#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48260896	48260897	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr7:48260896_48260897insT	ENST00000435803.1	+	5	482_483	c.458_459insT	c.(457-462)agttttfs	p.SF153fs		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	153					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TATGGTTCCAGTTTTTTTACAG	0.267																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.465dupT	7.37:g.48260903_48260903dupT	ENSP00000411096:p.Ser153fs	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Frame_Shift_Ins	INS	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T156fs	ENST00000435803.1	37	c.458_459	CCDS47584.1	7																																																																																			ABCA13	-	NULL	ENSG00000179869		0.267	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	12	0.00	0	-	NM_152701		48260896	48260897	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	frame_shift_ins	14	12.50	2	INS	0.915:0.933	T
ABCA8	10351	genome.wustl.edu	37	17	66872768	66872768	+	Splice_Site	SNP	C	C	A			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr17:66872768C>A	ENST00000269080.2	-	32	4293		c.e32+1		ABCA8_ENST00000586539.1_Splice_Site|ABCA8_ENST00000430352.2_Splice_Site	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8						transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CCTGCCCGTACCTTTCTCTTT	0.542																																						dbGAP											0													147.0	124.0	132.0					17																	66872768		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4155+1G>T	17.37:g.66872768C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U3|C9JQE6|Q86WW0	Splice_Site	SNP	-	e32+1	ENST00000269080.2	37	c.4275+1	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800342	0.31869	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8085	0.34952	0.0:0.893:0.0:0.107	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA8	64384363	1.000000	0.71417	0.996000	0.52242	0.255000	0.26057	5.133000	0.64764	2.157000	0.67596	0.655000	0.94253	.	ABCA8	-	-	ENSG00000141338		0.542	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	224	0.00	0	C	NM_007168	Intron	66872768	66872768	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	splice_site	189	34.03	98	SNP	1.000	A
ACACB	32	genome.wustl.edu	37	12	109637223	109637223	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr12:109637223G>T	ENST00000338432.7	+	18	2763	c.2644G>T	c.(2644-2646)Ggc>Tgc	p.G882C	ACACB_ENST00000377848.3_Missense_Mutation_p.G882C|ACACB_ENST00000377854.5_Missense_Mutation_p.G882C			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	882					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AATTACCATCGGCAATAAGAC	0.537																																						dbGAP											0													128.0	116.0	120.0					12																	109637223		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.2644G>T	12.37:g.109637223G>T	ENSP00000341044:p.Gly882Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.G882C	ENST00000338432.7	37	c.2644	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344719	0.82022	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	D;D;D	0.95885	-3.83;-3.83;-3.84	5.42	5.42	0.78866	Single hybrid motif (1);	0.046798	0.85682	D	0.000000	D	0.97773	0.9269	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.98288	1.0512	10	0.87932	D	0	.	19.1705	0.93575	0.0:0.0:1.0:0.0	.	882	O00763	ACACB_HUMAN	C	882;882;882;113	ENSP00000341044:G882C;ENSP00000367079:G882C;ENSP00000367085:G882C	ENSP00000341044:G882C	G	+	1	0	ACACB	108121606	1.000000	0.71417	0.986000	0.45419	0.972000	0.66771	6.612000	0.74187	2.700000	0.92200	0.585000	0.79938	GGC	ACACB	-	superfamily_Single_hybrid_motif	ENSG00000076555		0.537	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	86	0.00	0	G	NM_001093		109637223	109637223	+1	no_errors	ENST00000338432	ensembl	human	known	69_37n	missense	98	37.97	60	SNP	1.000	T
ARMCX5	64860	genome.wustl.edu	37	X	101858458	101858458	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chrX:101858458C>A	ENST00000604957.1	+	1	4011	c.1389C>A	c.(1387-1389)caC>caA	p.H463Q	ARMCX5_ENST00000537008.1_Missense_Mutation_p.H463Q|ARMCX5_ENST00000246174.2_Missense_Mutation_p.H463Q|ARMCX5_ENST00000372742.1_Missense_Mutation_p.H463Q|ARMCX5_ENST00000541409.1_Missense_Mutation_p.H463Q|ARMCX5_ENST00000536530.1_Missense_Mutation_p.H463Q|RP4-769N13.6_ENST00000476910.2_RNA|RP4-769N13.7_ENST00000602441.1_RNA	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	463										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						CTAAAAATCACGCCAATACAA	0.333																																						dbGAP											0													58.0	54.0	55.0					X																	101858458		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1389C>A	X.37:g.101858458C>A	ENSP00000474720:p.His463Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.H463Q	ENST00000604957.1	37	c.1389	CCDS14500.1	X	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.825555	0.00589	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63	3.97	-4.57	0.03421	Armadillo-like helical (1);Armadillo-type fold (1);	0.568258	0.14838	N	0.295423	T	0.06781	0.0173	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16424	-1.0403	10	0.37606	T	0.19	0.9803	1.4966	0.02467	0.2073:0.1418:0.3722:0.2788	.	463	Q6P1M9	ARMX5_HUMAN	Q	463	ENSP00000246174:H463Q;ENSP00000439001:H463Q;ENSP00000446385:H463Q;ENSP00000445851:H463Q;ENSP00000361827:H463Q	ENSP00000246174:H463Q	H	+	3	2	ARMCX5	101745114	0.897000	0.30589	0.106000	0.21319	0.058000	0.15608	-0.327000	0.07955	-1.113000	0.02981	-1.736000	0.00690	CAC	ARMCX5	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000125962		0.333	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX5	HGNC	protein_coding	OTTHUMT00000469659.1	605	0.17	1	C	NM_022838		101858458	101858458	+1	no_errors	ENST00000246174	ensembl	human	known	69_37n	missense	475	20.30	121	SNP	0.175	A
