#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APOBEC1	339	genome.wustl.edu	37	12	7805264	7805264	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr12:7805264G>A	ENST00000229304.4	-	3	232	c.212C>T	c.(211-213)aCg>aTg	p.T71M		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	71					cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						TCTTTCTGACGtaaatttttt	0.468																																					Pancreas(135;929 1826 4531 10527 41012)	dbGAP											0													32.0	32.0	32.0					12																	7805264		2203	4300	6503	-	-	-	SO:0001583	missense	0			U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.212C>T	12.37:g.7805264G>A	ENSP00000229304:p.Thr71Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UE64|Q9UM71	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.T71M	ENST00000229304.4	37	c.212	CCDS8579.1	12	.	.	.	.	.	.	.	.	.	.	G	8.721	0.914465	0.17907	.	.	ENSG00000111701	ENST00000229304	T	0.66099	-0.19	4.48	-0.0094	0.14001	APOBEC-like, N-terminal (1);APOBEC/CMP deaminase, zinc-binding (1);	0.719989	0.12957	N	0.425338	T	0.68915	0.3053	M	0.73962	2.25	0.09310	N	1	D	0.76494	0.999	D	0.63597	0.916	T	0.57266	-0.7841	10	0.59425	D	0.04	-2.9867	1.1423	0.01768	0.2083:0.1756:0.4363:0.1798	.	71	P41238	ABEC1_HUMAN	M	71	ENSP00000229304:T71M	ENSP00000229304:T71M	T	-	2	0	APOBEC1	7696531	0.007000	0.16637	0.001000	0.08648	0.046000	0.14306	1.242000	0.32755	0.083000	0.17047	0.462000	0.41574	ACG	APOBEC1	-	pfam_APOBEC_N,superfamily_Cytidine_deaminase-like	ENSG00000111701		0.468	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC1	HGNC	protein_coding	OTTHUMT00000280523.1	36	0.00	0	G	NM_001644		7805264	7805264	-1	no_errors	ENST00000229304	ensembl	human	known	69_37n	missense	110	19.71	27	SNP	0.000	A
ATP11C	286410	genome.wustl.edu	37	X	138869362	138869362	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:138869362C>G	ENST00000327569.3	-	15	1669	c.1571G>C	c.(1570-1572)aGa>aCa	p.R524T	ATP11C_ENST00000370543.1_Missense_Mutation_p.R524T|ATP11C_ENST00000359686.2_Missense_Mutation_p.R524T|ATP11C_ENST00000370557.1_Missense_Mutation_p.R521T|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000361648.2_Missense_Mutation_p.R524T	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	524					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GTTCTCTACTCTCATATATCC	0.313																																						dbGAP											0													120.0	93.0	102.0					X																	138869362		2202	4299	6501	-	-	-	SO:0001583	missense	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1571G>C	X.37:g.138869362C>G	ENSP00000332756:p.Arg524Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.R524T	ENST00000327569.3	37	c.1571	CCDS14668.1	X	.	.	.	.	.	.	.	.	.	.	C	9.949	1.219498	0.22373	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15	5.76	-0.398	0.12418	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.477635	0.25729	N	0.028694	T	0.26774	0.0655	N	0.02865	-0.47	0.26708	N	0.971029	B;B	0.28208	0.203;0.152	B;B	0.36766	0.149;0.232	T	0.30621	-0.9972	10	0.11794	T	0.64	.	4.4187	0.11470	0.3755:0.3852:0.0:0.2394	.	524;524	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	T	521;524;524;524;524	ENSP00000359588:R521T;ENSP00000355165:R524T;ENSP00000332756:R524T;ENSP00000359574:R524T;ENSP00000352715:R524T	ENSP00000332756:R524T	R	-	2	0	ATP11C	138697028	1.000000	0.71417	0.163000	0.22734	0.901000	0.52897	1.083000	0.30815	-0.046000	0.13446	-0.229000	0.12294	AGA	ATP11C	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000101974		0.313	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	172	0.00	0	C	NM_173694		138869362	138869362	-1	no_errors	ENST00000327569	ensembl	human	known	69_37n	missense	287	12.50	41	SNP	0.087	G
BAI3	577	genome.wustl.edu	37	6	69758178	69758178	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr6:69758178G>T	ENST00000370598.1	+	14	3030	c.2209G>T	c.(2209-2211)Gat>Tat	p.D737Y		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	737					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				AAACTCAGAAGATAGGGTAGT	0.393																																						dbGAP											0													78.0	83.0	82.0					6																	69758178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2209G>T	6.37:g.69758178G>T	ENSP00000359630:p.Asp737Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.D737Y	ENST00000370598.1	37	c.2209	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518267	0.85495	.	.	ENSG00000135298	ENST00000370598	T	0.12039	2.72	5.12	5.12	0.69794	Domain of unknown function DUF3497 (1);	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.02491	-1.1151	10	0.87932	D	0	.	18.9103	0.92481	0.0:0.0:1.0:0.0	.	737	O60242	BAI3_HUMAN	Y	737	ENSP00000359630:D737Y	ENSP00000359630:D737Y	D	+	1	0	BAI3	69814899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.547000	0.85894	0.655000	0.94253	GAT	BAI3	-	pfam_DUF3497,prints_GPCR_2_brain-spec_angio_inhib	ENSG00000135298		0.393	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	110	0.00	0	G			69758178	69758178	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	missense	140	23.08	42	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32836514	32836514	+	Splice_Site	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:32836514G>T	ENST00000421745.2	+	73	14393		c.e73-1			NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6						apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TTTTTCTCAAGGTAATACACA	0.343																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													75.0	72.0	73.0					2																	32836514		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.14260-1G>T	2.37:g.32836514G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULD1	Splice_Site	SNP	-	e73-1	ENST00000421745.2	37	c.14260-1	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	19.42	3.825088	0.71143	.	.	ENSG00000115760	ENST00000421745	.	.	.	4.76	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.794	0.88564	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BIRC6	32690018	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	9.776000	0.99001	2.172000	0.68678	0.555000	0.69702	.	BIRC6	-	-	ENSG00000115760		0.343	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	107	0.00	0	G	NM_016252	Intron	32836514	32836514	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	splice_site	312	14.05	51	SNP	1.000	T
CACNA1B	774	genome.wustl.edu	37	9	140846819	140846819	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr9:140846819G>A	ENST00000371372.1	+	7	1205	c.1060G>A	c.(1060-1062)Gtg>Atg	p.V354M	CACNA1B_ENST00000371363.1_Missense_Mutation_p.V354M|CACNA1B_ENST00000277551.2_Missense_Mutation_p.V354M|CACNA1B_ENST00000371355.4_Missense_Mutation_p.V354M|CACNA1B_ENST00000371357.1_Missense_Mutation_p.V354M|CACNA1B_ENST00000277549.5_5'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	354					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTGCTGGGCGTGCTCTCGGG	0.602																																						dbGAP											0													87.0	92.0	90.0					9																	140846819		2153	4261	6414	-	-	-	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1060G>A	9.37:g.140846819G>A	ENSP00000360423:p.Val354Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.V354M	ENST00000371372.1	37	c.1060	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544165	0.65198	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.98987	-5.3;-5.3;-5.3;-5.3;-5.3	5.67	5.67	0.87782	.	0.137998	0.49305	D	0.000152	D	0.99729	0.9894	H	0.99783	4.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96907	0.9664	10	0.87932	D	0	.	19.4093	0.94662	0.0:0.0:1.0:0.0	.	354	B1AQK6	.	M	354	ENSP00000360423:V354M;ENSP00000277551:V354M;ENSP00000360414:V354M;ENSP00000360408:V354M;ENSP00000360406:V354M	ENSP00000277551:V354M	V	+	1	0	CACNA1B	139966640	1.000000	0.71417	0.996000	0.52242	0.175000	0.22909	9.158000	0.94723	2.699000	0.92147	0.579000	0.79373	GTG	CACNA1B	-	pfam_Ion_trans_dom	ENSG00000148408		0.602	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	34	0.00	0	G	NM_000718		140846819	140846819	+1	no_errors	ENST00000371355	ensembl	human	known	69_37n	missense	40	20.00	10	SNP	1.000	A
CAMKV	79012	genome.wustl.edu	37	3	49899764	49899764	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr3:49899764C>G	ENST00000477224.1	-	2	536	c.58G>C	c.(58-60)Gtg>Ctg	p.V20L	CAMKV_ENST00000498324.1_5'UTR|CAMKV_ENST00000466940.1_Missense_Mutation_p.V20L|CAMKV_ENST00000463537.1_Missense_Mutation_p.V20L|CAMKV_ENST00000467248.1_Splice_Site|RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000488336.1_Missense_Mutation_p.V20L|CAMKV_ENST00000296471.7_Missense_Mutation_p.V20L			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	20						cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CTGTCAGTCACCTCCGATGGC	0.577																																						dbGAP											0													145.0	126.0	132.0					3																	49899764		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.58G>C	3.37:g.49899764C>G	ENSP00000419195:p.Val20Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Splice_Site	SNP	-	e0+1	ENST00000477224.1	37	c.1+1	CCDS33762.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.87|15.87	2.961587|2.961587	0.53400|0.53400	.|.	.|.	ENSG00000164076|ENSG00000164076	ENST00000480398|ENST00000296471;ENST00000488336;ENST00000463537;ENST00000477224;ENST00000466940	.|T;T;T;T;T	.|0.38077	.|2.86;2.86;1.16;2.86;2.86	4.89|4.89	4.89|4.89	0.63831|0.63831	.|Protein kinase-like domain (1);	.|0.000000	.|0.38436	.|N	.|0.001684	.|T	.|0.40719	.|0.1128	L|L	0.37850|0.37850	1.14|1.14	0.58432|0.58432	D|D	0.999992|0.999992	.|P;P;P;P	.|0.52463	.|0.842;0.949;0.953;0.741	.|B;P;B;B	.|0.49192	.|0.173;0.602;0.426;0.178	.|T	.|0.38329	.|-0.9666	.|10	.|0.72032	.|D	.|0.01	.|.	18.0036|18.0036	0.89203|0.89203	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|20;20;20;20	.|E7ETR1;Q8NCB2-2;Q8NCB2-3;Q8NCB2	.|.;.;.;CAMKV_HUMAN	.|L	-1|20	.|ENSP00000296471:V20L;ENSP00000418809:V20L;ENSP00000417614:V20L;ENSP00000419195:V20L;ENSP00000420724:V20L	.|ENSP00000296471:V20L	.|V	-|-	.|1	.|0	CAMKV|CAMKV	49874768|49874768	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	5.447000|5.447000	0.66606|0.66606	2.430000|2.430000	0.82344|0.82344	0.561000|0.561000	0.74099|0.74099	.|GTG	CAMKV	-	-	ENSG00000164076		0.577	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKV	HGNC	protein_coding	OTTHUMT00000350584.4	22	0.00	0	C	NM_024046		49899764	49899764	-1	no_errors	ENST00000467248	ensembl	human	putative	69_37n	splice_site	26	35.00	14	SNP	1.000	G
CAPN2	824	genome.wustl.edu	37	1	223940644	223940644	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:223940644G>A	ENST00000295006.5	+	9	1430	c.1121G>A	c.(1120-1122)tGc>tAc	p.C374Y	CAPN2_ENST00000433674.2_Missense_Mutation_p.C296Y	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	374	Domain III.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		GCGGGAGGTTGCAGGAACTAC	0.572																																						dbGAP											0													84.0	93.0	90.0					1																	223940644		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.1121G>A	1.37:g.223940644G>A	ENSP00000295006:p.Cys374Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat	p.C374Y	ENST00000295006.5	37	c.1121	CCDS31035.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493387	0.84962	.	.	ENSG00000162909	ENST00000433674;ENST00000295006;ENST00000366869	D;D	0.90197	-2.63;-2.63	5.3	5.3	0.74995	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.000000	0.85682	D	0.000000	D	0.97228	0.9094	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98306	1.0521	10	0.87932	D	0	.	19.3177	0.94223	0.0:0.0:1.0:0.0	.	296;374	B7ZA96;P17655	.;CAN2_HUMAN	Y	296;374;403	ENSP00000413158:C296Y;ENSP00000295006:C374Y	ENSP00000295006:C374Y	C	+	2	0	CAPN2	222007267	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	9.706000	0.98722	2.640000	0.89533	0.561000	0.74099	TGC	CAPN2	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Calpain_III,prints_Calpain_cysteine_protease	ENSG00000162909		0.572	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN2	HGNC	protein_coding	OTTHUMT00000090973.1	39	0.00	0	G	NM_001748		223940644	223940644	+1	no_errors	ENST00000295006	ensembl	human	known	69_37n	missense	40	23.08	12	SNP	1.000	A
CAPN2	824	genome.wustl.edu	37	1	223959610	223959610	+	Missense_Mutation	SNP	G	G	A	rs550161035		TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:223959610G>A	ENST00000295006.5	+	19	2312	c.2003G>A	c.(2002-2004)cGg>cAg	p.R668Q	CAPN2_ENST00000433674.2_Missense_Mutation_p.R590Q|CAPN2_ENST00000474026.1_3'UTR	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	668	Domain IV.|EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TGTTTGGTTCGGCTGGAAACG	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		21424	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													236.0	216.0	223.0					1																	223959610		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.2003G>A	1.37:g.223959610G>A	ENSP00000295006:p.Arg668Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat	p.R668Q	ENST00000295006.5	37	c.2003	CCDS31035.1	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983012	0.93044	.	.	ENSG00000162909	ENST00000433674;ENST00000295006;ENST00000366869	T;T	0.32753	1.44;1.44	5.63	5.63	0.86233	EF-hand-like domain (1);	0.059111	0.64402	D	0.000003	T	0.64746	0.2626	M	0.90650	3.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	T	0.71388	-0.4608	10	0.66056	D	0.02	.	17.8718	0.88813	0.0:0.0:1.0:0.0	.	590;251;668	B7ZA96;B3KUH9;P17655	.;.;CAN2_HUMAN	Q	590;668;697	ENSP00000413158:R590Q;ENSP00000295006:R668Q	ENSP00000295006:R668Q	R	+	2	0	CAPN2	222026233	1.000000	0.71417	0.775000	0.31657	0.868000	0.49771	4.049000	0.57397	2.654000	0.90174	0.561000	0.74099	CGG	CAPN2	-	NULL	ENSG00000162909		0.438	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN2	HGNC	protein_coding	OTTHUMT00000090973.1	189	0.00	0	G	NM_001748		223959610	223959610	+1	no_errors	ENST00000295006	ensembl	human	known	69_37n	missense	361	40.62	247	SNP	0.994	A
CCDC87	55231	genome.wustl.edu	37	11	66358013	66358013	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr11:66358013C>T	ENST00000333861.3	-	1	2541	c.2474G>A	c.(2473-2475)cGg>cAg	p.R825Q	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	825					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GTGGCGAACCCGCCGCTGCTG	0.557																																						dbGAP											0													163.0	174.0	171.0					11																	66358013		2200	4295	6495	-	-	-	SO:0001583	missense	0			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.2474G>A	11.37:g.66358013C>T	ENSP00000328487:p.Arg825Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NE76	Missense_Mutation	SNP	pfam_Microtubule-assoc_MAP65_ASE1	p.R825Q	ENST00000333861.3	37	c.2474	CCDS8145.1	11	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194753	0.78902	.	.	ENSG00000182791	ENST00000333861	T	0.31769	1.48	5.5	5.5	0.81552	.	0.000000	0.38272	N	0.001757	T	0.57213	0.2038	M	0.77103	2.36	0.33979	D	0.647712	D	0.89917	1.0	D	0.91635	0.999	T	0.70923	-0.4740	10	0.87932	D	0	.	14.8917	0.70614	0.0:1.0:0.0:0.0	.	825	Q9NVE4	CCD87_HUMAN	Q	825	ENSP00000328487:R825Q	ENSP00000328487:R825Q	R	-	2	0	CCDC87	66114589	0.981000	0.34729	0.910000	0.35882	0.612000	0.37316	4.508000	0.60441	2.591000	0.87537	0.491000	0.48974	CGG	CCDC87	-	pfam_Microtubule-assoc_MAP65_ASE1	ENSG00000182791		0.557	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	HGNC	protein_coding	OTTHUMT00000393825.1	36	0.00	0	C	NM_018219		66358013	66358013	-1	no_errors	ENST00000333861	ensembl	human	known	69_37n	missense	65	17.72	14	SNP	0.614	T
