#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABHD16A	7920	genome.wustl.edu	37	6	31655488	31655488	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr6:31655488C>T	ENST00000395952.3	-	18	1639	c.1477G>A	c.(1477-1479)Gag>Aag	p.E493K	ABHD16A_ENST00000375842.4_Missense_Mutation_p.E274K|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000471644.1_5'UTR|ABHD16A_ENST00000440843.2_Missense_Mutation_p.E460K	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	493						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CACCAGTCCTCTTCCACCTCC	0.627																																						dbGAP											0													42.0	45.0	44.0					6																	31655488		1507	2707	4214	-	-	-	SO:0001583	missense	0			AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.1477G>A	6.37:g.31655488C>T	ENSP00000379282:p.Glu493Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Missense_Mutation	SNP	pfam_AB_hydrolase_1	p.E493K	ENST00000395952.3	37	c.1477	CCDS4713.1	6	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079127	0.76528	.	.	ENSG00000204427	ENST00000395952;ENST00000375842;ENST00000440843	.	.	.	5.66	5.66	0.87406	.	0.053040	0.64402	D	0.000001	T	0.34571	0.0902	L	0.31476	0.935	0.80722	D	1	B;B	0.27498	0.168;0.18	B;B	0.20577	0.03;0.027	T	0.27502	-1.0072	9	0.54805	T	0.06	-22.1942	17.2349	0.86996	0.0:1.0:0.0:0.0	.	460;493	B7Z4R6;O95870	.;ABHGA_HUMAN	K	493;274;460	.	ENSP00000365002:E274K	E	-	1	0	ABHD16A	31763467	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	6.513000	0.73742	2.682000	0.91365	0.555000	0.69702	GAG	ABHD16A	-	NULL	ENSG00000204427		0.627	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD16A	HGNC	protein_coding	OTTHUMT00000076342.4	147	0.00	0	C			31655488	31655488	-1	no_errors	ENST00000395952	ensembl	human	known	69_37n	missense	104	21.21	28	SNP	1.000	T
ACAD11	84129	genome.wustl.edu	37	3	132378462	132378462	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr3:132378462G>T	ENST00000264990.6	-	1	1105	c.134C>A	c.(133-135)aCc>aAc	p.T45N	UBA5_ENST00000493720.2_5'Flank|UBA5_ENST00000356232.4_5'UTR|ACAD11_ENST00000545291.1_5'UTR|ACAD11_ENST00000481970.2_Missense_Mutation_p.T45N|UBA5_ENST00000494238.2_5'Flank|ACAD11_ENST00000489991.1_5'UTR|UBA5_ENST00000264991.4_Intron|ACAD11_ENST00000355458.3_Missense_Mutation_p.T45N|UBA5_ENST00000473651.1_5'Flank	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	45					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						CTGGGCAATGGTCAGCGTAGC	0.532											OREG0015804	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													82.0	80.0	81.0					3																	132378462		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.134C>A	3.37:g.132378462G>T	ENSP00000264990:p.Thr45Asn	Somatic	1594	WXS	Illumina GAIIx	Phase_IV	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_DH_N,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C,superfamily_Kinase-like_dom	p.T45N	ENST00000264990.6	37	c.134	CCDS3074.1	3	.	.	.	.	.	.	.	.	.	.	g	5.076	0.199708	0.09652	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	T;T;T	0.29397	1.57;1.57;1.57	5.86	1.83	0.25207	Protein kinase-like domain (1);	.	.	.	.	T	0.41213	0.1149	M	0.86651	2.83	0.09310	N	0.999995	B;B	0.32653	0.122;0.379	B;B	0.37650	0.099;0.255	T	0.31724	-0.9933	9	0.27785	T	0.31	.	10.9376	0.47253	0.0:0.1183:0.3936:0.4881	.	45;45	D6RDI8;Q709F0	.;ACD11_HUMAN	N	45	ENSP00000347636:T45N;ENSP00000264990:T45N;ENSP00000420907:T45N	ENSP00000264990:T45N	T	-	2	0	ACAD11	133861152	0.172000	0.23043	0.001000	0.08648	0.007000	0.05969	0.823000	0.27366	0.352000	0.24053	-0.121000	0.15023	ACC	ACAD11	-	superfamily_Kinase-like_dom	ENSG00000240303		0.532	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD11	HGNC	protein_coding	OTTHUMT00000357279.2	38	0.00	0	G	NM_032169		132378462	132378462	-1	no_errors	ENST00000264990	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.001	T
ANKRD13C	81573	genome.wustl.edu	37	1	70758132	70758132	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr1:70758132C>T	ENST00000370944.4	-	9	1467	c.1154G>A	c.(1153-1155)cGa>cAa	p.R385Q	ANKRD13C_ENST00000262346.6_Missense_Mutation_p.R350Q	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	385					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						GGCCTTATTTCGAAGAATATC	0.333																																						dbGAP											0													80.0	78.0	78.0					1																	70758132		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.1154G>A	1.37:g.70758132C>T	ENSP00000359982:p.Arg385Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R385Q	ENST00000370944.4	37	c.1154	CCDS648.2	1	.	.	.	.	.	.	.	.	.	.	C	36	5.599190	0.96614	.	.	ENSG00000118454	ENST00000370944;ENST00000262346	T;T	0.39787	1.06;1.06	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	L	0.39326	1.205	0.80722	D	1	P;P	0.42961	0.756;0.795	B;B	0.41174	0.343;0.349	T	0.18681	-1.0329	10	0.72032	D	0.01	.	19.915	0.97057	0.0:1.0:0.0:0.0	.	350;385	Q8N6S4-2;Q8N6S4	.;AN13C_HUMAN	Q	385;350	ENSP00000359982:R385Q;ENSP00000262346:R350Q	ENSP00000262346:R350Q	R	-	2	0	ANKRD13C	70530720	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.734000	0.84928	2.707000	0.92482	0.557000	0.71058	CGA	ANKRD13C	-	pfam_ANKRD13	ENSG00000118454		0.333	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13C	HGNC	protein_coding	OTTHUMT00000025903.1	143	0.00	0	C	NM_030816		70758132	70758132	-1	no_errors	ENST00000370944	ensembl	human	known	69_37n	missense	176	20.72	46	SNP	1.000	T
AQP10	89872	genome.wustl.edu	37	1	154293636	154293636	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr1:154293636T>C	ENST00000324978.3	+	1	45	c.5T>C	c.(4-6)gTc>gCc	p.V2A	AQP10_ENST00000355197.4_3'UTR|AQP10_ENST00000484864.1_Missense_Mutation_p.V2A	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	2					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCACCATGGTCTTCACTCAG	0.562																																						dbGAP											0													59.0	55.0	57.0					1																	154293636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.5T>C	1.37:g.154293636T>C	ENSP00000318355:p.Val2Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYD3|Q5VYD4|Q8NG70	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_3,tigrfam_Aquaporin	p.V2A	ENST00000324978.3	37	c.5	CCDS1065.1	1	.	.	.	.	.	.	.	.	.	.	T	2.618	-0.289129	0.05605	.	.	ENSG00000143595	ENST00000324978;ENST00000484864	D;D	0.84800	-1.74;-1.9	4.88	-2.06	0.07298	.	1.433560	0.04482	N	0.377973	T	0.47303	0.1438	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.48139	-0.9061	10	0.02654	T	1	-5.7257	7.1612	0.25664	0.0:0.4052:0.1143:0.4806	.	2;2	Q96PS8-2;Q96PS8	.;AQP10_HUMAN	A	2	ENSP00000318355:V2A;ENSP00000420341:V2A	ENSP00000318355:V2A	V	+	2	0	AQP10	152560260	0.035000	0.19736	0.003000	0.11579	0.051000	0.14879	0.091000	0.15046	-0.270000	0.09285	-0.394000	0.06481	GTC	AQP10	-	NULL	ENSG00000143595		0.562	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP10	HGNC	protein_coding	OTTHUMT00000087661.1	36	0.00	0	T	NM_080429		154293636	154293636	+1	no_errors	ENST00000324978	ensembl	human	known	69_37n	missense	51	56.41	66	SNP	0.000	C
ATM	472	genome.wustl.edu	37	11	108129723	108129723	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr11:108129723A>C	ENST00000452508.2	+	17	2576	c.2387A>C	c.(2386-2388)aAt>aCt	p.N796T	ATM_ENST00000278616.4_Missense_Mutation_p.N796T			Q13315	ATM_HUMAN	ATM serine/threonine kinase	796					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAGAGTCCAAATAAGATTGCA	0.328			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													120.0	114.0	116.0					11																	108129723		2200	4298	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2387A>C	11.37:g.108129723A>C	ENSP00000388058:p.Asn796Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.N796T	ENST00000452508.2	37	c.2387	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	A	5.126	0.208813	0.09757	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.74315	-0.83;-0.83;-0.83	5.8	0.808	0.18719	Armadillo-type fold (1);	0.670270	0.16326	N	0.219332	T	0.56485	0.1988	L	0.53249	1.67	0.09310	N	1	P	0.36483	0.555	B	0.27262	0.078	T	0.42292	-0.9460	10	0.13853	T	0.58	.	3.98	0.09490	0.5717:0.0:0.1939:0.2344	.	796	Q13315	ATM_HUMAN	T	796	ENSP00000435747:N796T;ENSP00000278616:N796T;ENSP00000388058:N796T	ENSP00000278616:N796T	N	+	2	0	ATM	107634933	0.906000	0.30813	0.095000	0.20976	0.173000	0.22820	0.612000	0.24283	-0.109000	0.12044	-0.274000	0.10170	AAT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.328	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	49	0.00	0	A	NM_000051		108129723	108129723	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	0.351	C