B9D2	80776	genome.wustl.edu	37	19	41863814	41863814	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr19:41863814T>C	ENST00000243578.3	-	3	421	c.202A>G	c.(202-204)Aaa>Gaa	p.K68E	TMEM91_ENST00000539627.1_Intron|CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000604123.1_Intron	NM_030578.3	NP_085055.2	Q9BPU9	B9D2_HUMAN	B9 protein domain 2	68	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.				cilium assembly (GO:0042384)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)	gamma-tubulin binding (GO:0043015)			large_intestine(1)|ovary(1)	2						TGAAGACCTTTGGTGGCGAAG	0.642																																						dbGAP											0													112.0	92.0	99.0					19																	41863814		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004157	CCDS12579.1	19q13.2	2014-01-28				ENSG00000123810			28636	protein-coding gene	gene with protein product		611951				21763481	Standard	NM_030578		Approved	MGC4093, MKS10	uc002oqj.2	Q9BPU9		ENST00000243578.3:c.202A>G	19.37:g.41863814T>C	ENSP00000243578:p.Lys68Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_B9_dom	p.K68E	ENST00000243578.3	37	c.202	CCDS12579.1	19	.	.	.	.	.	.	.	.	.	.	T	18.89	3.719039	0.68844	.	.	ENSG00000123810	ENST00000243578	T	0.70282	-0.47	4.48	4.48	0.54585	.	0.059957	0.64402	U	0.000005	T	0.72581	0.3478	M	0.62209	1.925	0.53005	D	0.999968	P	0.48230	0.907	P	0.54460	0.753	T	0.71310	-0.4631	10	0.02654	T	1	.	12.8847	0.58036	0.0:0.0:0.0:1.0	.	68	Q9BPU9	B9D2_HUMAN	E	68	ENSP00000243578:K68E	ENSP00000243578:K68E	K	-	1	0	B9D2	46555654	1.000000	0.71417	1.000000	0.80357	0.600000	0.36913	6.875000	0.75551	1.890000	0.54733	0.260000	0.18958	AAA	B9D2	-	pfam_B9_dom	ENSG00000123810		0.642	B9D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B9D2	HGNC	protein_coding	OTTHUMT00000463489.1	35	0.00	0	T	NM_030578		41863814	41863814	-1	no_errors	ENST00000243578	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	C
CITED2	10370	genome.wustl.edu	37	6	139694830	139694831	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr6:139694830_139694831insG	ENST00000367651.2	-	2	466_467	c.251_252insC	c.(250-252)ccgfs	p.P84fs	CITED2_ENST00000537332.1_Frame_Shift_Ins_p.P84fs|CITED2_ENST00000536159.1_Frame_Shift_Ins_p.P84fs	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	84					adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		CCAGCGCGCTCGGGGGGTGCCC	0.678																																					NSCLC(98;1219 1550 33720 43229 49330)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.252dupC	6.37:g.139694836_139694836dupG	ENSP00000356623:p.Pro84fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O95426|Q5VTF4	Frame_Shift_Ins	INS	pfam_CITED	p.S85fs	ENST00000367651.2	37	c.252_251	CCDS5195.1	6																																																																																			CITED2	-	pfam_CITED	ENSG00000164442		0.678	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CITED2	HGNC	protein_coding	OTTHUMT00000042463.1	14	0.00	0	-			139694830	139694831	-1	no_errors	ENST00000367651	ensembl	human	known	69_37n	frame_shift_ins	5	37.50	3	INS	0.699:0.771	G
CLASP1	23332	genome.wustl.edu	37	2	122122750	122122750	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr2:122122750G>A	ENST00000263710.4	-	36	4386	c.3997C>T	c.(3997-3999)Cgg>Tgg	p.R1333W	CLASP1_ENST00000541859.1_Missense_Mutation_p.R1050W|CLASP1_ENST00000397587.3_Missense_Mutation_p.R1273W|CLASP1_ENST00000545861.1_Missense_Mutation_p.R1040W|CLASP1_ENST00000409078.3_Missense_Mutation_p.R1266W|CLASP1_ENST00000541377.1_Missense_Mutation_p.R1272W|CLASP1_ENST00000455322.2_Missense_Mutation_p.R1289W	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1333	Interaction with CLIP2. {ECO:0000250}.|Interaction with PHLDB2 and RSN.|Localization to kinetochores.				axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					CTGTCTTCCCGCGTGATCTTG	0.567																																						dbGAP											0													71.0	76.0	74.0					2																	122122750		2079	4221	6300	-	-	-	SO:0001583	missense	0			AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.3997C>T	2.37:g.122122750G>A	ENSP00000263710:p.Arg1333Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.R1333W	ENST00000263710.4	37	c.3997		2	.	.	.	.	.	.	.	.	.	.	g	17.68	3.449417	0.63178	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.57	3.69	0.42338	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79986	0.4541	M	0.71581	2.175	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.995;0.996;0.991;0.997	T	0.81662	-0.0831	10	0.87932	D	0	-17.1307	13.8811	0.63682	0.0:0.0:0.419:0.581	.	1266;1273;1274;1333	E7EUA5;F5GWS0;A2RU21;Q7Z460	.;.;.;CLAP1_HUMAN	W	1333;1289;1273;1272;1050;1266;1040	ENSP00000263710:R1333W;ENSP00000389372:R1289W;ENSP00000380717:R1273W;ENSP00000441625:R1272W;ENSP00000441770:R1050W;ENSP00000386442:R1266W;ENSP00000438620:R1040W	ENSP00000263710:R1333W	R	-	1	2	CLASP1	121839220	1.000000	0.71417	0.521000	0.27850	0.564000	0.35744	4.947000	0.63583	0.758000	0.33059	0.556000	0.70494	CGG	CLASP1	-	superfamily_ARM-type_fold	ENSG00000074054		0.567	CLASP1-201	KNOWN	basic	protein_coding	CLASP1	HGNC	protein_coding		55	0.00	0	G	NM_015282		122122750	122122750	-1	no_errors	ENST00000263710	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	0.929	A