CD226	10666	genome.wustl.edu	37	18	67614147	67614147	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr18:67614147T>C	ENST00000280200.4	-	3	473	c.205A>G	c.(205-207)Atg>Gtg	p.M69V	CD226_ENST00000577287.1_Intron|CD226_ENST00000581982.1_Intron|CD226_ENST00000582621.1_Missense_Mutation_p.M69V	NM_006566.2	NP_006557.2	Q15762	CD226_HUMAN	CD226 molecule	69	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)|cytokine production (GO:0001816)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	24		Esophageal squamous(42;0.129)				CTTATGACCATGCCATGAGTA	0.448																																					NSCLC(184;838 2130 8673 21498 50749)	dbGAP											0													104.0	86.0	92.0					18																	67614147		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56102	CCDS11997.1	18q22.3	2013-01-11	2006-03-28		ENSG00000150637	ENSG00000150637		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	16961	protein-coding gene	gene with protein product		605397	"""CD226 antigen"""			8673704	Standard	NM_006566		Approved	DNAM-1, DNAM1, PTA1, TLiSA1	uc002lkm.4	Q15762	OTTHUMG00000132809	ENST00000280200.4:c.205A>G	18.37:g.67614147T>C	ENSP00000280200:p.Met69Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R818	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.M69V	ENST00000280200.4	37	c.205	CCDS11997.1	18	.	.	.	.	.	.	.	.	.	.	T	0.158	-1.084425	0.01888	.	.	ENSG00000150637	ENST00000280200	T	0.64438	-0.1	5.51	-2.19	0.07015	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.330610	0.04407	N	0.365362	T	0.29684	0.0741	N	0.03000	-0.44	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33317	-0.9873	10	0.02654	T	1	.	5.246	0.15496	0.1461:0.3319:0.0:0.5221	.	69	Q15762	CD226_HUMAN	V	69	ENSP00000280200:M69V	ENSP00000280200:M69V	M	-	1	0	CD226	65765127	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.945000	0.03909	-0.367000	0.08052	-0.177000	0.13119	ATG	CD226	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000150637		0.448	CD226-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD226	HGNC	protein_coding	OTTHUMT00000256226.3	159	0.00	0	T	NM_006566		67614147	67614147	-1	no_errors	ENST00000280200	ensembl	human	known	69_37n	missense	212	26.13	75	SNP	0.000	C
CDC25B	994	genome.wustl.edu	37	20	3785499	3785499	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr20:3785499T>C	ENST00000245960.5	+	16	2331	c.1634T>C	c.(1633-1635)aTg>aCg	p.M545T	CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000344256.6_Missense_Mutation_p.M481T|CDC25B_ENST00000379598.5_Missense_Mutation_p.M454T|CDC25B_ENST00000340833.4_Missense_Mutation_p.M504T|CDC25B_ENST00000439880.2_Missense_Mutation_p.M531T	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	545					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						TACCGGCCCATGAACCACGAG	0.622																																						dbGAP											0													93.0	89.0	90.0					20																	3785499		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1634T>C	20.37:g.3785499T>C	ENSP00000245960:p.Met545Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.M545T	ENST00000245960.5	37	c.1634	CCDS13067.1	20	.	.	.	.	.	.	.	.	.	.	T	20.2	3.950205	0.73787	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	5.2	5.2	0.72013	Rhodanese-like (2);	0.000000	0.85682	D	0.000000	T	0.62134	0.2403	M	0.90019	3.08	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0;1.0;0.999	D;D;D;D;D;D;D	0.91635	0.997;0.997;0.997;0.997;0.999;0.999;0.991	T	0.70761	-0.4784	10	0.87932	D	0	-8.822	13.3367	0.60522	0.0:0.0:0.0:1.0	.	454;467;481;433;504;531;545	B4DQZ3;B4DRC3;B4DIG0;B3KS38;P30305-3;P30305-2;P30305	.;.;.;.;.;.;MPIP2_HUMAN	T	481;454;545;531;504	ENSP00000339125:M481T;ENSP00000368918:M454T;ENSP00000245960:M545T;ENSP00000405972:M531T;ENSP00000339170:M504T	ENSP00000245960:M545T	M	+	2	0	CDC25B	3733499	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.157000	0.77461	2.086000	0.62901	0.460000	0.39030	ATG	CDC25B	-	superfamily_Rhodanese-like_dom,prints_MPI_Phosphatase	ENSG00000101224		0.622	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25B	HGNC	protein_coding	OTTHUMT00000077779.2	28	0.00	0	T	NM_021874		3785499	3785499	+1	no_errors	ENST00000245960	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	1.000	C
CEP89	84902	genome.wustl.edu	37	19	33390801	33390801	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:33390801C>T	ENST00000305768.5	-	16	1925	c.1837G>A	c.(1837-1839)Gaa>Aaa	p.E613K		NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	613					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						GTTATGTTTTCTGCCAGGCCA	0.408																																						dbGAP											0													152.0	130.0	137.0					19																	33390801		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.1837G>A	19.37:g.33390801C>T	ENSP00000306105:p.Glu613Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGA6|Q8N5J8	Missense_Mutation	SNP	NULL	p.E613K	ENST00000305768.5	37	c.1837	CCDS32987.1	19	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195979	0.38806	.	.	ENSG00000121289	ENST00000305768	D	0.89050	-2.46	5.0	3.95	0.45737	.	0.150663	0.64402	D	0.000015	D	0.87180	0.6113	M	0.66939	2.045	0.80722	D	1	B	0.15473	0.013	B	0.21360	0.034	D	0.84310	0.0510	10	0.36615	T	0.2	-23.3872	13.9718	0.64245	0.0:0.9214:0.0:0.0786	.	613	Q96ST8	CEP89_HUMAN	K	613	ENSP00000306105:E613K	ENSP00000306105:E613K	E	-	1	0	CEP89	38082641	1.000000	0.71417	0.998000	0.56505	0.204000	0.24138	3.984000	0.56923	2.454000	0.82982	0.563000	0.77884	GAA	CEP89	-	NULL	ENSG00000121289		0.408	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	101	0.00	0	C	NM_032816		33390801	33390801	-1	no_errors	ENST00000305768	ensembl	human	known	69_37n	missense	269	18.48	61	SNP	1.000	T
FNTB	2342	genome.wustl.edu	37	14	65520040	65520041	+	Frame_Shift_Ins	INS	-	-	G	rs374785351|rs149471226	byFrequency	TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr14:65520040_65520041insG	ENST00000246166.2	+	10	1274_1275	c.1040_1041insG	c.(1039-1044)gcggggfs	p.AG347fs	FNTB_ENST00000447296.2_Frame_Shift_Ins_p.AG381fs|FNTB_ENST00000542227.1_Frame_Shift_Ins_p.AG301fs|MAX_ENST00000341653.2_Intron|CHURC1-FNTB_ENST00000549987.1_Frame_Shift_Ins_p.AG382fs	NM_002028.3	NP_002019.1	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	347					negative regulation of cell proliferation (GO:0008285)|phototransduction, visible light (GO:0007603)|positive regulation of cell cycle (GO:0045787)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|protein farnesylation (GO:0018343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to cytokine (GO:0034097)|response to inorganic substance (GO:0010035)|response to organic cyclic compound (GO:0014070)|rhodopsin mediated signaling pathway (GO:0016056)|wound healing (GO:0042060)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	farnesyltranstransferase activity (GO:0004311)|protein farnesyltransferase activity (GO:0004660)|zinc ion binding (GO:0008270)	p.A347A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CAGTGCCCTGCGGGGGGGCTTC	0.599																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS9769.1	14q23.3	2011-09-28			ENSG00000257365	ENSG00000257365			3785	protein-coding gene	gene with protein product		134636				8276393	Standard	NM_002028		Approved	FPTB		P49356	OTTHUMG00000142811	ENST00000246166.2:c.1047dupG	14.37:g.65520047_65520047dupG	ENSP00000246166:p.Ala347fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDX6|B4E1A0	Frame_Shift_Ins	INS	pfam_Prenyltrans,pfam_Transcrpt_activator_Churchill,superfamily_Terpenoid_cyclase/PrenylTrfase	p.L384fs	ENST00000246166.2	37	c.1142_1143	CCDS9769.1	14																																																																																			CHURC1-FNTB	-	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000125954		0.599	FNTB-001	KNOWN	basic|CCDS	protein_coding	CHURC1-FNTB	HGNC	protein_coding	OTTHUMT00000286392.1	31	0.00	0	-	NM_002028		65520040	65520041	+1	no_errors	ENST00000447296	ensembl	human	known	69_37n	frame_shift_ins	29	14.71	5	INS	0.207:0.000	G
CSMD3	114788	genome.wustl.edu	37	8	113358357	113358357	+	Silent	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr8:113358357G>A	ENST00000297405.5	-	41	6655	c.6411C>T	c.(6409-6411)tgC>tgT	p.C2137C	CSMD3_ENST00000352409.3_Silent_p.C2067C|CSMD3_ENST00000455883.2_Silent_p.C2033C|CSMD3_ENST00000343508.3_Silent_p.C2097C	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2137	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTGTCCATGTGCAATCTAAAC	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													111.0	114.0	113.0					8																	113358357		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6411C>T	8.37:g.113358357G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.C2137	ENST00000297405.5	37	c.6411	CCDS6315.1	8																																																																																			CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	102	0.00	0	G	NM_052900		113358357	113358357	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	silent	226	16.30	44	SNP	1.000	A
CYB5R2	51700	genome.wustl.edu	37	11	7687778	7687778	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr11:7687778C>T	ENST00000533558.1	-	8	1118	c.562G>A	c.(562-564)Gag>Aag	p.E188K	CYB5R2_ENST00000524790.1_Missense_Mutation_p.E188K|CYB5R2_ENST00000528585.1_Intron|CYB5R2_ENST00000299498.6_Missense_Mutation_p.E188K|CYB5R2_ENST00000299497.9_Missense_Mutation_p.E188K			Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase 2	188					oxidation-reduction process (GO:0055114)|sterol biosynthetic process (GO:0016126)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATATCCTCCTCTGTCTAGAAA	0.522											OREG0020724	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													106.0	102.0	104.0					11																	7687778		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF169802	CCDS7780.1	11p15.4	2014-08-12			ENSG00000166394	ENSG00000166394	1.6.2.2		24376	protein-coding gene	gene with protein product		608342				10611283	Standard	XM_005252973		Approved		uc001mfm.3	Q6BCY4	OTTHUMG00000165665	ENST00000533558.1:c.562G>A	11.37:g.7687778C>T	ENSP00000437041:p.Glu188Lys	Somatic	643	WXS	Illumina GAIIx	Phase_IV	Q9BVA3|Q9UF68|Q9UHJ0	Missense_Mutation	SNP	pfam_OxRdtase_FAD-bd_dom,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	p.E188K	ENST00000533558.1	37	c.562	CCDS7780.1	11	.	.	.	.	.	.	.	.	.	.	C	23.7	4.452687	0.84209	.	.	ENSG00000166394	ENST00000524790;ENST00000299498;ENST00000533558;ENST00000299497	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.59	4.68	0.58851	Oxidoreductase FAD/NAD(P)-binding (1);	0.000000	0.85682	D	0.000000	D	0.92645	0.7663	M	0.84948	2.725	0.80722	D	1	P	0.49307	0.922	P	0.57468	0.821	D	0.93523	0.6863	10	0.72032	D	0.01	-19.9314	14.4311	0.67251	0.0:0.8517:0.1483:0.0	.	188	Q6BCY4	NB5R2_HUMAN	K	188	ENSP00000435916:E188K;ENSP00000299498:E188K;ENSP00000437041:E188K;ENSP00000299497:E188K	ENSP00000299497:E188K	E	-	1	0	CYB5R2	7644354	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	5.596000	0.67570	1.356000	0.45884	0.655000	0.94253	GAG	CYB5R2	-	pfam_OxRdtase_FAD/NAD-bd	ENSG00000166394		0.522	CYB5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R2	HGNC	protein_coding	OTTHUMT00000385679.1	25	0.00	0	C	NM_016229		7687778	7687778	-1	no_errors	ENST00000299498	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	T
DEFB4B	100289462	genome.wustl.edu	37	8	7272523	7272523	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr8:7272523G>C	ENST00000318157.2	-	2	190	c.155C>G	c.(154-156)aCc>aGc	p.T52S		NM_001205266.1	NP_001192195.1	O15263	DFB4A_HUMAN	defensin, beta 4B	52					chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)											GAGACCACAGGTGCCAATTTG	0.488																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55193.1	8p23.1	2011-03-29	2010-03-01	2010-03-01	ENSG00000177257	ENSG00000177257		"""Defensins, beta"""	30193	protein-coding gene	gene with protein product			"""defensin, beta 4, pseudogene"""	DEFB4P			Standard	NM_001205266		Approved		uc022arf.1	O15263	OTTHUMG00000143857	ENST00000318157.2:c.155C>G	8.37:g.7272523G>C	ENSP00000424598:p.Thr52Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LC0	Missense_Mutation	SNP	pfam_Defensin_beta-typ,smart_Defensin_beta/neutrophil	p.T52S	ENST00000318157.2	37	c.155	CCDS55193.1	8	.	.	.	.	.	.	.	.	.	.	G	5.557	0.287603	0.10513	.	.	ENSG00000177257	ENST00000318157	T	0.27890	1.64	1.95	-0.0523	0.13823	.	.	.	.	.	T	0.21062	0.0507	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25572	-1.0128	6	0.36615	T	0.2	.	2.8884	0.05668	0.1695:0.0:0.5706:0.26	.	.	.	.	S	52	ENSP00000424598:T52S	ENSP00000424598:T52S	T	-	2	0	DEFB4B	7259933	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.250000	0.08830	-0.054000	0.13266	-1.206000	0.01644	ACC	DEFB4B	-	pfam_Defensin_beta-typ,smart_Defensin_beta/neutrophil	ENSG00000177257		0.488	DEFB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB4B	HGNC	protein_coding	OTTHUMT00000290105.3	21	0.00	0	G			7272523	7272523	-1	no_errors	ENST00000318157	ensembl	human	known	69_37n	missense	9	60.87	14	SNP	0.001	C
DLGAP3	58512	genome.wustl.edu	37	1	35350653	35350653	+	Silent	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:35350653G>T	ENST00000373347.1	-	8	2194	c.1926C>A	c.(1924-1926)atC>atA	p.I642I	DLGAP3_ENST00000235180.4_Silent_p.I642I			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	642					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CCGAATCTGAGATCGTCTCCA	0.612																																						dbGAP											0													86.0	82.0	84.0					1																	35350653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1926C>A	1.37:g.35350653G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDD5|Q9H3X7	Silent	SNP	pfam_GKAP	p.I642	ENST00000373347.1	37	c.1926	CCDS30670.1	1																																																																																			DLGAP3	-	pfam_GKAP	ENSG00000116544		0.612	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	19	0.00	0	G	NM_021234		35350653	35350653	-1	no_errors	ENST00000235180	ensembl	human	known	69_37n	silent	9	52.63	10	SNP	1.000	T
DSG3	1830	genome.wustl.edu	37	18	29055687	29055687	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr18:29055687G>A	ENST00000257189.4	+	16	2547	c.2464G>A	c.(2464-2466)Gat>Aat	p.D822N		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	822					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGAAGGCGCAGATGCCACTGG	0.468																																						dbGAP											0													126.0	119.0	121.0					18																	29055687		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2464G>A	18.37:g.29055687G>A	ENSP00000257189:p.Asp822Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.D822N	ENST00000257189.4	37	c.2464	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600175	0.28534	.	.	ENSG00000134757	ENST00000257189	T	0.76186	-1.0	5.78	4.91	0.64330	Cadherin, cytoplasmic domain (1);	0.732736	0.12035	N	0.505637	T	0.67050	0.2852	N	0.22421	0.69	0.09310	N	1	B	0.30211	0.273	B	0.34824	0.19	T	0.62124	-0.6920	10	0.62326	D	0.03	.	14.6204	0.68579	0.0697:0.0:0.9303:0.0	.	822	P32926	DSG3_HUMAN	N	822	ENSP00000257189:D822N	ENSP00000257189:D822N	D	+	1	0	DSG3	27309685	0.895000	0.30542	0.003000	0.11579	0.095000	0.18619	5.404000	0.66344	1.453000	0.47775	0.655000	0.94253	GAT	DSG3	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000134757		0.468	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1	101	0.00	0	G	NM_001944		29055687	29055687	+1	no_errors	ENST00000257189	ensembl	human	known	69_37n	missense	66	60.71	102	SNP	0.025	A
ERCC6L	54821	genome.wustl.edu	37	X	71426034	71426034	+	Silent	SNP	A	A	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:71426034A>T	ENST00000334463.3	-	2	2718	c.2583T>A	c.(2581-2583)ccT>ccA	p.P861P	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Silent_p.P738P	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	861					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					AACTTTCCAGAGGATCCTCTT	0.373																																						dbGAP											0													74.0	69.0	70.0					X																	71426034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.2583T>A	X.37:g.71426034A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCI1|Q96H93|Q9NXQ8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_TPR-contain_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P861	ENST00000334463.3	37	c.2583	CCDS35329.1	X																																																																																			ERCC6L	-	NULL	ENSG00000186871		0.373	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6L	HGNC	protein_coding	OTTHUMT00000057174.2	246	0.00	0	A	NM_017669		71426034	71426034	-1	no_errors	ENST00000334463	ensembl	human	known	69_37n	silent	536	16.64	107	SNP	0.001	T
ERN1	2081	genome.wustl.edu	37	17	62137922	62137922	+	Silent	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr17:62137922C>T	ENST00000433197.3	-	11	1208	c.1113G>A	c.(1111-1113)gcG>gcA	p.A371A		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						TCTTGGTAGACGCAGACAGTG	0.448																																						dbGAP											0													141.0	136.0	138.0					17																	62137922		1949	4144	6093	-	-	-	SO:0001819	synonymous_variant	0			AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.1113G>A	17.37:g.62137922C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_KEN_RNase_activator,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_cat_dom	p.A371	ENST00000433197.3	37	c.1113	CCDS45762.1	17																																																																																			ERN1	-	NULL	ENSG00000178607		0.448	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN1	HGNC	protein_coding	OTTHUMT00000443734.2	80	0.00	0	C	NM_001433		62137922	62137922	-1	no_errors	ENST00000433197	ensembl	human	known	69_37n	silent	82	31.67	38	SNP	0.373	T