ATXN1	6310	genome.wustl.edu	37	6	16328465	16328465	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr6:16328465G>C	ENST00000244769.4	-	8	1013	c.77C>G	c.(76-78)tCc>tGc	p.S26C	ATXN1_ENST00000436367.1_Missense_Mutation_p.S26C	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	26					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CTTCTCCTCGGAGGACCGGCT	0.687																																						dbGAP											0													39.0	43.0	42.0					6																	16328465		2203	4298	6501	-	-	-	SO:0001583	missense	0			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.77C>G	6.37:g.16328465G>C	ENSP00000244769:p.Ser26Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_Capicua_tscrpt_rep_mod,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.S26C	ENST00000244769.4	37	c.77	CCDS34342.1	6	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477616	0.63849	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.53857	0.6;0.6	5.01	4.14	0.48551	.	0.059199	0.64402	D	0.000001	T	0.60805	0.2297	M	0.62723	1.935	0.51482	D	0.999924	D	0.89917	1.0	D	0.68192	0.956	T	0.66594	-0.5884	10	0.59425	D	0.04	-25.5235	15.6753	0.77311	0.0:0.1372:0.8628:0.0	.	26	P54253	ATX1_HUMAN	C	26	ENSP00000244769:S26C;ENSP00000416360:S26C	ENSP00000244769:S26C	S	-	2	0	ATXN1	16436444	1.000000	0.71417	0.472000	0.27241	0.765000	0.43378	7.297000	0.78799	1.331000	0.45412	-0.467000	0.05162	TCC	ATXN1	-	NULL	ENSG00000124788		0.687	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	HGNC	protein_coding	OTTHUMT00000039943.3	26	0.00	0	G	NM_000332		16328465	16328465	-1	no_errors	ENST00000244769	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	0.892	C
ATXN2L	11273	genome.wustl.edu	37	16	28842080	28842080	+	Silent	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr16:28842080C>T	ENST00000336783.4	+	9	1346	c.1179C>T	c.(1177-1179)ggC>ggT	p.G393G	ATXN2L_ENST00000395547.2_Silent_p.G393G|ATXN2L_ENST00000570200.1_Silent_p.G393G|ATXN2L_ENST00000340394.8_Silent_p.G393G|ATXN2L_ENST00000325215.6_Silent_p.G393G|ATXN2L_ENST00000382686.4_Silent_p.G393G|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000564304.1_Silent_p.G393G	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	393					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GCAGCCCTGGCCCAGGTTCTG	0.617																																						dbGAP											0													43.0	44.0	44.0					16																	28842080		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1179C>T	16.37:g.28842080C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	NULL	p.A207V	ENST00000336783.4	37	c.620	CCDS10641.1	16																																																																																			ATXN2L	-	NULL	ENSG00000168488		0.617	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATXN2L	HGNC	protein_coding	OTTHUMT00000214139.1	37	0.00	0	C	NM_007245		28842080	28842080	+1	no_start_codon	ENST00000565971	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	1.000	T
C1orf85	112770	genome.wustl.edu	37	1	156263157	156263157	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr1:156263157C>T	ENST00000362007.1	-	5	1035	c.1009G>A	c.(1009-1011)Ggg>Agg	p.G337R	C1orf85_ENST00000482579.1_Intron	NM_001256604.1|NM_001256609.1|NM_144580.2	NP_001243533.1|NP_001243538.1|NP_653181.1	Q8WWB7	NCUG1_HUMAN	chromosome 1 open reading frame 85	337					intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(2)|skin(3)	14	Hepatocellular(266;0.158)					GTGGAAGCCCCGAACGTCAGA	0.562																																						dbGAP											0													66.0	71.0	69.0					1																	156263157		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011575	CCDS1139.1, CCDS72947.1, CCDS72948.1, CCDS72949.1	1q22	2014-08-07			ENSG00000198715	ENSG00000198715			29436	protein-coding gene	gene with protein product	"""kidney lysosomal membrane protein"""					12975309, 18021396, 19489740	Standard	NM_144580		Approved	MGC31963, NCU-G1	uc001foh.4	Q8WWB7	OTTHUMG00000019789	ENST00000362007.1:c.1009G>A	1.37:g.156263157C>T	ENSP00000354553:p.Gly337Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH16|B4DJN4|Q5SZX4|Q6UX96|Q8IV07|Q96F65	Missense_Mutation	SNP	NULL	p.G337R	ENST00000362007.1	37	c.1009	CCDS1139.1	1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554927	0.65425	.	.	ENSG00000198715	ENST00000362007	T	0.52295	0.67	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.62478	0.2431	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65619	-0.6124	10	0.87932	D	0	-11.6364	14.2923	0.66286	0.0:1.0:0.0:0.0	.	256;337	Q8WWB7-2;Q8WWB7	.;NCUG1_HUMAN	R	337	ENSP00000354553:G337R	ENSP00000354553:G337R	G	-	1	0	C1orf85	154529781	1.000000	0.71417	0.998000	0.56505	0.225000	0.24961	4.785000	0.62418	2.757000	0.94681	0.462000	0.41574	GGG	C1orf85	-	NULL	ENSG00000198715		0.562	C1orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf85	HGNC	protein_coding	OTTHUMT00000052108.1	51	0.00	0	C	NM_144580		156263157	156263157	-1	no_errors	ENST00000362007	ensembl	human	known	69_37n	missense	59	16.67	12	SNP	0.999	T
C3orf62	375341	genome.wustl.edu	37	3	49311552	49311552	+	Silent	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr3:49311552C>T	ENST00000343010.3	-	2	1504	c.468G>A	c.(466-468)ttG>ttA	p.L156L	MIR4271_ENST00000582451.1_RNA	NM_198562.2	NP_940964.1	Q6ZUJ4	CC062_HUMAN	chromosome 3 open reading frame 62	156										breast(1)|kidney(1)|large_intestine(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGTCAGCCTTCAAATCTCTCT	0.458																																						dbGAP											0													152.0	131.0	138.0					3																	49311552		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK125642	CCDS2792.1	3p21.31	2006-02-11			ENSG00000188315	ENSG00000188315			24771	protein-coding gene	gene with protein product						12477932	Standard	NM_198562		Approved	FLJ43654	uc003cwn.2	Q6ZUJ4	OTTHUMG00000156819	ENST00000343010.3:c.468G>A	3.37:g.49311552C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P7E9|Q7Z3X6	Missense_Mutation	SNP	NULL	p.E97K	ENST00000343010.3	37	c.289	CCDS2792.1	3																																																																																			C3orf62	-	NULL	ENSG00000188315		0.458	C3orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf62	HGNC	protein_coding	OTTHUMT00000345990.1	56	0.00	0	C	NM_198562		49311552	49311552	-1	no_start_codon	ENST00000424960	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	T
CASC5	57082	genome.wustl.edu	37	15	40921499	40921499	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr15:40921499G>C	ENST00000346991.5	+	14	6080	c.5690G>C	c.(5689-5691)aGg>aCg	p.R1897T	CASC5_ENST00000399668.2_Missense_Mutation_p.R1871T			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1897	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ATAACAATAAGGGAGTTCTTT	0.378																																						dbGAP											0													80.0	76.0	77.0					15																	40921499		1818	4076	5894	-	-	-	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.5690G>C	15.37:g.40921499G>C	ENSP00000335463:p.Arg1897Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.R1897T	ENST00000346991.5	37	c.5690	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208844	0.58343	.	.	ENSG00000137812	ENST00000346991;ENST00000399668	T;T	0.05258	3.47;3.47	5.56	2.02	0.26589	.	0.553890	0.18883	N	0.128539	T	0.08447	0.0210	L	0.36672	1.1	0.09310	N	0.999998	D;D	0.53462	0.96;0.96	P;P	0.51229	0.663;0.663	T	0.18555	-1.0333	10	0.48119	T	0.1	.	7.3733	0.26815	0.4701:0.0:0.5299:0.0	.	1871;1897	Q8NG31-2;Q8NG31	.;CASC5_HUMAN	T	1897;1871	ENSP00000335463:R1897T;ENSP00000382576:R1871T	ENSP00000335463:R1897T	R	+	2	0	CASC5	38708791	0.761000	0.28439	0.962000	0.40283	0.996000	0.88848	0.824000	0.27379	0.240000	0.21263	0.644000	0.83932	AGG	CASC5	-	NULL	ENSG00000137812		0.378	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	107	0.00	0	G	NM_144508		40921499	40921499	+1	no_errors	ENST00000346991	ensembl	human	known	69_37n	missense	85	29.17	35	SNP	0.524	C