CLCN6	1185	genome.wustl.edu	37	1	11888625	11888625	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr1:11888625C>G	ENST00000346436.6	+	12	1117	c.1065C>G	c.(1063-1065)aaC>aaG	p.N355K	CLCN6_ENST00000312413.6_Intron|CLCN6_ENST00000376492.3_Intron|CLCN6_ENST00000376496.3_Missense_Mutation_p.N355K|CLCN6_ENST00000376487.3_Missense_Mutation_p.N333K	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	355					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		ACTGTCTGAACAAGAGGCTTG	0.547																																						dbGAP											0													173.0	182.0	179.0					1																	11888625		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.1065C>G	1.37:g.11888625C>G	ENSP00000234488:p.Asn355Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-6	p.N355K	ENST00000346436.6	37	c.1065	CCDS138.1	1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772369	0.90108	.	.	ENSG00000011021	ENST00000346436;ENST00000376487;ENST00000376496	D;D;D	0.94537	-3.45;-3.45;-3.45	6.07	6.07	0.98685	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.97745	0.9260	M	0.93720	3.45	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.72982	0.967;0.979	D	0.98010	1.0365	10	0.72032	D	0.01	-38.1971	12.8765	0.57994	0.0:0.9266:0.0:0.0734	.	333;355	F8W9R3;P51797	.;CLCN6_HUMAN	K	355;333;355	ENSP00000234488:N355K;ENSP00000365670:N333K;ENSP00000365679:N355K	ENSP00000234488:N355K	N	+	3	2	CLCN6	11811212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.683000	0.61679	2.884000	0.98904	0.655000	0.94253	AAC	CLCN6	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000011021		0.547	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN6	HGNC	protein_coding	OTTHUMT00000006639.2	226	0.00	0	C	NM_001286		11888625	11888625	+1	no_errors	ENST00000346436	ensembl	human	known	69_37n	missense	201	18.22	45	SNP	1.000	G
CRIPAK	285464	genome.wustl.edu	37	4	1388375	1388376	+	Frame_Shift_Ins	INS	-	-	CA	rs533172496|rs530731346|rs373032956	byFrequency	TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr4:1388375_1388376insCA	ENST00000324803.4	+	1	3036_3037	c.76_77insCA	c.(76-78)tcafs	p.S26fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	26					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCGCCTGCTCATGTGCCCAT	0.639														782	0.15615	0.1952	0.1412	5008	,	,		17889	0.0278		0.2286	False		,,,				2504	0.1718					dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.77_78dupCA	4.37:g.1388376_1388377dupCA	ENSP00000323978:p.Ser26fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Frame_Shift_Ins	INS	smart_Post-SET_dom	p.C27fs	ENST00000324803.4	37	c.76_77	CCDS3349.1	4																																																																																			CRIPAK	-	NULL	ENSG00000179979		0.639	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	39	0.00	0	-	NM_175918		1388375	1388376	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	frame_shift_ins	29	12.12	4	INS	0.039:0.487	CA
EDEM1	9695	genome.wustl.edu	37	3	5252828	5252828	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr3:5252828A>G	ENST00000256497.4	+	10	1740	c.1607A>G	c.(1606-1608)cAc>cGc	p.H536R	EDEM1_ENST00000445686.1_Missense_Mutation_p.H341R	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	536					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		ACGCTGCATCACGTCATTGAC	0.468																																						dbGAP											0													138.0	125.0	130.0					3																	5252828		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1607A>G	3.37:g.5252828A>G	ENSP00000256497:p.His536Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9C8|B4DXP3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.H536R	ENST00000256497.4	37	c.1607	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	A	18.65	3.669464	0.67814	.	.	ENSG00000134109	ENST00000256497;ENST00000445686	T;T	0.71579	-0.58;-0.58	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.73544	0.3600	L	0.43152	1.355	0.80722	D	1	P	0.42827	0.791	P	0.50270	0.636	T	0.76793	-0.2828	10	0.87932	D	0	-34.6586	15.4003	0.74834	1.0:0.0:0.0:0.0	.	536	Q92611	EDEM1_HUMAN	R	536;341	ENSP00000256497:H536R;ENSP00000394099:H341R	ENSP00000256497:H536R	H	+	2	0	EDEM1	5227828	1.000000	0.71417	0.991000	0.47740	0.939000	0.58152	8.766000	0.91728	2.028000	0.59812	0.533000	0.62120	CAC	EDEM1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47	ENSG00000134109		0.468	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	HGNC	protein_coding	OTTHUMT00000337566.2	46	0.00	0	A	NM_014674		5252828	5252828	+1	no_errors	ENST00000256497	ensembl	human	known	69_37n	missense	60	22.08	17	SNP	1.000	G
ELAVL3	1995	genome.wustl.edu	37	19	11577604	11577605	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr19:11577604_11577605insC	ENST00000359227.3	-	2	471_472	c.47_48insG	c.(46-48)ggcfs	p.G16fs	RN7SL669P_ENST00000581926.1_RNA|ELAVL3_ENST00000438662.2_Frame_Shift_Ins_p.G16fs|CTC-398G3.6_ENST00000585656.1_Frame_Shift_Ins_p.G170fs	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	16					cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						ggccggccgggcccccccccAC	0.649																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.48dupG	19.37:g.11577613_11577613dupC	ENSP00000352162:p.Gly16fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16135|Q96CL8|Q96QS9	Frame_Shift_Ins	INS	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.A18fs	ENST00000359227.3	37	c.48_47	CCDS32912.1	19																																																																																			ELAVL3	-	NULL	ENSG00000196361		0.649	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	HGNC	protein_coding	OTTHUMT00000458827.2	15	0.00	0	-	NM_001420		11577604	11577605	-1	no_errors	ENST00000359227	ensembl	human	known	69_37n	frame_shift_ins	11	21.43	3	INS	1.000:1.000	C
ERN2	10595	genome.wustl.edu	37	16	23713958	23713958	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr16:23713958C>T	ENST00000457008.2	-	9	958	c.920G>A	c.(919-921)gGa>gAa	p.G307E	ERN2_ENST00000256797.4_Missense_Mutation_p.G355E					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		CAGGGCCACTCCTGTGTGGAC	0.498																																						dbGAP											0													136.0	126.0	129.0					16																	23713958		2197	4300	6497	-	-	-	SO:0001583	missense	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.920G>A	16.37:g.23713958C>T	ENSP00000413812:p.Gly307Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_cat_dom	p.G355E	ENST00000457008.2	37	c.1064		16	.	.	.	.	.	.	.	.	.	.	c	16.41	3.115133	0.56505	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.61627	0.09;0.19	6.07	5.12	0.69794	.	0.049800	0.85682	D	0.000000	T	0.74168	0.3681	M	0.69823	2.125	0.53688	D	0.999979	B;D;P	0.89917	0.255;1.0;0.742	B;D;P	0.91635	0.305;0.999;0.715	T	0.73953	-0.3820	10	0.35671	T	0.21	.	15.4229	0.75028	0.0:0.8605:0.1395:0.0	.	307;307;307	Q76MJ5;E7ETG2;A5YM65	ERN2_HUMAN;.;.	E	355;307	ENSP00000256797:G355E;ENSP00000413812:G307E	ENSP00000256797:G355E	G	-	2	0	ERN2	23621459	0.997000	0.39634	1.000000	0.80357	0.945000	0.59286	5.229000	0.65316	1.598000	0.50083	-0.127000	0.14921	GGA	ERN2	-	NULL	ENSG00000134398		0.498	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1	105	0.93	1	C			23713958	23713958	-1	no_errors	ENST00000256797	ensembl	human	known	69_37n	missense	81	28.95	33	SNP	1.000	T