ESRP1	54845	genome.wustl.edu	37	8	95690588	95690588	+	Silent	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr8:95690588G>T	ENST00000433389.2	+	13	1999	c.1809G>T	c.(1807-1809)gcG>gcT	p.A603A	ESRP1_ENST00000358397.5_Silent_p.A599A|ESRP1_ENST00000454170.2_Silent_p.A603A|ESRP1_ENST00000423620.2_Silent_p.A599A	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	603					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						ATTACACAGCGTACTATCCCA	0.498																																						dbGAP											0													77.0	73.0	74.0					8																	95690588		2046	4206	6252	-	-	-	SO:0001819	synonymous_variant	0			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.1809G>T	8.37:g.95690588G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	smart_RRM_dom,pfscan_RRM_dom	p.V469L	ENST00000433389.2	37	c.1405	CCDS47897.1	8	.	.	.	.	.	.	.	.	.	.	G	7.018	0.558141	0.13436	.	.	ENSG00000104413	ENST00000519505	.	.	.	5.36	-10.7	0.00240	.	.	.	.	.	T	0.61375	0.2342	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79988	-0.1571	4	.	.	.	-13.3528	16.2416	0.82411	0.4506:0.1028:0.4466:0.0	.	.	.	.	L	469	.	.	V	+	1	0	ESRP1	95759764	0.000000	0.05858	0.060000	0.19600	0.974000	0.67602	-8.028000	0.00026	-4.444000	0.00048	-0.841000	0.03054	GTA	ESRP1	-	NULL	ENSG00000104413		0.498	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	65	0.00	0	G	NM_017697		95690588	95690588	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519505	ensembl	human	putative	69_37n	missense	173	16.02	33	SNP	0.002	T
FRMPD3	84443	genome.wustl.edu	37	X	106845785	106845785	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:106845785G>C	ENST00000276185.4	+	16	4615	c.4615G>C	c.(4615-4617)Gca>Cca	p.A1539P				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1539						cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						GTGTGACATGGCAGATGATGC	0.572																																						dbGAP											0													174.0	154.0	160.0					X																	106845785		876	1991	2867	-	-	-	SO:0001583	missense	0			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.4615G>C	X.37:g.106845785G>C	ENSP00000276185:p.Ala1539Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JK8	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.A1539P	ENST00000276185.4	37	c.4615		X	.	.	.	.	.	.	.	.	.	.	g	13.18	2.159978	0.38119	.	.	ENSG00000147234	ENST00000276185;ENST00000439554	T;T	0.20463	2.07;2.08	3.76	3.76	0.43208	.	0.231189	0.35207	U	0.003379	T	0.19644	0.0472	L	0.36672	1.1	0.25012	N	0.991399	.	.	.	.	.	.	T	0.08330	-1.0727	8	0.39692	T	0.17	.	8.0984	0.30842	0.1145:0.0:0.8855:0.0	.	.	.	.	P	1539;1487	ENSP00000276185:A1539P;ENSP00000398668:A1487P	ENSP00000276185:A1539P	A	+	1	0	FRMPD3	106732441	1.000000	0.71417	0.927000	0.36925	0.925000	0.55904	7.240000	0.78192	1.718000	0.51419	0.431000	0.28591	GCA	FRMPD3	-	NULL	ENSG00000147234		0.572	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	HGNC	protein_coding		101	0.00	0	G	XM_042978		106845785	106845785	+1	no_errors	ENST00000276185	ensembl	human	known	69_37n	missense	104	11.11	13	SNP	0.971	C
GABRQ	55879	genome.wustl.edu	37	X	151815455	151815455	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:151815455G>A	ENST00000370306.2	+	4	373	c.353G>A	c.(352-354)cGc>cAc	p.R118H		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	118					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAAGATTCACGCTTAGCATAC	0.458																																						dbGAP											0													275.0	208.0	231.0					X																	151815455		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.353G>A	X.37:g.151815455G>A	ENSP00000359329:p.Arg118His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAt_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABAAb_rcpt,prints_GABAAa_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R118H	ENST00000370306.2	37	c.353	CCDS14707.1	X	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478704	0.84747	.	.	ENSG00000147402	ENST00000370306	D	0.82081	-1.57	5.51	5.51	0.81932	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.44688	D	0.000426	D	0.94115	0.8113	H	0.96662	3.86	0.49687	D	0.999811	D	0.89917	1.0	D	0.81914	0.995	D	0.95922	0.8931	10	0.87932	D	0	.	15.7039	0.77563	0.0:0.0:1.0:0.0	.	118	Q9UN88	GBRT_HUMAN	H	118	ENSP00000359329:R118H	ENSP00000359329:R118H	R	+	2	0	GABRQ	151566111	1.000000	0.71417	0.564000	0.28396	0.515000	0.34225	9.869000	0.99810	2.305000	0.77605	0.544000	0.68410	CGC	GABRQ	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,prints_GABAAb_rcpt,tigrfam_Neur_channel	ENSG00000147402		0.458	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRQ	HGNC	protein_coding	OTTHUMT00000058763.2	119	0.00	0	G	NM_018558		151815455	151815455	+1	no_errors	ENST00000370306	ensembl	human	known	69_37n	missense	284	15.48	52	SNP	1.000	A
GLDC	2731	genome.wustl.edu	37	9	6588676	6588676	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr9:6588676C>T	ENST00000321612.6	-	13	1757	c.1607G>A	c.(1606-1608)cGg>cAg	p.R536Q		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	536					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)	p.R536L(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	CTTCATGTACCGGACAATGTT	0.413																																						dbGAP											1	Substitution - Missense(1)	lung(1)											131.0	112.0	119.0					9																	6588676		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1607G>A	9.37:g.6588676C>T	ENSP00000370737:p.Arg536Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2F8	Missense_Mutation	SNP	pfam_GDC-P_N,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	p.R536Q	ENST00000321612.6	37	c.1607	CCDS34987.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.838303	0.97009	.	.	ENSG00000178445	ENST00000321612	D	0.98221	-4.8	5.8	5.8	0.92144	Pyridoxal phosphate-dependent transferase, major domain (1);	0.111691	0.56097	D	0.000028	D	0.99105	0.9692	M	0.93594	3.435	0.80722	D	1	D	0.69078	0.997	P	0.57502	0.822	D	0.99470	1.0945	10	0.87932	D	0	-18.519	20.0563	0.97651	0.0:1.0:0.0:0.0	.	536	P23378	GCSP_HUMAN	Q	536	ENSP00000370737:R536Q	ENSP00000370737:R536Q	R	-	2	0	GLDC	6578676	1.000000	0.71417	0.997000	0.53966	0.854000	0.48673	7.270000	0.78493	2.746000	0.94184	0.563000	0.77884	CGG	GLDC	-	pfam_GDC-P_N,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	ENSG00000178445		0.413	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	HGNC	protein_coding	OTTHUMT00000051674.2	72	0.00	0	C	NM_000170		6588676	6588676	-1	no_errors	ENST00000321612	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	1.000	T
GPR6	2830	genome.wustl.edu	37	6	110301379	110301379	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr6:110301379G>A	ENST00000275169.3	+	1	1082	c.1064G>A	c.(1063-1065)cGt>cAt	p.R355H	GPR6_ENST00000414000.2_Missense_Mutation_p.R370H	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	355					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		GTGCCCTTTCGTTCCAGGTCT	0.592																																						dbGAP											0													99.0	103.0	102.0					6																	110301379		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.1064G>A	6.37:g.110301379G>A	ENSP00000275169:p.Arg355His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPR6_rcpt,prints_GPR_orph_rcpt,prints_7TM_GPCR_Rhodpsn	p.R370H	ENST00000275169.3	37	c.1109	CCDS5079.1	6	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294987	0.81025	.	.	ENSG00000146360	ENST00000428489;ENST00000414000;ENST00000275169	T;T	0.37915	1.17;1.17	4.93	4.93	0.64822	.	0.138709	0.49916	D	0.000132	T	0.45677	0.1354	L	0.55990	1.75	0.80722	D	1	D;D	0.76494	0.999;0.998	P;P	0.60117	0.813;0.869	T	0.47195	-0.9136	10	0.87932	D	0	.	18.3227	0.90244	0.0:0.0:1.0:0.0	.	370;355	B4DHS9;P46095	.;GPR6_HUMAN	H	333;370;355	ENSP00000406986:R370H;ENSP00000275169:R355H	ENSP00000275169:R355H	R	+	2	0	GPR6	110408072	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	9.657000	0.98554	2.560000	0.86352	0.655000	0.94253	CGT	GPR6	-	NULL	ENSG00000146360		0.592	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR6	HGNC	protein_coding	OTTHUMT00000041774.1	62	0.00	0	G			110301379	110301379	+1	no_errors	ENST00000414000	ensembl	human	known	69_37n	missense	37	36.21	21	SNP	1.000	A
GPRASP2	114928	genome.wustl.edu	37	X	101970846	101970847	+	Nonsense_Mutation	DNP	TC	TC	AA			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T|C	T|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:101970846_101970847TC>AA	ENST00000535209.1	+	4	1880_1881	c.1049_1050TC>AA	c.(1048-1050)tTC>tAA	p.F350*	GPRASP2_ENST00000543253.1_Nonsense_Mutation_p.F350*|GPRASP2_ENST00000332262.5_Nonsense_Mutation_p.F350*			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	350						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AATAGTAGATTCAGGCACAGAG	0.441																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	Exception_encountered	X.37:g.101970846_101970847delinsAA	ENSP00000437394:p.Phe350*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.F350Y|p.F350L	ENST00000535209.1	37	c.1049|c.1050	CCDS14501.1	X																																																																																			GPRASP2	-	NULL	ENSG00000158301		0.441	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	197|194	0.00	0	T|C	NM_138437		101970846|101970847	101970846|101970847	+1	no_errors	ENST00000332262	ensembl	human	known	69_37n	missense	165|167	33.47|33.20	83	SNP	0.181|0.038	A
GTF2IRD2	84163	genome.wustl.edu	37	7	74237282	74237282	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr7:74237282G>A	ENST00000405086.2	-	5	601	c.412C>T	c.(412-414)Cga>Tga	p.R138*	GTF2IRD2_ENST00000361071.5_Nonsense_Mutation_p.R138*|GTF2IRD2_ENST00000453619.2_Nonsense_Mutation_p.R138*	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						GACTGGTCTCGCAGCATCTTC	0.502																																					NSCLC(40;560 1096 7501 40315 49546)	dbGAP											0													16.0	16.0	16.0					7																	74237282		1457	3113	4570	-	-	-	SO:0001587	stop_gained	0			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.412C>T	7.37:g.74237282G>A	ENSP00000385491:p.Arg138*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Nonsense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,superfamily_RNaseH-like_dom,pfscan_GTF2I	p.R138*	ENST00000405086.2	37	c.412	CCDS5576.1	7	.	.	.	.	.	.	.	.	.	.	G	16.70	3.194829	0.58017	.	.	ENSG00000196275	ENST00000405086;ENST00000361071;ENST00000453619	.	.	.	2.67	0.259	0.15583	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.357	8.7221	0.34447	0.0:0.0:0.5739:0.4261	.	.	.	.	X	138	.	ENSP00000354362:R138X	R	-	1	2	GTF2IRD2	73875218	0.001000	0.12720	0.020000	0.16555	0.443000	0.32047	1.035000	0.30216	-0.092000	0.12417	0.393000	0.25936	CGA	GTF2IRD2	-	pfam_GTF2I,superfamily_GTF2I,pfscan_GTF2I	ENSG00000196275		0.502	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2	HGNC	protein_coding	OTTHUMT00000252712.3	29	0.00	0	G	NM_173537		74237282	74237282	-1	no_errors	ENST00000405086	ensembl	human	known	69_37n	nonsense	58	22.67	17	SNP	0.232	A
HERC2P2	400322	genome.wustl.edu	37	15	23330887	23330887	+	RNA	SNP	C	C	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr15:23330887C>A	ENST00000560464.1	-	0	1122									hect domain and RLD 2 pseudogene 2																		CCTAGCTCACCTTCACGTTGT	0.517																																						dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23330887C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.517	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	18	0.00	0	C			23330887	23330887	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	18	21.74	5	SNP	1.000	A
HSD17B7P2	158160	genome.wustl.edu	37	10	38651187	38651187	+	RNA	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr10:38651187G>C	ENST00000494540.1	+	0	334					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		TCAGAGATTAGACCGTATATA	0.358																																						dbGAP											0																																										-	-	-			0					10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38651187G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000494540.1	37	NULL		10																																																																																			HSD17B7P2	-	-	ENSG00000099251		0.358	HSD17B7P2-001	KNOWN	basic	processed_transcript	HSD17B7P2	HGNC	pseudogene	OTTHUMT00000047631.2	72	0.00	0	G	NR_003086		38651187	38651187	+1	no_errors	ENST00000494540	ensembl	human	known	69_37n	rna	85	64.29	153	SNP	1.000	C
INPP5B	3633	genome.wustl.edu	37	1	38341331	38341331	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:38341331G>C	ENST00000373026.1	-	16	1975	c.1975C>G	c.(1975-1977)Ctg>Gtg	p.L659V	INPP5B_ENST00000373027.1_Missense_Mutation_p.L415V|INPP5B_ENST00000458109.2_3'UTR|INPP5B_ENST00000373024.3_Missense_Mutation_p.L579V|INPP5B_ENST00000373023.2_Missense_Mutation_p.L659V			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	659	5-phosphatase. {ECO:0000250}.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ATCTTATCCAGGGAGCGAACA	0.498																																						dbGAP											0													121.0	124.0	123.0					1																	38341331		1959	4157	6116	-	-	-	SO:0001583	missense	0			M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.1975C>G	1.37:g.38341331G>C	ENSP00000362117:p.Leu659Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L659V	ENST00000373026.1	37	c.1975		1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635353	0.67130	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024	D;D;D;D	0.95307	-3.67;-3.67;-3.67;-3.67	5.39	3.53	0.40419	Endonuclease/exonuclease/phosphatase (1);	0.061339	0.64402	D	0.000005	D	0.94905	0.8353	M	0.72479	2.2	0.80722	D	1	D;D	0.59357	0.985;0.982	P;P	0.53518	0.685;0.728	D	0.93703	0.7017	10	0.56958	D	0.05	.	10.2045	0.43105	0.2138:0.0:0.7862:0.0	.	659;579	P32019;P32019-2	I5P2_HUMAN;.	V	415;659;659;659;579	ENSP00000362118:L415V;ENSP00000362114:L659V;ENSP00000362117:L659V;ENSP00000362115:L579V	ENSP00000362114:L659V	L	-	1	2	INPP5B	38113918	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.346000	0.33964	0.785000	0.33685	-0.136000	0.14681	CTG	INPP5B	-	superfamily_Endo/exonuclease/phosphatase	ENSG00000204084		0.498	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	HGNC	protein_coding	OTTHUMT00000012968.1	25	0.00	0	G	NM_005540		38341331	38341331	-1	no_errors	ENST00000373023	ensembl	human	known	69_37n	missense	42	17.31	9	SNP	1.000	C
HSD3B2	3284	genome.wustl.edu	37	1	119962135	119962135	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:119962135C>G	ENST00000543831.1	+	3	486	c.237C>G	c.(235-237)atC>atG	p.I79M	HSD3B2_ENST00000369416.3_Missense_Mutation_p.I79M|HSD3B2_ENST00000471656.1_3'UTR	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	79					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	CGGTCGTCATCCACACCGCCT	0.488																																						dbGAP											0													117.0	93.0	101.0					1																	119962135		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.237C>G	1.37:g.119962135C>G	ENSP00000445122:p.Ile79Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	p.I79M	ENST00000543831.1	37	c.237	CCDS902.1	1	.	.	.	.	.	.	.	.	.	.	-	16.24	3.068223	0.55539	.	.	ENSG00000203859	ENST00000543831;ENST00000433745;ENST00000369416	D;D;D	0.90955	-2.76;-2.76;-2.76	3.93	-6.44	0.01920	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.054705	0.64402	D	0.000001	D	0.93890	0.8045	H	0.96398	3.815	0.33078	D	0.536211	P;D	0.89917	0.762;1.0	B;D	0.85130	0.445;0.997	D	0.91451	0.5181	9	.	.	.	-10.8888	9.6131	0.39674	0.0:0.7331:0.1096:0.1573	.	79;79	P26439-2;P26439	.;3BHS2_HUMAN	M	79	ENSP00000445122:I79M;ENSP00000388292:I79M;ENSP00000358424:I79M	.	I	+	3	3	HSD3B2	119763658	0.465000	0.25815	0.889000	0.34880	0.056000	0.15407	-0.323000	0.07997	-1.216000	0.02607	0.298000	0.19748	ATC	HSD3B2	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	ENSG00000203859		0.488	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	HGNC	protein_coding	OTTHUMT00000034994.1	61	0.00	0	C	NM_000198		119962135	119962135	+1	no_errors	ENST00000369416	ensembl	human	known	69_37n	missense	147	22.22	42	SNP	0.946	G
