4	-	14	5025_5026	c.4825_4826insA	c.(4825-4827)acafs	p.T1609fs		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1609	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CTTAAAAGCTGTTTTTTCTGGT	0.406																																						dbGAP											0			GRCh37	CI931081	F8	I																																				-	-	-	SO:0001589	frameshift_variant	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4826dupA	X.37:g.154157245_154157245dupT	ENSP00000353393:p.Thr1609fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14286|Q5HY69	Frame_Shift_Ins	INS	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.T1609fs	ENST00000360256.4	37	c.4826_4825	CCDS35457.1	X																																																																																			F8	-	NULL	ENSG00000185010		0.406	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	770	0.00	0	-			154157239	154157240	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	frame_shift_ins	459	28.39	182	INS	0.000:0.001	T
GGA3	23163	genome.wustl.edu	37	17	73239562	73239562	+	Silent	SNP	C	C	T	rs371748162		TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr17:73239562C>T	ENST00000245541.6	-	5	606	c.390G>A	c.(388-390)aaG>aaA	p.K130K	GGA3_ENST00000579743.1_5'Flank|GGA3_ENST00000578348.1_Silent_p.K8K|GGA3_ENST00000582486.1_Silent_p.K58K|GGA3_ENST00000351904.7_Silent_p.K97K|GGA3_ENST00000582717.1_Silent_p.K58K|GGA3_ENST00000538886.1_Silent_p.K8K|GGA3_ENST00000537686.1_Silent_p.K130K	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	130	Binds to ARF1 (in long isoform).|VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			CGTCTTTGATCTTTGCTTCTT	0.572																																						dbGAP											0													222.0	180.0	194.0					17																	73239562		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.390G>A	17.37:g.73239562C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pfscan_VHS	p.D130N	ENST00000245541.6	37	c.388	CCDS11717.1	17																																																																																			GGA3	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pfscan_VHS	ENSG00000125447		0.572	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA3	HGNC	protein_coding	OTTHUMT00000446645.1	96	0.00	0	C	NM_138619		73239562	73239562	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000584243	ensembl	human	known	69_37n	missense	69	31.68	32	SNP	1.000	T
GUCY2C	2984	genome.wustl.edu	37	12	14839103	14839103	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr12:14839103G>C	ENST00000261170.3	-	3	523	c.387C>G	c.(385-387)ttC>ttG	p.F129L	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	129					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACTACATCTGGAAGGTGGAGT	0.408																																						dbGAP											0													99.0	83.0	88.0					12																	14839103		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.387C>G	12.37:g.14839103G>C	ENSP00000261170:p.Phe129Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMY6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.F129L	ENST00000261170.3	37	c.387	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	G	18.61	3.662075	0.67700	.	.	ENSG00000070019	ENST00000261170	D	0.82344	-1.6	5.92	3.79	0.43588	Extracellular ligand-binding receptor (1);	0.225099	0.46758	D	0.000278	D	0.82715	0.5097	M	0.66939	2.045	0.40206	D	0.977576	P	0.51653	0.947	P	0.51657	0.676	T	0.79553	-0.1756	10	0.12430	T	0.62	.	9.131	0.36846	0.1895:0.0:0.8105:0.0	.	129	P25092	GUC2C_HUMAN	L	129	ENSP00000261170:F129L	ENSP00000261170:F129L	F	-	3	2	GUCY2C	14730370	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.078000	0.50096	1.514000	0.48869	0.655000	0.94253	TTC	GUCY2C	-	pfam_ANF_lig-bd_rcpt	ENSG00000070019		0.408	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1	45	0.00	0	G			14839103	14839103	-1	no_errors	ENST00000261170	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	1.000	C
HECTD4	283450	genome.wustl.edu	37	12	112600859	112600860	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr12:112600859_112600860insG	ENST00000430131.2	-	74	12985_12986	c.11840_11841insC	c.(11839-11841)ccafs	p.P3947fs	HECTD4_ENST00000550722.1_Frame_Shift_Ins_p.P4223fs|HECTD4_ENST00000377560.5_Frame_Shift_Ins_p.P4197fs|HECTD4_ENST00000549141.1_5'Flank			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3947	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CTGTGCCATCTGGGGGGGCGAT	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11841dupC	12.37:g.112600866_112600866dupG	ENSP00000404379:p.Pro3947fs	Somatic		WXS	Illumina GAIIx	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Frame_Shift_Ins	INS	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.D4198fs	ENST00000430131.2	37	c.12591_12590		12																																																																																			HECTD4	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000173064		0.629	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		63	0.00	0	-	NM_173813		112600859	112600860	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	frame_shift_ins	23	11.54	3	INS	0.555:1.000	G