CASR	846	genome.wustl.edu	37	3	121980842	121980842	+	Silent	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr3:121980842C>T	ENST00000490131.1	+	4	1332	c.960C>T	c.(958-960)ttC>ttT	p.F320F	CASR_ENST00000296154.5_Silent_p.F320F|CASR_ENST00000498619.1_Silent_p.F320F	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	320					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCATTGGATTCGCTCTGAAGG	0.577																																						dbGAP											0													56.0	50.0	52.0					3																	121980842		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.960C>T	3.37:g.121980842C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.F320	ENST00000490131.1	37	c.960	CCDS3010.1	3																																																																																			CASR	-	pfam_ANF_lig-bd_rcpt	ENSG00000036828		0.577	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	189	0.00	0	C	NM_000388		121980842	121980842	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	silent	105	22.79	31	SNP	0.980	T
CHD4	1108	genome.wustl.edu	37	12	6702335	6702335	+	Silent	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr12:6702335G>A	ENST00000357008.2	-	17	2737	c.2574C>T	c.(2572-2574)gaC>gaT	p.D858D	CHD4_ENST00000544040.1_Silent_p.D851D|CHD4_ENST00000544484.1_Silent_p.D855D|CHD4_ENST00000309577.6_Silent_p.D858D	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	858	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						AAATAGCCATGTCAATGGTGA	0.483																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													122.0	102.0	109.0					12																	6702335		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2574C>T	12.37:g.6702335G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Silent	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D858	ENST00000357008.2	37	c.2574	CCDS8552.1	12																																																																																			CHD4	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111642		0.483	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		246	0.00	0	G	NM_001273		6702335	6702335	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	silent	210	27.24	79	SNP	1.000	A
CYP11B2	1585	genome.wustl.edu	37	8	143994076	143994076	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr8:143994076T>A	ENST00000323110.2	-	8	1270	c.1268A>T	c.(1267-1269)tAt>tTt	p.Y423F		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	423					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CTGGGGATTATACCGCTCAGG	0.627									Familial Hyperaldosteronism type I																													dbGAP											0													85.0	91.0	89.0					8																	143994076		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1268A>T	8.37:g.143994076T>A	ENSP00000325822:p.Tyr423Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B0ZBE4|Q16726	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.Y423F	ENST00000323110.2	37	c.1268	CCDS6393.1	8	.	.	.	.	.	.	.	.	.	.	.	13.45	2.240687	0.39598	.	.	ENSG00000179142	ENST00000323110	T	0.32988	1.43	3.52	3.52	0.40303	.	0.152839	0.30742	N	0.008973	T	0.14184	0.0343	N	0.11673	0.155	0.24640	N	0.993573	P	0.39782	0.688	B	0.40444	0.329	T	0.19910	-1.0291	10	0.02654	T	1	.	10.3128	0.43718	0.0:0.0:0.0:1.0	.	423	P19099	C11B2_HUMAN	F	423	ENSP00000325822:Y423F	ENSP00000325822:Y423F	Y	-	2	0	CYP11B2	143991078	0.915000	0.31059	0.100000	0.21137	0.001000	0.01503	1.452000	0.35156	1.578000	0.49821	0.460000	0.39030	TAT	CYP11B2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	ENSG00000179142		0.627	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	HGNC	protein_coding	OTTHUMT00000359904.1	49	0.00	0	T			143994076	143994076	-1	no_errors	ENST00000323110	ensembl	human	known	69_37n	missense	97	11.82	13	SNP	0.852	A
DLGAP4	22839	genome.wustl.edu	37	20	35060254	35060254	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr20:35060254G>A	ENST00000373907.2	+	2	333	c.134G>A	c.(133-135)cGc>cAc	p.R45H	DLGAP4_ENST00000401952.2_Missense_Mutation_p.R45H|DLGAP4_ENST00000339266.5_Missense_Mutation_p.R45H|DLGAP4_ENST00000373913.3_Missense_Mutation_p.R45H			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	45					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CGCGAGGCCCGCTTCCCCGGG	0.677																																						dbGAP											0													39.0	43.0	41.0					20																	35060254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.134G>A	20.37:g.35060254G>A	ENSP00000363014:p.Arg45His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	pfam_GKAP	p.R45H	ENST00000373907.2	37	c.134		20	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343726	0.41498	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.67	5.67	0.87782	.	0.313255	0.36034	N	0.002837	T	0.41789	0.1174	N	0.17674	0.51	0.41190	D	0.986293	D	0.64830	0.994	P	0.48454	0.578	T	0.14783	-1.0460	10	0.18710	T	0.47	.	18.7705	0.91890	0.0:0.0:1.0:0.0	.	45	Q9Y2H0-1	.	H	45	ENSP00000363023:R45H;ENSP00000384954:R45H;ENSP00000363014:R45H;ENSP00000341633:R45H	ENSP00000341633:R45H	R	+	2	0	DLGAP4	34493668	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	5.374000	0.66167	2.677000	0.91161	0.561000	0.74099	CGC	DLGAP4	-	NULL	ENSG00000080845		0.677	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	36	0.00	0	G	NM_014902		35060254	35060254	+1	no_errors	ENST00000339266	ensembl	human	known	69_37n	missense	29	31.82	14	SNP	1.000	A
DNAH11	8701	genome.wustl.edu	37	7	21805205	21805205	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr7:21805205G>A	ENST00000409508.3	+	55	9131	c.9100G>A	c.(9100-9102)Gag>Aag	p.E3034K	DNAH11_ENST00000328843.6_Missense_Mutation_p.E3041K	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3041	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CAAGGGAATTGAGGTATGCCG	0.517									Kartagener syndrome																													dbGAP											0													61.0	60.0	61.0					7																	21805205		2079	4218	6297	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.9100G>A	7.37:g.21805205G>A	ENSP00000475939:p.Glu3034Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E3041K	ENST00000409508.3	37	c.9121		7	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774937	0.90108	.	.	ENSG00000105877	ENST00000328843	T	0.41758	0.99	5.63	5.63	0.86233	Dynein heavy chain, P-loop containing D4 domain (1);	0.049500	0.85682	D	0.000000	T	0.53722	0.1814	.	.	.	0.58432	D	0.999998	D	0.64830	0.994	D	0.68483	0.958	T	0.40739	-0.9547	9	0.13470	T	0.59	.	13.6035	0.62033	0.0749:0.0:0.9251:0.0	.	3041	Q96DT5	DYH11_HUMAN	K	3041	ENSP00000330671:E3041K	ENSP00000330671:E3041K	E	+	1	0	DNAH11	21771730	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.574000	0.60900	2.651000	0.90000	0.455000	0.32223	GAG	DNAH11	-	NULL	ENSG00000105877		0.517	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	48	0.00	0	G	NM_003777		21805205	21805205	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	31	43.64	24	SNP	1.000	A
FGFR4	2264	genome.wustl.edu	37	5	176522628	176522628	+	Silent	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr5:176522628C>T	ENST00000292408.4	+	13	1970	c.1725C>T	c.(1723-1725)gaC>gaT	p.D575D	FGFR4_ENST00000393637.1_Silent_p.D535D|FGFR4_ENST00000292410.3_Silent_p.D535D|FGFR4_ENST00000393648.2_Silent_p.D507D|FGFR4_ENST00000502906.1_Silent_p.D575D	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	575	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TCAGCCCCGACGGTCCTCGGA	0.701										TSP Lung(9;0.080)																												dbGAP											0													21.0	25.0	24.0					5																	176522628		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1725C>T	5.37:g.176522628C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R207W	ENST00000292408.4	37	c.619	CCDS4410.1	5	.	.	.	.	.	.	.	.	.	.	C	0.390	-0.923923	0.02377	.	.	ENSG00000160867	ENST00000511076	.	.	.	5.29	-10.6	0.00265	.	.	.	.	.	T	0.47948	0.1473	.	.	.	0.53688	D	0.99997	.	.	.	.	.	.	T	0.60677	-0.7216	4	.	.	.	.	10.5734	0.45212	0.2415:0.0802:0.0:0.6784	.	.	.	.	W	207	.	.	R	+	1	2	FGFR4	176455234	0.000000	0.05858	0.013000	0.15412	0.013000	0.08279	-2.138000	0.01303	-2.154000	0.00792	-0.367000	0.07326	CGG	FGFR4	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000160867		0.701	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	28	0.00	0	C			176522628	176522628	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000511076	ensembl	human	novel	69_37n	missense	18	21.74	5	SNP	0.011	T