ITGA4	3676	genome.wustl.edu	37	2	182386929	182386929	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:182386929A>G	ENST00000397033.2	+	18	2364	c.1934A>G	c.(1933-1935)aAt>aGt	p.N645S		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	645					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	CCCCATGAAAATAAAACATAT	0.303																																						dbGAP											0													102.0	92.0	95.0					2																	182386929		1814	4080	5894	-	-	-	SO:0001583	missense	0				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1934A>G	2.37:g.182386929A>G	ENSP00000380227:p.Asn645Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.N645S	ENST00000397033.2	37	c.1934	CCDS42788.1	2	.	.	.	.	.	.	.	.	.	.	A	9.394	1.076251	0.20227	.	.	ENSG00000115232	ENST00000397033	T	0.50001	0.76	5.78	4.62	0.57501	Integrin alpha-2 (1);	0.253966	0.47852	N	0.000211	T	0.33177	0.0854	L	0.28274	0.84	0.35276	D	0.780914	B;B	0.28208	0.082;0.203	B;B	0.27170	0.045;0.077	T	0.39781	-0.9597	10	0.44086	T	0.13	.	8.8327	0.35093	0.8558:0.0:0.1442:0.0	.	467;645	Q59H74;P13612	.;ITA4_HUMAN	S	645	ENSP00000380227:N645S	ENSP00000380227:N645S	N	+	2	0	ITGA4	182095174	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.336000	0.52113	1.008000	0.39264	0.477000	0.44152	AAT	ITGA4	-	pfam_Integrin_alpha-2	ENSG00000115232		0.303	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1	164	0.00	0	A			182386929	182386929	+1	no_errors	ENST00000397033	ensembl	human	known	69_37n	missense	251	21.07	67	SNP	1.000	G
ITGAV	3685	genome.wustl.edu	37	2	187521035	187521035	+	Silent	SNP	G	G	T	rs201056056		TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:187521035G>T	ENST00000261023.3	+	17	1900	c.1626G>T	c.(1624-1626)ctG>ctT	p.L542L	ITGAV_ENST00000374907.3_Silent_p.L506L|AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000433736.2_Silent_p.L496L	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	542					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GACGAGCACTGTTTCTCTACA	0.428																																					Melanoma(58;108 1995 6081)	dbGAP											0													224.0	218.0	220.0					2																	187521035		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1626G>T	2.37:g.187521035G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.L542	ENST00000261023.3	37	c.1626	CCDS2292.1	2																																																																																			ITGAV	-	pfam_Integrin_alpha-2	ENSG00000138448		0.428	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	175	0.00	0	G	NM_002210		187521035	187521035	+1	no_errors	ENST00000261023	ensembl	human	known	69_37n	silent	306	20.10	77	SNP	0.241	T
ITGAV	3685	genome.wustl.edu	37	2	187540353	187540353	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:187540353T>G	ENST00000261023.3	+	27	3003	c.2729T>G	c.(2728-2730)tTg>tGg	p.L910W	ITGAV_ENST00000374907.3_Missense_Mutation_p.L874W|AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000433736.2_Missense_Mutation_p.L864W	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	910					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GCTCAGTGCTTGAAGATTGTC	0.363																																					Melanoma(58;108 1995 6081)	dbGAP											0													118.0	110.0	113.0					2																	187540353		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.2729T>G	2.37:g.187540353T>G	ENSP00000261023:p.Leu910Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.L910W	ENST00000261023.3	37	c.2729	CCDS2292.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.70|17.70	3.454791|3.454791	0.63290|0.63290	.|.	.|.	ENSG00000138448|ENSG00000138448	ENST00000261023;ENST00000374907;ENST00000433736|ENST00000430709	T;T;T|.	0.50001|.	0.76;0.76;0.76|.	5.4|5.4	5.4|5.4	0.78164|0.78164	Integrin alpha-2 (1);|.	0.079351|.	0.51477|.	D|.	0.000099|.	T|.	0.58509|.	0.2127|.	L|L	0.38175|0.38175	1.15|1.15	0.41121|0.41121	D|D	0.985812|0.985812	D;B;D|.	0.89917|.	1.0;0.09;1.0|.	D;B;D|.	0.85130|.	0.997;0.061;0.997|.	T|.	0.55774|.	-0.8088|.	10|.	0.32370|.	T|.	0.25|.	.|.	15.584|15.584	0.76468|0.76468	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	864;874;910|.	E7EWZ6;P06756-2;P06756|.	.;.;ITAV_HUMAN|.	W|G	910;874;864|61	ENSP00000261023:L910W;ENSP00000364042:L874W;ENSP00000404291:L864W|.	ENSP00000261023:L910W|.	L|X	+|+	2|1	0|0	ITGAV|ITGAV	187248598|187248598	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.984000|0.984000	0.73092|0.73092	4.182000|4.182000	0.58310|0.58310	2.269000|2.269000	0.75478|0.75478	0.460000|0.460000	0.39030|0.39030	TTG|TGA	ITGAV	-	pfam_Integrin_alpha-2	ENSG00000138448		0.363	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	56	0.00	0	T	NM_002210		187540353	187540353	+1	no_errors	ENST00000261023	ensembl	human	known	69_37n	missense	87	43.87	68	SNP	1.000	G
KAT6B	23522	genome.wustl.edu	37	10	76729488	76729488	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr10:76729488C>G	ENST00000287239.4	+	5	1290	c.801C>G	c.(799-801)atC>atG	p.I267M	KAT6B_ENST00000372724.1_Missense_Mutation_p.I267M|KAT6B_ENST00000372714.1_Missense_Mutation_p.I267M|KAT6B_ENST00000372725.1_Missense_Mutation_p.I267M|KAT6B_ENST00000372711.1_Missense_Mutation_p.I267M	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	267					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										ggcagtgCATCGAATGCAAGA	0.428																																						dbGAP											0													93.0	86.0	89.0					10																	76729488		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.801C>G	10.37:g.76729488C>G	ENSP00000287239:p.Ile267Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.I267M	ENST00000287239.4	37	c.801	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405400	0.42715	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24	5.68	1.3	0.21679	.	0.000000	0.45867	D	0.000331	D	0.87529	0.6200	L	0.37800	1.135	0.25478	N	0.987769	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.91635	0.999;0.999;0.997	T	0.77787	-0.2457	10	0.87932	D	0	-12.644	6.6847	0.23138	0.0:0.3511:0.0:0.6489	.	267;267;267	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	M	267	ENSP00000361810:I267M;ENSP00000361809:I267M;ENSP00000287239:I267M;ENSP00000361799:I267M;ENSP00000361796:I267M	ENSP00000287239:I267M	I	+	3	3	KAT6B	76399494	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.242000	0.32755	0.352000	0.24053	0.655000	0.94253	ATC	KAT6B	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000156650		0.428	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	140	0.00	0	C	NM_012330		76729488	76729488	+1	no_errors	ENST00000287239	ensembl	human	known	69_37n	missense	199	47.07	177	SNP	1.000	G
KRT19	3880	genome.wustl.edu	37	17	39681142	39681143	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr17:39681142_39681143insG	ENST00000361566.3	-	3	672_673	c.612_613insC	c.(610-615)atcgaafs	p.E205fs	KRT15_ENST00000254043.3_5'Flank	NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	205	Coil 1B.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.L195fs*3(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				TTCAGGCCTTCGATCTGCATCT	0.604																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.613dupC	17.37:g.39681143_39681143dupG	ENSP00000355124:p.Glu205fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Frame_Shift_Ins	INS	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.E204fs	ENST00000361566.3	37	c.613_612	CCDS11399.1	17																																																																																			KRT19	-	pfam_F,superfamily_Prefoldin	ENSG00000171345		0.604	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT19	HGNC	protein_coding	OTTHUMT00000257285.1	67	0.00	0	-	NM_002276		39681142	39681143	-1	no_errors	ENST00000361566	ensembl	human	known	69_37n	frame_shift_ins	53	18.46	12	INS	0.995:0.004	G
LPA	4018	genome.wustl.edu	37	6	161026093	161026093	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr6:161026093G>T	ENST00000316300.5	-	18	2974	c.2930C>A	c.(2929-2931)gCa>gAa	p.A977E	LPA_ENST00000447678.1_Missense_Mutation_p.A977E			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3485	Kringle 9. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.A977E(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGGGTAGTATGCTGGGGTCCG	0.438																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											344.0	358.0	353.0					6																	161026093		2190	4295	6485	-	-	-	SO:0001583	missense	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2930C>A	6.37:g.161026093G>T	ENSP00000321334:p.Ala977Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTD7|Q9UD88	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.A977E	ENST00000316300.5	37	c.2930	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	0.001	-3.679747	0.00006	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.63580	-0.05;-0.05	2.16	-1.35	0.09114	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.16041	0.0386	N	0.00738	-1.235	0.09310	N	1	D	0.63880	0.993	D	0.63381	0.914	T	0.38693	-0.9649	9	0.02654	T	1	.	6.5254	0.22299	0.0:0.0:0.51:0.49	.	3485	P08519	APOA_HUMAN	E	977	ENSP00000321334:A977E;ENSP00000395608:A977E	ENSP00000321334:A977E	A	-	2	0	LPA	160946083	0.000000	0.05858	0.036000	0.18154	0.014000	0.08584	-1.282000	0.02799	-0.354000	0.08212	-1.296000	0.01341	GCA	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.438	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	506	0.00	0	G	NM_005577		161026093	161026093	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	missense	731	29.04	300	SNP	0.158	T
LRRC37A3	374819	genome.wustl.edu	37	17	62856170	62856170	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr17:62856170A>G	ENST00000584306.1	-	11	4624	c.4094T>C	c.(4093-4095)cTg>cCg	p.L1365P	LRRC37A3_ENST00000319651.5_Missense_Mutation_p.L1365P|LRRC37A3_ENST00000400877.3_Missense_Mutation_p.L403P|LRRC37A3_ENST00000334962.5_Missense_Mutation_p.L342P|LRRC37A3_ENST00000339474.5_Missense_Mutation_p.L483P	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1365						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TTGAGGACTCAGGTCTCTTAA	0.403																																						dbGAP											0													60.0	66.0	64.0					17																	62856170		2178	4282	6460	-	-	-	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.4094T>C	17.37:g.62856170A>G	ENSP00000464535:p.Leu1365Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L1365P	ENST00000584306.1	37	c.4094	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	1.897	-0.454107	0.04540	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000334962;ENST00000319651	T;T;T	0.60672	1.42;1.41;0.17	2.23	-0.304	0.12788	.	.	.	.	.	T	0.40645	0.1125	L	0.31065	0.9	0.09310	N	0.999999	B;B	0.15141	0.012;0.002	B;B	0.16289	0.015;0.003	T	0.27640	-1.0068	9	0.56958	D	0.05	.	5.2237	0.15383	0.6862:0.0:0.3138:0.0	.	483;1365	B4DG20;O60309	.;L37A3_HUMAN	P	446;403;342;1365	ENSP00000383674:L403P;ENSP00000335617:L342P;ENSP00000325713:L1365P	ENSP00000325713:L1365P	L	-	2	0	LRRC37A3	60286632	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.583000	0.05807	-0.452000	0.07087	-1.194000	0.01681	CTG	LRRC37A3	-	NULL	ENSG00000176809		0.403	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	181	0.00	0	A	NM_199340		62856170	62856170	-1	no_errors	ENST00000319651	ensembl	human	known	69_37n	missense	371	15.10	66	SNP	0.003	G
MDN1	23195	genome.wustl.edu	37	6	90353899	90353899	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr6:90353899T>C	ENST00000369393.3	-	102	16731	c.16616A>G	c.(16615-16617)gAc>gGc	p.D5539G	MDN1_ENST00000428876.1_Missense_Mutation_p.D5539G			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5539	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TACTTTAATGTCCAAGATAGA	0.403																																						dbGAP											0													110.0	104.0	107.0					6																	90353899		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.16616A>G	6.37:g.90353899T>C	ENSP00000358400:p.Asp5539Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.D5539G	ENST00000369393.3	37	c.16616	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	T	16.45	3.127024	0.56721	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.05996	3.36;3.36	5.83	5.83	0.93111	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	T	0.25754	0.0627	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.18241	-1.0343	10	0.72032	D	0.01	.	16.1988	0.82053	0.0:0.0:0.0:1.0	.	5539	Q9NU22	MDN1_HUMAN	G	5539	ENSP00000358400:D5539G;ENSP00000413970:D5539G	ENSP00000358400:D5539G	D	-	2	0	MDN1	90410620	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.455000	0.80726	2.230000	0.72887	0.454000	0.30748	GAC	MDN1	-	smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	ENSG00000112159		0.403	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	134	0.00	0	T			90353899	90353899	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	136	21.71	38	SNP	1.000	C
NAV1	89796	genome.wustl.edu	37	1	201777790	201777790	+	Intron	SNP	C	C	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:201777790C>A	ENST00000367296.4	+	20	4458				IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Intron|NAV1_ENST00000295624.6_Intron|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000367297.4_Intron|NAV1_ENST00000367295.1_Intron|NAV1_ENST00000367300.3_Intron	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1						microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GGCTTGCTGTCTGTCCAGTCT	0.582																																						dbGAP											0													93.0	99.0	97.0					1																	201777790		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4039-41C>A	1.37:g.201777790C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	RNA	SNP	-	NULL	ENST00000367296.4	37	NULL	CCDS1414.2	1																																																																																			MIR1231	-	-	ENSG00000221028		0.582	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR1231	HGNC	protein_coding	OTTHUMT00000087013.1	112	0.00	0	C	NM_020443		201777790	201777790	+1	no_errors	ENST00000408101	ensembl	human	known	69_37n	rna	150	20.94	40	SNP	0.000	A
MPV17L2	84769	genome.wustl.edu	37	19	18305818	18305819	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:18305818_18305819insC	ENST00000599612.2	+	4	586_587	c.486_487insC	c.(487-489)cccfs	p.P163fs		NM_032683.2	NP_116072.2	Q567V2	M17L2_HUMAN	MPV17 mitochondrial membrane protein-like 2	163						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				large_intestine(1)|lung(2)|urinary_tract(1)	4						TCCTCTTCGTGCCCCCCCAATT	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK094091	CCDS42522.1	19p13.11	2011-05-26			ENSG00000254858	ENSG00000254858			28177	protein-coding gene	gene with protein product						12477932	Standard	NM_032683		Approved	FKSG24, MGC12972	uc002nid.3	Q567V2	OTTHUMG00000165628	ENST00000599612.2:c.493dupC	19.37:g.18305825_18305825dupC	ENSP00000469836:p.Pro163fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96P34|Q96QA0|Q9BSG4	Frame_Shift_Ins	INS	pfam_Mpv17_PMP22	p.Q164fs	ENST00000599612.2	37	c.486_487	CCDS42522.1	19																																																																																			MPV17L2	-	pfam_Mpv17_PMP22	ENSG00000254858		0.653	MPV17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPV17L2	HGNC	protein_coding	OTTHUMT00000466294.2	27	0.00	0	-	NM_032683		18305818	18305819	+1	no_errors	ENST00000247712	ensembl	human	known	69_37n	frame_shift_ins	23	17.86	5	INS	1.000:1.000	C
MYH1	4619	genome.wustl.edu	37	17	10419370	10419370	+	Silent	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr17:10419370G>C	ENST00000226207.5	-	5	472	c.378C>G	c.(376-378)gtC>gtG	p.V126V	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	126	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGTAGGGGTTGACAGTGACAC	0.483																																						dbGAP											0													100.0	102.0	101.0					17																	10419370		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.378C>G	17.37:g.10419370G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V126	ENST00000226207.5	37	c.378	CCDS11155.1	17																																																																																			MYH1	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000109061		0.483	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	216	0.00	0	G	NM_005963		10419370	10419370	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	silent	217	32.51	105	SNP	1.000	C