KIDINS220	57498	genome.wustl.edu	37	2	8871022	8871022	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr2:8871022G>A	ENST00000256707.3	-	30	5325	c.5144C>T	c.(5143-5145)cCt>cTt	p.P1715L	KIDINS220_ENST00000473731.1_Missense_Mutation_p.P1696L|KIDINS220_ENST00000427284.1_Missense_Mutation_p.P1696L|KIDINS220_ENST00000418530.1_Missense_Mutation_p.P1616L	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1715					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACTGGAACTAGGCCTCAAAAT	0.438																																						dbGAP											0													164.0	152.0	156.0					2																	8871022		1907	4123	6030	-	-	-	SO:0001583	missense	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.5144C>T	2.37:g.8871022G>A	ENSP00000256707:p.Pro1715Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P1715L	ENST00000256707.3	37	c.5144	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738911	0.89573	.	.	ENSG00000134313	ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731	T;T;T;T	0.70749	-0.51;-0.51;-0.47;-0.51	5.93	5.93	0.95920	.	0.184624	0.46758	D	0.000267	T	0.79275	0.4418	L	0.32530	0.975	0.58432	D	0.999999	D;D;P	0.89917	1.0;0.999;0.889	D;D;P	0.74348	0.983;0.962;0.628	T	0.80174	-0.1492	10	0.87932	D	0	.	20.3368	0.98748	0.0:0.0:1.0:0.0	.	1616;1715;569	Q9ULH0-2;Q9ULH0;B4DG84	.;KDIS_HUMAN;.	L	1715;1696;1616;1696	ENSP00000256707:P1715L;ENSP00000411849:P1696L;ENSP00000414923:P1616L;ENSP00000418974:P1696L	ENSP00000256707:P1715L	P	-	2	0	KIDINS220	8788473	1.000000	0.71417	0.914000	0.36105	0.995000	0.86356	8.178000	0.89690	2.805000	0.96524	0.655000	0.94253	CCT	KIDINS220	-	NULL	ENSG00000134313		0.438	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	116	0.00	0	G	NM_020738		8871022	8871022	-1	no_errors	ENST00000256707	ensembl	human	known	69_37n	missense	79	10.23	9	SNP	0.966	A
KIRREL	55243	genome.wustl.edu	37	1	158047872	158047872	+	Silent	SNP	C	C	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr1:158047872C>T	ENST00000359209.6	+	3	361	c.294C>T	c.(292-294)taC>taT	p.Y98Y	KIRREL_ENST00000360089.4_Silent_p.Y37Y|KIRREL_ENST00000392272.2_Silent_p.Y98Y|KIRREL_ENST00000368173.3_Silent_p.Y98Y|KIRREL_ENST00000416935.2_Intron			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	98	Ig-like C2-type 1.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					ACGCCTCTTACGAGTGCCAGG	0.627																																						dbGAP											0													116.0	106.0	109.0					1																	158047872		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.294C>T	1.37:g.158047872C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Y98	ENST00000359209.6	37	c.294	CCDS1172.2	1																																																																																			KIRREL	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000183853		0.627	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	120	0.00	0	C	NM_018240		158047872	158047872	+1	no_errors	ENST00000368173	ensembl	human	known	69_37n	silent	109	24.31	35	SNP	0.915	T
KLHL34	257240	genome.wustl.edu	37	X	21675572	21675572	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chrX:21675572G>T	ENST00000379499.2	-	1	876	c.335C>A	c.(334-336)aCt>aAt	p.T112N		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	112						extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						CAGGGCCTCAGTGACCTGCAG	0.647																																						dbGAP											0													18.0	17.0	17.0					X																	21675572		2202	4293	6495	-	-	-	SO:0001583	missense	0			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.335C>A	X.37:g.21675572G>T	ENSP00000368813:p.Thr112Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T112N	ENST00000379499.2	37	c.335	CCDS14199.1	X	.	.	.	.	.	.	.	.	.	.	G	7.600	0.672533	0.14776	.	.	ENSG00000185915	ENST00000379499	T	0.67171	-0.25	4.35	3.44	0.39384	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.388784	0.26359	N	0.024821	T	0.47192	0.1432	N	0.25992	0.78	0.27444	N	0.953622	B	0.25272	0.122	B	0.21917	0.037	T	0.24261	-1.0165	10	0.16420	T	0.52	.	8.609	0.33791	0.0958:0.168:0.7362:0.0	.	112	Q8N239	KLH34_HUMAN	N	112	ENSP00000368813:T112N	ENSP00000368813:T112N	T	-	2	0	KLHL34	21585493	0.988000	0.35896	0.989000	0.46669	0.893000	0.52053	2.724000	0.47285	2.006000	0.58801	0.422000	0.28245	ACT	KLHL34	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000185915		0.647	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL34	HGNC	protein_coding	OTTHUMT00000056022.1	13	0.00	0	G	NM_153270		21675572	21675572	-1	no_errors	ENST00000379499	ensembl	human	known	69_37n	missense	3	66.67	6	SNP	0.743	T
MUC16	94025	genome.wustl.edu	37	19	8997511	8997511	+	Missense_Mutation	SNP	G	G	T	rs267605778		TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr19:8997511G>T	ENST00000397910.4	-	59	41114	c.40911C>A	c.(40909-40911)ttC>ttA	p.F13637L	MUC16_ENST00000380951.5_Missense_Mutation_p.F278L	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13639	SEA 11. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGTTGAGAGTGAATAGCACCA	0.507																																						dbGAP											0													152.0	123.0	132.0					19																	8997511		1975	4182	6157	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40911C>A	19.37:g.8997511G>T	ENSP00000381008:p.Phe13637Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.F13637L	ENST00000397910.4	37	c.40911	CCDS54212.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.73|13.73	2.323458|2.323458	0.41096|0.41096	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.44881|.	0.91;0.91|.	2.86|2.86	-3.27|-3.27	0.05048|0.05048	SEA (2);|.	.|.	.|.	.|.	.|.	T|.	0.65606|.	0.2707|.	M|M	0.90483|0.90483	3.12|3.12	.|.	.|.	.|.	B;P|.	0.39576|.	0.114;0.679|.	B;P|.	0.57679|.	0.054;0.825|.	T|.	0.69525|.	-0.5122|.	8|.	0.56958|.	D|.	0.05|.	-13.8916|-13.8916	7.6798|7.6798	0.28507|0.28507	0.6249:0.0:0.3751:0.0|0.6249:0.0:0.3751:0.0	.|.	21282;13637|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	L|X	13637;278|477	ENSP00000381008:F13637L;ENSP00000370338:F278L|.	ENSP00000370338:F278L|.	F|S	-|-	3|2	2|0	MUC16|MUC16	8858511|8858511	0.742000|0.742000	0.28228|0.28228	0.001000|0.001000	0.08648|0.08648	0.003000|0.003000	0.03518|0.03518	-0.106000|-0.106000	0.10890|0.10890	-0.669000|-0.669000	0.05289|0.05289	-0.266000|-0.266000	0.10368|0.10368	TTC|TCA	MUC16	-	pfam_SEA,pfscan_SEA	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	422	0.00	0	G	NM_024690		8997511	8997511	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	331	25.39	113	SNP	0.001	T
