#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTSL1	92949	genome.wustl.edu	37	9	18474248	18474248	+	Silent	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr9:18474248G>C	ENST00000380548.4	+	1	357	c.18G>C	c.(16-18)cgG>cgC	p.R6R	ADAMTSL1_ENST00000380570.4_Silent_p.R6R|ADAMTSL1_ENST00000327883.7_Silent_p.R6R|ADAMTSL1_ENST00000431052.2_Silent_p.R6R|ADAMTSL1_ENST00000380566.4_Silent_p.R6R|ADAMTSL1_ENST00000276935.6_Silent_p.R6R	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	6						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GCTGCCGTCGGGCAACTCCTG	0.507																																						dbGAP											0													196.0	166.0	176.0					9																	18474248		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.18G>C	9.37:g.18474248G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_ADAM_spacer1,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Thrombospondin_1_rpt	p.R6	ENST00000380548.4	37	c.18	CCDS47954.1	9																																																																																			ADAMTSL1	-	NULL	ENSG00000178031		0.507	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	194	0.00	0	G			18474248	18474248	+1	no_errors	ENST00000327883	ensembl	human	known	69_37n	silent	55	32.93	27	SNP	1.000	C
ADCY10	55811	genome.wustl.edu	37	1	167791335	167791335	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:167791335G>A	ENST00000367851.4	-	30	4397	c.4213C>T	c.(4213-4215)Caa>Taa	p.Q1405*	ADCY10_ENST00000367848.1_Nonsense_Mutation_p.Q1313*|ADCY10_ENST00000545172.1_Nonsense_Mutation_p.Q1252*|RP1-313L4.3_ENST00000451545.1_RNA	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1405					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TTTTCGTATTGGTGTATGAAT	0.388																																						dbGAP											0													153.0	141.0	145.0					1																	167791335		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4213C>T	1.37:g.167791335G>A	ENSP00000356825:p.Gln1405*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Nonsense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.Q1405*	ENST00000367851.4	37	c.4213	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.172149	0.98688	.	.	ENSG00000143199	ENST00000545172;ENST00000271426;ENST00000367851;ENST00000367848	.	.	.	5.98	2.77	0.32553	.	0.516715	0.17957	N	0.156315	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-4.5563	14.8626	0.70392	0.0:0.4286:0.5714:0.0	.	.	.	.	X	1252;306;1405;1313	.	ENSP00000271426:Q306X	Q	-	1	0	ADCY10	166057959	0.004000	0.15560	0.004000	0.12327	0.008000	0.06430	0.417000	0.21214	0.798000	0.33994	0.650000	0.86243	CAA	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.388	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	287	0.00	0	G	NM_018417		167791335	167791335	-1	no_errors	ENST00000367851	ensembl	human	known	69_37n	nonsense	213	28.52	85	SNP	0.001	A
ANKFY1	51479	genome.wustl.edu	37	17	4111293	4111293	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:4111293G>A	ENST00000341657.4	-	6	702	c.667C>T	c.(667-669)Cat>Tat	p.H223Y	ANKFY1_ENST00000574367.1_Missense_Mutation_p.H223Y|ANKFY1_ENST00000570535.1_Missense_Mutation_p.H265Y|ANKFY1_ENST00000433651.1_Missense_Mutation_p.H223Y	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	223					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						ATGGCTTTATGTAGCGGGTAC	0.448																																						dbGAP											0													196.0	186.0	189.0					17																	4111293		1926	4138	6064	-	-	-	SO:0001583	missense	0			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.667C>T	17.37:g.4111293G>A	ENSP00000343362:p.His223Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_FYVE,pfam_BTB_POZ,superfamily_Ankyrin_rpt-contain_dom,superfamily_BTB/POZ_fold,superfamily_Znf_FYVE_PHD,smart_BTB/POZ-like,smart_Ankyrin_rpt,smart_Znf_FYVE,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like,pfscan_Znf_FYVE-rel,prints_Ankyrin_rpt	p.H265Y	ENST00000341657.4	37	c.793		17	.	.	.	.	.	.	.	.	.	.	G	31	5.059003	0.93846	.	.	ENSG00000185722	ENST00000341657;ENST00000535427;ENST00000433651	T;T	0.58210	0.64;0.35	5.58	5.58	0.84498	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.71796	0.3382	M	0.72353	2.195	0.80722	D	1	D;D;P;P;P	0.67145	0.996;0.994;0.827;0.57;0.702	D;P;B;B;B	0.75484	0.986;0.804;0.439;0.421;0.421	T	0.68217	-0.5467	10	0.32370	T	0.25	-18.1284	18.5617	0.91102	0.0:0.0:1.0:0.0	.	164;223;223;223;265	F5H754;Q9P2R3-3;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;.;ANFY1_HUMAN;.;.	Y	223;164;223	ENSP00000343362:H223Y;ENSP00000416005:H223Y	ENSP00000343362:H223Y	H	-	1	0	ANKFY1	4058042	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	7.844000	0.86867	2.636000	0.89361	0.655000	0.94253	CAT	ANKFY1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000185722		0.448	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	ANKFY1	HGNC	protein_coding	OTTHUMT00000438702.1	145	0.00	0	G	NM_016376		4111293	4111293	-1	no_errors	ENST00000570535	ensembl	human	known	69_37n	missense	66	45.00	54	SNP	1.000	A