HSPBAP1	79663	genome.wustl.edu	37	3	122459670	122459670	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr3:122459670G>A	ENST00000306103.2	-	8	1132	c.989C>T	c.(988-990)tCt>tTt	p.S330F	HSPBAP1_ENST00000383659.1_3'UTR	NM_024610.5	NP_078886.2	Q96EW2	HBAP1_HUMAN	HSPB (heat shock 27kDa) associated protein 1	330						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(114;0.0531)		AAAAAATGCAGAAACAGCTGC	0.388																																						dbGAP											0													109.0	105.0	106.0					3																	122459670		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF400663	CCDS3017.1	3q21.1	2008-07-18	2002-08-29		ENSG00000169087	ENSG00000169087			16389	protein-coding gene	gene with protein product		608263	"""HSPB (heat shock 27kD) associated protein 1"""			11978969	Standard	NM_024610		Approved	FLJ22623, PASS1	uc003efu.2	Q96EW2	OTTHUMG00000159550	ENST00000306103.2:c.989C>T	3.37:g.122459670G>A	ENSP00000302562:p.Ser330Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P476|Q8N8J4|Q8NHH6|Q8WWF0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom,prints_HSPB1-associated_protein_1	p.S330F	ENST00000306103.2	37	c.989	CCDS3017.1	3	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446307	0.43429	.	.	ENSG00000169087	ENST00000306103	T	0.33865	1.39	5.38	1.46	0.22682	Cupin, JmjC-type (1);	0.843323	0.11116	N	0.597995	T	0.32376	0.0827	M	0.62723	1.935	0.53688	D	0.999973	P	0.41265	0.744	B	0.37047	0.24	T	0.11842	-1.0571	10	0.62326	D	0.03	.	6.6129	0.22761	0.1546:0.2864:0.5589:0.0	.	330	Q96EW2	HBAP1_HUMAN	F	330	ENSP00000302562:S330F	ENSP00000302562:S330F	S	-	2	0	HSPBAP1	123942360	1.000000	0.71417	0.133000	0.22050	0.959000	0.62525	0.884000	0.28214	0.085000	0.17107	0.655000	0.94253	TCT	HSPBAP1	-	pfam_JmjC_dom,prints_HSPB1-associated_protein_1	ENSG00000169087		0.388	HSPBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPBAP1	HGNC	protein_coding	OTTHUMT00000356161.1	255	0.00	0	G	NM_024610		122459670	122459670	-1	no_errors	ENST00000306103	ensembl	human	known	69_37n	missense	195	25.48	67	SNP	0.807	A
LAMA1	284217	genome.wustl.edu	37	18	7015822	7015822	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr18:7015822G>A	ENST00000389658.3	-	22	3118	c.3025C>T	c.(3025-3027)Cca>Tca	p.P1009S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1009	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCAGTTTCTGGGTCGCAGGTA	0.532																																						dbGAP											0													119.0	111.0	114.0					18																	7015822		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3025C>T	18.37:g.7015822G>A	ENSP00000374309:p.Pro1009Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.P1009S	ENST00000389658.3	37	c.3025	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	11.89	1.773290	0.31411	.	.	ENSG00000101680	ENST00000389658	T	0.60424	0.19	5.09	4.2	0.49525	EGF-like, laminin (3);	0.071223	0.56097	D	0.000035	T	0.62938	0.2469	M	0.71871	2.18	0.31255	N	0.693604	P	0.50943	0.94	P	0.51487	0.671	T	0.66348	-0.5946	10	0.34782	T	0.22	.	10.4133	0.44307	0.0825:0.1771:0.7405:0.0	.	1009	P25391	LAMA1_HUMAN	S	1009	ENSP00000374309:P1009S	ENSP00000374309:P1009S	P	-	1	0	LAMA1	7005822	1.000000	0.71417	0.887000	0.34795	0.025000	0.11179	2.592000	0.46171	2.521000	0.84997	0.643000	0.83706	CCA	LAMA1	-	pfam_EGF_laminin,smart_EGF-like,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000101680		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	97	0.00	0	G	NM_005559		7015822	7015822	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	106	18.32	24	SNP	0.751	A
LRP6	4040	genome.wustl.edu	37	12	12311946	12311946	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr12:12311946G>T	ENST00000261349.4	-	12	2684	c.2608C>A	c.(2608-2610)Cag>Aag	p.Q870K	LRP6_ENST00000543091.1_Missense_Mutation_p.Q870K	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	870	Beta-propeller 3.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				AAATGGCCCTGAATGATGGTG	0.507																																						dbGAP											0													240.0	165.0	191.0					12																	12311946		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.2608C>A	12.37:g.12311946G>T	ENSP00000261349:p.Gln870Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RZ2	Missense_Mutation	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EGF-like,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.Q870K	ENST00000261349.4	37	c.2608	CCDS8647.1	12	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737138	0.89482	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.95980	-3.87;-3.87	5.78	5.78	0.91487	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.56097	U	0.000035	D	0.96318	0.8799	L	0.43152	1.355	0.80722	D	1	D;D	0.65815	0.977;0.995	D;D	0.68765	0.96;0.948	D	0.94024	0.7295	10	0.17369	T	0.5	.	20.0124	0.97464	0.0:0.0:1.0:0.0	.	870;870	F5H7J9;O75581	.;LRP6_HUMAN	K	870	ENSP00000261349:Q870K;ENSP00000442472:Q870K	ENSP00000261349:Q870K	Q	-	1	0	LRP6	12203213	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.749000	0.94314	0.655000	0.94253	CAG	LRP6	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000070018		0.507	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP6	HGNC	protein_coding	OTTHUMT00000400137.1	139	0.00	0	G			12311946	12311946	-1	no_errors	ENST00000261349	ensembl	human	known	69_37n	missense	147	19.23	35	SNP	1.000	T
MARCH7	64844	genome.wustl.edu	37	2	160605150	160605150	+	Missense_Mutation	SNP	C	C	T	rs200506647		TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr2:160605150C>T	ENST00000259050.4	+	5	1471	c.1349C>T	c.(1348-1350)gCa>gTa	p.A450V	MARCH7_ENST00000539065.1_Missense_Mutation_p.A394V|MARCH7_ENST00000409591.1_Missense_Mutation_p.A412V|MARCH7_ENST00000409175.1_Missense_Mutation_p.A450V	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	450					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						AGACCACAAGCATCTGCAGCA	0.443																																						dbGAP											0													108.0	112.0	110.0					2																	160605150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.1349C>T	2.37:g.160605150C>T	ENSP00000259050:p.Ala450Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.A450V	ENST00000259050.4	37	c.1349	CCDS2210.1	2	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214422	0.39102	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591	T;T;T;T	0.12569	2.67;2.68;2.67;2.67	5.59	4.71	0.59529	.	0.313741	0.33732	N	0.004603	T	0.12178	0.0296	L	0.40543	1.245	0.25627	N	0.986344	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.08055	0.003;0.002;0.001	T	0.17745	-1.0359	10	0.24483	T	0.36	-13.2385	12.5996	0.56489	0.0:0.8613:0.0:0.1387	.	394;412;450	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	V	450;394;450;412	ENSP00000386830:A450V;ENSP00000442992:A394V;ENSP00000259050:A450V;ENSP00000387238:A412V	ENSP00000259050:A450V	A	+	2	0	MARCH7	160313396	0.729000	0.28090	1.000000	0.80357	0.994000	0.84299	0.724000	0.25954	1.345000	0.45676	0.655000	0.94253	GCA	MARCH7	-	NULL	ENSG00000136536		0.443	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH7	HGNC	protein_coding	OTTHUMT00000255040.3	184	0.54	1	C	NM_022826		160605150	160605150	+1	no_errors	ENST00000259050	ensembl	human	known	69_37n	missense	105	28.08	41	SNP	1.000	T