MUC6	4588	genome.wustl.edu	37	11	1016078	1016079	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr11:1016078_1016079insG	ENST00000421673.2	-	31	6772_6773	c.6722_6723insC	c.(6721-6723)ctafs	p.L2241fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2241	Ser-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCTGGAGGCTAGGTGGCTGGA	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6722_6723insC	11.37:g.1016078_1016079insG	ENSP00000406861:p.Leu2241fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Ins	INS	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.A2242fs	ENST00000421673.2	37	c.6723_6722	CCDS44513.1	11																																																																																			MUC6	-	NULL	ENSG00000184956		0.609	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	14	0.00	0	-	XM_290540		1016078	1016079	-1	no_errors	ENST00000421673	ensembl	human	known	69_37n	frame_shift_ins	14	36.36	8	INS	0.000:0.000	G
LINC01317	104355287	genome.wustl.edu	37	2	33952092	33952092	+	lincRNA	SNP	C	C	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr2:33952092C>A	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							GCAAACGGGGCCCTTTGGGAG	0.547																																						dbGAP											0																																										-	-	-			0																															2.37:g.33952092C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.547	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	36	0.00	0	C			33952092	33952092	-1	no_errors	ENST00000474610	ensembl	human	known	69_37n	rna	14	30.00	6	SNP	0.015	A
NAV1	89796	genome.wustl.edu	37	1	201687769	201687769	+	Missense_Mutation	SNP	G	G	T	rs369380338		TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr1:201687769G>T	ENST00000367296.4	+	3	1532	c.1112G>T	c.(1111-1113)cGc>cTc	p.R371L	NAV1_ENST00000367297.4_Missense_Mutation_p.R371L|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Missense_Mutation_p.R384L|NAV1_ENST00000295624.6_Missense_Mutation_p.R371L|MIR5191_ENST00000577455.1_RNA|NAV1_ENST00000367300.3_Missense_Mutation_p.R371L	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	371					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CATATCTCCCGCCTGGAGCTG	0.632																																						dbGAP											0													102.0	95.0	98.0					1																	201687769		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.1112G>T	1.37:g.201687769G>T	ENSP00000356265:p.Arg371Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	smart_AAA+_ATPase	p.R371L	ENST00000367296.4	37	c.1112	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.927903	0.73327	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.58	5.58	0.84498	.	0.063397	0.64402	D	0.000007	T	0.39708	0.1088	L	0.53249	1.67	0.40745	D	0.982864	P	0.35272	0.493	B	0.34536	0.185	T	0.42015	-0.9476	10	0.66056	D	0.02	-24.0893	12.5295	0.56106	0.0773:0.0:0.9227:0.0	.	371	Q8NEY1-3	.	L	384;371;371;371;371	ENSP00000356271:R384L;ENSP00000356265:R371L;ENSP00000295624:R371L;ENSP00000356266:R371L;ENSP00000356269:R371L	ENSP00000295624:R371L	R	+	2	0	NAV1	199954392	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.491000	0.60326	2.610000	0.88304	0.563000	0.77884	CGC	NAV1	-	NULL	ENSG00000134369		0.632	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	83	0.00	0	G	NM_020443		201687769	201687769	+1	no_errors	ENST00000367296	ensembl	human	known	69_37n	missense	16	70.91	39	SNP	1.000	T
NEFM	4741	genome.wustl.edu	37	8	24774866	24774866	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr8:24774866G>A	ENST00000221166.5	+	3	2280	c.1498G>A	c.(1498-1500)Gaa>Aaa	p.E500K	NEFM_ENST00000437366.2_Missense_Mutation_p.E500K|NEFM_ENST00000433454.2_Missense_Mutation_p.E124K|NEFM_ENST00000521540.1_3'UTR|NEFM_ENST00000518131.1_Missense_Mutation_p.E500K|GS1-72M22.1_ENST00000607058.1_RNA			P07197	NFM_HUMAN	neurofilament, medium polypeptide	500	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		agaggaacccgaagctgaaga	0.468																																						dbGAP											0													38.0	42.0	41.0					8																	24774866		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.1498G>A	8.37:g.24774866G>A	ENSP00000221166:p.Glu500Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	pfam_F,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin,prints_Keratin_I	p.E500K	ENST00000221166.5	37	c.1498	CCDS6046.1	8	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279818	0.23392	.	.	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366;ENST00000433454	D;D;D;D	0.94897	-1.9;-1.66;-1.87;-3.55	4.19	4.19	0.49359	.	0.388897	0.18874	N	0.128770	D	0.90823	0.7118	L	0.50333	1.59	0.47374	D	0.999405	P;P	0.43352	0.553;0.804	B;B	0.31101	0.026;0.124	D	0.91871	0.5507	10	0.54805	T	0.06	.	16.497	0.84247	0.0:0.0:1.0:0.0	.	500;500	E7EMV2;P07197	.;NFM_HUMAN	K	500;500;500;124	ENSP00000221166:E500K;ENSP00000427872:E500K;ENSP00000410137:E500K;ENSP00000412295:E124K	ENSP00000221166:E500K	E	+	1	0	NEFM	24830771	0.957000	0.32711	0.172000	0.22920	0.144000	0.21451	5.124000	0.64709	2.034000	0.60081	0.467000	0.42956	GAA	NEFM	-	NULL	ENSG00000104722		0.468	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEFM	HGNC	protein_coding	OTTHUMT00000254954.2	48	0.00	0	G	NM_005382		24774866	24774866	+1	no_errors	ENST00000221166	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	0.958	A
