#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ATF6B	1388	genome.wustl.edu	37	6	32088603	32088603	+	Silent	SNP	T	T	C			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr6:32088603T>C	ENST00000375203.3	-	8	809	c.777A>G	c.(775-777)agA>agG	p.R259R	ATF6B_ENST00000375201.4_Silent_p.R256R	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	259					response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						GAGGCACAGCTCTGGATGGCA	0.607																																						dbGAP											0													177.0	172.0	174.0					6																	32088603		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.777A>G	6.37:g.32088603T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	Silent	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.R259	ENST00000375203.3	37	c.777	CCDS4737.1	6																																																																																			ATF6B	-	NULL	ENSG00000213676		0.607	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATF6B	HGNC	protein_coding	OTTHUMT00000076638.2	101	0.00	0	T			32088603	32088603	-1	no_errors	ENST00000375203	ensembl	human	known	69_37n	silent	104	38.10	64	SNP	0.824	C
CLCNKB	1188	genome.wustl.edu	37	1	16373087	16373087	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr1:16373087G>A	ENST00000375679.4	+	4	398	c.287G>A	c.(286-288)tGg>tAg	p.W96*	CLCNKB_ENST00000375667.3_5'Flank	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	96					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TATCTCTCCTGGACTGTGTAC	0.617																																						dbGAP											0													126.0	94.0	105.0					1																	16373087		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.287G>A	1.37:g.16373087G>A	ENSP00000364831:p.Trp96*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUY3|Q5T5Q7|Q5T5Q8	Nonsense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-K	p.W96*	ENST00000375679.4	37	c.287	CCDS168.1	1	.	.	.	.	.	.	.	.	.	.	g	32	5.125582	0.94429	.	.	ENSG00000184908	ENST00000375679;ENST00000331579	.	.	.	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6978	0.77515	0.0:0.0:1.0:0.0	.	.	.	.	X	96	.	ENSP00000332055:W96X	W	+	2	0	CLCNKB	16245674	1.000000	0.71417	1.000000	0.80357	0.614000	0.37383	7.054000	0.76649	1.931000	0.55961	0.313000	0.20887	TGG	CLCNKB	-	superfamily_Cl-channel_core	ENSG00000184908		0.617	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCNKB	HGNC	protein_coding	OTTHUMT00000026331.1	23	0.00	0	G	NM_000085		16373087	16373087	+1	no_errors	ENST00000375679	ensembl	human	known	69_37n	nonsense	22	24.14	7	SNP	1.000	A
DEFB105A	245908	genome.wustl.edu	37	8	7679549	7679549	+	Missense_Mutation	SNP	C	C	T	rs200757797		TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr8:7679549C>T	ENST00000334773.6	-	3	268	c.218G>A	c.(217-219)tGc>tAc	p.C73Y		NM_152250.1	NP_689463.1	Q8NG35	D105A_HUMAN	defensin, beta 105A	73					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				lung(2)|skin(1)	3				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		CTGTCTGCAGCAGAGAAAGTT	0.483																																						dbGAP											0													2.0	2.0	2.0					8																	7679549		1339	2913	4252	-	-	-	SO:0001583	missense	0			AB089180	CCDS34832.1	8p23.1	2011-03-29	2005-02-28	2005-03-03	ENSG00000186562	ENSG00000186562		"""Defensins, beta"""	18087	protein-coding gene	gene with protein product			"""defensin, beta 105"""	DEFB105		11854508, 12734011	Standard	NM_152250		Approved	DEFB-5	uc011kwp.2	Q8NG35	OTTHUMG00000150011	ENST00000334773.6:c.218G>A	8.37:g.7679549C>T	ENSP00000334330:p.Cys73Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A581|Q8IZN8	Missense_Mutation	SNP	NULL	p.C73Y	ENST00000334773.6	37	c.218	CCDS34832.1	8	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747567	0.30955	.	.	ENSG00000186562	ENST00000334773	D	0.99270	-5.66	3.1	2.16	0.27623	.	0.160540	0.30076	N	0.010461	D	0.98298	0.9436	.	.	.	0.20764	N	0.999856	.	.	.	.	.	.	D	0.96415	0.9307	7	0.87932	D	0	-9.8301	7.9374	0.29937	0.0:0.7452:0.2548:0.0	.	.	.	.	Y	73	ENSP00000334330:C73Y	ENSP00000334330:C73Y	C	-	2	0	DEFB105A	7716959	0.871000	0.30034	0.185000	0.23176	0.020000	0.10135	2.543000	0.45752	0.810000	0.34279	0.543000	0.68304	TGC	DEFB105A	-	NULL	ENSG00000186562		0.483	DEFB105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB105A	HGNC	protein_coding	OTTHUMT00000315758.2	36	0.00	0	C	NM_152250		7679549	7679549	-1	no_errors	ENST00000334773	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.244	T