NR4A3	8013	genome.wustl.edu	37	9	102595691	102595691	+	Silent	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr9:102595691C>T	ENST00000395097.2	+	5	1938	c.1209C>T	c.(1207-1209)gtC>gtT	p.V403V	NR4A3_ENST00000338488.4_Silent_p.V403V|NR4A3_ENST00000330847.1_Silent_p.V414V	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	403					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)		TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				ATGCCCTTGTCCGAGCTTTAA	0.453			T	EWSR1	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	0													192.0	176.0	181.0					9																	102595691		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.1209C>T	9.37:g.102595691C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_NOR1_rcpt,prints_Nuc_orph_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.V414	ENST00000395097.2	37	c.1242	CCDS6743.1	9																																																																																			NR4A3	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_Nuc_orph_rcpt	ENSG00000119508		0.453	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A3	HGNC	protein_coding	OTTHUMT00000055482.1	94	0.00	0	C			102595691	102595691	+1	no_errors	ENST00000330847	ensembl	human	known	69_37n	silent	125	19.35	30	SNP	0.996	T
NXF5	55998	genome.wustl.edu	37	X	101096037	101096037	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:101096037C>T	ENST00000361708.2	-	8	790	c.431G>A	c.(430-432)aGa>aAa	p.R144K	NXF5_ENST00000537026.1_Missense_Mutation_p.R144K|NXF5_ENST00000473265.2_Missense_Mutation_p.R144K			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	144					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						CATGCAGTTTCTTCGATTCAG	0.507																																						dbGAP											0													103.0	96.0	98.0					X																	101096037		2201	4297	6498	-	-	-	SO:0001583	missense	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.431G>A	X.37:g.101096037C>T	ENSP00000355286:p.Arg144Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	pfam_Tap_RNA-bd	p.R144K	ENST00000361708.2	37	c.431		X	.	.	.	.	.	.	.	.	.	.	.	16.32	3.090639	0.55968	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	T;T;T	0.54479	0.57;0.57;0.57	2.05	2.05	0.26809	.	0.062950	0.64402	U	0.000008	T	0.54727	0.1876	M	0.62088	1.915	0.26266	N	0.978498	P	0.47409	0.895	P	0.53760	0.734	T	0.40001	-0.9586	10	0.24483	T	0.36	.	7.1219	0.25450	0.0:1.0:0.0:0.0	.	144	A2RRM0	.	K	144	ENSP00000442401:R144K;ENSP00000426978:R144K;ENSP00000355286:R144K	ENSP00000263032:R144K	R	-	2	0	NXF5	100982693	1.000000	0.71417	0.992000	0.48379	0.248000	0.25809	4.640000	0.61368	1.365000	0.46057	0.267000	0.19312	AGA	NXF5	-	NULL	ENSG00000126952		0.507	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		412	0.00	0	C			101096037	101096037	-1	no_errors	ENST00000263032	ensembl	human	known	69_37n	missense	1106	17.67	238	SNP	1.000	T
NXF5	55998	genome.wustl.edu	37	X	101096477	101096477	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:101096477C>G	ENST00000361708.2	-	6	653	c.294G>C	c.(292-294)ttG>ttC	p.L98F	NXF5_ENST00000537026.1_Missense_Mutation_p.L98F|NXF5_ENST00000473265.2_Missense_Mutation_p.L98F			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	98					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						GGCCTGGCTTCAACTTATTCT	0.478																																						dbGAP											0													137.0	115.0	123.0					X																	101096477		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.294G>C	X.37:g.101096477C>G	ENSP00000355286:p.Leu98Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	pfam_Tap_RNA-bd	p.L98F	ENST00000361708.2	37	c.294		X	.	.	.	.	.	.	.	.	.	.	.	11.31	1.602104	0.28534	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	T;T;T	0.40225	1.04;1.04;1.04	2.18	1.21	0.21127	.	0.185000	0.36338	N	0.002658	T	0.24624	0.0597	L	0.31120	0.905	0.35001	D	0.755932	B	0.20988	0.05	B	0.16722	0.016	T	0.11567	-1.0582	10	0.29301	T	0.29	.	5.2043	0.15283	0.3587:0.6413:0.0:0.0	.	98	A2RRM0	.	F	98	ENSP00000442401:L98F;ENSP00000426978:L98F;ENSP00000355286:L98F	ENSP00000263032:L98F	L	-	3	2	NXF5	100983133	0.184000	0.23200	0.603000	0.28903	0.237000	0.25408	0.320000	0.19540	0.336000	0.23639	0.401000	0.26515	TTG	NXF5	-	NULL	ENSG00000126952		0.478	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		440	0.00	0	C			101096477	101096477	-1	no_errors	ENST00000263032	ensembl	human	known	69_37n	missense	909	19.70	223	SNP	0.948	G
OR2L2	26246	genome.wustl.edu	37	1	248201688	248201688	+	Missense_Mutation	SNP	G	G	T	rs553489526	byFrequency	TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:248201688G>T	ENST00000366479.2	+	1	215	c.119G>T	c.(118-120)gGa>gTa	p.G40V	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GCTCTAATTGGAAATCTATCC	0.383																																						dbGAP											0													231.0	220.0	224.0					1																	248201688		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.119G>T	1.37:g.248201688G>T	ENSP00000355435:p.Gly40Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3T5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G40V	ENST00000366479.2	37	c.119	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	14.37	2.515544	0.44763	.	.	ENSG00000203663	ENST00000366479	T	0.56103	0.48	2.09	2.09	0.27110	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.66733	0.2819	H	0.94503	3.545	0.50171	D	0.99985	P	0.44816	0.844	P	0.45856	0.495	T	0.75986	-0.3124	9	0.87932	D	0	.	10.9157	0.47135	0.0:0.0:1.0:0.0	.	40	Q8NH16	OR2L2_HUMAN	V	40	ENSP00000355435:G40V	ENSP00000355435:G40V	G	+	2	0	OR2L2	246268311	0.024000	0.19004	0.234000	0.24042	0.331000	0.28603	0.301000	0.19174	1.016000	0.39470	0.194000	0.17425	GGA	OR2L2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000203663		0.383	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	565	0.00	0	G	NM_001004686		248201688	248201688	+1	no_errors	ENST00000366479	ensembl	human	known	69_37n	missense	1353	18.25	302	SNP	0.797	T
OR5D16	390144	genome.wustl.edu	37	11	55607005	55607005	+	Missense_Mutation	SNP	C	C	G	rs375832312		TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr11:55607005C>G	ENST00000378396.1	+	1	778	c.778C>G	c.(778-780)Ctc>Gtc	p.L260V		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				CATCCTCTTCCTCTACTGTGT	0.532																																						dbGAP											0													115.0	103.0	107.0					11																	55607005		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.778C>G	11.37:g.55607005C>G	ENSP00000367649:p.Leu260Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF65|Q96RB4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L260V	ENST00000378396.1	37	c.778	CCDS31512.1	11	.	.	.	.	.	.	.	.	.	.	.	13.20	2.165876	0.38217	.	.	ENSG00000205029	ENST00000378396	T	0.00107	8.72	4.43	0.679	0.17975	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00178	0.0005	N	0.25825	0.765	0.09310	N	1	P	0.46912	0.886	P	0.57283	0.817	T	0.48007	-0.9072	9	0.72032	D	0.01	-40.8448	2.445	0.04504	0.4374:0.3265:0.1345:0.1016	.	260	Q8NGK9	OR5DG_HUMAN	V	260	ENSP00000367649:L260V	ENSP00000367649:L260V	L	+	1	0	OR5D16	55363581	0.000000	0.05858	0.052000	0.19188	0.673000	0.39480	-0.361000	0.07612	0.412000	0.25729	0.537000	0.68136	CTC	OR5D16	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205029		0.532	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D16	HGNC	protein_coding	OTTHUMT00000334506.1	222	0.00	0	C	NM_001005496		55607005	55607005	+1	no_errors	ENST00000378396	ensembl	human	known	69_37n	missense	337	20.66	88	SNP	0.001	G
OSBPL9	114883	genome.wustl.edu	37	1	52227565	52227565	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:52227565C>T	ENST00000428468.1	+	11	702	c.700C>T	c.(700-702)Cag>Tag	p.Q234*	OSBPL9_ENST00000447887.1_Nonsense_Mutation_p.Q244*|OSBPL9_ENST00000531828.1_Nonsense_Mutation_p.Q69*|OSBPL9_ENST00000371714.1_Nonsense_Mutation_p.Q221*|OSBPL9_ENST00000435686.2_Nonsense_Mutation_p.Q69*|OSBPL9_ENST00000486942.1_Nonsense_Mutation_p.Q56*|OSBPL9_ENST00000530544.1_Nonsense_Mutation_p.Q153*|OSBPL9_ENST00000453295.1_Nonsense_Mutation_p.Q217*|OSBPL9_ENST00000337809.4_Nonsense_Mutation_p.Q239*|OSBPL9_ENST00000361556.5_Nonsense_Mutation_p.Q124*|OSBPL9_ENST00000462759.1_Nonsense_Mutation_p.Q56*|OSBPL9_ENST00000371710.3_Nonsense_Mutation_p.Q252*			Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9	234					lipid transport (GO:0006869)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|pancreas(1)|prostate(3)|skin(1)	18						TAAGTCAGAGCAGCGTCCATC	0.418																																						dbGAP											0													173.0	169.0	170.0					1																	52227565		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF392445	CCDS558.1, CCDS41332.1, CCDS41333.1, CCDS41334.1, CCDS41332.2, CCDS41332.3, CCDS41333.2, CCDS44145.1, CCDS55598.1	1p32.3	2013-01-10			ENSG00000117859	ENSG00000117859		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16386	protein-coding gene	gene with protein product		606737					Standard	NM_148904		Approved		uc001csu.3	Q96SU4	OTTHUMG00000008234	ENST00000428468.1:c.700C>T	1.37:g.52227565C>T	ENSP00000407168:p.Gln234*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKJ8|B3KPQ4|D3DQ31|Q5TFC0|Q6IA67|Q86YQ3|Q8NB17|Q8TAS8|Q96SK4|Q9H9X2	Nonsense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q252*	ENST00000428468.1	37	c.754	CCDS41332.3	1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920816	0.92249	.	.	ENSG00000117859	ENST00000371714;ENST00000371710;ENST00000337809;ENST00000447887;ENST00000435686;ENST00000428468;ENST00000453295;ENST00000530544;ENST00000532975;ENST00000527631;ENST00000531828;ENST00000361556;ENST00000462759;ENST00000486942	.	.	.	5.69	5.69	0.88448	.	0.302709	0.36972	N	0.002308	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-19.6074	20.181	0.98201	0.0:1.0:0.0:0.0	.	.	.	.	X	221;252;239;244;69;234;217;153;56;69;69;124;56;56	.	ENSP00000337265:Q239X	Q	+	1	0	OSBPL9	52000153	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.215000	0.65241	2.840000	0.97914	0.655000	0.94253	CAG	OSBPL9	-	NULL	ENSG00000117859		0.418	OSBPL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL9	HGNC	protein_coding	OTTHUMT00000022584.4	166	0.00	0	C			52227565	52227565	+1	no_errors	ENST00000371710	ensembl	human	known	69_37n	nonsense	175	25.42	60	SNP	1.000	T
PCDHB4	56131	genome.wustl.edu	37	5	140502504	140502504	+	Silent	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr5:140502504C>T	ENST00000194152.1	+	1	924	c.924C>T	c.(922-924)ttC>ttT	p.F308F	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATTGGATTTCGAAAAAATTA	0.363																																						dbGAP											0													101.0	118.0	112.0					5																	140502504		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.924C>T	5.37:g.140502504C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4V761	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F308	ENST00000194152.1	37	c.924	CCDS4246.1	5																																																																																			PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081818		0.363	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	184	0.00	0	C	NM_018938		140502504	140502504	+1	no_errors	ENST00000194152	ensembl	human	known	69_37n	silent	149	30.05	64	SNP	1.000	T
PER3	8863	genome.wustl.edu	37	1	7886604	7886604	+	Silent	SNP	G	G	A	rs575428586		TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:7886604G>A	ENST00000361923.2	+	16	2173	c.1998G>A	c.(1996-1998)tcG>tcA	p.S666S	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Silent_p.S674S	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	666	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CTTTGACCTCGGAAGAATTTA	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		16608	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													59.0	56.0	57.0					1																	7886604		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.1998G>A	1.37:g.7886604G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.S666	ENST00000361923.2	37	c.1998	CCDS89.1	1																																																																																			PER3	-	NULL	ENSG00000049246		0.483	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	83	0.00	0	G	NM_016831		7886604	7886604	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	silent	77	28.04	30	SNP	0.000	A
PHACTR1	221692	genome.wustl.edu	37	6	13053669	13053669	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr6:13053669G>A	ENST00000379350.1	+	4	452	c.323G>A	c.(322-324)cGc>cAc	p.R108H	PHACTR1_ENST00000457702.2_5'UTR|PHACTR1_ENST00000332995.7_Missense_Mutation_p.R108H|PHACTR1_ENST00000379345.2_5'UTR|PHACTR1_ENST00000482982.1_3'UTR			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	108					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			CCACCCATCCGCAGGAGAAGT	0.502																																						dbGAP											0													46.0	46.0	46.0					6																	13053669		1943	4138	6081	-	-	-	SO:0001583	missense	0			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.323G>A	6.37:g.13053669G>A	ENSP00000368655:p.Arg108His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.R108H	ENST00000379350.1	37	c.323		6	.	.	.	.	.	.	.	.	.	.	G	33	5.290948	0.95546	.	.	ENSG00000112137	ENST00000379350;ENST00000332995;ENST00000432934	T;T	0.38887	1.11;1.15	5.84	5.84	0.93424	.	0.182021	0.46442	D	0.000284	T	0.52517	0.1739	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.80764	0.991;0.987;0.994	T	0.53121	-0.8483	10	0.87932	D	0	-12.6706	19.1361	0.93429	0.0:0.0:1.0:0.0	.	108;108;108	E7ESR5;Q9C0D0;Q9C0D0-2	.;PHAR1_HUMAN;.	H	108	ENSP00000368655:R108H;ENSP00000329880:R108H	ENSP00000329880:R108H	R	+	2	0	PHACTR1	13161655	1.000000	0.71417	0.994000	0.49952	0.958000	0.62258	9.820000	0.99359	2.778000	0.95560	0.609000	0.83330	CGC	PHACTR1	-	NULL	ENSG00000112137		0.502	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHACTR1	HGNC	protein_coding	OTTHUMT00000039876.1	23	0.00	0	G	XM_166420		13053669	13053669	+1	no_errors	ENST00000432934	ensembl	human	known	69_37n	missense	21	44.74	17	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	126	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	278	50.80	287	SNP	1.000	G
PPFIA4	8497	genome.wustl.edu	37	1	203024614	203024614	+	Silent	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:203024614G>A	ENST00000447715.2	+	21	2259	c.1818G>A	c.(1816-1818)acG>acA	p.T606T	PPFIA4_ENST00000272198.6_Silent_p.T122T|PPFIA4_ENST00000414050.2_Silent_p.T335T|PPFIA4_ENST00000599966.1_Silent_p.T122T|PPFIA4_ENST00000367240.2_Silent_p.T607T|PPFIA4_ENST00000295706.4_Silent_p.T122T			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	606					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						AGATTGAGACGCGTGTAACCA	0.612																																						dbGAP											0													74.0	83.0	80.0					1																	203024614		2120	4232	6352	-	-	-	SO:0001819	synonymous_variant	0			AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.1818G>A	1.37:g.203024614G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_Prefoldin,smart_SAM,pfscan_SAM	p.T607	ENST00000447715.2	37	c.1821		1																																																																																			PPFIA4	-	NULL	ENSG00000143847		0.612	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	PPFIA4	HGNC	protein_coding	OTTHUMT00000462949.1	51	0.00	0	G	NM_015053		203024614	203024614	+1	no_errors	ENST00000367240	ensembl	human	known	69_37n	silent	56	25.33	19	SNP	0.002	A
PRDM8	56978	genome.wustl.edu	37	4	81123205	81123205	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr4:81123205G>A	ENST00000504452.1	+	8	1428	c.589G>A	c.(589-591)Gtg>Atg	p.V197M	PRDM8_ENST00000339711.4_Missense_Mutation_p.V197M|PRDM8_ENST00000415738.2_Missense_Mutation_p.V197M			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	197	Gly-rich.				corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						Aggcggcggcgtgggcaccaa	0.617											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													43.0	51.0	48.0					4																	81123205		2018	4171	6189	-	-	-	SO:0001583	missense	0			AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.589G>A	4.37:g.81123205G>A	ENSP00000423985:p.Val197Met	Somatic	1203	WXS	Illumina GAIIx	Phase_IV	A8K7X2|Q6IQ36	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V197M	ENST00000504452.1	37	c.589	CCDS43243.1	4	.	.	.	.	.	.	.	.	.	.	G	9.316	1.056859	0.19907	.	.	ENSG00000152784	ENST00000504452;ENST00000515013;ENST00000339711;ENST00000415738	T;T;T;T	0.65732	-0.17;0.41;-0.17;-0.17	4.99	-0.304	0.12788	.	0.629622	0.12988	N	0.422718	T	0.33527	0.0866	N	0.24115	0.695	0.09310	N	1	P	0.41265	0.744	B	0.21708	0.036	T	0.14811	-1.0459	10	0.40728	T	0.16	.	4.524	0.11973	0.0678:0.3335:0.2582:0.3405	.	197	Q9NQV8	PRDM8_HUMAN	M	197	ENSP00000423985:V197M;ENSP00000425149:V197M;ENSP00000339764:V197M;ENSP00000406998:V197M	ENSP00000339764:V197M	V	+	1	0	PRDM8	81342229	0.051000	0.20477	0.387000	0.26183	0.249000	0.25844	-0.229000	0.09098	-0.297000	0.08934	0.313000	0.20887	GTG	PRDM8	-	NULL	ENSG00000152784		0.617	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRDM8	HGNC	protein_coding	OTTHUMT00000362793.1	45	0.00	0	G			81123205	81123205	+1	no_errors	ENST00000339711	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.069	A