MLYCD	23417	genome.wustl.edu	37	16	83948559	83948560	+	Splice_Site	DEL	AG	AG	-			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr16:83948559_83948560delAG	ENST00000262430.4	+	5	967		c.e5-1		RP11-505K9.4_ENST00000561562.1_Intron|RP11-505K9.4_ENST00000566309.1_Intron	NM_012213.2	NP_036345.2	O95822	DCMC_HUMAN	malonyl-CoA decarboxylase						acetyl-CoA biosynthetic process (GO:0006085)|cellular lipid metabolic process (GO:0044255)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA catabolic process (GO:2001294)|positive regulation of fatty acid oxidation (GO:0046321)|regulation of glucose metabolic process (GO:0010906)|response to ischemia (GO:0002931)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	malonyl-CoA decarboxylase activity (GO:0050080)|receptor binding (GO:0005102)			NS(1)|biliary_tract(1)|breast(1)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						CATGCTTTACAGAGAGAGTTTC	0.495																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AF153679	CCDS42206.1	16q24	2009-02-04				ENSG00000103150			7150	protein-coding gene	gene with protein product		606761				10455107, 9869665	Standard	NM_012213		Approved	MCD, hMCD	uc002fgz.3	O95822		ENST00000262430.4:c.949-1AG>-	16.37:g.83948565_83948566delAG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UNU5|Q9Y3F2	Splice_Site	DEL	-	e5-1	ENST00000262430.4	37	c.949-2_949-1	CCDS42206.1	16																																																																																			MLYCD	-	-	ENSG00000103150		0.495	MLYCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLYCD	HGNC	protein_coding	OTTHUMT00000433009.1	93	0.00	0	AG	NM_012213	Intron	83948559	83948560	+1	no_errors	ENST00000262430	ensembl	human	known	69_37n	splice_site_del	78	31.93	38	DEL	1.000:1.000	-
MTMR11	10903	genome.wustl.edu	37	1	149908094	149908094	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr1:149908094G>A	ENST00000439741.2	-	2	345	c.95C>T	c.(94-96)cCc>cTc	p.P32L	MTMR11_ENST00000406732.3_Missense_Mutation_p.P4L|MTMR11_ENST00000369140.3_5'UTR|MTMR11_ENST00000361405.6_Missense_Mutation_p.P32L|MTMR11_ENST00000492824.1_5'UTR	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	32							phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			ACGACTCCTGGGCTCCGGCAT	0.552																																						dbGAP											0													120.0	120.0	120.0					1																	149908094		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.95C>T	1.37:g.149908094G>A	ENSP00000391668:p.Pro32Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	pfam_Myotubularin_assoc,pfam_Myotub-related	p.P32L	ENST00000439741.2	37	c.95	CCDS53360.1	1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718775	0.30503	.	.	ENSG00000014914	ENST00000439741;ENST00000361405;ENST00000406732	D;T;D	0.96200	-3.61;0.68;-3.94	4.67	0.593	0.17478	.	.	.	.	.	D	0.85265	0.5657	L	0.57536	1.79	0.34366	D	0.691535	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.68930	-0.5279	8	.	.	.	.	2.8148	0.05453	0.0903:0.1596:0.4207:0.3293	.	4;32	A4FU01-6;A4FU01	.;MTMRB_HUMAN	L	32;32;4	ENSP00000391668:P32L;ENSP00000354941:P32L;ENSP00000383948:P4L	.	P	-	2	0	MTMR11	148174718	0.264000	0.24093	0.981000	0.43875	0.668000	0.39293	0.027000	0.13621	-0.036000	0.13669	-0.981000	0.02577	CCC	MTMR11	-	NULL	ENSG00000014914		0.552	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	HGNC	protein_coding		204	0.00	0	G	NM_181873		149908094	149908094	-1	no_errors	ENST00000439741	ensembl	human	known	69_37n	missense	279	28.09	109	SNP	0.988	A
MUC16	94025	genome.wustl.edu	37	19	9063731	9063731	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr19:9063731C>T	ENST00000397910.4	-	3	23918	c.23715G>A	c.(23713-23715)atG>atA	p.M7905I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7907	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.M7905I(2)|p.M3538I(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TATGGGTGTTCATGGTTATTT	0.473																																						dbGAP											3	Substitution - Missense(3)	endometrium(3)											230.0	211.0	217.0					19																	9063731		2030	4189	6219	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23715G>A	19.37:g.9063731C>T	ENSP00000381008:p.Met7905Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.M7905I	ENST00000397910.4	37	c.23715	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	6.164	0.398394	0.11696	.	.	ENSG00000181143	ENST00000397910	T	0.02085	4.46	2.2	-0.273	0.12915	.	.	.	.	.	T	0.00967	0.0032	N	0.01048	-1.04	.	.	.	B	0.10296	0.003	B	0.04013	0.001	T	0.38499	-0.9658	8	0.87932	D	0	.	7.8098	0.29223	0.0:0.5307:0.4693:0.0	.	7905	B5ME49	.	I	7905	ENSP00000381008:M7905I	ENSP00000381008:M7905I	M	-	3	0	MUC16	8924731	0.000000	0.05858	0.000000	0.03702	0.187000	0.23431	-0.311000	0.08124	0.032000	0.15435	0.187000	0.17357	ATG	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	163	0.61	1	C	NM_024690		9063731	9063731	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	161	34.02	83	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9065839	9065839	+	Missense_Mutation	SNP	A	A	C	rs376128991		TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr19:9065839A>C	ENST00000397910.4	-	3	21810	c.21607T>G	c.(21607-21609)Tca>Gca	p.S7203A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7205	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGTCTCTGAGTCAGCTAAG	0.483																																						dbGAP											0													222.0	211.0	214.0					19																	9065839		2098	4227	6325	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21607T>G	19.37:g.9065839A>C	ENSP00000381008:p.Ser7203Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S7203A	ENST00000397910.4	37	c.21607	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	5.424	0.263333	0.10294	.	.	ENSG00000181143	ENST00000397910	T	0.27557	1.66	2.47	0.131	0.14755	.	.	.	.	.	T	0.36635	0.0974	L	0.58101	1.795	.	.	.	P	0.46952	0.887	P	0.54759	0.76	T	0.42932	-0.9422	8	0.87932	D	0	.	1.9057	0.03276	0.5632:0.0:0.1667:0.2701	.	7203	B5ME49	.	A	7203	ENSP00000381008:S7203A	ENSP00000381008:S7203A	S	-	1	0	MUC16	8926839	0.002000	0.14202	0.006000	0.13384	0.040000	0.13550	0.056000	0.14256	-0.042000	0.13535	0.164000	0.16699	TCA	MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	293	0.00	0	A	NM_024690		9065839	9065839	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	268	33.90	139	SNP	0.007	C
MUC5B	727897	genome.wustl.edu	37	11	1264973	1264973	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr11:1264973C>T	ENST00000529681.1	+	31	6921	c.6863C>T	c.(6862-6864)cCc>cTc	p.P2288L	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.P2291L	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2288	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACGGCCACACCCAGCAAGACC	0.682																																						dbGAP											0													71.0	103.0	92.0					11																	1264973		2111	4211	6322	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6863C>T	11.37:g.1264973C>T	ENSP00000436812:p.Pro2288Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P2291L	ENST00000529681.1	37	c.6872	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	c	10.41	1.341555	0.24339	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.17213	2.29;2.5	2.44	-0.988	0.10245	.	.	.	.	.	T	0.08179	0.0204	N	0.14661	0.345	0.09310	N	1	B;B	0.16396	0.003;0.017	B;B	0.12156	0.003;0.007	T	0.33675	-0.9859	9	0.87932	D	0	.	2.1817	0.03876	0.1339:0.4083:0.2648:0.193	.	2926;2291	A7Y9J9;E9PBJ0	.;.	L	2288;2291;2289;2303	ENSP00000436812:P2288L;ENSP00000415793:P2291L	ENSP00000343037:P2289L	P	+	2	0	MUC5B	1221549	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.936000	0.03946	-0.101000	0.12219	0.305000	0.20034	CCC	MUC5B	-	NULL	ENSG00000117983		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	34	0.00	0	C	XM_001126093		1264973	1264973	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	31	35.42	17	SNP	0.000	T