DFFB	1677	genome.wustl.edu	37	1	3782540	3782540	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr1:3782540G>A	ENST00000378209.3	+	3	729	c.406G>A	c.(406-408)Gct>Act	p.A136T	DFFB_ENST00000338895.3_Missense_Mutation_p.A136T	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	136					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		CGAGACCCGGGCTGAGGACCC	0.632																																						dbGAP											0													10.0	12.0	11.0					1																	3782540		2188	4290	6478	-	-	-	SO:0001583	missense	0				CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.406G>A	1.37:g.3782540G>A	ENSP00000367454:p.Ala136Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_Apoptosis_DFF40,pfam_CAD,smart_CAD,pfscan_CAD	p.A136T	ENST00000378209.3	37	c.406	CCDS52.1	1	.	.	.	.	.	.	.	.	.	.	G	8.453	0.853497	0.17106	.	.	ENSG00000169598	ENST00000378209;ENST00000338895;ENST00000339350;ENST00000378206	T;T	0.30981	1.51;1.51	5.12	3.25	0.37280	Apoptosis, DNA fragmentation factor 40kDa (1);	0.808617	0.11713	N	0.536664	T	0.24353	0.0590	L	0.40543	1.245	0.09310	N	0.999998	B;B;B;B	0.20988	0.003;0.029;0.05;0.003	B;B;B;B	0.24701	0.008;0.055;0.034;0.008	T	0.27872	-1.0061	10	0.28530	T	0.3	-8.1621	6.7199	0.23325	0.2882:0.0:0.7118:0.0	.	160;72;136;136	B4DZS0;Q5SR21;O76075-2;O76075	.;.;.;DFFB_HUMAN	T	136;136;72;72	ENSP00000367454:A136T;ENSP00000339524:A136T	ENSP00000339524:A136T	A	+	1	0	DFFB	3772400	0.944000	0.32072	0.370000	0.25965	0.754000	0.42855	2.758000	0.47565	0.556000	0.29098	0.462000	0.41574	GCT	DFFB	-	pfam_Apoptosis_DFF40	ENSG00000169598		0.632	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFFB	HGNC	protein_coding	OTTHUMT00000009821.2	10	0.00	0	G	NM_001282669		3782540	3782540	+1	no_errors	ENST00000378209	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.015	A
FBXO24	26261	genome.wustl.edu	37	7	100187288	100187289	+	Intron	INS	-	-	G			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr7:100187288_100187289insG	ENST00000241071.6	+	2	361				FBXO24_ENST00000468962.1_Intron|FBXO24_ENST00000498195.1_Intron|FBXO24_ENST00000360609.2_Intron|PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000427939.2_Frame_Shift_Ins_p.R9fs|FBXO24_ENST00000465843.1_Intron	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24						protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCAGCAGGAACGGGGGGGCCAA	0.644																																						dbGAP											0									,,	9,2969		0,9,1480					,,	2.0	0.1			33	5,6263		1,3,3130	no	intron,frameshift,intron	FBXO24	NM_033506.2,NM_012172.4,NM_001163499.1	,,	1,12,4610	A1A1,A1R,RR		0.0798,0.3022,0.1514	,,	,,		14,9232				-	-	-	SO:0001627	intron_variant	0			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.40-311->G	7.37:g.100187295_100187295dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2D4|B4DX91|B4DY42|Q9H0G1	Frame_Shift_Ins	INS	pfam_F-box_dom_cyclin-like,pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like,pfscan_Reg_chr_condens	p.Q12fs	ENST00000241071.6	37	c.25_26	CCDS5698.1	7																																																																																			FBXO24	-	NULL	ENSG00000106336		0.644	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO24	HGNC	protein_coding	OTTHUMT00000356104.1	10	0.00	0	-			100187288	100187289	+1	no_errors	ENST00000427939	ensembl	human	known	69_37n	frame_shift_ins	18	14.29	3	INS	0.039:0.000	G
KIF1C	10749	genome.wustl.edu	37	17	4926901	4926901	+	Frame_Shift_Del	DEL	C	C	-	rs147017530		TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr17:4926901delC	ENST00000320785.5	+	23	3124	c.2767delC	c.(2767-2769)cggfs	p.R923fs		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	923					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						AAGCTGGGAGCGGGTGTCACG	0.687																																					Melanoma(96;1023 1447 10250 19259 33730)	dbGAP											0													34.0	33.0	33.0					17																	4926901		2202	4297	6499	-	-	-	SO:0001589	frameshift_variant	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2767delC	17.37:g.4926901delC	ENSP00000320821:p.Arg923fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTL6|O75186|Q5U618	Frame_Shift_Del	DEL	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R923fs	ENST00000320785.5	37	c.2767	CCDS11065.1	17																																																																																			KIF1C	-	NULL	ENSG00000129250		0.687	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1	21	0.00	0	C			4926901	4926901	+1	no_errors	ENST00000320785	ensembl	human	known	69_37n	frame_shift_del	6	53.85	7	DEL	1.000	-