GATA3	2625	genome.wustl.edu	37	10	8115926	8115927	+	Frame_Shift_Ins	INS	-	-	C	rs182422967	byFrequency	TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr10:8115926_8115927insC	ENST00000346208.3	+	6	1727_1728	c.1272_1273insC	c.(1273-1275)ccafs	p.P425fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.P426fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	425				P -> A (in Ref. 4; AAA35870). {ECO:0000305}.	anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.S427fs*21(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CGATGCACCCGCCATCCAGCCT	0.649			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Insertion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1274dupC	10.37:g.8115928_8115928dupC	ENSP00000341619:p.Pro425fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.S426fs	ENST00000346208.3	37	c.1275_1276	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.649	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	76	0.00	0	-	NM_001002295		8115926	8115927	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	79	52.12	86	INS	0.639:0.969	C
KLHL41	10324	genome.wustl.edu	37	2	170367168	170367168	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr2:170367168G>A	ENST00000284669.1	+	1	957	c.880G>A	c.(880-882)Gac>Aac	p.D294N	RP11-724O16.1_ENST00000513963.1_Intron|BBS5_ENST00000554017.1_Intron	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	294					myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											TTACCTGAATGACATTCCCAG	0.468																																						dbGAP											0													139.0	141.0	140.0					2																	170367168		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.880G>A	2.37:g.170367168G>A	ENSP00000284669:p.Asp294Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R42	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D294N	ENST00000284669.1	37	c.880	CCDS2234.1	2	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066894	0.55539	.	.	ENSG00000239474	ENST00000284669	T	0.72725	-0.68	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.64659	0.2618	L	0.39085	1.19	0.80722	D	1	B	0.09022	0.002	B	0.15870	0.014	T	0.59053	-0.7526	10	0.40728	T	0.16	.	19.0078	0.92859	0.0:0.0:1.0:0.0	.	294	O60662	KBTBA_HUMAN	N	294	ENSP00000284669:D294N	ENSP00000284669:D294N	D	+	1	0	KBTBD10	170075414	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.006000	0.88564	2.497000	0.84241	0.467000	0.42956	GAC	KBTBD10	-	pirsf_Kelch-like_gigaxonin	ENSG00000239474		0.468	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD10	HGNC	protein_coding	OTTHUMT00000255263.1	92	0.00	0	G	NM_006063		170367168	170367168	+1	no_errors	ENST00000284669	ensembl	human	known	69_37n	missense	78	24.27	25	SNP	1.000	A
LBP	3929	genome.wustl.edu	37	20	36993284	36993284	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr20:36993284A>G	ENST00000217407.2	+	8	960	c.799A>G	c.(799-801)Atg>Gtg	p.M267V		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	267				VMSLP -> A (in Ref. 1; AAA59493). {ECO:0000305}.	acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				TGCTGCAGTCATGAGCCTTCC	0.463																																						dbGAP											0													201.0	183.0	189.0					20																	36993284		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.799A>G	20.37:g.36993284A>G	ENSP00000217407:p.Met267Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R938|O43438|Q92672|Q9H403|Q9UD66	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.M267V	ENST00000217407.2	37	c.799	CCDS13304.1	20	.	.	.	.	.	.	.	.	.	.	A	10.45	1.353775	0.24512	.	.	ENSG00000129988	ENST00000217407;ENST00000538599	T	0.09255	3.0	5.55	0.257	0.15574	Lipid-binding serum glycoprotein, C-terminal (1);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.314542	0.35677	N	0.003060	T	0.11281	0.0275	M	0.64676	1.99	0.09310	N	1	B	0.29212	0.237	B	0.35278	0.199	T	0.24119	-1.0169	10	0.26408	T	0.33	-19.8397	6.3606	0.21427	0.4909:0.259:0.0:0.2501	.	267	P18428	LBP_HUMAN	V	267	ENSP00000217407:M267V	ENSP00000217407:M267V	M	+	1	0	LBP	36426698	0.207000	0.23482	0.040000	0.18447	0.005000	0.04900	0.481000	0.22260	0.136000	0.18733	0.533000	0.62120	ATG	LBP	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom	ENSG00000129988		0.463	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBP	HGNC	protein_coding	OTTHUMT00000079174.2	98	0.00	0	A	NM_004139		36993284	36993284	+1	no_errors	ENST00000217407	ensembl	human	known	69_37n	missense	270	14.83	47	SNP	0.114	G
LDB2	9079	genome.wustl.edu	37	4	16597474	16597474	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr4:16597474C>T	ENST00000304523.5	-	3	583	c.260G>A	c.(259-261)cGt>cAt	p.R87H	LDB2_ENST00000503178.2_5'UTR|LDB2_ENST00000502640.1_Missense_Mutation_p.R87H|LDB2_ENST00000515064.1_Missense_Mutation_p.R87H|LDB2_ENST00000441778.2_Missense_Mutation_p.R87H|LDB2_ENST00000503829.1_5'UTR	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	87					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						GCTAAAGTAACGGGGGATGAG	0.488																																						dbGAP											0													74.0	65.0	68.0					4																	16597474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.260G>A	4.37:g.16597474C>T	ENSP00000306772:p.Arg87His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60619|O75480	Missense_Mutation	SNP	NULL	p.R87H	ENST00000304523.5	37	c.260	CCDS3420.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.184266|5.184266	0.94885|0.94885	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000506732|ENST00000507464	.|.	.|.	.|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83211|0.83211	0.5205|0.5205	M|M	0.86178|0.86178	2.8|2.8	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.999;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	0.991;0.998;1.0;0.998;0.999|.	D|D	0.84206|0.84206	0.0453|0.0453	9|5	0.87932|.	D|.	0|.	-8.8609|-8.8609	18.9634|18.9634	0.92685|0.92685	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	53;87;87;87;87|.	B7Z6D0;E9PFI4;G5E9Y7;O43679-2;O43679|.	.;.;.;.;LDB2_HUMAN|.	H|I	87;87;87;87;63|9	.|.	ENSP00000306772:R87H|.	R|V	-|-	2|1	0|0	LDB2|LDB2	16206572|16206572	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.445000|7.445000	0.80570|0.80570	2.793000|2.793000	0.96121|0.96121	0.563000|0.563000	0.77884|0.77884	CGT|GTT	LDB2	-	NULL	ENSG00000169744		0.488	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	70	0.00	0	C			16597474	16597474	-1	no_errors	ENST00000304523	ensembl	human	known	69_37n	missense	49	50.47	54	SNP	1.000	T