PRICKLE3	4007	genome.wustl.edu	37	X	49032244	49032244	+	Silent	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:49032244C>T	ENST00000376317.3	-	9	1720	c.1626G>A	c.(1624-1626)tcG>tcA	p.S542S	PRICKLE3_ENST00000538114.1_Silent_p.S366S|PRICKLE3_ENST00000536904.1_Silent_p.S461S|PRICKLE3_ENST00000540849.1_Silent_p.S474S	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	542							zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						AGCAAGATTCCGAGTCTGACC	0.572																																						dbGAP											0													164.0	125.0	138.0					X																	49032244		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.1626G>A	X.37:g.49032244C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G555R	ENST00000376317.3	37	c.1663	CCDS14320.1	X	.	.	.	.	.	.	.	.	.	.	-	5.173	0.217502	0.09810	.	.	ENSG00000012211	ENST00000453382	.	.	.	2.9	-5.8	0.02347	.	.	.	.	.	T	0.38904	0.1058	.	.	.	0.40740	D	0.982824	.	.	.	.	.	.	T	0.38693	-0.9649	4	.	.	.	-5.6572	3.1831	0.06592	0.1341:0.4944:0.1346:0.2368	.	.	.	.	R	555	.	.	G	-	1	0	PRICKLE3	48919188	0.001000	0.12720	0.013000	0.15412	0.783000	0.44284	-2.489000	0.00976	-2.664000	0.00417	-0.565000	0.04167	GGA	PRICKLE3	-	NULL	ENSG00000012211		0.572	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	HGNC	protein_coding	OTTHUMT00000060811.1	85	0.00	0	C	NM_006150		49032244	49032244	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453382	ensembl	human	known	69_37n	missense	103	16.26	20	SNP	0.009	T
PRKD3	23683	genome.wustl.edu	37	2	37543649	37543649	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:37543649G>C	ENST00000379066.1	-	2	781	c.19C>G	c.(19-21)Cct>Gct	p.P7A	PRKD3_ENST00000234179.2_Missense_Mutation_p.P7A|PRKD3_ENST00000477132.1_5'Flank			O94806	KPCD3_HUMAN	protein kinase D3	7					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				GCTGATGGAGGGGAATTATTT	0.418																																					Melanoma(80;621 1355 8613 11814 51767)	dbGAP											0													75.0	73.0	74.0					2																	37543649		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.19C>G	2.37:g.37543649G>C	ENSP00000368356:p.Pro7Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.P7A	ENST00000379066.1	37	c.19	CCDS1789.1	2	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804269	0.70682	.	.	ENSG00000115825	ENST00000379066;ENST00000234179	T;T	0.67345	-0.26;-0.26	5.67	5.67	0.87782	.	0.059431	0.64402	D	0.000002	T	0.63745	0.2537	L	0.40543	1.245	0.45216	D	0.998226	P;B	0.35348	0.496;0.147	B;B	0.38264	0.269;0.046	T	0.66015	-0.6028	10	0.62326	D	0.03	-18.5369	17.9492	0.89047	0.0:0.0:1.0:0.0	.	7;7	O94806-2;O94806	.;KPCD3_HUMAN	A	7	ENSP00000368356:P7A;ENSP00000234179:P7A	ENSP00000234179:P7A	P	-	1	0	PRKD3	37397153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.209000	0.65208	2.665000	0.90641	0.591000	0.81541	CCT	PRKD3	-	NULL	ENSG00000115825		0.418	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	91	0.00	0	G	NM_005813		37543649	37543649	-1	no_errors	ENST00000234179	ensembl	human	known	69_37n	missense	202	16.18	39	SNP	1.000	C
PRKG2	5593	genome.wustl.edu	37	4	82092908	82092908	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr4:82092908T>C	ENST00000395578.1	-	4	795	c.679A>G	c.(679-681)Atg>Gtg	p.M227V	RP11-100N20.1_ENST00000512502.1_RNA|RP11-100N20.1_ENST00000505175.1_RNA|PRKG2_ENST00000418486.2_Missense_Mutation_p.M227V|PRKG2_ENST00000264399.1_Missense_Mutation_p.M227V			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	227					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						GTGGTCCACATAGGGATGGAG	0.413																																						dbGAP											0													97.0	99.0	99.0					4																	82092908		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.679A>G	4.37:g.82092908T>C	ENSP00000378945:p.Met227Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.M227V	ENST00000395578.1	37	c.679	CCDS3589.1	4	.	.	.	.	.	.	.	.	.	.	T	10.99	1.508359	0.27036	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	D;D;D	0.92348	-3.02;-3.02;-3.02	5.42	1.49	0.22878	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.230661	0.43919	D	0.000515	T	0.67316	0.2880	N	0.00385	-1.57	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56926	-0.7898	10	0.41790	T	0.15	-21.3505	0.2673	0.00227	0.2012:0.1956:0.2076:0.3956	.	227;227	E7EPE6;Q13237	.;KGP2_HUMAN	V	227	ENSP00000378945:M227V;ENSP00000264399:M227V;ENSP00000389038:M227V	ENSP00000264399:M227V	M	-	1	0	PRKG2	82311932	0.980000	0.34600	0.989000	0.46669	0.957000	0.61999	2.026000	0.41069	0.388000	0.25054	0.533000	0.62120	ATG	PRKG2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom	ENSG00000138669		0.413	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	114	0.00	0	T	NM_006259		82092908	82092908	-1	no_errors	ENST00000264399	ensembl	human	known	69_37n	missense	133	27.96	52	SNP	0.970	C
PTPRS	5802	genome.wustl.edu	37	19	5265033	5265033	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:5265033T>C	ENST00000587303.1	-	4	653	c.554A>G	c.(553-555)aAa>aGa	p.K185R	PTPRS_ENST00000588012.1_Missense_Mutation_p.K185R|PTPRS_ENST00000592099.1_Missense_Mutation_p.K185R|PTPRS_ENST00000348075.2_Missense_Mutation_p.K185R|PTPRS_ENST00000353284.2_Missense_Mutation_p.K185R|PTPRS_ENST00000357368.4_Missense_Mutation_p.K185R|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.K185R|PTPRS_ENST00000372412.4_Missense_Mutation_p.K185R			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	185	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TCGCAGCTGTTTGATGCGTCC	0.617																																						dbGAP											0													129.0	93.0	105.0					19																	5265033		2203	4300	6503	-	-	-	SO:0001583	missense	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.554A>G	19.37:g.5265033T>C	ENSP00000467537:p.Lys185Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like	p.K185R	ENST00000587303.1	37	c.554	CCDS45930.1	19	.	.	.	.	.	.	.	.	.	.	T	13.89	2.373160	0.42105	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.67865	1.61;-0.28;-0.28;-0.29;-0.29	3.31	2.28	0.28536	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000004	T	0.61502	0.2352	N	0.11255	0.115	0.26303	N	0.977941	B;P;D;P;D;D	0.76494	0.443;0.494;0.974;0.938;0.999;0.979	B;B;P;P;D;P	0.77004	0.144;0.134;0.577;0.603;0.989;0.702	T	0.53634	-0.8411	10	0.42905	T	0.14	.	8.4549	0.32893	0.0:0.0958:0.0:0.9042	.	185;185;185;185;185;211	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	R	211;185;185;185;185;185;185;185;185;185	ENSP00000361489:K185R;ENSP00000349932:K185R;ENSP00000262963:K185R;ENSP00000269907:K185R;ENSP00000327313:K185R	ENSP00000262963:K185R	K	-	2	0	PTPRS	5216033	1.000000	0.71417	1.000000	0.80357	0.204000	0.24138	7.727000	0.84838	0.479000	0.27511	0.459000	0.35465	AAA	PTPRS	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000105426		0.617	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2	23	0.00	0	T			5265033	5265033	-1	no_errors	ENST00000372412	ensembl	human	known	69_37n	missense	21	47.50	19	SNP	1.000	C
PYGM	5837	genome.wustl.edu	37	11	64514134	64514134	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr11:64514134G>C	ENST00000164139.3	-	20	2924	c.2526C>G	c.(2524-2526)atC>atG	p.I842M	RASGRP2_ENST00000377494.1_5'Flank|RASGRP2_ENST00000377497.3_5'Flank|RASGRP2_ENST00000377489.1_5'Flank|RASGRP2_ENST00000377486.3_5'Flank|RASGRP2_ENST00000394430.1_5'Flank|PYGM_ENST00000377432.3_Missense_Mutation_p.I754M|RASGRP2_ENST00000394432.3_5'Flank|RASGRP2_ENST00000377487.1_5'Flank|RASGRP2_ENST00000354024.3_5'Flank	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	842					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGGAGGCTCAGATGGCCTCAT	0.627																																						dbGAP											0													61.0	68.0	66.0					11																	64514134		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.2526C>G	11.37:g.64514134G>C	ENSP00000164139:p.Ile842Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK1|A6NDY6	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.I842M	ENST00000164139.3	37	c.2526	CCDS8079.1	11	.	.	.	.	.	.	.	.	.	.	G	8.909	0.958221	0.18507	.	.	ENSG00000068976	ENST00000377432;ENST00000164139	D;D	0.93953	-3.15;-3.32	4.39	2.44	0.29823	.	0.864674	0.09637	N	0.775479	D	0.82697	0.5093	N	0.08118	0	0.21762	N	0.999555	B;B	0.26483	0.15;0.077	B;B	0.20767	0.027;0.031	T	0.72833	-0.4173	10	0.51188	T	0.08	.	2.9053	0.05719	0.0991:0.1838:0.5269:0.1902	.	754;842	A6NDY6;P11217	.;PYGM_HUMAN	M	754;842	ENSP00000366650:I754M;ENSP00000164139:I842M	ENSP00000164139:I842M	I	-	3	3	PYGM	64270710	0.047000	0.20315	0.706000	0.30403	0.231000	0.25187	0.655000	0.24933	0.449000	0.26747	0.462000	0.41574	ATC	PYGM	-	NULL	ENSG00000068976		0.627	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	HGNC	protein_coding	OTTHUMT00000143254.2	34	0.00	0	G	NM_005609		64514134	64514134	-1	no_errors	ENST00000164139	ensembl	human	known	69_37n	missense	23	50.00	23	SNP	0.963	C
RBAK-RBAKDN	100533952	genome.wustl.edu	37	7	5024707	5024707	+	Splice_Site	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr7:5024707G>T	ENST00000407184.1	+	2	222		c.e2+1							RBAK-RBAKDN readthrough																		CACCCGAAAGGTACTCTACTT	0.493																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.-45+1G>T	7.37:g.5024707G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	NULL	ENST00000407184.1	37	c.NULL		7																																																																																			RNF216P1	-	-	ENSG00000196204		0.493	RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	RNF216P1	HGNC	protein_coding	OTTHUMT00000472007.1	55	0.00	0	G		Intron	5024707	5024707	+1	no_errors	ENST00000403969	ensembl	human	known	69_37n	splice_site	96	31.43	44	SNP	1.000	T
SAP130	79595	genome.wustl.edu	37	2	128774072	128774074	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	GGT	GGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:128774072_128774074delGGT	ENST00000259235.3	-	4	603_605	c.474_476delACC	c.(472-477)ccacct>cct	p.158_159PP>P	SAP130_ENST00000357702.5_In_Frame_Del_p.158_159PP>P|SAP130_ENST00000259234.6_In_Frame_Del_p.132_133PP>P	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	158	Pro-rich.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		CAGGGTAGAAGGTGGAGCAGGAG	0.542																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.474_476delACC	2.37:g.128774072_128774074delGGT	ENSP00000259235:p.Pro159del	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	In_Frame_Del	DEL	NULL	p.P159in_frame_del	ENST00000259235.3	37	c.476_474	CCDS2153.1	2																																																																																			SAP130	-	NULL	ENSG00000136715		0.542	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	HGNC	protein_coding	OTTHUMT00000254436.3	41	0.00	0	GGT	NM_024545		128774072	128774074	-1	no_errors	ENST00000357702	ensembl	human	known	69_37n	in_frame_del	75	13.79	12	DEL	1.000:1.000:1.000	-
SCN7A	6332	genome.wustl.edu	37	2	167304187	167304187	+	Missense_Mutation	SNP	C	C	A	rs531498308		TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:167304187C>A	ENST00000409855.1	-	11	1448	c.1322G>T	c.(1321-1323)aGg>aTg	p.R441M		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	441					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AATTGGTGACCTTTTCTTCAT	0.383													c|||	1	0.000199681	0.0008	0.0	5008	,	,		15437	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													246.0	223.0	230.0					2																	167304187		1858	4101	5959	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1322G>T	2.37:g.167304187C>A	ENSP00000386796:p.Arg441Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.R441M	ENST00000409855.1	37	c.1322	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	c	16.49	3.137532	0.56936	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.97089	-4.21;-4.24	5.13	4.25	0.50352	.	0.091515	0.47852	D	0.000214	D	0.95535	0.8549	L	0.29908	0.895	0.32502	N	0.538766	D	0.59767	0.986	P	0.53722	0.733	D	0.96146	0.9104	10	0.87932	D	0	.	11.3224	0.49430	0.0:0.9121:0.0:0.0879	.	441	Q01118	SCN7A_HUMAN	M	441	ENSP00000386796:R441M;ENSP00000413699:R441M	ENSP00000259060:R441M	R	-	2	0	SCN7A	167012433	0.999000	0.42202	1.000000	0.80357	0.608000	0.37181	2.382000	0.44345	1.388000	0.46506	-0.224000	0.12420	AGG	SCN7A	-	NULL	ENSG00000136546		0.383	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	101	0.98	1	C			167304187	167304187	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	221	23.53	68	SNP	0.997	A
SEC14L6	730005	genome.wustl.edu	37	22	30921438	30921438	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr22:30921438C>T	ENST00000402034.2	-	11	979	c.980G>A	c.(979-981)cGg>cAg	p.R327Q		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	327	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						AGCCCTCTGCCGCTCCCCCAT	0.607																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.980G>A	22.37:g.30921438C>T	ENSP00000385695:p.Arg327Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.R327Q	ENST00000402034.2	37	c.980	CCDS54518.1	22	.	.	.	.	.	.	.	.	.	.	C	8.846	0.943325	0.18281	.	.	ENSG00000214491	ENST00000402034	T	0.40225	1.04	3.67	1.1	0.20463	.	.	.	.	.	T	0.46964	0.1420	M	0.72576	2.205	0.80722	D	1	.	.	.	.	.	.	T	0.26573	-1.0099	7	0.21014	T	0.42	-15.8578	8.8252	0.35050	0.0:0.8006:0.0:0.1994	.	.	.	.	Q	327	ENSP00000385695:R327Q	ENSP00000385695:R327Q	R	-	2	0	SEC14L6	29251438	0.008000	0.16893	0.090000	0.20809	0.248000	0.25809	0.911000	0.28584	-0.062000	0.13088	-0.450000	0.05554	CGG	SEC14L6	-	superfamily_GOLD,pfscan_GOLD	ENSG00000214491		0.607	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	SEC14L6	HGNC	protein_coding	OTTHUMT00000322022.2	45	0.00	0	C			30921438	30921438	-1	no_errors	ENST00000402034	ensembl	human	novel	69_37n	missense	49	44.44	40	SNP	0.934	T
SEMA4F	10505	genome.wustl.edu	37	2	74900921	74900921	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:74900921G>A	ENST00000357877.2	+	7	937	c.788G>A	c.(787-789)cGc>cAc	p.R263H	SEMA4F_ENST00000339773.5_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	263	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TCATACGAGCGCATTAAAGTC	0.557																																						dbGAP											0													109.0	117.0	114.0					2																	74900921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.788G>A	2.37:g.74900921G>A	ENSP00000350547:p.Arg263His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q542Y7|Q9NS35	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.R263H	ENST00000357877.2	37	c.788	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309276	0.40895	.	.	ENSG00000135622	ENST00000357877	T	0.10860	2.83	5.03	-4.74	0.03249	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.796333	0.11605	N	0.547387	T	0.04227	0.0117	N	0.13272	0.32	0.09310	N	0.999996	B	0.11235	0.004	B	0.10450	0.005	T	0.37454	-0.9705	10	0.31617	T	0.26	.	2.1447	0.03784	0.4596:0.2354:0.1855:0.1195	.	263	O95754	SEM4F_HUMAN	H	263	ENSP00000350547:R263H	ENSP00000350547:R263H	R	+	2	0	SEMA4F	74754429	0.000000	0.05858	0.035000	0.18076	0.962000	0.63368	0.222000	0.17699	-0.592000	0.05851	0.462000	0.41574	CGC	SEMA4F	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000135622		0.557	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	HGNC	protein_coding	OTTHUMT00000252214.2	105	0.00	0	G	NM_004263		74900921	74900921	+1	no_errors	ENST00000357877	ensembl	human	known	69_37n	missense	180	16.67	36	SNP	0.001	A