LYSMD3	116068	genome.wustl.edu	37	5	89815283	89815284	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr5:89815283_89815284delCT	ENST00000315948.6	-	3	417_418	c.273_274delAG	c.(271-276)agagttfs	p.RV91fs	LYSMD3_ENST00000500869.2_Intron|LYSMD3_ENST00000509384.1_Intron	NM_198273.1	NP_938014.1	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain containing 3	91						integral component of membrane (GO:0016021)				breast(2)|large_intestine(1)|lung(2)|prostate(1)|urinary_tract(1)	7		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		AGATTGTTAACTCTCTTGATAT	0.361																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BX537972	CCDS43338.1, CCDS68911.1	5q14.3	2010-12-09			ENSG00000176018	ENSG00000176018			26969	protein-coding gene	gene with protein product							Standard	NM_001286812		Approved	FLJ13542	uc003kjr.3	Q7Z3D4	OTTHUMG00000162667	ENST00000315948.6:c.273_274delAG	5.37:g.89815287_89815288delCT	ENSP00000314518:p.Arg91fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9U0|Q6PEK0|Q9NTE9	Frame_Shift_Del	DEL	pfam_Peptidoglycan-bd_lysin,smart_Peptidoglycan-bd_Lysin_subgr	p.R91fs	ENST00000315948.6	37	c.274_273	CCDS43338.1	5																																																																																			LYSMD3	-	pfam_Peptidoglycan-bd_lysin,smart_Peptidoglycan-bd_Lysin_subgr	ENSG00000176018		0.361	LYSMD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYSMD3	HGNC	protein_coding	OTTHUMT00000369987.2	113	0.00	0	CT	XM_371760		89815283	89815284	-1	no_errors	ENST00000315948	ensembl	human	known	69_37n	frame_shift_del	135	19.05	32	DEL	1.000:0.998	-
MAP3K1	4214	genome.wustl.edu	37	5	56177874	56177875	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr5:56177874_56177875delAG	ENST00000399503.3	+	14	2847_2848	c.2847_2848delAG	c.(2845-2850)acagagfs	p.E950fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	950					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		caacaacaacaGAGCAACCAAA	0.431																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2847_2848delAG	5.37:g.56177876_56177877delAG	ENSP00000382423:p.Glu950fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.E950fs	ENST00000399503.3	37	c.2847_2848	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.431	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	218	0.00	0	AG	XM_042066		56177874	56177875	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	98	60.32	152	DEL	0.928:1.000	-
NBEAL2	23218	genome.wustl.edu	37	3	47047309	47047310	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr3:47047309_47047310insG	ENST00000450053.3	+	42	6952_6953	c.6773_6774insG	c.(6772-6777)gacttcfs	p.DF2258fs	NBEAL2_ENST00000383740.2_Frame_Shift_Ins_p.DF537fs|NBEAL2_ENST00000292309.5_Frame_Shift_Ins_p.DF2074fs	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2258	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TCTCCTGAGGACTTCATCCAGC	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	Exception_encountered	3.37:g.47047309_47047310insG	ENSP00000415034:p.Asp2258fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60288|Q6P994|Q6UX91|Q8NAC9	Frame_Shift_Ins	INS	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D2258fs	ENST00000450053.3	37	c.6773_6774	CCDS46817.1	3																																																																																			NBEAL2	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000160796		0.619	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	22	0.00	0	-	XM_291064		47047309	47047310	+1	no_errors	ENST00000450053	ensembl	human	known	69_37n	frame_shift_ins	8	20.00	2	INS	1.000:1.000	G
NQO1	1728	genome.wustl.edu	37	16	69744912	69744912	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr16:69744912G>C	ENST00000320623.5	-	6	1303	c.792C>G	c.(790-792)atC>atG	p.I264M	NQO1_ENST00000439109.2_Missense_Mutation_p.I192M|NQO1_ENST00000564043.1_Missense_Mutation_p.I243M|NQO1_ENST00000379046.2_Missense_Mutation_p.I226M|NQO1_ENST00000379047.3_Missense_Mutation_p.I230M|snoU13_ENST00000459361.1_RNA|NQO1_ENST00000561500.1_Intron|CTD-2033A16.1_ENST00000562696.1_RNA	NM_000903.2	NP_000894.1	P15559	NQO1_HUMAN	NAD(P)H dehydrogenase, quinone 1	264					aging (GO:0007568)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cellular amino acid metabolic process (GO:0006521)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|poly(A) RNA binding (GO:0044822)|superoxide dismutase activity (GO:0004784)			autonomic_ganglia(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	10					Carboplatin(DB00958)|Cisplatin(DB00515)|Dicoumarol(DB00266)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|Menadione(DB00170)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	TGTCAGTTGGGATGGACTTGC	0.423																																						dbGAP											0													162.0	163.0	163.0					16																	69744912		2198	4300	6498	-	-	-	SO:0001583	missense	0			M81600	CCDS10883.1, CCDS32471.1, CCDS32472.1, CCDS67067.1	16q12-q22	2012-10-02	2001-11-30	2001-12-07	ENSG00000181019	ENSG00000181019	1.6.5.2		2874	protein-coding gene	gene with protein product		125860	"""diaphorase (NADH/NADPH) (cytochrome b-5 reductase)"""	NMOR1, DIA4		2843525	Standard	NM_001286137		Approved	DHQU, QR1, DTD	uc002exp.3	P15559	OTTHUMG00000137575	ENST00000320623.5:c.792C>G	16.37:g.69744912G>C	ENSP00000319788:p.Ile264Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Y9|B4DNM7|B7ZAD1|Q86UK1	Missense_Mutation	SNP	pfam_Flavodoxin_fold,pfam_FMN_red	p.I264M	ENST00000320623.5	37	c.792	CCDS10883.1	16	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320917	0.60634	.	