MUC3A	4584	genome.wustl.edu	37	7	100552250	100552250	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr7:100552250C>T	ENST00000319509.7	+	1	1001	c.1001C>T	c.(1000-1002)tCt>tTt	p.S334F				Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated	1999	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GTCCCTGCCTCTCCCACTGAT	0.483																																						dbGAP											0													453.0	436.0	441.0					7																	100552250		876	1991	2867	-	-	-	SO:0001583	missense	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.1001C>T	7.37:g.100552250C>T	ENSP00000324834:p.Ser334Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	Missense_Mutation	SNP	pfam_SEA,smart_EGF-like,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S334F	ENST00000319509.7	37	c.1001		7	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484468	0.44147	.	.	ENSG00000169894	ENST00000319509	T	0.15017	2.46	1.44	1.44	0.22558	.	.	.	.	.	T	0.22820	0.0551	N	0.24115	0.695	0.30974	N	0.7227589999999999	D	0.64830	0.994	D	0.67725	0.953	T	0.29882	-0.9997	8	0.66056	D	0.02	-1.475	8.768	0.34715	0.0:1.0:0.0:0.0	.	1999	Q02505	MUC3A_HUMAN	F	334	ENSP00000324834:S334F	ENSP00000324834:S334F	S	+	2	0	MUC3A	100390186	0.023000	0.18921	0.010000	0.14722	0.285000	0.27093	2.588000	0.46137	1.076000	0.40961	0.205000	0.17691	TCT	MUC3A	-	NULL	ENSG00000169894		0.483	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	MUC3A	HGNC	protein_coding	OTTHUMT00000347215.1	276	0.00	0	C	XM_001725354		100552250	100552250	+1	no_start_codon	ENST00000319509	ensembl	human	known	69_37n	missense	265	27.79	102	SNP	0.042	T
NBPF12	149013	genome.wustl.edu	37	1	146459507	146459507	+	Silent	SNP	G	G	A	rs200874728	byFrequency	TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr1:146459507G>A	ENST00000442909.2	+	74	9584	c.8748G>A	c.(8746-8748)agG>agA	p.R2916R	NBPF12_ENST00000446760.2_Intron|NBPF12_ENST00000537773.1_3'UTR|NBPF12_ENST00000309471.8_Intron|NBPF12_ENST00000446080.2_Intron			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	98						cytoplasm (GO:0005737)				ovary(2)	2						GGCTCAGCAGGGAGCTGCTGG	0.493																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.8748G>A	1.37:g.146459507G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95877	Silent	SNP	pfam_NBPF_dom	p.R2916	ENST00000442909.2	37	c.8748		1																																																																																			NBPF12	-	pfam_NBPF_dom	ENSG00000186275		0.493	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	NBPF12	HGNC	protein_coding	OTTHUMT00000102086.3	8	0.00	0	G	XM_003119146		146459507	146459507	+1	no_errors	ENST00000442909	ensembl	human	novel	69_37n	silent	3	40.00	2	SNP	0.000	A
NLGN2	57555	genome.wustl.edu	37	17	7318874	7318874	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr17:7318874C>A	ENST00000302926.2	+	6	1155	c.1082C>A	c.(1081-1083)cCc>cAc	p.P361H	NLGN2_ENST00000575301.1_Missense_Mutation_p.P361H	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	361					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GACGTGGTCCCCGATGACCCT	0.607																																						dbGAP											0													134.0	97.0	109.0					17																	7318874		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1082C>A	17.37:g.7318874C>A	ENSP00000305288:p.Pro361His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2I1	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.P361H	ENST00000302926.2	37	c.1082	CCDS11103.1	17	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099857	0.76983	.	.	ENSG00000169992	ENST00000302926	T	0.71461	-0.57	5.41	5.41	0.78517	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.87842	0.6279	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90135	0.4209	10	0.87932	D	0	.	16.7464	0.85473	0.0:1.0:0.0:0.0	.	361	Q8NFZ4	NLGN2_HUMAN	H	361	ENSP00000305288:P361H	ENSP00000305288:P361H	P	+	2	0	NLGN2	7259598	1.000000	0.71417	0.986000	0.45419	0.822000	0.46500	7.645000	0.83430	2.826000	0.97356	0.561000	0.74099	CCC	NLGN2	-	pfam_CarbesteraseB	ENSG00000169992		0.607	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN2	HGNC	protein_coding	OTTHUMT00000226941.2	35	0.00	0	C	NM_020795		7318874	7318874	+1	no_errors	ENST00000302926	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	A