SGK1	6446	genome.wustl.edu	37	6	134495199	134495199	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr6:134495199A>C	ENST00000237305.7	-	3	260	c.172T>G	c.(172-174)Ttg>Gtg	p.L58V	SGK1_ENST00000367857.5_Missense_Mutation_p.L48V|SGK1_ENST00000413996.3_Missense_Mutation_p.L72V|SGK1_ENST00000475719.2_Missense_Mutation_p.L58V|SGK1_ENST00000367858.5_Missense_Mutation_p.L153V|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000528577.1_Missense_Mutation_p.L86V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	58	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GAGATCTTCAAGATGGACTGA	0.498																																						dbGAP											0													133.0	126.0	128.0					6																	134495199		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.172T>G	6.37:g.134495199A>C	ENSP00000237305:p.Leu58Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.L153V	ENST00000237305.7	37	c.457	CCDS5170.1	6	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202526	0.79127	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.68903	0.37;0.37;0.37;0.37;0.37;0.37;-0.36	5.99	3.63	0.41609	.	0.000000	0.85682	D	0.000000	T	0.70666	0.3250	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D;D	0.71674	0.994;0.998;0.978;0.987;0.984;0.978	P;D;P;P;P;P	0.77557	0.903;0.99;0.802;0.841;0.837;0.802	T	0.71724	-0.4506	10	0.49607	T	0.09	.	8.6629	0.34103	0.7961:0.0:0.2039:0.0	.	86;72;58;48;153;58	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	153;72;58;48;86;58;122	ENSP00000356832:L153V;ENSP00000396242:L72V;ENSP00000237305:L58V;ENSP00000356831:L48V;ENSP00000434450:L86V;ENSP00000434302:L58V;ENSP00000435577:L122V	ENSP00000237305:L58V	L	-	1	2	SGK1	134536892	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.022000	0.57203	0.525000	0.28522	-0.250000	0.11733	TTG	SGK1	-	superfamily_Phox	ENSG00000118515		0.498	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK1	HGNC	protein_coding	OTTHUMT00000042312.2	78	0.00	0	A			134495199	134495199	-1	no_errors	ENST00000367858	ensembl	human	known	69_37n	missense	98	23.44	30	SNP	1.000	C
SLC35E1	79939	genome.wustl.edu	37	19	16678954	16678954	+	Silent	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:16678954G>T	ENST00000595753.1	-	3	536	c.519C>A	c.(517-519)atC>atA	p.I173I	SLC35E1_ENST00000431408.1_Silent_p.I17I|CTD-3222D19.10_ENST00000597851.1_RNA|CTD-3222D19.2_ENST00000409035.1_Intron	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	173					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						GGACACCGCTGATGATGGGGA	0.577																																						dbGAP											0													81.0	80.0	81.0					19																	16678954		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.519C>A	19.37:g.16678954G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBQ2|Q96JV7	Silent	SNP	pfam_DUF250,pfam_DMT,pfam_UAA	p.I173	ENST00000595753.1	37	c.519	CCDS12346.2	19																																																																																			SLC35E1	-	pfam_DMT,pfam_UAA	ENSG00000127526		0.577	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35E1	HGNC	protein_coding	OTTHUMT00000326809.2	44	0.00	0	G	NM_024881		16678954	16678954	-1	no_errors	ENST00000409648	ensembl	human	known	69_37n	silent	32	28.89	13	SNP	1.000	T
SORBS2	8470	genome.wustl.edu	37	4	186544917	186544917	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr4:186544917C>G	ENST00000284776.7	-	13	2163	c.1654G>C	c.(1654-1656)Gag>Cag	p.E552Q	SORBS2_ENST00000355634.5_Missense_Mutation_p.E652Q|SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.E552Q|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.E456Q	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	552					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AGCAAATACTCAATGGAAAAC	0.547																																					Esophageal Squamous(153;41 2433 9491 36028)	dbGAP											0													39.0	43.0	42.0					4																	186544917		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1654G>C	4.37:g.186544917C>G	ENSP00000284776:p.Glu552Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.E552Q	ENST00000284776.7	37	c.1654	CCDS3845.1	4	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350047	0.61183	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.58940	0.35;0.35;0.3;0.32	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.76442	0.3988	M	0.68593	2.085	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.77557	0.99;0.986;0.99	T	0.76945	-0.2771	10	0.87932	D	0	-38.0904	20.2405	0.98372	0.0:1.0:0.0:0.0	.	456;652;552	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	Q	552;552;456;652	ENSP00000284776:E552Q;ENSP00000411764:E552Q;ENSP00000397482:E456Q;ENSP00000347852:E652Q	ENSP00000284776:E552Q	E	-	1	0	SORBS2	186781911	1.000000	0.71417	0.974000	0.42286	0.065000	0.16274	7.625000	0.83145	2.797000	0.96272	0.561000	0.74099	GAG	SORBS2	-	NULL	ENSG00000154556		0.547	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	41	0.00	0	C	NM_003603		186544917	186544917	-1	no_errors	ENST00000284776	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	G
SPEG	10290	genome.wustl.edu	37	2	220348875	220348876	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:220348875_220348876insC	ENST00000312358.7	+	30	6822_6823	c.6690_6691insC	c.(6691-6693)cccfs	p.P2231fs	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2231	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGCCTGCACCACCCCCCCAGGC	0.678																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.6697dupC	2.37:g.220348882_220348882dupC	ENSP00000311684:p.Pro2231fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Q2232fs	ENST00000312358.7	37	c.6690_6691	CCDS42824.1	2																																																																																			SPEG	-	NULL	ENSG00000072195		0.678	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	13	0.00	0	-	NM_005876		220348875	220348876	+1	no_errors	ENST00000312358	ensembl	human	novel	69_37n	frame_shift_ins	3	40.00	2	INS	0.009:0.034	C
SPHKAP	80309	genome.wustl.edu	37	2	228882135	228882135	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:228882135C>G	ENST00000392056.3	-	7	3481	c.3435G>C	c.(3433-3435)gaG>gaC	p.E1145D	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E1145D	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1145						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CCAGCAGTAACTCAAATCCTC	0.522																																						dbGAP											0													66.0	55.0	59.0					2																	228882135		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3435G>C	2.37:g.228882135C>G	ENSP00000375909:p.Glu1145Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.E1145D	ENST00000392056.3	37	c.3435	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	8.012	0.757802	0.15846	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.61980	0.06;0.06	5.57	3.67	0.42095	.	0.089852	0.85682	D	0.000000	T	0.31327	0.0793	N	0.04203	-0.255	0.38702	D	0.953012	B;B;B	0.22414	0.009;0.069;0.041	B;B;B	0.22386	0.01;0.029;0.039	T	0.27739	-1.0065	10	0.20046	T	0.44	.	3.4927	0.07644	0.2334:0.5428:0.1359:0.0879	.	176;1145;1145	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	D	1145	ENSP00000375909:E1145D;ENSP00000339886:E1145D	ENSP00000339886:E1145D	E	-	3	2	SPHKAP	228590379	1.000000	0.71417	0.979000	0.43373	0.990000	0.78478	2.068000	0.41471	2.785000	0.95823	0.655000	0.94253	GAG	SPHKAP	-	NULL	ENSG00000153820		0.522	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	73	0.00	0	C	NM_030623		228882135	228882135	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	67	20.24	17	SNP	0.986	G
TMEM209	84928	genome.wustl.edu	37	7	129832501	129832501	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr7:129832501G>A	ENST00000397622.2	-	6	858	c.736C>T	c.(736-738)Ctc>Ttc	p.L246F	TMEM209_ENST00000462753.1_Missense_Mutation_p.L245F|TMEM209_ENST00000473456.1_Missense_Mutation_p.L246F|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_Missense_Mutation_p.L245F	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	246						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					TCACTTCTGAGAAAAGTATCC	0.398																																						dbGAP											0													102.0	102.0	102.0					7																	129832501		1847	4104	5951	-	-	-	SO:0001583	missense	0				CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.736C>T	7.37:g.129832501G>A	ENSP00000380747:p.Leu246Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	pfam_Cytochrome_B561-rel	p.L246F	ENST00000397622.2	37	c.736	CCDS47712.1	7	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701990	0.68501	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.67249	0.2873	M	0.79475	2.455	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	T	0.67738	-0.5593	10	0.51188	T	0.08	-19.5429	18.703	0.91627	0.0:0.0:1.0:0.0	.	246;246	Q96SK2-3;Q96SK2	.;TM209_HUMAN	F	246;245;246;245	ENSP00000380747:L246F;ENSP00000419697:L245F;ENSP00000417258:L246F;ENSP00000338388:L245F	ENSP00000338388:L245F	L	-	1	0	TMEM209	129619737	1.000000	0.71417	0.976000	0.42696	0.499000	0.33736	7.022000	0.76431	2.733000	0.93635	0.591000	0.81541	CTC	TMEM209	-	pfam_Cytochrome_B561-rel	ENSG00000146842		0.398	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM209	HGNC	protein_coding	OTTHUMT00000349339.1	48	0.00	0	G	NM_032842		129832501	129832501	-1	no_errors	ENST00000397622	ensembl	human	known	69_37n	missense	118	24.36	38	SNP	1.000	A
TNC	3371	genome.wustl.edu	37	9	117838356	117838356	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr9:117838356T>G	ENST00000350763.4	-	9	3316	c.2905A>C	c.(2905-2907)Aag>Cag	p.K969Q	TNC_ENST00000423613.2_Missense_Mutation_p.K969Q|TNC_ENST00000535648.1_Missense_Mutation_p.K969Q|TNC_ENST00000537320.1_Missense_Mutation_p.K969Q|TNC_ENST00000345230.3_Missense_Mutation_p.K969Q|TNC_ENST00000341037.4_Missense_Mutation_p.K969Q|TNC_ENST00000542877.1_Missense_Mutation_p.K969Q|TNC_ENST00000346706.3_Missense_Mutation_p.K969Q|TNC_ENST00000340094.3_Missense_Mutation_p.K969Q	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	969	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TTGTCTTCCTTCACAGCAGAA	0.517																																						dbGAP											0													163.0	151.0	155.0					9																	117838356		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.2905A>C	9.37:g.117838356T>G	ENSP00000265131:p.Lys969Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.K969Q	ENST00000350763.4	37	c.2905	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	T	22.0	4.233666	0.79688	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.38	5.38	0.77491	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.299436	0.36338	N	0.002658	T	0.62208	0.2409	L	0.58510	1.815	0.51012	D	0.999901	B;B	0.34226	0.443;0.13	P;B	0.46718	0.525;0.299	T	0.63233	-0.6683	10	0.49607	T	0.09	.	15.6599	0.77178	0.0:0.0:0.0:1.0	.	969;969	E9PC84;P24821	.;TENA_HUMAN	Q	969	ENSP00000344400:K969Q;ENSP00000438152:K969Q;ENSP00000344555:K969Q;ENSP00000345861:K969Q;ENSP00000265131:K969Q;ENSP00000339553:K969Q;ENSP00000411406:K969Q;ENSP00000443478:K969Q;ENSP00000442242:K969Q	ENSP00000344400:K969Q	K	-	1	0	TNC	116878177	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.906000	0.69900	2.158000	0.67659	0.533000	0.62120	AAG	TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000041982		0.517	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	144	0.00	0	T	NM_002160		117838356	117838356	-1	no_errors	ENST00000350763	ensembl	human	known	69_37n	missense	222	21.00	59	SNP	1.000	G
TNFSF18	8995	genome.wustl.edu	37	1	173019924	173019924	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr1:173019924A>C	ENST00000404377.3	-	1	179	c.179T>G	c.(178-180)cTt>cGt	p.L60R	RP1-15D23.2_ENST00000432694.2_lincRNA|TNFSF18_ENST00000239468.2_Missense_Mutation_p.L38R	NM_005092.3	NP_005083.2	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily, member 18	60					cell-cell signaling (GO:0007267)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of T cell proliferation (GO:0042129)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	9						GAAGGAGCAAAGAAATAGCAA	0.368																																						dbGAP											0													70.0	62.0	65.0					1																	173019924		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117713	CCDS1305.2	1q23	2008-02-05			ENSG00000120337	ENSG00000120337		"""Tumor necrosis factor (ligand) superfamily"""	11932	protein-coding gene	gene with protein product		603898				10037686, 10074428	Standard	NM_005092		Approved	AITRL, TL6, hGITRL	uc001giu.2	Q9UNG2	OTTHUMG00000034835	ENST00000404377.3:c.179T>G	1.37:g.173019924A>C	ENSP00000385470:p.Leu60Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A9IQG8|O95852|Q6ISV1	Missense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like	p.L60R	ENST00000404377.3	37	c.179	CCDS1305.2	1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629275	0.46944	.	.	ENSG00000120337	ENST00000404377;ENST00000239468	.	.	.	5.38	5.38	0.77491	.	0.953532	0.08648	N	0.914449	T	0.36386	0.0965	L	0.32530	0.975	0.09310	N	1	D	0.58970	0.984	P	0.57371	0.819	T	0.38200	-0.9672	9	0.87932	D	0	-0.3014	12.0594	0.53555	1.0:0.0:0.0:0.0	.	60	Q9UNG2	TNF18_HUMAN	R	60;38	.	ENSP00000239468:L38R	L	-	2	0	TNFSF18	171286547	0.009000	0.17119	0.003000	0.11579	0.012000	0.07955	2.475000	0.45162	2.160000	0.67779	0.383000	0.25322	CTT	TNFSF18	-	NULL	ENSG00000120337		0.368	TNFSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFSF18	HGNC	protein_coding	OTTHUMT00000084268.2	71	0.00	0	A	NM_005092		173019924	173019924	-1	no_errors	ENST00000404377	ensembl	human	known	69_37n	missense	111	22.92	33	SNP	0.006	C
TP53	7157	genome.wustl.edu	37	17	7578508	7578508	+	Missense_Mutation	SNP	C	C	T	rs587781288		TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr17:7578508C>T	ENST00000269305.4	-	5	611	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	TP53_ENST00000455263.2_Missense_Mutation_p.C141Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.C141Y|TP53_ENST00000413465.2_Missense_Mutation_p.C141Y|TP53_ENST00000445888.2_Missense_Mutation_p.C141Y|TP53_ENST00000359597.4_Missense_Mutation_p.C141Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141Y(79)|p.0?(8)|p.C9Y(5)|p.C48Y(5)|p.A138_P142delAKTCP(4)|p.C141F(4)|p.C141S(3)|p.N131fs*27(2)|p.C9S(1)|p.K139_C141>N(1)|p.L137_W146del10(1)|p.C141A(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C48S(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCACAGGGCAGGTCTTGGC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	121	Substitution - Missense(99)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(5)|Complex - deletion inframe(1)	large_intestine(23)|breast(17)|ovary(12)|haematopoietic_and_lymphoid_tissue(7)|oesophagus(7)|liver(7)|upper_aerodigestive_tract(6)|central_nervous_system(6)|endometrium(6)|urinary_tract(6)|lung(5)|prostate(5)|bone(5)|stomach(4)|soft_tissue(2)|biliary_tract(1)|testis(1)|pancreas(1)	GRCh37	CM993216	TP53	M							56.0	55.0	55.0					17																	7578508		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.422G>A	17.37:g.7578508C>T	ENSP00000269305:p.Cys141Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C141Y	ENST00000269305.4	37	c.422	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720132	0.48728	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.48	4.5	0.54988	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99832	0.9924	M	0.90309	3.105	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.987;1.0;0.999;1.0;1.0	D	0.96735	0.9542	10	0.87932	D	0	-26.1094	13.743	0.62860	0.1552:0.8448:0.0:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141Y;ENSP00000352610:C141Y;ENSP00000269305:C141Y;ENSP00000398846:C141Y;ENSP00000391127:C141Y;ENSP00000391478:C141Y;ENSP00000425104:C9Y;ENSP00000423862:C48Y;ENSP00000424104:C141Y	ENSP00000269305:C141Y	C	-	2	0	TP53	7519233	1.000000	0.71417	0.996000	0.52242	0.022000	0.10575	6.016000	0.70798	1.427000	0.47276	-0.182000	0.12963	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	49	0.00	0	C	NM_000546		7578508	7578508	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	23	68.49	50	SNP	1.000	T
UTP14A	10813	genome.wustl.edu	37	X	129058966	129058966	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:129058966A>C	ENST00000394422.3	+	12	1572	c.1544A>C	c.(1543-1545)gAa>gCa	p.E515A	RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000425117.2_Missense_Mutation_p.E463A|UTP14A_ENST00000371042.3_Missense_Mutation_p.E347A|UTP14A_ENST00000371051.5_Missense_Mutation_p.E461A	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	515					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						GAAGAGCTAGAAGAGCTGGGA	0.522																																						dbGAP											0													109.0	116.0	113.0					X																	129058966		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1544A>C	X.37:g.129058966A>C	ENSP00000377944:p.Glu515Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	pfam_SSU_processome_Utp14	p.E515A	ENST00000394422.3	37	c.1544	CCDS14615.1	X	.	.	.	.	.	.	.	.	.	.	A	18.26	3.584995	0.66105	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000371042	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	6.08	4.89	0.63831	.	0.412804	0.30649	N	0.009178	T	0.21841	0.0526	M	0.77486	2.375	0.21627	N	0.999617	P;P;P	0.41366	0.673;0.58;0.747	B;B;B	0.40134	0.23;0.32;0.32	T	0.15896	-1.0421	10	0.09843	T	0.71	-7.9934	6.1133	0.20112	0.7772:0.0:0.076:0.1467	.	461;463;515	F8WD00;E9PEL7;Q9BVJ6	.;.;UT14A_HUMAN	A	463;515;461;347	ENSP00000388669:E463A;ENSP00000377944:E515A;ENSP00000360090:E461A;ENSP00000360081:E347A	ENSP00000360081:E347A	E	+	2	0	UTP14A	128886647	0.998000	0.40836	0.025000	0.17156	0.419000	0.31324	4.645000	0.61404	0.860000	0.35481	0.486000	0.48141	GAA	UTP14A	-	pfam_SSU_processome_Utp14	ENSG00000156697		0.522	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	HGNC	protein_coding	OTTHUMT00000058221.1	242	0.00	0	A	NM_006649		129058966	129058966	+1	no_errors	ENST00000394422	ensembl	human	known	69_37n	missense	305	16.44	60	SNP	0.157	C