NBEA	26960	genome.wustl.edu	37	13	35733461	35733463	+	In_Frame_Del	DEL	AGT	AGT	-			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	AGT	AGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr13:35733461_35733463delAGT	ENST00000400445.3	+	22	3687_3689	c.3153_3155delAGT	c.(3151-3156)gaagta>gaa	p.V1052del	NBEA_ENST00000540320.1_In_Frame_Del_p.V1052del|NBEA_ENST00000379939.2_In_Frame_Del_p.V1052del|NBEA_ENST00000310336.4_In_Frame_Del_p.V1052del	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1052					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TACATGTGGAAGTACATGATCTT	0.399																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.3153_3155delAGT	13.37:g.35733461_35733463delAGT	ENSP00000383295:p.Val1052del	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	In_Frame_Del	DEL	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.V1052in_frame_del	ENST00000400445.3	37	c.3153_3155	CCDS45026.1	13																																																																																			NBEA	-	NULL	ENSG00000172915		0.399	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		191	0.00	0	AGT	NM_015678		35733461	35733463	+1	no_errors	ENST00000310336	ensembl	human	known	69_37n	in_frame_del	85	22.02	24	DEL	1.000:1.000:1.000	-
NUDT6	11162	genome.wustl.edu	37	4	123814333	123814333	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr4:123814333C>T	ENST00000304430.5	-	5	634	c.601G>A	c.(601-603)Gaa>Aaa	p.E201K	NUDT6_ENST00000502270.1_Missense_Mutation_p.E32K|FGF2_ENST00000264498.3_3'UTR|FGF2_ENST00000608478.1_3'UTR|NUDT6_ENST00000339154.2_Missense_Mutation_p.E32K|NUDT6_ENST00000608639.1_5'Flank	NM_007083.4	NP_009014.2	P53370	NUDT6_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 6	201	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|hydrolase activity (GO:0016787)			endometrium(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	6						GACCTGAATTCTGATTTTATA	0.383																																						dbGAP											0													70.0	74.0	73.0					4																	123814333		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF019632	CCDS3729.1, CCDS43268.1	4q26	2011-02-21			ENSG00000170917	ENSG00000170917		"""Nudix motif containing"""	8053	protein-coding gene	gene with protein product		606261				7984147, 10022609	Standard	NM_198041		Approved	gfg-1, gfg, FGF2AS, FGF-AS	uc003iew.3	P53370	OTTHUMG00000039507	ENST00000304430.5:c.601G>A	4.37:g.123814333C>T	ENSP00000306070:p.Glu201Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K756|O95097|Q9UQD9	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_Nudix_hydrolase6-like	p.E201K	ENST00000304430.5	37	c.601	CCDS43268.1	4	.	.	.	.	.	.	.	.	.	.	C	31	5.083175	0.94050	.	.	ENSG00000170917	ENST00000304430;ENST00000339154;ENST00000502270	T;T;T	0.06068	3.35;3.35;3.35	5.41	5.41	0.78517	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.18045	0.0433	L	0.53617	1.68	0.80722	D	1	D	0.54397	0.966	P	0.56163	0.793	T	0.00092	-1.2082	10	0.51188	T	0.08	-0.3507	19.2326	0.93846	0.0:1.0:0.0:0.0	.	201	P53370	NUDT6_HUMAN	K	201;32;32	ENSP00000306070:E201K;ENSP00000344011:E32K;ENSP00000424117:E32K	ENSP00000306070:E201K	E	-	1	0	NUDT6	124033783	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.317000	0.65822	2.538000	0.85594	0.650000	0.86243	GAA	NUDT6	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,prints_Nudix_hydrolase6-like	ENSG00000170917		0.383	NUDT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT6	HGNC	protein_coding	OTTHUMT00000095331.3	166	0.60	1	C	NM_007083		123814333	123814333	-1	no_errors	ENST00000304430	ensembl	human	known	69_37n	missense	103	16.13	20	SNP	1.000	T
PARP6	56965	genome.wustl.edu	37	15	72559136	72559136	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr15:72559136C>T	ENST00000569795.1	-	4	718	c.31G>A	c.(31-33)Gac>Aac	p.D11N	CELF6_ENST00000569547.1_3'UTR|PARP6_ENST00000413097.2_5'UTR|PARP6_ENST00000287196.9_Missense_Mutation_p.D11N|PARP6_ENST00000260376.7_Missense_Mutation_p.D11N			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	11							NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						TCCGAGTCGTCATCATTCCAG	0.463																																						dbGAP											0													152.0	153.0	153.0					15																	72559136		1913	4131	6044	-	-	-	SO:0001583	missense	0			AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.31G>A	15.37:g.72559136C>T	ENSP00000456348:p.Asp11Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.D11N	ENST00000569795.1	37	c.31	CCDS10241.2	15	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206130	0.79127	.	.	ENSG00000137817	ENST00000419739;ENST00000287196;ENST00000260376;ENST00000336471	.	.	.	5.78	5.78	0.91487	.	0.046170	0.85682	D	0.000000	T	0.39517	0.1081	N	0.08118	0	0.80722	D	1	B;B	0.27559	0.181;0.181	B;B	0.26969	0.051;0.075	T	0.39921	-0.9590	9	0.72032	D	0.01	-11.4281	14.2156	0.65790	0.0:0.9265:0.0:0.0735	.	11;11	Q0VDG0;Q2NL67	.;PARP6_HUMAN	N	11	.	ENSP00000260376:D11N	D	-	1	0	PARP6	70346190	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.377000	0.66184	2.731000	0.93534	0.655000	0.94253	GAC	PARP6	-	NULL	ENSG00000137817		0.463	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP6	HGNC	protein_coding	OTTHUMT00000257315.2	132	0.00	0	C	NM_020214		72559136	72559136	-1	no_errors	ENST00000287196	ensembl	human	known	69_37n	missense	128	21.47	35	SNP	1.000	T
PCMTD2	55251	genome.wustl.edu	37	20	62891426	62891426	+	Silent	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr20:62891426C>T	ENST00000308824.6	+	2	235	c.108C>T	c.(106-108)atC>atT	p.I36I	PCMTD2_ENST00000609372.1_Silent_p.I36I|PCMTD2_ENST00000299468.7_Silent_p.I36I|PCMTD2_ENST00000369758.4_Silent_p.I36I	NM_018257.2	NP_060727.2	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2	36						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|upper_aerodigestive_tract(1)	17	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TCAGAGCTATCGATCGTGCAG	0.428																																						dbGAP											0													80.0	81.0	81.0					20																	62891426		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001745	CCDS13559.1, CCDS46631.1	20q13.33	2012-10-02	2005-10-06	2005-10-06	ENSG00000203880	ENSG00000203880			15882	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 36"""	C20orf36			Standard	NM_018257		Approved	FLJ10883	uc002yil.4	Q9NV79	OTTHUMG00000033029	ENST00000308824.6:c.108C>T	20.37:g.62891426C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5H3|Q8IW60|Q9H4K2	Silent	SNP	pfam_PCMT	p.I36	ENST00000308824.6	37	c.108	CCDS13559.1	20																																																																																			PCMTD2	-	pfam_PCMT	ENSG00000203880		0.428	PCMTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCMTD2	HGNC	protein_coding	OTTHUMT00000080301.1	101	0.00	0	C	NM_018257		62891426	62891426	+1	no_errors	ENST00000308824	ensembl	human	known	69_37n	silent	150	16.57	30	SNP	0.609	T
PCSK5	5125	genome.wustl.edu	37	9	78772039	78772039	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr9:78772039G>A	ENST00000545128.1	+	11	1929	c.1391G>A	c.(1390-1392)cGg>cAg	p.R464Q	PCSK5_ENST00000376752.4_Missense_Mutation_p.R464Q|PCSK5_ENST00000376767.3_Missense_Mutation_p.R464Q	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	464					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ACCGTTCCCCGGCAGCACGTG	0.522																																						dbGAP											0													139.0	116.0	124.0					9																	78772039		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1391G>A	9.37:g.78772039G>A	ENSP00000446280:p.Arg464Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EGF-like,prints_Peptidase_S8_subtilisin-rel	p.R464Q	ENST00000545128.1	37	c.1391	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222760	0.39300	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.75	4.62	0.57501	.	0.355194	0.32093	N	0.006581	T	0.28665	0.0710	N	0.01048	-1.04	0.24965	N	0.99171	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.13737	-1.0498	10	0.36615	T	0.2	-14.5577	6.3398	0.21316	0.5973:0.3066:0.0961:0.0	.	464;464	Q92824-2;B1AMG5	.;.	Q	464;167;464;464;464;137	ENSP00000446280:R464Q;ENSP00000365958:R464Q;ENSP00000365943:R464Q;ENSP00000411654:R137Q	ENSP00000365943:R464Q	R	+	2	0	PCSK5	77961859	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	1.892000	0.39748	1.011000	0.39340	0.591000	0.81541	CGG	PCSK5	-	superfamily_Galactose-bd-like	ENSG00000099139		0.522	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		83	0.00	0	G			78772039	78772039	+1	no_errors	ENST00000545128	ensembl	human	known	69_37n	missense	75	29.25	31	SNP	1.000	A