PCDHB16	57717	genome.wustl.edu	37	5	140562339	140562339	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr5:140562339C>T	ENST00000361016.2	+	1	1360	c.205C>T	c.(205-207)Cag>Tag	p.Q69*		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	69	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GATCATTTCCCAGGGGAACAA	0.512																																						dbGAP											0													74.0	80.0	78.0					5																	140562339		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.205C>T	5.37:g.140562339C>T	ENSP00000354293:p.Gln69*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q69*	ENST00000361016.2	37	c.205	CCDS4251.1	5	.	.	.	.	.	.	.	.	.	.	C	45	11.481556	0.99566	.	.	ENSG00000196963	ENST00000361016	.	.	.	4.84	0.616	0.17613	.	0.259259	0.20402	N	0.093033	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	11.164	0.48533	0.105:0.405:0.49:0.0	.	.	.	.	X	69	.	ENSP00000354293:Q69X	Q	+	1	0	PCDHB16	140542523	0.000000	0.05858	0.002000	0.10522	0.904000	0.53231	-0.843000	0.04350	0.402000	0.25451	0.655000	0.94253	CAG	PCDHB16	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196963		0.512	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	99	0.00	0	C	NM_020957		140562339	140562339	+1	no_errors	ENST00000361016	ensembl	human	known	69_37n	nonsense	39	40.91	27	SNP	0.003	T
PCDHB16	57717	genome.wustl.edu	37	5	140564292	140564292	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr5:140564292G>T	ENST00000361016.2	+	1	3313	c.2158G>T	c.(2158-2160)Gcc>Tcc	p.A720S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	720					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGCAGGGCGGCCTCGGTGGG	0.662																																						dbGAP											0													64.0	75.0	71.0					5																	140564292		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.2158G>T	5.37:g.140564292G>T	ENSP00000354293:p.Ala720Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A720S	ENST00000361016.2	37	c.2158	CCDS4251.1	5	.	.	.	.	.	.	.	.	.	.	g	12.29	1.892522	0.33442	.	.	ENSG00000196963	ENST00000361016	T	0.11169	2.8	3.91	-1.15	0.09709	.	0.798086	0.10245	N	0.697861	T	0.13970	0.0338	M	0.72353	2.195	0.09310	N	1	B	0.32829	0.386	B	0.35770	0.21	T	0.27262	-1.0079	10	0.44086	T	0.13	.	9.1019	0.36673	0.0:0.4389:0.41:0.1511	.	720	Q9NRJ7	PCDBG_HUMAN	S	720	ENSP00000354293:A720S	ENSP00000354293:A720S	A	+	1	0	PCDHB16	140544476	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	0.001000	0.13038	0.112000	0.17975	0.479000	0.44913	GCC	PCDHB16	-	NULL	ENSG00000196963		0.662	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	60	0.00	0	G	NM_020957		140564292	140564292	+1	no_errors	ENST00000361016	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	0.000	T
PIK3CG	5294	genome.wustl.edu	37	7	106523500	106523500	+	Silent	SNP	C	C	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr7:106523500C>T	ENST00000359195.3	+	8	2962	c.2652C>T	c.(2650-2652)gaC>gaT	p.D884D	PIK3CG_ENST00000440650.2_Silent_p.D884D|PIK3CG_ENST00000496166.1_Silent_p.D884D	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	884	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						TTGTGAAAGACGCCACGACAA	0.478																																						dbGAP											0													180.0	179.0	179.0					7																	106523500		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.2652C>T	7.37:g.106523500C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q6|Q8IV23|Q9BZC8	Silent	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.D884	ENST00000359195.3	37	c.2652	CCDS5739.1	7																																																																																			PIK3CG	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000105851		0.478	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIK3CG	HGNC	protein_coding	OTTHUMT00000349294.1	395	0.25	1	C			106523500	106523500	+1	no_errors	ENST00000359195	ensembl	human	known	69_37n	silent	110	48.84	105	SNP	0.571	T
PLK2	10769	genome.wustl.edu	37	5	57753376	57753378	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr5:57753376_57753378delCAG	ENST00000274289.3	-	6	1046_1048	c.746_748delCTG	c.(745-750)cctgaa>caa	p.249_250PE>Q	PLK2_ENST00000502671.1_5'UTR	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		TTGAGGACTTCAGGAGAGAGATA	0.394																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.746_748delCTG	5.37:g.57753376_57753378delCAG	ENSP00000274289:p.Pro249_Glu250delinsGln	Somatic		WXS	Illumina GAIIx	Phase_IV	O60679|Q96CV7|Q9UE61	In_Frame_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_cat_dom	p.PE249in_frame_delQ	ENST00000274289.3	37	c.748_746	CCDS3974.1	5																																																																																			PLK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000145632		0.394	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK2	HGNC	protein_coding	OTTHUMT00000214150.1	65	0.00	0	CAG	NM_006622		57753376	57753378	-1	no_errors	ENST00000274289	ensembl	human	known	69_37n	in_frame_del	20	12.00	3	DEL	1.000:0.947:1.000	-
PNMAL1	55228	genome.wustl.edu	37	19	46973388	46973388	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr19:46973388G>A	ENST00000313683.10	-	2	1210	c.905C>T	c.(904-906)gCt>gTt	p.A302V	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_Missense_Mutation_p.A302V	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	302										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CTTCTTCAAAGCCAACTCCTC	0.582																																						dbGAP											0													123.0	127.0	126.0					19																	46973388		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.905C>T	19.37:g.46973388G>A	ENSP00000318131:p.Ala302Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	NULL	p.A302V	ENST00000313683.10	37	c.905	CCDS33059.1	19	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160064	0.38119	.	.	ENSG00000182013	ENST00000438932;ENST00000313683	T;T	0.08282	3.11;3.11	3.75	1.58	0.23477	.	0.546754	0.15414	N	0.263595	T	0.04003	0.0112	N	0.14661	0.345	0.09310	N	1	B;B	0.22909	0.077;0.077	B;B	0.19391	0.025;0.025	T	0.43114	-0.9411	10	0.22706	T	0.39	-16.0937	4.0104	0.09619	0.1255:0.0:0.641:0.2335	.	302;302	Q86V59-2;Q86V59	.;PNML1_HUMAN	V	302	ENSP00000410273:A302V;ENSP00000318131:A302V	ENSP00000318131:A302V	A	-	2	0	PNMAL1	51665228	0.001000	0.12720	0.000000	0.03702	0.627000	0.37826	0.854000	0.27791	0.529000	0.28599	0.655000	0.94253	GCT	PNMAL1	-	NULL	ENSG00000182013		0.582	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNMAL1	HGNC	protein_coding	OTTHUMT00000403929.1	152	0.00	0	G	NM_018215		46973388	46973388	-1	no_errors	ENST00000313683	ensembl	human	known	69_37n	missense	69	40.17	47	SNP	0.000	A