PHACTR4	65979	genome.wustl.edu	37	1	28802626	28802626	+	Missense_Mutation	SNP	G	G	A	rs543331485		TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr1:28802626G>A	ENST00000373839.3	+	8	1690	c.1429G>A	c.(1429-1431)Gat>Aat	p.D477N	PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_Missense_Mutation_p.D487N	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	477					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		TAGTCCAGACGATGAAGAAGA	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		21204	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													78.0	72.0	74.0					1																	28802626		1934	4132	6066	-	-	-	SO:0001583	missense	0			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1429G>A	1.37:g.28802626G>A	ENSP00000362945:p.Asp477Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.D487N	ENST00000373839.3	37	c.1459	CCDS41293.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371989	0.82573	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.24908	1.84;1.83	5.32	4.41	0.53225	.	0.406012	0.28262	N	0.015982	T	0.45054	0.1323	M	0.64997	1.995	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.28106	-1.0054	10	0.21014	T	0.42	-6.8407	13.232	0.59949	0.0786:0.0:0.9214:0.0	.	487;477	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	N	477;487;476	ENSP00000362945:D477N;ENSP00000362942:D487N	ENSP00000362942:D487N	D	+	1	0	PHACTR4	28675213	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.180000	0.58296	1.374000	0.46228	0.655000	0.94253	GAT	PHACTR4	-	NULL	ENSG00000204138		0.388	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHACTR4	HGNC	protein_coding	OTTHUMT00000009868.4	189	0.00	0	G	NM_023923		28802626	28802626	+1	no_errors	ENST00000373836	ensembl	human	known	69_37n	missense	145	18.54	33	SNP	1.000	A
NME7	29922	genome.wustl.edu	37	1	169272390	169272390	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr1:169272390A>C	ENST00000367811.3	-	5	689	c.433T>G	c.(433-435)Ttt>Gtt	p.F145V	NME7_ENST00000469474.1_5'UTR|NME7_ENST00000472647.1_Missense_Mutation_p.F109V	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	145					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TACTTGAAAAAGGGTCTTGAC	0.284																																						dbGAP											0													59.0	57.0	58.0					1																	169272390		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.433T>G	1.37:g.169272390A>C	ENSP00000356785:p.Phe145Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.F145V	ENST00000367811.3	37	c.433	CCDS1277.1	1	.	.	.	.	.	.	.	.	.	.	A	12.57	1.977334	0.34848	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.79749	-1.3;-1.3	5.24	4.08	0.47627	.	0.106414	0.64402	D	0.000004	T	0.81351	0.4804	M	0.93939	3.475	0.54753	D	0.999989	P;P	0.44241	0.559;0.829	P;P	0.47645	0.465;0.553	T	0.80961	-0.1148	9	0.33141	T	0.24	-12.4035	9.8643	0.41134	0.8277:0.1723:0.0:0.0	.	149;145	Q59GR0;Q9Y5B8	.;NDK7_HUMAN	V	109;145	ENSP00000433341:F109V;ENSP00000356785:F145V	ENSP00000356785:F145V	F	-	1	0	NME7	167539014	1.000000	0.71417	0.893000	0.35052	0.314000	0.28054	6.072000	0.71238	0.792000	0.33850	0.377000	0.23210	TTT	NME7	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	ENSG00000143156		0.284	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	140	0.00	0	A	NM_013330		169272390	169272390	-1	no_errors	ENST00000367811	ensembl	human	known	69_37n	missense	77	44.20	61	SNP	0.994	C
PPP2R3B	28227	genome.wustl.edu	37	X	302052	302052	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chrX:302052delT	ENST00000390665.3	-	9	1183	c.1165delA	c.(1165-1167)acafs	p.T389fs		NM_013239.4	NP_037371.2	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'', beta	389	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|phosphoprotein phosphatase activity (GO:0004721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(5)|lung(5)|skin(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTGGTCGGTGTTTTTTTGTCT	0.567																																						dbGAP											0													227.0	246.0	240.0					X																	302052		1936	4146	6082	-	-	-	SO:0001589	frameshift_variant	0			AF215840	CCDS14104.1	Xp22.3 and Yp11.3	2013-01-10	2010-06-18		ENSG00000167393	ENSG00000167393		"""Pseudoautosomal regions / PAR1"", ""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	13417	protein-coding gene	gene with protein product		300339	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta"""	PPP2R3L		11173861	Standard	NM_013239		Approved	PPP2R3LY, PR48	uc004cpg.3	Q9Y5P8	OTTHUMG00000021052	ENST00000390665.3:c.1165delA	X.37:g.302052delT	ENSP00000375080:p.Thr389fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4G9|Q7RTT1|Q96H01	Frame_Shift_Del	DEL	pfscan_EF_HAND_2	p.T389fs	ENST00000390665.3	37	c.1165	CCDS14104.1	X																																																																																			PPP2R3B	-	pfscan_EF_HAND_2	ENSG00000167393		0.567	PPP2R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3B	HGNC	protein_coding	OTTHUMT00000055577.2	8	0.00	0	T	NM_013239		302052	302052	-1	no_errors	ENST00000390665	ensembl	human	known	69_37n	frame_shift_del	3	33.33	2	DEL	1.000	-
S1PR4	8698	genome.wustl.edu	37	19	3179623	3179623	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr19:3179623C>T	ENST00000246115.3	+	1	888	c.833C>T	c.(832-834)tCc>tTc	p.S278F		NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	278					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						GTCTTTGGCTCCAACCTCTGG	0.657																																					GBM(82;318 1638 33279 49708)	dbGAP											0													72.0	73.0	73.0					19																	3179623		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.833C>T	19.37:g.3179623C>T	ENSP00000246115:p.Ser278Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W612	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_EDG6_rcpt,prints_S1P_rcpt,prints_7TM_GPCR_Rhodpsn	p.S278F	ENST00000246115.3	37	c.833	CCDS12105.1	19	.	.	.	.	.	.	.	.	.	.	C	14.58	2.579019	0.46006	.	.	ENSG00000125910	ENST00000246115	T	0.38240	1.15	4.23	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.568954	0.17291	N	0.179659	T	0.38188	0.1031	L	0.51422	1.61	0.45046	D	0.998067	P	0.41673	0.759	P	0.44597	0.454	T	0.19031	-1.0318	10	0.44086	T	0.13	.	12.0669	0.53594	0.0:0.8247:0.1753:0.0	.	278	O95977	S1PR4_HUMAN	F	278	ENSP00000246115:S278F	ENSP00000246115:S278F	S	+	2	0	S1PR4	3130623	0.954000	0.32549	0.953000	0.39169	0.299000	0.27559	3.892000	0.56235	1.923000	0.55706	0.462000	0.41574	TCC	S1PR4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_EDG6_rcpt	ENSG00000125910		0.657	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR4	HGNC	protein_coding	OTTHUMT00000452517.1	20	0.00	0	C	NM_003775		3179623	3179623	+1	no_errors	ENST00000246115	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.989	T