ANKRD13C	81573	genome.wustl.edu	37	1	70781223	70781223	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:70781223G>A	ENST00000370944.4	-	4	917	c.604C>T	c.(604-606)Cag>Tag	p.Q202*	ANKRD13C_ENST00000262346.6_Nonsense_Mutation_p.Q167*	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	202					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						CTGGATTGCTGCTTAAGCTTC	0.313																																						dbGAP											0													72.0	76.0	75.0					1																	70781223		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0				CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.604C>T	1.37:g.70781223G>A	ENSP00000359982:p.Gln202*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Nonsense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q202*	ENST00000370944.4	37	c.604	CCDS648.2	1	.	.	.	.	.	.	.	.	.	.	G	39	7.736460	0.98462	.	.	ENSG00000118454	ENST00000370944;ENST00000262346	.	.	.	4.83	4.83	0.62350	.	0.059995	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	16.6893	0.85317	0.0:0.0:1.0:0.0	.	.	.	.	X	202;167	.	ENSP00000262346:Q167X	Q	-	1	0	ANKRD13C	70553811	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.606000	0.98325	2.205000	0.71048	0.467000	0.42956	CAG	ANKRD13C	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt	ENSG00000118454		0.313	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13C	HGNC	protein_coding	OTTHUMT00000025903.1	107	0.00	0	G	NM_030816		70781223	70781223	-1	no_errors	ENST00000370944	ensembl	human	known	69_37n	nonsense	67	17.28	14	SNP	1.000	A
ANKRD50	57182	genome.wustl.edu	37	4	125593162	125593162	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:125593162T>A	ENST00000504087.1	-	4	2307	c.1270A>T	c.(1270-1272)Aag>Tag	p.K424*	ANKRD50_ENST00000515641.1_Nonsense_Mutation_p.K245*	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	424										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						CATAAATACTTCTGAGTACAG	0.373																																						dbGAP											0													114.0	111.0	112.0					4																	125593162		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1270A>T	4.37:g.125593162T>A	ENSP00000425658:p.Lys424*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K424*	ENST00000504087.1	37	c.1270	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	T	46	12.867878	0.99702	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7778	0.78236	0.0:0.0:0.0:1.0	.	.	.	.	X	424;245	.	ENSP00000425658:K424X	K	-	1	0	ANKRD50	125812612	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.365000	0.79537	2.313000	0.78055	0.454000	0.30748	AAG	ANKRD50	-	NULL	ENSG00000151458		0.373	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	122	0.00	0	T	NM_020337		125593162	125593162	-1	no_errors	ENST00000504087	ensembl	human	known	69_37n	nonsense	37	49.32	36	SNP	1.000	A
ANKRD6	22881	genome.wustl.edu	37	6	90340379	90340379	+	Missense_Mutation	SNP	G	G	A	rs200296488		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:90340379G>A	ENST00000522441.1	+	16	2481	c.1840G>A	c.(1840-1842)Gtc>Atc	p.V614I	ANKRD6_ENST00000339746.4_Missense_Mutation_p.V614I|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000369408.5_Missense_Mutation_p.V579I|ANKRD6_ENST00000520793.1_Missense_Mutation_p.V550I|ANKRD6_ENST00000447838.2_Missense_Mutation_p.V609I	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	614					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		TGGGCCCTGCGTCAACAGAGG	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19036	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													25.0	28.0	27.0					6																	90340379		2055	4202	6257	-	-	-	SO:0001583	missense	0			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1840G>A	6.37:g.90340379G>A	ENSP00000430985:p.Val614Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V614I	ENST00000522441.1	37	c.1840	CCDS56441.1	6	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	4.024	0.001994	0.07819	.	