QSER1	79832	genome.wustl.edu	37	11	32954676	32954676	+	Silent	SNP	T	T	C			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr11:32954676T>C	ENST00000399302.2	+	4	1820	c.1485T>C	c.(1483-1485)tcT>tcC	p.S495S	QSER1_ENST00000527788.1_Silent_p.S256S	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	495	Ser-rich.									breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					ATTATATTTCTATGCATTCTT	0.463																																						dbGAP											0													82.0	76.0	78.0					11																	32954676		1839	4083	5922	-	-	-	SO:0001819	synonymous_variant	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.1485T>C	11.37:g.32954676T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Silent	SNP	NULL	p.S495	ENST00000399302.2	37	c.1485	CCDS41631.1	11																																																																																			QSER1	-	NULL	ENSG00000060749		0.463	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	236	0.42	1	T	NM_024774		32954676	32954676	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	silent	111	42.19	81	SNP	0.648	C
RECQL5	9400	genome.wustl.edu	37	17	73654533	73654533	+	Missense_Mutation	SNP	C	C	T	rs201204572		TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr17:73654533C>T	ENST00000317905.5	-	7	1153	c.994G>A	c.(994-996)Gcc>Acc	p.A332T	RECQL5_ENST00000584999.1_Missense_Mutation_p.A332T|RECQL5_ENST00000423245.2_Missense_Mutation_p.A305T|RECQL5_ENST00000340830.5_Missense_Mutation_p.A332T|RECQL5_ENST00000420326.2_Missense_Mutation_p.A332T	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	332	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TTCCAATGGGCGACAAACCTG	0.547								Other identified genes with known or suspected DNA repair function																														dbGAP											0													103.0	104.0	103.0					17																	73654533		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.994G>A	17.37:g.73654533C>T	ENSP00000317636:p.Ala332Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	pfam_RecQ_helicase-like_5,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.A332T	ENST00000317905.5	37	c.994	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	C	9.525	1.109213	0.20714	.	.	ENSG00000108469	ENST00000423245;ENST00000317905;ENST00000420326;ENST00000340830	T;T;T	0.75367	-0.93;-0.93;-0.93	5.84	4.87	0.63330	Helicase, C-terminal (3);	0.218273	0.47852	D	0.000209	D	0.86020	0.5833	M	0.73962	2.25	0.45930	D	0.998766	P;D;P	0.89917	0.543;1.0;0.949	P;D;P	0.77004	0.448;0.989;0.642	D	0.85598	0.1250	10	0.44086	T	0.13	-6.4444	18.0801	0.89440	0.0:0.9363:0.0:0.0637	.	332;305;332	O94762;Q6P4G0;O94762-3	RECQ5_HUMAN;.;.	T	332	ENSP00000317636:A332T;ENSP00000414933:A332T;ENSP00000341983:A332T	ENSP00000317636:A332T	A	-	1	0	RECQL5	71166128	1.000000	0.71417	0.092000	0.20876	0.061000	0.15899	6.095000	0.71439	0.827000	0.34685	-0.797000	0.03246	GCC	RECQL5	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000108469		0.547	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	RECQL5	HGNC	protein_coding	OTTHUMT00000448207.1	98	0.00	0	C	NM_004259		73654533	73654533	-1	no_errors	ENST00000317905	ensembl	human	known	69_37n	missense	168	49.85	168	SNP	0.989	T
RIMBP2	23504	genome.wustl.edu	37	12	130935822	130935822	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr12:130935822G>T	ENST00000261655.4	-	5	534	c.371C>A	c.(370-372)cCt>cAt	p.P124H	RIMBP2_ENST00000536002.1_Missense_Mutation_p.P32H|RIMBP2_ENST00000535703.1_Missense_Mutation_p.P32H	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	124					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCTGTCACCAGGCTGCGGAAG	0.572																																						dbGAP											0													53.0	53.0	53.0					12																	130935822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.371C>A	12.37:g.130935822G>T	ENSP00000261655:p.Pro124His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.P124H	ENST00000261655.4	37	c.371	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318733	0.23994	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.18960	2.18;2.94;2.94	3.95	3.95	0.45737	.	1.010740	0.07925	N	0.976641	T	0.30541	0.0768	L	0.47716	1.5	0.09310	N	1	P;P	0.42993	0.797;0.641	P;B	0.47470	0.548;0.436	T	0.23868	-1.0176	10	0.40728	T	0.16	-0.9647	14.1942	0.65659	0.0:0.0:1.0:0.0	.	32;124	O15034-2;O15034	.;RIMB2_HUMAN	H	124;32;32;32	ENSP00000261655:P124H;ENSP00000440347:P32H;ENSP00000439159:P32H	ENSP00000261655:P124H	P	-	2	0	RIMBP2	129501775	0.570000	0.26651	0.005000	0.12908	0.004000	0.04260	4.469000	0.60169	1.756000	0.51951	0.561000	0.74099	CCT	RIMBP2	-	NULL	ENSG00000060709		0.572	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	45	0.00	0	G	NM_015347		130935822	130935822	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.022	T