.	ENSG00000181019	ENST00000320623;ENST00000379047;ENST00000379046;ENST00000439109	T;T;T;T	0.08807	3.05;3.05;3.05;3.05	5.86	0.227	0.15359	.	0.190627	0.46145	D	0.000317	T	0.11196	0.0273	L	0.60455	1.87	0.41802	D	0.989921	P;P;D;P	0.54601	0.757;0.929;0.967;0.834	P;P;P;P	0.51974	0.592;0.606;0.606;0.686	T	0.16070	-1.0415	10	0.72032	D	0.01	-18.0855	1.2869	0.02052	0.3661:0.1398:0.3518:0.1424	.	192;226;230;264	B4DLR8;B4DNM7;B7ZAD1;P15559	.;.;.;NQO1_HUMAN	M	264;230;226;192	ENSP00000319788:I264M;ENSP00000368335:I230M;ENSP00000368334:I226M;ENSP00000398330:I192M	ENSP00000319788:I264M	I	-	3	3	NQO1	68302413	0.957000	0.32711	0.998000	0.56505	0.940000	0.58332	-0.006000	0.12833	0.027000	0.15297	-0.182000	0.12963	ATC	NQO1	-	NULL	ENSG00000181019		0.423	NQO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NQO1	HGNC	protein_coding	OTTHUMT00000268956.2	140	0.00	0	G			69744912	69744912	-1	no_errors	ENST00000320623	ensembl	human	known	69_37n	missense	98	45.86	83	SNP	0.996	C
OPN1MW	2652	genome.wustl.edu	37	X	153461447	153461447	+	Silent	SNP	C	C	T			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chrX:153461447C>T	ENST00000369935.5	+	6	1071	c.1011C>T	c.(1009-1011)ttC>ttT	p.F337F		NM_000513.2	NP_000504.1	P04001	OPSG_HUMAN	opsin 1 (cone pigments), medium-wave-sensitive	337					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|lung(1)	2	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGCAGCTTTTCGGGAAGAAGG	0.552																																						dbGAP											0													1.0	1.0	1.0					X																	153461447		135	331	466	-	-	-	SO:0001819	synonymous_variant	0			K03494	CCDS14743.1	Xq28	2013-01-08	2008-04-16		ENSG00000147380	ENSG00000268221		"""GPCR / Class A : Opsin receptors"""	4206	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300821	"""color blindness, deutan"", ""green cone photoreceptor pigment"""	GCP, CBBM, CBD			Standard	NM_000513		Approved	OPN1MW1, COD5	uc004fkb.3	P04001	OTTHUMG00000022652	ENST00000369935.5:c.1011C>T	X.37:g.153461447C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Opsin_red/grn	p.R137W	ENST00000369935.5	37	c.409	CCDS14743.1	X	.	.	.	.	.	.	.	.	.	.	C	8.453	0.853438	0.17106	.	.	ENSG00000147380	ENST00000430054	.	.	.	2.71	-2.63	0.06133	.	.	.	.	.	T	0.50531	0.1621	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42865	-0.9426	4	.	.	.	.	7.082	0.25237	0.0:0.3617:0.0:0.6383	.	.	.	.	W	137	.	.	R	+	1	2	OPN1MW	153114641	0.986000	0.35501	0.967000	0.41034	0.942000	0.58702	0.051000	0.14141	-0.629000	0.05575	-0.802000	0.03209	CGG	OPN1MW	-	pfscan_GPCR_Rhodpsn_supfam	ENSG00000147380		0.552	OPN1MW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1MW	HGNC	protein_coding	OTTHUMT00000058771.3	73	0.00	0	C	NM_000513		153461447	153461447	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430054	ensembl	human	novel	69_37n	missense	60	15.49	11	SNP	1.000	T
OR10J1	26476	genome.wustl.edu	37	1	159409936	159409936	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr1:159409936G>A	ENST00000423932.3	+	1	425	c.388G>A	c.(388-390)Gga>Aga	p.G130R	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	130					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					CACAGCAATGGGATATGACCG	0.502																																						dbGAP											0													116.0	102.0	107.0					1																	159409936		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.388G>A	1.37:g.159409936G>A	ENSP00000399078:p.Gly130Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G130R	ENST00000423932.3	37	c.388	CCDS1185.1	1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764490	0.69878	.	.	ENSG00000196184	ENST00000423932	T	0.01359	4.98	4.49	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41097	D	0.000958	T	0.02888	0.0086	M	0.80847	2.515	0.42351	D	0.992374	D	0.58620	0.983	P	0.58013	0.831	T	0.30909	-0.9962	10	0.87932	D	0	.	9.6312	0.39780	0.1053:0.0:0.8947:0.0	.	130	P30954	O10J1_HUMAN	R	130	ENSP00000399078:G130R	ENSP00000399078:G130R	G	+	1	0	OR10J1	157676560	1.000000	0.71417	0.871000	0.34182	0.892000	0.51952	3.126000	0.50477	1.190000	0.43042	0.655000	0.94253	GGA	OR10J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196184		0.502	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J1	HGNC	protein_coding	OTTHUMT00000059020.1	238	0.00	0	G	NM_012351		159409936	159409936	+1	no_errors	ENST00000423932	ensembl	human	known	69_37n	missense	150	36.17	85	SNP	1.000	A