PPM1L	151742	genome.wustl.edu	37	3	160474474	160474474	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr3:160474474C>G	ENST00000498165.1	+	1	479	c.378C>G	c.(376-378)atC>atG	p.I126M	RP11-16N11.2_ENST00000566372.1_RNA|PPM1L_ENST00000497343.1_Missense_Mutation_p.I126M	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	126	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TCTTCGGGATCTTCGACGGGC	0.582																																					Pancreas(86;250 1994 13715 43211)	dbGAP											0													37.0	40.0	39.0					3																	160474474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.378C>G	3.37:g.160474474C>G	ENSP00000417659:p.Ile126Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3J2|Q96NM7	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.I126M	ENST00000498165.1	37	c.378	CCDS33886.1	3	.	.	.	.	.	.	.	.	.	.	C	15.32	2.797865	0.50208	.	.	ENSG00000163590	ENST00000497343;ENST00000498165	T;T	0.12147	2.71;2.71	4.82	3.01	0.34805	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	M	0.75447	2.3	0.80722	D	1	P	0.38250	0.624	P	0.48738	0.588	T	0.01684	-1.1296	10	0.87932	D	0	.	6.9704	0.24646	0.3283:0.5861:0.0:0.0856	.	126	Q5SGD2	PPM1L_HUMAN	M	126	ENSP00000420354:I126M;ENSP00000417659:I126M	ENSP00000420354:I126M	I	+	3	3	PPM1L	161957168	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.791000	0.26915	1.028000	0.39785	-0.268000	0.10319	ATC	PPM1L	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000163590		0.582	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1L	HGNC	protein_coding	OTTHUMT00000353019.1	44	0.00	0	C	NM_139245		160474474	160474474	+1	no_errors	ENST00000498165	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	1.000	G
PREX2	80243	genome.wustl.edu	37	8	68965476	68965476	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr8:68965476G>A	ENST00000288368.4	+	9	1365	c.1088G>A	c.(1087-1089)cGg>cAg	p.R363Q	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	363					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.R363Q(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGAGAACGGCGGAAAGGTGGG	0.373																																						dbGAP											2	Substitution - Missense(2)	lung(2)											107.0	104.0	105.0					8																	68965476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1088G>A	8.37:g.68965476G>A	ENSP00000288368:p.Arg363Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R363Q	ENST00000288368.4	37	c.1088	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	36	5.643888	0.96704	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.61040	0.14	5.74	5.74	0.90152	Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.74114	0.3674	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.74197	-0.3743	10	0.62326	D	0.03	.	19.9189	0.97077	0.0:0.0:1.0:0.0	.	363;363;363	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	Q	363	ENSP00000288368:R363Q	ENSP00000288368:R363Q	R	+	2	0	PREX2	69128030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.707000	0.92482	0.655000	0.94253	CGG	PREX2	-	smart_Pleckstrin_homology	ENSG00000046889		0.373	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	334	0.00	0	G	NM_025170		68965476	68965476	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	458	12.76	67	SNP	1.000	A
SALL4	57167	genome.wustl.edu	37	20	50400810	50400810	+	Silent	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr20:50400810G>A	ENST00000217086.4	-	4	3267	c.3156C>T	c.(3154-3156)gtC>gtT	p.V1052V	SALL4_ENST00000371539.3_Silent_p.V275V|SALL4_ENST00000395997.3_Silent_p.V615V	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	1052					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCCTTAGCTGACCGCAATCT	0.458																																						dbGAP											0													92.0	81.0	85.0					20																	50400810		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.3156C>T	20.37:g.50400810G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2D8|Q540H3|Q6Y8G6	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V1052	ENST00000217086.4	37	c.3156	CCDS13438.1	20																																																																																			SALL4	-	NULL	ENSG00000101115		0.458	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	52	0.00	0	G			50400810	50400810	-1	no_errors	ENST00000217086	ensembl	human	known	69_37n	silent	87	21.62	24	SNP	1.000	A
SCN3B	55800	genome.wustl.edu	37	11	123513189	123513189	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr11:123513189G>A	ENST00000392770.2	-	3	1212	c.410C>T	c.(409-411)aCg>aTg	p.T137M	SCN3B_ENST00000299333.3_Missense_Mutation_p.T137M|SCN3B_ENST00000530277.1_Missense_Mutation_p.T137M	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	137	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGCCGCGTCGTCTTCACAAA	0.592																																						dbGAP											0													80.0	75.0	77.0					11																	123513189		2202	4299	6501	-	-	-	SO:0001583	missense	0			AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.410C>T	11.37:g.123513189G>A	ENSP00000376523:p.Thr137Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.T137M	ENST00000392770.2	37	c.410	CCDS8442.1	11	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262382	0.59431	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.221122	0.52532	D	0.000065	T	0.53384	0.1793	L	0.34521	1.04	0.34862	D	0.742776	D	0.54207	0.965	B	0.37047	0.24	T	0.67507	-0.5653	10	0.45353	T	0.12	0.9634	14.8759	0.70493	0.0:0.2504:0.7496:0.0	.	137	Q9NY72	SCN3B_HUMAN	M	137	ENSP00000376523:T137M;ENSP00000299333:T137M;ENSP00000432785:T137M;ENSP00000435554:T137M	ENSP00000299333:T137M	T	-	2	0	SCN3B	123018399	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.089000	0.41672	2.854000	0.98071	0.655000	0.94253	ACG	SCN3B	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000166257		0.592	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN3B	HGNC	protein_coding	OTTHUMT00000387412.1	88	0.00	0	G	NM_018400		123513189	123513189	-1	no_errors	ENST00000299333	ensembl	human	known	69_37n	missense	53	32.91	26	SNP	1.000	A
SH2D4A	63898	genome.wustl.edu	37	8	19231145	19231145	+	Missense_Mutation	SNP	C	C	T	rs200130559	byFrequency	TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr8:19231145C>T	ENST00000265807.3	+	8	1433	c.1022C>T	c.(1021-1023)tCa>tTa	p.S341L	SH2D4A_ENST00000519207.1_Missense_Mutation_p.S341L|SH2D4A_ENST00000518040.1_Missense_Mutation_p.S296L	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	341					negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		CAGAAAACCTCAGACACCATA	0.542																																						dbGAP											0													94.0	70.0	78.0					8																	19231145		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.1022C>T	8.37:g.19231145C>T	ENSP00000265807:p.Ser341Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.S341L	ENST00000265807.3	37	c.1022	CCDS6009.1	8	.	.	.	.	.	.	.	.	.	.	C	18.96	3.734634	0.69189	.	.	ENSG00000104611	ENST00000265807;ENST00000518040;ENST00000519207	T;T;T	0.16743	2.32;2.32;2.32	5.99	5.99	0.97316	.	0.642162	0.15282	N	0.270603	T	0.23846	0.0577	M	0.73962	2.25	0.27235	N	0.959296	P;B	0.35077	0.483;0.209	B;B	0.30401	0.115;0.032	T	0.13899	-1.0492	10	0.42905	T	0.14	.	15.9778	0.80083	0.0:1.0:0.0:0.0	.	296;341	B4DDR1;Q9H788	.;SH24A_HUMAN	L	341;296;341	ENSP00000265807:S341L;ENSP00000429482:S296L;ENSP00000428684:S341L	ENSP00000265807:S341L	S	+	2	0	SH2D4A	19275425	0.010000	0.17322	0.062000	0.19696	0.848000	0.48234	1.773000	0.38563	2.840000	0.97914	0.655000	0.94253	TCA	SH2D4A	-	NULL	ENSG00000104611		0.542	SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH2D4A	HGNC	protein_coding	OTTHUMT00000214094.1	115	0.00	0	C	NM_022071		19231145	19231145	+1	no_errors	ENST00000265807	ensembl	human	known	69_37n	missense	74	33.33	37	SNP	0.591	T