SCEL	8796	genome.wustl.edu	37	13	78182240	78182240	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr13:78182240A>T	ENST00000349847.3	+	20	1291	c.1207A>T	c.(1207-1209)Agt>Tgt	p.S403C	SCEL-AS1_ENST00000456280.2_RNA|SCEL_ENST00000469982.1_3'UTR|SCEL_ENST00000377246.3_Missense_Mutation_p.S383C|SCEL_ENST00000535157.1_Missense_Mutation_p.S361C|SCEL-AS1_ENST00000457528.2_RNA	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	403	16 X approximate tandem repeats.				embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		AGTAAAGAGAAGTAACCAAGG	0.423																																						dbGAP											0													141.0	126.0	131.0					13																	78182240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.1207A>T	13.37:g.78182240A>T	ENSP00000302579:p.Ser403Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.S403C	ENST00000349847.3	37	c.1207	CCDS9459.1	13	.	.	.	.	.	.	.	.	.	.	A	12.45	1.942664	0.34283	.	.	ENSG00000136155	ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.26067	1.91;1.76;1.76	4.31	3.12	0.35913	.	0.340299	0.25654	N	0.029199	T	0.31263	0.0791	M	0.64997	1.995	0.09310	N	1	P;P;P	0.50272	0.771;0.933;0.896	P;P;P	0.49528	0.494;0.614;0.591	T	0.12993	-1.0526	10	0.66056	D	0.02	-3.4501	6.6181	0.22788	0.891:0.0:0.109:0.0	.	361;383;403	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	C	361;383;403	ENSP00000437895:S361C;ENSP00000366454:S383C;ENSP00000302579:S403C	ENSP00000302579:S403C	S	+	1	0	SCEL	77080241	0.007000	0.16637	0.022000	0.16811	0.490000	0.33462	1.165000	0.31822	0.813000	0.34350	0.459000	0.35465	AGT	SCEL	-	NULL	ENSG00000136155		0.423	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCEL	HGNC	protein_coding	OTTHUMT00000045339.2	113	0.88	1	A	NM_144777		78182240	78182240	+1	no_errors	ENST00000349847	ensembl	human	known	69_37n	missense	106	19.08	25	SNP	0.014	T
SLC13A2	9058	genome.wustl.edu	37	17	26818553	26818553	+	Missense_Mutation	SNP	G	G	A	rs199777182		TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr17:26818553G>A	ENST00000314669.5	+	5	1093	c.673G>A	c.(673-675)Gtg>Atg	p.V225M	SLC13A2_ENST00000537681.1_Missense_Mutation_p.V154M|SLC13A2_ENST00000444914.3_Missense_Mutation_p.V274M|SLC13A2_ENST00000545060.1_Missense_Mutation_p.V182M	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	225					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	GAGCCTGTGCGTGTGCTACTC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		22033	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													66.0	61.0	63.0					17																	26818553		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.673G>A	17.37:g.26818553G>A	ENSP00000316202:p.Val225Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.V274M	ENST00000314669.5	37	c.820	CCDS11231.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	19.15	3.770913	0.69992	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000541739;ENST00000537681	T;T;T;T	0.03496	3.91;3.91;3.91;3.91	5.62	2.4	0.29515	.	0.180143	0.48286	D	0.000182	T	0.17746	0.0426	M	0.90369	3.11	0.45025	D	0.998043	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0	D;D;D;D;D	0.77004	0.974;0.975;0.989;0.988;0.984	T	0.00236	-1.1891	10	0.87932	D	0	-6.9864	6.2512	0.20848	0.2607:0.1404:0.5989:0.0	.	182;274;181;154;225	F5GWV6;E7ETH5;B4E1M6;G3V1L2;Q13183	.;.;.;.;S13A2_HUMAN	M	225;274;182;181;154	ENSP00000316202:V225M;ENSP00000392411:V274M;ENSP00000441935:V182M;ENSP00000440802:V154M	ENSP00000316202:V225M	V	+	1	0	SLC13A2	23842680	0.998000	0.40836	0.598000	0.28837	0.782000	0.44232	2.757000	0.47557	0.671000	0.31185	0.557000	0.71058	GTG	SLC13A2	-	pfam_Na/sul_symport	ENSG00000007216		0.627	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A2	HGNC	protein_coding	OTTHUMT00000255722.1	71	0.00	0	G	NM_003984		26818553	26818553	+1	no_errors	ENST00000444914	ensembl	human	known	69_37n	missense	25	34.21	13	SNP	0.878	A
SPON1	10418	genome.wustl.edu	37	11	14279316	14279316	+	RNA	SNP	G	G	C			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr11:14279316G>C	ENST00000310358.7	+	0	1899							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		TCCGCCTGCAGCTCCTCCACC	0.577																																						dbGAP											0													29.0	34.0	32.0					11																	14279316		2073	4204	6277	-	-	-			0			AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14279316G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6W5|O94862|Q8NCD7|Q8WUR5	RNA	SNP	-	NULL	ENST00000310358.7	37	NULL		11	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727537	0.48833	.	.	ENSG00000152268	ENST00000310358	.	.	.	5.37	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.73281	0.3567	.	.	.	0.48511	D	0.999668	D	0.76494	0.999	D	0.81914	0.995	T	0.80130	-0.1511	7	0.51188	T	0.08	.	11.8183	0.52224	0.0854:0.0:0.9146:0.0	.	455	Q9HCB6	SPON1_HUMAN	T	454	.	ENSP00000309297:S454T	S	+	2	0	SPON1	14235892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	1.284000	0.44531	0.561000	0.74099	AGC	SPON1	-	-	ENSG00000152268		0.577	SPON1-201	KNOWN	basic	processed_transcript	SPON1	HGNC	processed_transcript		32	0.00	0	G	NM_145584		14279316	14279316	+1	no_errors	ENST00000310358	ensembl	human	known	69_37n	rna	16	33.33	8	SNP	1.000	C