PLXNC1	10154	genome.wustl.edu	37	12	94620410	94620410	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr12:94620410C>T	ENST00000258526.4	+	8	2069	c.1820C>T	c.(1819-1821)gCg>gTg	p.A607V		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	607					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ACTGGCTGCGCGTGGTGTAAA	0.443																																						dbGAP											0													156.0	142.0	147.0					12																	94620410		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1820C>T	12.37:g.94620410C>T	ENSP00000258526:p.Ala607Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59H25	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Plexin_repeat,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Plexin-like_fold,superfamily_Ig_E-set,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.A607V	ENST00000258526.4	37	c.1820	CCDS9049.1	12	.	.	.	.	.	.	.	.	.	.	C	8.681	0.905085	0.17760	.	.	ENSG00000136040	ENST00000258526	T	0.06849	3.25	5.71	5.71	0.89125	.	0.526294	0.21670	N	0.070895	T	0.08980	0.0222	L	0.53249	1.67	0.80722	D	1	P	0.35011	0.48	B	0.28991	0.097	T	0.18304	-1.0341	10	0.09843	T	0.71	.	15.7376	0.77859	0.0:1.0:0.0:0.0	.	607	O60486	PLXC1_HUMAN	V	607	ENSP00000258526:A607V	ENSP00000258526:A607V	A	+	2	0	PLXNC1	93144541	0.903000	0.30736	0.925000	0.36789	0.004000	0.04260	3.494000	0.53273	2.873000	0.98535	0.561000	0.74099	GCG	PLXNC1	-	superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000136040		0.443	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNC1	HGNC	protein_coding	OTTHUMT00000408126.2	190	0.00	0	C			94620410	94620410	+1	no_errors	ENST00000258526	ensembl	human	known	69_37n	missense	183	30.68	81	SNP	0.886	T
POLR1B	84172	genome.wustl.edu	37	2	113333168	113333168	+	Silent	SNP	C	C	T			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr2:113333168C>T	ENST00000263331.5	+	15	3850	c.3270C>T	c.(3268-3270)gcC>gcT	p.A1090A	POLR1B_ENST00000417433.2_Silent_p.A1034A|POLR1B_ENST00000537335.1_Silent_p.A879A|POLR1B_ENST00000541869.1_Silent_p.A1128A|POLR1B_ENST00000409894.3_Silent_p.A907A	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	1090					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CTTGGTCTGCCATGCGCAACA	0.483																																					Ovarian(16;256 576 9537 23969 41147)	dbGAP											0													136.0	116.0	123.0					2																	113333168		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.3270C>T	2.37:g.113333168C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Silent	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.A1128	ENST00000263331.5	37	c.3384	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	C	8.769	0.925458	0.18056	.	.	ENSG00000125630	ENST00000536096	.	.	.	5.38	3.55	0.40652	.	.	.	.	.	T	0.65228	0.2671	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65220	-0.6221	5	0.72032	D	0.01	-9.8002	9.4579	0.38767	0.0:0.7695:0.1503:0.0802	.	.	.	.	Y	449	.	ENSP00000441192:H449Y	H	+	1	0	POLR1B	113049639	0.993000	0.37304	0.951000	0.38953	0.995000	0.86356	0.573000	0.23699	0.612000	0.30071	0.563000	0.77884	CAT	POLR1B	-	pfam_RNA_pol_Rpb2_7	ENSG00000125630		0.483	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	241	0.00	0	C	NM_019014		113333168	113333168	+1	no_errors	ENST00000541869	ensembl	human	known	69_37n	silent	169	32.94	83	SNP	1.000	T
SBF1	6305	genome.wustl.edu	37	22	50899119	50899119	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr22:50899119delT	ENST00000390679.3	-	24	3174	c.2990delA	c.(2989-2991)gagfs	p.E998fs	SBF1_ENST00000348911.6_Frame_Shift_Del_p.E999fs|SBF1_ENST00000380817.3_Frame_Shift_Del_p.E998fs			O95248	MTMR5_HUMAN	SET binding factor 1	998					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CCCCACCTCCTCGTCAAAGGC	0.622																																						dbGAP											0													81.0	85.0	84.0					22																	50899119		1984	4149	6133	-	-	-	SO:0001589	frameshift_variant	0			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.2990delA	22.37:g.50899119delT	ENSP00000375097:p.Glu998fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Frame_Shift_Del	DEL	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotub-related,pfam_dDENN_dom,pfam_GRAM,pfam_Pleckstrin_homology,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.E997fs	ENST00000390679.3	37	c.2990		22																																																																																			SBF1	-	NULL	ENSG00000100241		0.622	SBF1-201	KNOWN	basic	protein_coding	SBF1	HGNC	protein_coding		62	0.00	0	T			50899119	50899119	-1	no_errors	ENST00000380817	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000	-