SP1	6667	genome.wustl.edu	37	12	53776064	53776064	+	Silent	SNP	T	T	C			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr12:53776064T>C	ENST00000327443.4	+	3	431	c.333T>C	c.(331-333)tcT>tcC	p.S111S	SP1_ENST00000426431.2_Silent_p.S104S	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	111	Ser/Thr-rich.				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		AGATCATCTCTTCCTCCTCTG	0.562																																						dbGAP											0													75.0	68.0	71.0					12																	53776064		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.333T>C	12.37:g.53776064T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S111	ENST00000327443.4	37	c.333	CCDS8857.1	12																																																																																			SP1	-	NULL	ENSG00000185591		0.562	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP1	HGNC	protein_coding	OTTHUMT00000407044.1	44	0.00	0	T			53776064	53776064	+1	no_errors	ENST00000327443	ensembl	human	known	69_37n	silent	37	36.21	21	SNP	0.909	C
SPHK2	56848	genome.wustl.edu	37	19	49131440	49131440	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr19:49131440C>T	ENST00000245222.4	+	6	1144	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C	SPHK2_ENST00000443164.1_Missense_Mutation_p.R322C|SPHK2_ENST00000599748.1_Missense_Mutation_p.R224C|SPHK2_ENST00000600537.1_Missense_Mutation_p.R201C|SPHK2_ENST00000601712.1_Missense_Mutation_p.R224C|SPHK2_ENST00000340932.3_Missense_Mutation_p.R224C|SPHK2_ENST00000599029.1_Missense_Mutation_p.R224C|SPHK2_ENST00000598088.1_Missense_Mutation_p.R260C	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	260	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		GCTCCTAGATCGCCCTGACTG	0.667																																						dbGAP											0													39.0	40.0	39.0					19																	49131440		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.778C>T	19.37:g.49131440C>T	ENSP00000245222:p.Arg260Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.R322C	ENST00000245222.4	37	c.964	CCDS12727.1	19	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701988	0.68501	.	.	ENSG00000063176	ENST00000245222;ENST00000406269;ENST00000340932;ENST00000443164	T;T;T	0.26067	1.76;1.76;1.76	4.45	4.45	0.53987	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.60143	0.2246	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.71886	-0.4457	10	0.87932	D	0	-18.3874	14.9404	0.70989	0.0:1.0:0.0:0.0	.	201;322;224;260	B4DU87;A0T4C8;Q9NRA0-3;Q9NRA0	.;.;.;SPHK2_HUMAN	C	260;233;224;322	ENSP00000245222:R260C;ENSP00000341091:R224C;ENSP00000413369:R322C	ENSP00000245222:R260C	R	+	1	0	SPHK2	53823252	1.000000	0.71417	0.552000	0.28243	0.839000	0.47603	4.345000	0.59360	2.195000	0.70347	0.563000	0.77884	CGC	SPHK2	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000063176		0.667	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466153.1	14	0.00	0	C			49131440	49131440	+1	no_errors	ENST00000443164	ensembl	human	known	69_37n	missense	10	47.62	10	SNP	0.977	T
TCHP	84260	genome.wustl.edu	37	12	110346447	110346447	+	Silent	SNP	G	G	A			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr12:110346447G>A	ENST00000312777.5	+	7	970	c.756G>A	c.(754-756)gaG>gaA	p.E252E	TCHP_ENST00000405876.4_Silent_p.E252E	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						GGGAGCTAGAGAGGCTGGAGG	0.577																																						dbGAP											0													50.0	49.0	49.0					12																	110346447		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.756G>A	12.37:g.110346447G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.E252	ENST00000312777.5	37	c.756	CCDS9137.1	12																																																																																			TCHP	-	NULL	ENSG00000139437		0.577	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TCHP	HGNC	protein_coding	OTTHUMT00000403289.1	23	0.00	0	G	NM_032300		110346447	110346447	+1	no_errors	ENST00000312777	ensembl	human	known	69_37n	silent	25	26.47	9	SNP	0.320	A
TMEM131	23505	genome.wustl.edu	37	2	98475800	98475802	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr2:98475800_98475802delTGT	ENST00000186436.5	-	5	676_678	c.448_450delACA	c.(448-450)acadel	p.T150del	TMEM131_ENST00000425805.2_In_Frame_Del_p.T101del	NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	150						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GAAAATGTGATGTTGTAGCAGAT	0.305																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.448_450delACA	2.37:g.98475803_98475805delTGT	ENSP00000186436:p.Thr150del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_DUF3651_TMEM131	p.T150in_frame_del	ENST00000186436.5	37	c.450_448	CCDS46368.1	2																																																																																			TMEM131	-	NULL	ENSG00000075568		0.305	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	128	0.00	0	TGT	XM_371542		98475800	98475802	-1	no_errors	ENST00000186436	ensembl	human	known	69_37n	in_frame_del	138	21.91	39	DEL	1.000:1.000:1.000	-
TP53	7157	genome.wustl.edu	37	17	7579311	7579311	+	Splice_Site	SNP	C	C	T			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr17:7579311C>T	ENST00000269305.4	-	4	565		c.e4+1		TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAACTGACCGTGCAAGTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(12)|breast(5)|upper_aerodigestive_tract(4)|bone(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	GRCh37	CS951538	TP53	S							66.0	61.0	63.0					17																	7579311		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>A	17.37:g.7579311C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e3+1	ENST00000269305.4	37	c.375+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015182	0.75161	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6586	0.68852	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520036	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.208000	0.72165	2.403000	0.81681	0.655000	0.94253	.	TP53	-	-	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	150	0.00	0	C	NM_000546	Intron	7579311	7579311	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	131	36.71	76	SNP	1.000	T
UQCRC1	7384	genome.wustl.edu	37	3	48641015	48641015	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A07O-01A-11W-A019-09	TCGA-A8-A07O-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4574b64d-8848-46e4-913e-5d318c1f6162	edde47bb-2b18-4fcf-8c3a-10ea98983e62	g.chr3:48641015C>G	ENST00000203407.5	-	6	1104	c.688G>C	c.(688-690)Gtg>Ctg	p.V230L		NM_003365.2	NP_003356.2	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	230					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to alkaloid (GO:0043279)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GCTGCCAGCACCATTCGAGGG	0.542																																					NSCLC(81;1112 1427 27031 32409 45529)	dbGAP											0													106.0	89.0	94.0					3																	48641015		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009586	CCDS2774.1	3p21	2011-07-04			ENSG00000010256	ENSG00000010256	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12585	protein-coding gene	gene with protein product		191328				8407948	Standard	NM_003365		Approved	D3S3191, QCR1, UQCR1	uc003cub.1	P31930	OTTHUMG00000133539	ENST00000203407.5:c.688G>C	3.37:g.48641015C>G	ENSP00000203407:p.Val230Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7R8|Q96DD2	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.V230L	ENST00000203407.5	37	c.688	CCDS2774.1	3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.903466	0.92035	.	.	ENSG00000010256	ENST00000203407	T	0.10192	2.9	5.8	5.8	0.92144	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.052338	0.85682	N	0.000000	T	0.51075	0.1653	H	0.97051	3.93	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.77557	0.984;0.99	T	0.67304	-0.5704	10	0.87932	D	0	-27.7249	20.0591	0.97667	0.0:1.0:0.0:0.0	.	115;230	B4DUL5;P31930	.;QCR1_HUMAN	L	230	ENSP00000203407:V230L	ENSP00000203407:V230L	V	-	1	0	UQCRC1	48616019	1.000000	0.71417	1.000000	0.80357	0.577000	0.36160	7.717000	0.84732	2.747000	0.94245	0.462000	0.41574	GTG	UQCRC1	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	ENSG00000010256		0.542	UQCRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC1	HGNC	protein_coding	OTTHUMT00000257517.1	24	0.00	0	C	NM_003365		48641015	48641015	-1	no_errors	ENST00000203407	ensembl	human	known	69_37n	missense	12	27.78	5	SNP	1.000	G