TBC1D22B	55633	genome.wustl.edu	37	6	37254787	37254787	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr6:37254787A>G	ENST00000373491.3	+	7	952	c.806A>G	c.(805-807)cAc>cGc	p.H269R		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	269	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			TTTCAGATTCACATTGACATT	0.433																																						dbGAP											0													164.0	153.0	157.0					6																	37254787		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.806A>G	6.37:g.37254787A>G	ENSP00000362590:p.His269Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.H269R	ENST00000373491.3	37	c.806	CCDS4832.1	6	.	.	.	.	.	.	.	.	.	.	A	24.8	4.573250	0.86542	.	.	ENSG00000065491	ENST00000373491	T	0.09630	2.96	5.87	5.87	0.94306	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.07818	0.0196	L	0.58428	1.81	0.80722	D	1	P	0.36712	0.566	B	0.37451	0.25	T	0.09751	-1.0660	10	0.35671	T	0.21	.	15.5573	0.76208	1.0:0.0:0.0:0.0	.	269	Q9NU19	TB22B_HUMAN	R	269	ENSP00000362590:H269R	ENSP00000362590:H269R	H	+	2	0	TBC1D22B	37362765	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.800000	0.91900	2.371000	0.80710	0.533000	0.62120	CAC	TBC1D22B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000065491		0.433	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22B	HGNC	protein_coding	OTTHUMT00000040402.1	177	0.00	0	A	NM_017772		37254787	37254787	+1	no_errors	ENST00000373491	ensembl	human	known	69_37n	missense	99	26.12	35	SNP	1.000	G
TNFRSF11A	8792	genome.wustl.edu	37	18	60017101	60017101	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr18:60017101G>A	ENST00000586569.1	+	3	252	c.214G>A	c.(214-216)Ggc>Agc	p.G72S	TNFRSF11A_ENST00000269485.7_Missense_Mutation_p.G72S	NM_001270949.1|NM_003839.3	NP_001257878.1|NP_003830.1	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily, member 11a, NFKB activator	72					adaptive immune response (GO:0002250)|cell-cell signaling (GO:0007267)|circadian temperature homeostasis (GO:0060086)|lymph node development (GO:0048535)|mammary gland alveolus development (GO:0060749)|monocyte chemotaxis (GO:0002548)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|response to cytokine (GO:0034097)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to radiation (GO:0009314)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(13)|skin(3)|upper_aerodigestive_tract(1)	29		Colorectal(73;0.188)				TCTGCCCTGTGGCCCGGATGA	0.423																																						dbGAP											0													191.0	181.0	185.0					18																	60017101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF018253	CCDS11980.1, CCDS59324.1, CCDS74227.1, CCDS74228.1	18q22.1	2014-09-17			ENSG00000141655	ENSG00000141655		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11908	protein-coding gene	gene with protein product		603499	"""tumor necrosis factor receptor superfamily, member 11a, activator of NFKB"", ""Paget disease of bone 2"", ""loss of heterozygosity, 18, chromosomal region 1"""	PDB2, LOH18CR1		9367155, 10615125	Standard	NM_001270951		Approved	RANK, CD265, FEO	uc002lin.4	Q9Y6Q6	OTTHUMG00000132779	ENST00000586569.1:c.214G>A	18.37:g.60017101G>A	ENSP00000465500:p.Gly72Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	I4EC36|I4EC38|I4EC39|I7JE63|N0GVH0|Q59EP9	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_11A,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg	p.G72S	ENST00000586569.1	37	c.214	CCDS11980.1	18	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716883	0.68844	.	.	ENSG00000141655	ENST00000382790;ENST00000269485	T	0.69806	-0.43	5.33	4.44	0.53790	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.427174	0.26196	N	0.025762	T	0.74612	0.3739	L	0.59436	1.845	0.35154	D	0.770038	D;D	0.76494	0.999;0.998	D;D	0.65323	0.934;0.934	T	0.79208	-0.1898	9	.	.	.	-28.4584	10.8981	0.47034	0.089:0.0:0.911:0.0	.	94;72	Q59EP9;Q9Y6Q6	.;TNR11_HUMAN	S	94;72	ENSP00000269485:G72S	.	G	+	1	0	TNFRSF11A	58168081	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	3.236000	0.51336	2.646000	0.89796	0.462000	0.41574	GGC	TNFRSF11A	-	smart_TNFR/NGFR_Cys_rich_reg	ENSG00000141655		0.423	TNFRSF11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11A	HGNC	protein_coding	OTTHUMT00000256186.2	231	0.00	0	G			60017101	60017101	+1	no_errors	ENST00000586569	ensembl	human	known	69_37n	missense	179	27.53	68	SNP	1.000	A
TP53BP2	7159	genome.wustl.edu	37	1	223991057	223991057	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr1:223991057C>G	ENST00000343537.7	-	7	1038	c.747G>C	c.(745-747)gaG>gaC	p.E249D	TP53BP2_ENST00000391879.2_5'Flank|TP53BP2_ENST00000391878.2_Missense_Mutation_p.E120D|TP53BP2_ENST00000498843.1_5'Flank	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	243					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TCTTGAGCATCTCTAGCTGCC	0.488																																						dbGAP											0													133.0	121.0	125.0					1																	223991057		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.747G>C	1.37:g.223991057C>G	ENSP00000341957:p.Glu249Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E249D	ENST00000343537.7	37	c.747	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964845	0.74131	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.36340	1.26;1.26	6.06	6.06	0.98353	.	0.043261	0.85682	D	0.000000	T	0.51890	0.1701	L	0.46885	1.475	0.80722	D	1	D;P	0.69078	0.997;0.709	D;P	0.72625	0.978;0.541	T	0.41197	-0.9522	10	0.44086	T	0.13	.	13.778	0.63066	0.0:0.9304:0.0:0.0696	.	249;243	B4DG66;Q13625	.;ASPP2_HUMAN	D	120;249	ENSP00000375750:E120D;ENSP00000341957:E249D	ENSP00000341957:E249D	E	-	3	2	TP53BP2	222057680	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	1.326000	0.33735	2.871000	0.98454	0.655000	0.94253	GAG	TP53BP2	-	NULL	ENSG00000143514		0.488	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	102	0.00	0	C	NM_001031685, NM_005426		223991057	223991057	-1	no_errors	ENST00000343537	ensembl	human	known	69_37n	missense	120	31.82	56	SNP	1.000	G