SH3TC1	54436	genome.wustl.edu	37	4	8242514	8242514	+	Silent	SNP	G	G	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr4:8242514G>A	ENST00000245105.3	+	18	3910	c.3843G>A	c.(3841-3843)acG>acA	p.T1281T	SH3TC1_ENST00000539824.1_Silent_p.T1205T	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	1281										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						AGATCTACACGCGGCTGGCCA	0.607																																					NSCLC(145;2298 2623 35616 37297)	dbGAP											0													86.0	88.0	87.0					4																	8242514		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.3843G>A	4.37:g.8242514G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5G5	Silent	SNP	superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.T1281	ENST00000245105.3	37	c.3843	CCDS3399.1	4																																																																																			SH3TC1	-	NULL	ENSG00000125089		0.607	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH3TC1	HGNC	protein_coding	OTTHUMT00000206991.2	12	0.00	0	G	NM_018986		8242514	8242514	+1	no_errors	ENST00000245105	ensembl	human	known	69_37n	silent	10	33.33	5	SNP	0.071	A
SLC41A1	254428	genome.wustl.edu	37	1	205764571	205764571	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr1:205764571G>A	ENST00000367137.3	-	9	2122	c.1108C>T	c.(1108-1110)Cgc>Tgc	p.R370C	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	370					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GTGGAGATGCGGCTGGCCTGC	0.572																																						dbGAP											0													65.0	54.0	58.0					1																	205764571		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.1108C>T	1.37:g.205764571G>A	ENSP00000356105:p.Arg370Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	pfam_MgtE_Mg_transptr_membr	p.R370C	ENST00000367137.3	37	c.1108	CCDS30988.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783140	0.90282	.	.	ENSG00000133065	ENST00000367137	T	0.35236	1.32	5.35	5.35	0.76521	MgtE magnesium transporter, integral membrane (1);	0.000000	0.85682	D	0.000000	T	0.67107	0.2858	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73880	-0.3843	10	0.87932	D	0	-6.5432	13.7702	0.63019	0.0:0.0:0.8464:0.1536	.	370	Q8IVJ1	S41A1_HUMAN	C	370	ENSP00000356105:R370C	ENSP00000356105:R370C	R	-	1	0	SLC41A1	204031194	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.329000	0.79170	2.776000	0.95493	0.655000	0.94253	CGC	SLC41A1	-	pfam_MgtE_Mg_transptr_membr	ENSG00000133065		0.572	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A1	HGNC	protein_coding	OTTHUMT00000087731.1	34	0.00	0	G			205764571	205764571	-1	no_errors	ENST00000367137	ensembl	human	known	69_37n	missense	38	35.59	21	SNP	1.000	A
SLC6A11	6538	genome.wustl.edu	37	3	10967723	10967723	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr3:10967723C>T	ENST00000254488.2	+	9	1220	c.1154C>T	c.(1153-1155)gCg>gTg	p.A385V		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	385					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	TACCCCAAGGCGGTCACCATG	0.582																																						dbGAP											0													244.0	251.0	249.0					3																	10967723		2203	4300	6503	-	-	-	SO:0001583	missense	0			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1154C>T	3.37:g.10967723C>T	ENSP00000254488:p.Ala385Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6U6|Q8IYC9	Missense_Mutation	SNP	pfam_Na/ntran_symport,superfamily_S-AdoMet_deCO2ase_core,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT3,pfscan_Na/ntran_symport	p.A385V	ENST00000254488.2	37	c.1154	CCDS2602.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.475023	0.96291	.	.	ENSG00000132164	ENST00000254488	T	0.75477	-0.94	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.87838	0.6278	M	0.87682	2.9	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	D	0.89632	0.3856	10	0.62326	D	0.03	.	18.7333	0.91744	0.0:1.0:0.0:0.0	.	385	P48066	S6A11_HUMAN	V	385	ENSP00000254488:A385V	ENSP00000254488:A385V	A	+	2	0	SLC6A11	10942723	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.639000	0.83342	2.419000	0.82065	0.561000	0.74099	GCG	SLC6A11	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000132164		0.582	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A11	HGNC	protein_coding	OTTHUMT00000251927.1	485	0.00	0	C	NM_014229		10967723	10967723	+1	no_errors	ENST00000254488	ensembl	human	known	69_37n	missense	290	34.38	153	SNP	1.000	T