UTP20	27340	genome.wustl.edu	37	12	101750765	101750765	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr12:101750765C>T	ENST00000261637.4	+	43	5770	c.5596C>T	c.(5596-5598)Cgc>Tgc	p.R1866C	snoU13_ENST00000458958.1_RNA	NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1866					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AGACATTGCACGCAGCACTCT	0.378																																						dbGAP											0													80.0	74.0	76.0					12																	101750765		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5596C>T	12.37:g.101750765C>T	ENSP00000261637:p.Arg1866Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.R1866C	ENST00000261637.4	37	c.5596	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288678	0.80914	.	.	ENSG00000120800	ENST00000261637	T	0.69435	-0.4	6.06	6.06	0.98353	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84951	0.5586	M	0.93375	3.41	0.80722	D	1	D	0.64830	0.994	P	0.56163	0.793	D	0.87893	0.2685	10	0.87932	D	0	-12.6318	20.6208	0.99490	0.0:1.0:0.0:0.0	.	1866	O75691	UTP20_HUMAN	C	1866	ENSP00000261637:R1866C	ENSP00000261637:R1866C	R	+	1	0	UTP20	100274896	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	4.343000	0.59348	2.882000	0.98803	0.655000	0.94253	CGC	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.378	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	102	0.00	0	C	NM_014503		101750765	101750765	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	146	41.37	103	SNP	0.999	T
XIRP2	129446	genome.wustl.edu	37	2	168107195	168107195	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:168107195C>A	ENST00000409195.1	+	9	9382	c.9293C>A	c.(9292-9294)aCc>aAc	p.T3098N	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.T3098N|XIRP2_ENST00000409273.1_Missense_Mutation_p.T2876N|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2923					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CACGTGAAAACCCATCAGGAA	0.393																																						dbGAP											0													84.0	83.0	84.0					2																	168107195		1925	4135	6060	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9293C>A	2.37:g.168107195C>A	ENSP00000386840:p.Thr3098Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.T3098N	ENST00000409195.1	37	c.9293	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	C	0.474	-0.883119	0.02530	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02498	4.27;4.27;4.27	5.35	0.516	0.17019	.	1.006700	0.07983	N	0.985906	T	0.02533	0.0077	L	0.44542	1.39	0.09310	N	1	B;B;P	0.40834	0.309;0.435;0.73	B;B;B	0.36186	0.109;0.219;0.219	T	0.44757	-0.9307	10	0.17369	T	0.5	1.1608	3.7608	0.08603	0.1619:0.4926:0.0:0.3456	.	2923;2923;2876	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	N	3098;3098;2876;512	ENSP00000386840:T3098N;ENSP00000295237:T3098N;ENSP00000387255:T2876N	ENSP00000295237:T3098N	T	+	2	0	XIRP2	167815441	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.454000	0.06770	-0.079000	0.12707	-0.262000	0.10625	ACC	XIRP2	-	NULL	ENSG00000163092		0.393	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	311	0.00	0	C	NM_152381		168107195	168107195	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	442	26.66	161	SNP	0.000	A
XIRP2	129446	genome.wustl.edu	37	2	168114995	168114995	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr2:168114995G>A	ENST00000409728.1	+	11	2127	c.2038G>A	c.(2038-2040)Gac>Aac	p.D680N	XIRP2_ENST00000409043.1_Missense_Mutation_p.D647N|XIRP2_ENST00000420519.1_Missense_Mutation_p.D680N|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409605.1_Missense_Mutation_p.D425N|XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000409756.2_Missense_Mutation_p.D647N	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2758					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGAAGCTGAAGACACAAAGAG	0.368																																						dbGAP											0													48.0	46.0	47.0					2																	168114995		1932	4144	6076	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2038G>A	2.37:g.168114995G>A	ENSP00000386619:p.Asp680Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.D680N	ENST00000409728.1	37	c.2038	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885828	0.51908	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409756;ENST00000420519;ENST00000409605	T;T;T;T;T	0.77877	-1.12;-1.13;-1.12;-1.13;-1.12	5.81	5.81	0.92471	.	.	.	.	.	T	0.82001	0.4942	.	.	.	0.80722	D	1	P;P	0.49090	0.919;0.919	P;P	0.48704	0.587;0.587	T	0.81252	-0.1017	8	0.44086	T	0.13	.	20.0621	0.97678	0.0:0.0:1.0:0.0	.	647;680	A4UGR9-4;A4UGR9-6	.;.	N	647;680;647;680;425	ENSP00000386454:D647N;ENSP00000386619:D680N;ENSP00000386724:D647N;ENSP00000415541:D680N;ENSP00000386981:D425N	ENSP00000386454:D647N	D	+	1	0	XIRP2	167823241	1.000000	0.71417	0.649000	0.29536	0.148000	0.21650	5.084000	0.64462	2.750000	0.94351	0.655000	0.94253	GAC	XIRP2	-	NULL	ENSG00000163092		0.368	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	149	0.00	0	G	NM_152381		168114995	168114995	+1	no_errors	ENST00000420519	ensembl	human	known	69_37n	missense	231	21.69	64	SNP	0.945	A
ZC3H12B	340554	genome.wustl.edu	37	X	64708837	64708837	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chrX:64708837G>T	ENST00000338957.4	+	1	223	c.156G>T	c.(154-156)aaG>aaT	p.K52N	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.K41N	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	52							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TAAGCCTTAAGAGTAGCGACA	0.527																																						dbGAP											0													57.0	61.0	60.0					X																	64708837		2113	4207	6320	-	-	-	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.156G>T	X.37:g.64708837G>T	ENSP00000340839:p.Lys52Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.K52N	ENST00000338957.4	37	c.156	CCDS48131.2	X	.	.	.	.	.	.	.	.	.	.	G	3.588	-0.084200	0.07097	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.23754	1.9;1.89	4.4	-0.542	0.11854	.	0.507414	0.21184	N	0.078773	T	0.10809	0.0264	N	0.08118	0	0.09310	N	1	B	0.33694	0.421	B	0.30029	0.11	T	0.17561	-1.0365	10	0.52906	T	0.07	-5.4276	8.836	0.35113	0.6695:0.0:0.3305:0.0	.	41	Q5HYM0	ZC12B_HUMAN	N	52;41;41	ENSP00000340839:K52N;ENSP00000408077:K41N	ENSP00000218172:K41N	K	+	3	2	ZC3H12B	64625562	0.746000	0.28272	0.005000	0.12908	0.184000	0.23303	0.396000	0.20867	-0.268000	0.09312	-0.332000	0.08345	AAG	ZC3H12B	-	NULL	ENSG00000102053		0.527	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2	76	0.00	0	G	XM_293334		64708837	64708837	+1	no_errors	ENST00000338957	ensembl	human	known	69_37n	missense	158	23.67	49	SNP	0.018	T
ZNF217	7764	genome.wustl.edu	37	20	52192376	52192376	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr20:52192376C>G	ENST00000371471.2	-	4	3352	c.2927G>C	c.(2926-2928)aGc>aCc	p.S976T	ZNF217_ENST00000302342.3_Missense_Mutation_p.S976T|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	976					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			ATCGACCTCGCTGGAGCTCAG	0.562																																						dbGAP											0													111.0	93.0	99.0					20																	52192376		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2927G>C	20.37:g.52192376C>G	ENSP00000360526:p.Ser976Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y6|Q14DB8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S976T	ENST00000371471.2	37	c.2927	CCDS13443.1	20	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792954	0.31685	.	.	ENSG00000171940	ENST00000371471;ENST00000302342;ENST00000437222;ENST00000395971	T;T	0.08720	3.06;3.06	4.79	2.52	0.30459	.	1.218600	0.05377	N	0.536531	T	0.05823	0.0152	N	0.22421	0.69	0.09310	N	1	B	0.27068	0.167	B	0.19148	0.024	T	0.37291	-0.9712	10	0.38643	T	0.18	-4.6905	2.8368	0.05518	0.0:0.3956:0.3671:0.2373	.	976	O75362	ZN217_HUMAN	T	976;976;64;136	ENSP00000360526:S976T;ENSP00000304308:S976T	ENSP00000304308:S976T	S	-	2	0	ZNF217	51625783	0.002000	0.14202	0.001000	0.08648	0.089000	0.18198	1.118000	0.31246	0.976000	0.38417	0.650000	0.86243	AGC	ZNF217	-	NULL	ENSG00000171940		0.562	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF217	HGNC	protein_coding	OTTHUMT00000079757.2	28	0.00	0	C	NM_006526		52192376	52192376	-1	no_errors	ENST00000302342	ensembl	human	known	69_37n	missense	83	19.42	20	SNP	0.002	G
ZNF235	9310	genome.wustl.edu	37	19	44792449	44792449	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:44792449C>A	ENST00000291182.4	-	5	1241	c.1139G>T	c.(1138-1140)tGt>tTt	p.C380F	ZNF235_ENST00000589799.1_Intron|ZNF235_ENST00000589248.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				GCCCTTCCCACAACTGTCACA	0.443																																						dbGAP											0													88.0	77.0	80.0					19																	44792449		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.1139G>T	19.37:g.44792449C>A	ENSP00000291182:p.Cys380Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C380F	ENST00000291182.4	37	c.1139	CCDS33048.1	19	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652789	0.67472	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	D	0.85861	-2.04	3.91	3.91	0.45181	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43747	D	0.000524	D	0.95319	0.8481	H	0.98507	4.25	0.52501	D	0.999951	D;D	0.89917	1.0;1.0	D;D	0.79108	0.986;0.992	D	0.97279	0.9916	10	0.87932	D	0	.	15.5506	0.76148	0.0:1.0:0.0:0.0	.	376;380	Q14590-2;Q14590	.;ZN235_HUMAN	F	380;380;302	ENSP00000291182:C380F	ENSP00000291182:C380F	C	-	2	0	ZNF235	49484289	1.000000	0.71417	0.946000	0.38457	0.989000	0.77384	7.401000	0.79962	2.149000	0.67028	0.462000	0.41574	TGT	ZNF235	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000159917		0.443	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF235	HGNC	protein_coding	OTTHUMT00000460732.1	175	0.00	0	C			44792449	44792449	-1	no_errors	ENST00000291182	ensembl	human	known	69_37n	missense	207	25.71	72	SNP	1.000	A
ZNF510	22869	genome.wustl.edu	37	9	99521789	99521789	+	Silent	SNP	G	G	A			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr9:99521789G>A	ENST00000375231.1	-	6	1973	c.1323C>T	c.(1321-1323)ttC>ttT	p.F441F	ZNF510_ENST00000223428.4_Silent_p.F441F			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				ACTTCTGGGAGAAAGTTTTTC	0.388																																						dbGAP											0													90.0	91.0	91.0					9																	99521789		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.1323C>T	9.37:g.99521789G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZP5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F441	ENST00000375231.1	37	c.1323	CCDS35074.1	9																																																																																			ZNF510	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000081386		0.388	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF510	HGNC	protein_coding	OTTHUMT00000053287.1	219	0.00	0	G	NM_014930		99521789	99521789	-1	no_errors	ENST00000223428	ensembl	human	known	69_37n	silent	509	20.09	128	SNP	0.967	A
ZNF536	9745	genome.wustl.edu	37	19	31039300	31039300	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:31039300T>G	ENST00000355537.3	+	4	2921	c.2774T>G	c.(2773-2775)tTt>tGt	p.F925C		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	925					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ATGGACAGTTTTGTCCTCAGT	0.493																																						dbGAP											0													177.0	184.0	182.0					19																	31039300		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2774T>G	19.37:g.31039300T>G	ENSP00000347730:p.Phe925Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F925C	ENST00000355537.3	37	c.2774	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	T	15.91	2.973680	0.53720	.	.	ENSG00000198597	ENST00000355537	T	0.14144	2.53	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	L	0.34521	1.04	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.01839	-1.1263	10	0.72032	D	0.01	-12.078	15.9342	0.79688	0.0:0.0:0.0:1.0	.	925;925	A7E228;O15090	.;ZN536_HUMAN	C	925	ENSP00000347730:F925C	ENSP00000347730:F925C	F	+	2	0	ZNF536	35731140	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.684000	0.84104	2.174000	0.68829	0.402000	0.26972	TTT	ZNF536	-	NULL	ENSG00000198597		0.493	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	174	0.00	0	T	NM_014717		31039300	31039300	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	missense	190	25.20	64	SNP	1.000	G
ZNF600	162966	genome.wustl.edu	37	19	53270087	53270087	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:53270087C>G	ENST00000338230.3	-	3	1189	c.922G>C	c.(922-924)Gac>Cac	p.D308H		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		AAAACTTTGTCACATTCTTCA	0.373																																					Esophageal Squamous(196;1235 2112 2375 33339 34207)	dbGAP											0													68.0	68.0	68.0					19																	53270087		2203	4299	6502	-	-	-	SO:0001583	missense	0			U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.922G>C	19.37:g.53270087C>G	ENSP00000344791:p.Asp308His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6MZR0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D308H	ENST00000338230.3	37	c.922	CCDS12856.1	19	.	.	.	.	.	.	.	.	.	.	.	14.70	2.614778	0.46631	.	.	ENSG00000189190	ENST00000338230	T	0.01068	5.38	1.5	1.5	0.22942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02012	0.0063	N	0.20357	0.565	0.34724	D	0.729062	P	0.48998	0.918	P	0.57548	0.823	T	0.61312	-0.7088	9	0.87932	D	0	.	9.9764	0.41786	0.0:1.0:0.0:0.0	.	308	Q6ZNG1	ZN600_HUMAN	H	308	ENSP00000344791:D308H	ENSP00000344791:D308H	D	-	1	0	ZNF600	57961899	0.006000	0.16342	0.227000	0.23927	0.661000	0.39034	0.720000	0.25896	0.835000	0.34877	0.184000	0.17185	GAC	ZNF600	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189190		0.373	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF600	HGNC	protein_coding	OTTHUMT00000463093.1	522	0.00	0	C	NM_198457		53270087	53270087	-1	no_errors	ENST00000338230	ensembl	human	known	69_37n	missense	661	19.76	163	SNP	1.000	G
ZNF549	256051	genome.wustl.edu	37	19	58048854	58048854	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A081-01A-11W-A019-09	TCGA-A8-A081-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d29c3a5b-aab5-4d1b-bdaf-eb6fa405bc80	a28d918c-2d16-49c9-a5f8-0cf66224f940	g.chr19:58048854G>C	ENST00000376233.3	+	4	663	c.482G>C	c.(481-483)aGa>aCa	p.R161T	ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000240719.3_Missense_Mutation_p.R148T|ZNF549_ENST00000602149.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAACACATCAGAAAGGAGGAG	0.453																																						dbGAP											0													73.0	68.0	69.0					19																	58048854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.482G>C	19.37:g.58048854G>C	ENSP00000365407:p.Arg161Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R161T	ENST00000376233.3	37	c.482	CCDS56106.1	19	.	.	.	.	.	.	.	.	.	.	G	8.889	0.953619	0.18431	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.06849	3.27;3.25	2.76	-4.17	0.03857	.	.	.	.	.	T	0.03651	0.0104	N	0.19112	0.55	0.09310	N	1	B;B	0.33694	0.421;0.232	B;B	0.26517	0.055;0.07	T	0.37596	-0.9699	9	0.56958	D	0.05	.	1.8922	0.03250	0.1259:0.1378:0.2119:0.5244	.	161;148	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	T	148;161	ENSP00000240719:R148T;ENSP00000365407:R161T	ENSP00000240719:R148T	R	+	2	0	ZNF549	62740666	0.003000	0.15002	0.001000	0.08648	0.085000	0.17905	-0.283000	0.08433	-0.437000	0.07243	0.655000	0.94253	AGA	ZNF549	-	NULL	ENSG00000121406		0.453	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF549	HGNC	protein_coding	OTTHUMT00000466780.1	173	0.00	0	G	NM_153263		58048854	58048854	+1	no_errors	ENST00000376233	ensembl	human	known	69_37n	missense	255	16.39	50	SNP	0.000	C