TRAFD1	10906	genome.wustl.edu	37	12	112578753	112578753	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr12:112578753T>G	ENST00000257604.5	+	5	985	c.368T>G	c.(367-369)gTc>gGc	p.V123G	TRAFD1_ENST00000412615.2_Missense_Mutation_p.V123G	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	123					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						GGTCGCAATGTCCTTGTGAAA	0.453																																						dbGAP											0													141.0	123.0	129.0					12																	112578753		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.368T>G	12.37:g.112578753T>G	ENSP00000257604:p.Val123Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L6|B4DI89	Missense_Mutation	SNP	superfamily_TRAF-like	p.V123G	ENST00000257604.5	37	c.368	CCDS9160.1	12	.	.	.	.	.	.	.	.	.	.	T	17.95	3.513684	0.64522	.	.	ENSG00000135148	ENST00000412615;ENST00000549358;ENST00000257604;ENST00000552896	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.92	5.92	0.95590	.	0.303544	0.34580	N	0.003858	T	0.57695	0.2071	L	0.60845	1.875	0.80722	D	1	B;P	0.39404	0.339;0.672	B;B	0.38842	0.167;0.283	T	0.63238	-0.6682	10	0.87932	D	0	-8.889	16.0277	0.80555	0.0:0.0:0.0:1.0	.	123;123	F8VNX8;O14545	.;TRAD1_HUMAN	G	123	ENSP00000396526:V123G;ENSP00000449319:V123G;ENSP00000257604:V123G;ENSP00000450357:V123G	ENSP00000257604:V123G	V	+	2	0	TRAFD1	111063136	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.719000	0.74718	2.269000	0.75478	0.460000	0.39030	GTC	TRAFD1	-	NULL	ENSG00000135148		0.453	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAFD1	HGNC	protein_coding	OTTHUMT00000405214.1	98	0.00	0	T	NM_006700		112578753	112578753	+1	no_errors	ENST00000257604	ensembl	human	known	69_37n	missense	77	28.70	31	SNP	1.000	G
TRPC5	7224	genome.wustl.edu	37	X	111078326	111078326	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chrX:111078326C>A	ENST00000262839.2	-	7	2637	c.1719G>T	c.(1717-1719)caG>caT	p.Q573H		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	573					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AGAAGAGTGACTGAAGAGTCT	0.383																																						dbGAP											0													176.0	176.0	176.0					X																	111078326		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1719G>T	X.37:g.111078326C>A	ENSP00000262839:p.Gln573His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.Q573H	ENST00000262839.2	37	c.1719	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	17.05	3.291102	0.59976	.	.	ENSG00000072315	ENST00000262839	D	0.98455	-4.94	5.56	3.78	0.43462	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98611	0.9535	M	0.72894	2.215	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.80764	0.981;0.994	D	0.98102	1.0415	10	0.66056	D	0.02	-11.7286	14.2741	0.66167	0.0:0.8605:0.0:0.1395	.	574;573	Q59G51;Q9UL62	.;TRPC5_HUMAN	H	573	ENSP00000262839:Q573H	ENSP00000262839:Q573H	Q	-	3	2	TRPC5	110964982	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.308000	0.51896	0.171000	0.19730	-1.195000	0.01675	CAG	TRPC5	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000072315		0.383	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	491	0.20	1	C	NM_012471		111078326	111078326	-1	no_errors	ENST00000262839	ensembl	human	known	69_37n	missense	412	16.60	82	SNP	1.000	A
XIAP	331	genome.wustl.edu	37	X	123019797	123019797	+	Silent	SNP	C	C	A			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chrX:123019797C>A	ENST00000371199.3	+	2	584	c.285C>A	c.(283-285)ggC>ggA	p.G95G	XIAP_ENST00000468691.1_Intron|XIAP_ENST00000355640.3_Silent_p.G95G|XIAP_ENST00000434753.3_Silent_p.G95G	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	95					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						TTATCAACGGCTTTTATCTTG	0.413									X-linked Lymphoproliferative syndrome																													dbGAP											0													70.0	67.0	68.0					X																	123019797		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.285C>A	X.37:g.123019797C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTF2|Q9NQ14	Silent	SNP	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.G95	ENST00000371199.3	37	c.285	CCDS14606.1	X																																																																																			XIAP	-	smart_BIR	ENSG00000101966		0.413	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XIAP	HGNC	protein_coding	OTTHUMT00000058165.5	142	0.00	0	C	NM_001167		123019797	123019797	+1	no_errors	ENST00000355640	ensembl	human	known	69_37n	silent	103	31.33	47	SNP	0.834	A
ZDBF2	57683	genome.wustl.edu	37	2	207171377	207171377	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07I-01A-11W-A019-09	TCGA-A8-A07I-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7718c3f0-1c90-4940-bc30-ea4f417851bb	cca486f4-dbe7-4629-b5bc-bce1d97f9bfc	g.chr2:207171377G>T	ENST00000374423.3	+	5	2511	c.2125G>T	c.(2125-2127)Gat>Tat	p.D709Y		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	709							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TCTGAGTTCTGATTCTCCGGC	0.408																																						dbGAP											0													72.0	72.0	72.0					2																	207171377		1858	4104	5962	-	-	-	SO:0001583	missense	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2125G>T	2.37:g.207171377G>T	ENSP00000363545:p.Asp709Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.D709Y	ENST00000374423.3	37	c.2125	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480005	0.26598	.	.	ENSG00000204186	ENST00000374423	T	0.55930	0.49	4.4	2.57	0.30868	.	0.989839	0.08198	N	0.982707	T	0.65698	0.2716	M	0.67397	2.05	0.28979	N	0.888766	D	0.65815	0.995	P	0.62885	0.908	T	0.53493	-0.8431	10	0.87932	D	0	.	6.0672	0.19870	0.1017:0.1913:0.7069:0.0	.	709	Q9HCK1	ZDBF2_HUMAN	Y	709	ENSP00000363545:D709Y	ENSP00000363545:D709Y	D	+	1	0	ZDBF2	206879622	1.000000	0.71417	0.910000	0.35882	0.016000	0.09150	2.393000	0.44442	0.772000	0.33382	0.655000	0.94253	GAT	ZDBF2	-	NULL	ENSG00000204186		0.408	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	171	0.00	0	G	NM_020923		207171377	207171377	+1	no_errors	ENST00000374423	ensembl	human	known	69_37n	missense	90	36.62	52	SNP	0.962	T