RASGRP4	115727	genome.wustl.edu	37	19	38911748	38911748	+	Missense_Mutation	SNP	G	G	A	rs572991560		TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr19:38911748G>A	ENST00000587738.1	-	3	371	c.301C>T	c.(301-303)Cgc>Tgc	p.R101C	RASGRP4_ENST00000586305.1_Missense_Mutation_p.R101C|RASGRP4_ENST00000426920.2_Missense_Mutation_p.R101C|RASGRP4_ENST00000587753.1_Missense_Mutation_p.R101C|RASGRP4_ENST00000454404.2_Missense_Mutation_p.R101C|RASGRP4_ENST00000293062.9_Missense_Mutation_p.R101C|RASGRP4_ENST00000433821.2_Missense_Mutation_p.R101C			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	101	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTCAGCAGGCGGGCAGCCAGG	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		17801	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													53.0	59.0	57.0					19																	38911748		2104	4232	6336	-	-	-	SO:0001583	missense	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.301C>T	19.37:g.38911748G>A	ENSP00000465772:p.Arg101Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.R101C	ENST00000587738.1	37	c.301	CCDS46068.1	19	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762956	0.49574	.	.	ENSG00000171777	ENST00000433821;ENST00000293062;ENST00000426920;ENST00000405332;ENST00000454404	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	3.88	3.88	0.44766	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.072732	0.52532	D	0.000079	T	0.50120	0.1597	L	0.57536	1.79	0.50632	D	0.99988	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.996;0.996;0.993;0.996	D;D;D;P;D;P;P	0.65684	0.93;0.93;0.937;0.53;0.937;0.761;0.53	T	0.52034	-0.8629	10	0.87932	D	0	-15.5502	9.048	0.36358	0.0:0.0:0.7805:0.2195	.	101;101;101;101;101;101;101	C0LTP5;C0LTP7;C0LTP2;C0LTP4;C0LTP3;Q8TDF6-2;Q8TDF6	.;.;.;.;.;.;GRP4_HUMAN	C	101	ENSP00000411878:R101C;ENSP00000293062:R101C;ENSP00000445966:R101C;ENSP00000416463:R101C	ENSP00000293062:R101C	R	-	1	0	RASGRP4	43603588	1.000000	0.71417	0.995000	0.50966	0.325000	0.28411	2.433000	0.44793	2.174000	0.68829	0.557000	0.71058	CGC	RASGRP4	-	superfamily_Ras_GEF_dom,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000171777		0.637	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	56	0.00	0	G	NM_170604		38911748	38911748	-1	no_errors	ENST00000587738	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	0.999	A
SLC12A9	56996	genome.wustl.edu	37	7	100459398	100459398	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr7:100459398C>A	ENST00000354161.3	+	12	1701	c.1576C>A	c.(1576-1578)Cac>Aac	p.H526N	SLC12A9_ENST00000415287.1_Missense_Mutation_p.H437N|SLC12A9_ENST00000540482.1_Missense_Mutation_p.H526N|SLC12A9_ENST00000275729.3_Missense_Mutation_p.H437N|SLC12A9_ENST00000428758.1_Missense_Mutation_p.H526N	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	526					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCGGAAGGATCACGTGAAGTT	0.642																																						dbGAP											0													85.0	85.0	85.0					7																	100459398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1576C>A	7.37:g.100459398C>A	ENSP00000275730:p.His526Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Missense_Mutation	SNP	pfam_AA-permease_dom	p.H526N	ENST00000354161.3	37	c.1576	CCDS5707.1	7	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890589	0.91889	.	.	ENSG00000146828	ENST00000540482;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000539308	D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15	5.56	5.56	0.83823	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99042	0.9672	M	0.78344	2.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.99683	1.0999	10	0.54805	T	0.06	.	16.9926	0.86358	0.0:1.0:0.0:0.0	.	437;526	Q9BXP2-2;Q9BXP2	.;S12A9_HUMAN	N	526;526;437;437;526;152	ENSP00000443702:H526N;ENSP00000408301:H526N;ENSP00000275729:H437N;ENSP00000413796:H437N;ENSP00000275730:H526N	ENSP00000275729:H437N	H	+	1	0	SLC12A9	100297334	1.000000	0.71417	0.275000	0.24674	0.962000	0.63368	7.775000	0.85489	2.616000	0.88540	0.478000	0.44815	CAC	SLC12A9	-	pfam_AA-permease_dom	ENSG00000146828		0.642	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A9	HGNC	protein_coding	OTTHUMT00000342837.1	47	0.00	0	C	NM_020246		100459398	100459398	+1	no_errors	ENST00000354161	ensembl	human	known	69_37n	missense	32	38.46	20	SNP	0.999	A
SLC16A5	9121	genome.wustl.edu	37	17	73100132	73100132	+	Silent	SNP	A	A	C			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr17:73100132A>C	ENST00000450736.2	+	5	1636	c.1221A>C	c.(1219-1221)tcA>tcC	p.S407S	SLC16A5_ENST00000538213.2_Silent_p.S447S|SLC16A5_ENST00000580123.1_Silent_p.S407S|SLC16A5_ENST00000329783.4_Silent_p.S407S			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	407					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TCCTCATCTCAGCTGCCCTCT	0.552																																						dbGAP											0													129.0	121.0	124.0					17																	73100132		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.1221A>C	17.37:g.73100132A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E288	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.S407	ENST00000450736.2	37	c.1221	CCDS11713.1	17																																																																																			SLC16A5	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000170190		0.552	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	55	0.00	0	A	NM_004695		73100132	73100132	+1	no_errors	ENST00000329783	ensembl	human	known	69_37n	silent	67	19.28	16	SNP	0.042	C
THAP9	79725	genome.wustl.edu	37	4	83826044	83826045	+	In_Frame_Ins	INS	-	-	GCT			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr4:83826044_83826045insGCT	ENST00000302236.5	+	2	287_288	c.236_237insGCT	c.(235-240)aagctg>aaGCTgctg	p.80_81insL		NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	80					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				ATAAGAAGAAAGCTGAAAAAAG	0.361																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.237_239dupGCT	4.37:g.83826045_83826047dupGCT	ENSP00000305533:p.Leu80_Leu80dup	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRE2|Q59AC9	In_Frame_Ins	INS	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.81in_frame_insL	ENST00000302236.5	37	c.236_237	CCDS3598.1	4																																																																																			THAP9	-	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	ENSG00000168152		0.361	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP9	HGNC	protein_coding	OTTHUMT00000252633.1	118	0.00	0	-	NM_024672		83826044	83826045	+1	no_errors	ENST00000302236	ensembl	human	known	69_37n	in_frame_ins	57	33.72	29	INS	1.000:0.997	GCT