SON	6651	genome.wustl.edu	37	21	34924651	34924651	+	Silent	SNP	G	G	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr21:34924651G>A	ENST00000356577.4	+	3	3589	c.3114G>A	c.(3112-3114)gaG>gaA	p.E1038E	SON_ENST00000381679.4_Silent_p.E1038E|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Silent_p.E1038E|SON_ENST00000290239.6_Silent_p.E1038E	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1038	14 X 6 AA repeats of [ED]-R-S-M-M-S.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CAGCCTACGAGCGCTCTATGA	0.488																																						dbGAP											0													108.0	95.0	100.0					21																	34924651		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3114G>A	21.37:g.34924651G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_Ds-RNA-bd,smart_G_patch_dom,smart_Ds-RNA-bd,pfscan_G_patch_dom,pfscan_Ds-RNA-bd	p.S33N	ENST00000356577.4	37	c.98	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	G	1.762	-0.486462	0.04352	.	.	ENSG00000159140	ENST00000436227	.	.	.	6.05	6.05	0.98169	.	.	.	.	.	T	0.69602	0.3129	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66528	-0.5901	4	.	.	.	.	13.6515	0.62314	0.0:0.1548:0.8452:0.0	.	.	.	.	N	33	.	.	S	+	2	0	SON	33846521	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.949000	0.29109	2.878000	0.98634	0.650000	0.86243	AGC	SON	-	NULL	ENSG00000159140		0.488	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	128	0.00	0	G	NM_138927		34924651	34924651	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000436227	ensembl	human	novel	69_37n	missense	64	13.51	10	SNP	1.000	A
NPFF	8620	genome.wustl.edu	37	12	53899836	53899837	+	IGR	DEL	TG	TG	-			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr12:53899836_53899837delTG	ENST00000267017.3	-	0	592				TARBP2_ENST00000456234.2_Frame_Shift_Del_p.V315fs|TARBP2_ENST00000552857.1_3'UTR|TARBP2_ENST00000266987.2_Frame_Shift_Del_p.V336fs|TARBP2_ENST00000394357.2_Frame_Shift_Del_p.V315fs	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						AGCCGGCCACTGTGTGTCATGG	0.634																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		12.37:g.53899840_53899841delTG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXL4	Frame_Shift_Del	DEL	pfam_Ds-RNA-bd,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	p.C337fs	ENST00000267017.3	37	c.1005_1006	CCDS8862.1	12																																																																																			TARBP2	-	smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	ENSG00000139546		0.634	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARBP2	HGNC	protein_coding	OTTHUMT00000406301.1	27	0.00	0	TG	NM_003717		53899836	53899837	+1	no_errors	ENST00000266987	ensembl	human	known	69_37n	frame_shift_del	19	24.00	6	DEL	0.050:1.000	-
TMCC1	23023	genome.wustl.edu	37	3	129546835	129546835	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr3:129546835C>A	ENST00000393238.3	-	3	727	c.387G>T	c.(385-387)gaG>gaT	p.E129D	TMCC1_ENST00000426664.2_Missense_Mutation_p.E15D	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	129						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CCTTTGGGGCCTCTGGCTTGC	0.562																																						dbGAP											0													104.0	94.0	97.0					3																	129546835		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.387G>T	3.37:g.129546835C>A	ENSP00000376930:p.Glu129Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.E129D	ENST00000393238.3	37	c.387	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806692	0.31961	.	.	ENSG00000172765	ENST00000393238;ENST00000426664;ENST00000505616	T;T;T	0.41400	1.5;1.46;1.0	5.98	-2.13	0.07144	.	0.414682	0.25801	N	0.028209	T	0.17959	0.0431	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08391	-1.0724	10	0.16896	T	0.51	-14.0217	1.1493	0.01782	0.1645:0.3113:0.2789:0.2454	.	129	O94876	TMCC1_HUMAN	D	129;15;15	ENSP00000376930:E129D;ENSP00000389892:E15D;ENSP00000422544:E15D	ENSP00000376930:E129D	E	-	3	2	TMCC1	131029525	0.023000	0.18921	0.992000	0.48379	0.992000	0.81027	-0.903000	0.04084	-0.191000	0.10448	0.591000	0.81541	GAG	TMCC1	-	NULL	ENSG00000172765		0.562	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	HGNC	protein_coding	OTTHUMT00000356418.2	101	0.00	0	C	NM_015008		129546835	129546835	-1	no_errors	ENST00000393238	ensembl	human	known	69_37n	missense	95	34.48	50	SNP	0.588	A