THSD7A	221981	genome.wustl.edu	37	7	11675946	11675946	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr7:11675946C>G	ENST00000423059.4	-	2	1084	c.833G>C	c.(832-834)gGg>gCg	p.G278A	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	278					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTTATTCTTCCCGCGTCTCCT	0.537										HNSCC(18;0.044)																												dbGAP											0													140.0	130.0	133.0					7																	11675946		1926	4131	6057	-	-	-	SO:0001583	missense	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.833G>C	7.37:g.11675946C>G	ENSP00000406482:p.Gly278Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G278A	ENST00000423059.4	37	c.833	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	C	0.155	-1.086989	0.01873	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.57907	0.37	5.62	4.74	0.60224	.	0.374020	0.33980	N	0.004379	T	0.39627	0.1085	N	0.20685	0.6	0.23930	N	0.996432	B	0.02656	0.0	B	0.04013	0.001	T	0.16012	-1.0417	10	0.28530	T	0.3	.	17.0434	0.86495	0.0:0.873:0.127:0.0	.	278	Q9UPZ6	THS7A_HUMAN	A	278	ENSP00000406482:G278A	ENSP00000262042:G278A	G	-	2	0	THSD7A	11642471	0.011000	0.17503	0.872000	0.34217	0.458000	0.32498	1.050000	0.30404	1.483000	0.48342	0.585000	0.79938	GGG	THSD7A	-	NULL	ENSG00000005108		0.537	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	169	0.00	0	C	XM_928187.2		11675946	11675946	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	missense	150	12.79	22	SNP	0.475	G
TSSK1B	83942	genome.wustl.edu	37	5	112769461	112769462	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr5:112769461_112769462insG	ENST00000390666.3	-	1	1266_1267	c.1075_1076insC	c.(1075-1077)caafs	p.Q359fs	CTD-2201G3.1_ENST00000416046.2_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000383058.4_RNA|CTD-2201G3.1_ENST00000510381.2_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	359					multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		TGGAGGCTGTTGGGGGGGCCCT	0.594																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.1076dupC	5.37:g.112769468_112769468dupG	ENSP00000375081:p.Gln359fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8D9	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q359fs	ENST00000390666.3	37	c.1076_1075	CCDS4112.1	5																																																																																			TSSK1B	-	NULL	ENSG00000212122		0.594	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK1B	HGNC	protein_coding	OTTHUMT00000250774.2	34	0.00	0	-	NM_032028		112769461	112769462	-1	no_errors	ENST00000390666	ensembl	human	known	69_37n	frame_shift_ins	21	16.00	4	INS	0.004:0.005	G
ZC3H13	23091	genome.wustl.edu	37	13	46544025	46544025	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr13:46544025C>T	ENST00000242848.4	-	14	3002	c.2654G>A	c.(2653-2655)aGa>aAa	p.R885K	ZC3H13_ENST00000282007.3_Missense_Mutation_p.R885K|ZC3H13_ENST00000378921.2_5'Flank			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	885							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TCTACCCTGTCTGTCTTCTGT	0.428																																					Esophageal Squamous(187;747 2077 11056 31291 44172)	dbGAP											0													290.0	275.0	280.0					13																	46544025		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.2654G>A	13.37:g.46544025C>T	ENSP00000242848:p.Arg885Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.R885K	ENST00000242848.4	37	c.2654		13	.	.	.	.	.	.	.	.	.	.	C	13.93	2.384217	0.42308	.	.	ENSG00000123200	ENST00000242848;ENST00000282007	T;T	0.26373	2.71;1.74	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.22704	0.0548	L	0.46741	1.465	0.80722	D	1	B;B	0.19583	0.022;0.037	B;B	0.14023	0.004;0.01	T	0.05699	-1.0869	10	0.09843	T	0.71	.	14.9567	0.71120	0.0:0.9326:0.0:0.0674	.	885;885	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	K	885	ENSP00000242848:R885K;ENSP00000282007:R885K	ENSP00000242848:R885K	R	-	2	0	ZC3H13	45442026	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.468000	0.60162	2.941000	0.99782	0.655000	0.94253	AGA	ZC3H13	-	NULL	ENSG00000123200		0.428	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1	752	0.00	0	C	NM_015070		46544025	46544025	-1	no_errors	ENST00000242848	ensembl	human	known	69_37n	missense	722	13.00	108	SNP	1.000	T
ZNF658	26149	genome.wustl.edu	37	9	40773310	40773310	+	Silent	SNP	C	C	T			TCGA-A8-A08J-01A-11W-A019-09	TCGA-A8-A08J-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae458901-e900-4aaa-bde6-3eda8912fbd5	b73ab3e7-fd15-4cc6-8cfd-aa3595bdac2b	g.chr9:40773310C>T	ENST00000602553.1	-	5	2259	c.1965G>A	c.(1963-1965)gaG>gaA	p.E655E	ZNF658_ENST00000377626.3_Silent_p.E655E|ZNF658_ENST00000441795.1_Intron			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	655					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CATAGGGTTTCTCCCCTGTGT	0.413																																						dbGAP											0													155.0	163.0	160.0					9																	40773310		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.1965G>A	9.37:g.40773310C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E655	ENST00000602553.1	37	c.1965	CCDS35023.1	9																																																																																			ZNF658	-	pfscan_Znf_C2H2	ENSG00000196409		0.413	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1	561	0.00	0	C	NM_033160		40773310	40773310	-1	no_errors	ENST00000377626	ensembl	human	known	69_37n	silent	381	24.10	121	SNP	1.000	T