UBASH3A	53347	genome.wustl.edu	37	21	43833311	43833311	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr21:43833311C>T	ENST00000319294.6	+	4	564	c.533C>T	c.(532-534)aCg>aTg	p.T178M	UBASH3A_ENST00000398367.1_Missense_Mutation_p.T178M|UBASH3A_ENST00000291535.6_Missense_Mutation_p.T178M	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	178					negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						ACCTTCGCCACGGAAGCATCT	0.627																																						dbGAP											0													56.0	53.0	54.0					21																	43833311		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.533C>T	21.37:g.43833311C>T	ENSP00000317327:p.Thr178Met	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,pfam_SH3_domain,superfamily_SH3_domain,superfamily_UBA-like,smart_SH3_domain,pfscan_SH3_domain,pfscan_UBA/transl_elong_EF1B_N_euk	p.T178M	ENST00000319294.6	37	c.533	CCDS13687.1	21	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287701	0.40494	.	.	ENSG00000160185	ENST00000291535;ENST00000319294;ENST00000398367	T;T;T	0.42131	0.98;1.83;0.98	5.35	3.53	0.40419	.	0.533554	0.18335	N	0.144370	T	0.57330	0.2046	M	0.67953	2.075	0.40372	D	0.979352	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.63113	0.911;0.911;0.852	T	0.58154	-0.7686	10	0.62326	D	0.03	-14.2515	10.5549	0.45112	0.1328:0.7979:0.0:0.0693	.	178;178;178	G5E9E4;P57075-2;P57075	.;.;UBS3A_HUMAN	M	178	ENSP00000291535:T178M;ENSP00000317327:T178M;ENSP00000381408:T178M	ENSP00000291535:T178M	T	+	2	0	UBASH3A	42706380	0.008000	0.16893	0.324000	0.25361	0.030000	0.12068	1.886000	0.39688	0.631000	0.30412	0.609000	0.83330	ACG	UBASH3A	-	NULL	ENSG00000160185		0.627	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	UBASH3A	HGNC	protein_coding	OTTHUMT00000195382.1	129	0.00	0	C	NM_001001895		43833311	43833311	+1	no_errors	ENST00000319294	ensembl	human	known	69_37n	missense	89	32.06	42	SNP	0.107	T
UBIAD1	29914	genome.wustl.edu	37	1	11333899	11333899	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr1:11333899A>C	ENST00000376810.5	+	1	637	c.311A>C	c.(310-312)tAc>tCc	p.Y104S	UBIAD1_ENST00000376804.2_Missense_Mutation_p.Y104S	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	104					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)	p.Y104S(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		GTCAACACTTACTATGACTTT	0.552																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											119.0	116.0	117.0					1																	11333899		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.311A>C	1.37:g.11333899A>C	ENSP00000366006:p.Tyr104Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQG3|Q53GX3|Q5THD4	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase	p.Y104S	ENST00000376810.5	37	c.311	CCDS129.1	1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.768866	0.90020	.	.	ENSG00000120942	ENST00000376810;ENST00000376804	D;D	0.94497	-3.44;-3.44	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.97362	0.9137	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98154	1.0443	10	0.87932	D	0	-2.129	14.2365	0.65929	1.0:0.0:0.0:0.0	.	104	Q9Y5Z9	UBIA1_HUMAN	S	104	ENSP00000366006:Y104S;ENSP00000366000:Y104S	ENSP00000366000:Y104S	Y	+	2	0	UBIAD1	11256486	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.648000	0.91062	2.010000	0.58986	0.372000	0.22366	TAC	UBIAD1	-	pfam_UbiA_prenyltransferase	ENSG00000120942		0.552	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBIAD1	HGNC	protein_coding	OTTHUMT00000005773.1	44	0.00	0	A	NM_013319		11333899	11333899	+1	no_errors	ENST00000376810	ensembl	human	known	69_37n	missense	18	26.92	7	SNP	1.000	C
WDR36	134430	genome.wustl.edu	37	5	110462515	110462515	+	Silent	SNP	C	C	A			TCGA-A8-A086-01A-11W-A019-09	TCGA-A8-A086-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	13d89926-9e4c-434f-80b4-4fb15e4426f6	1af700be-a789-4f68-bd75-290aeed2fd7b	g.chr5:110462515C>A	ENST00000513710.2	+	23	2794	c.2790C>A	c.(2788-2790)acC>acA	p.T930T	WDR36_ENST00000506538.2_Silent_p.T930T			Q8NI36	WDR36_HUMAN	WD repeat domain 36	930					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		AAAACTGGACCCATTTGCAAT	0.323																																						dbGAP											0													66.0	69.0	68.0					5																	110462515		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2790C>A	5.37:g.110462515C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUS4|Q68E02|Q8N1Q2	Silent	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T930	ENST00000513710.2	37	c.2790	CCDS4102.1	5																																																																																			WDR36	-	pfam_SSU_processome_Utp21	ENSG00000134987		0.323	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	162	0.00	0	C	NM_139281		110462515	110462515	+1	no_errors	ENST00000506538	ensembl	human	known	69_37n	silent	80	58.25	113	SNP	0.998	A