.	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000447838;ENST00000522441;ENST00000520793	T;T;T;T;T	0.66995	1.25;1.24;1.23;1.24;-0.24	5.01	1.03	0.20045	.	0.253574	0.27491	N	0.019137	T	0.18676	0.0448	N	0.25647	0.755	0.18873	N	0.999984	B;B;B;B	0.28801	0.223;0.005;0.004;0.005	B;B;B;B	0.18871	0.023;0.003;0.007;0.003	T	0.25537	-1.0129	10	0.08179	T	0.78	-12.4803	4.9646	0.14083	0.4421:0.2515:0.3064:0.0	.	550;614;579;609	B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.;ANKR6_HUMAN;.;.	I	579;614;609;614;550	ENSP00000358416:V579I;ENSP00000345767:V614I;ENSP00000396771:V609I;ENSP00000430985:V614I;ENSP00000429782:V550I	ENSP00000345767:V614I	V	+	1	0	ANKRD6	90397100	0.044000	0.20184	0.172000	0.22920	0.403000	0.30841	0.628000	0.24522	0.400000	0.25396	-0.214000	0.12660	GTC	ANKRD6	-	NULL	ENSG00000135299		0.592	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANKRD6	HGNC	protein_coding	OTTHUMT00000376594.1	75	0.00	0	G			90340379	90340379	+1	no_errors	ENST00000339746	ensembl	human	known	69_37n	missense	34	46.03	29	SNP	0.023	A
APOB	338	genome.wustl.edu	37	2	21232270	21232270	+	Silent	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:21232270G>T	ENST00000233242.1	-	26	7597	c.7470C>A	c.(7468-7470)acC>acA	p.T2490T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2490					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGATGATTAAGGTTATTTTGG	0.423																																						dbGAP											0													147.0	140.0	143.0					2																	21232270		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7470C>A	2.37:g.21232270G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.T2490	ENST00000233242.1	37	c.7470	CCDS1703.1	2																																																																																			APOB	-	NULL	ENSG00000084674		0.423	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	306	0.00	0	G			21232270	21232270	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	silent	237	34.44	125	SNP	0.000	T
ATP13A5	344905	genome.wustl.edu	37	3	193044787	193044787	+	Missense_Mutation	SNP	G	G	C	rs142024330	byFrequency	TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:193044787G>C	ENST00000342358.4	-	13	1638	c.1521C>G	c.(1519-1521)aaC>aaG	p.N507K		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	507						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AGGCCTACCAGTTGTCAGCAG	0.423																																						dbGAP											0													84.0	75.0	78.0					3																	193044787		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1521C>G	3.37:g.193044787G>C	ENSP00000341942:p.Asn507Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.N507K	ENST00000342358.4	37	c.1521	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419989	0.42918	.	.	ENSG00000187527	ENST00000342358	T	0.66280	-0.2	5.69	4.82	0.62117	ATPase, cation-transporting, domain N (1);HAD-like domain (1);	0.281339	0.36555	N	0.002537	T	0.57315	0.2045	L	0.45698	1.435	0.41804	D	0.989933	B	0.21520	0.057	B	0.32211	0.142	T	0.53049	-0.8493	10	0.21540	T	0.41	-2.9435	13.4882	0.61379	0.0757:0.0:0.9243:0.0	.	507	Q4VNC0	AT135_HUMAN	K	507	ENSP00000341942:N507K	ENSP00000341942:N507K	N	-	3	2	ATP13A5	194527481	0.317000	0.24589	1.000000	0.80357	0.721000	0.41392	2.601000	0.46249	1.554000	0.49487	0.655000	0.94253	AAC	ATP13A5	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000187527		0.423	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	153	0.00	0	G	NM_198505		193044787	193044787	-1	no_errors	ENST00000342358	ensembl	human	known	69_37n	missense	79	54.34	94	SNP	1.000	C
B3GAT1	27087	genome.wustl.edu	37	11	134253872	134253872	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr11:134253872G>T	ENST00000524765.1	-	3	4867	c.323C>A	c.(322-324)aCg>aAg	p.T108K	B3GAT1_ENST00000392580.1_Missense_Mutation_p.T108K|B3GAT1_ENST00000537389.1_Missense_Mutation_p.T121K|B3GAT1_ENST00000531510.1_5'Flank|B3GAT1_ENST00000312527.4_Missense_Mutation_p.T108K			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	108					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		GTGCAGCAGCGTGTTGGCCAT	0.721																																						dbGAP											0													32.0	25.0	27.0					11																	134253872		2197	4294	6491	-	-	-	SO:0001583	missense	0			AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.323C>A	11.37:g.134253872G>T	ENSP00000433847:p.Thr108Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96FS7	Missense_Mutation	SNP	pfam_Glyco_trans_43	p.T121K	ENST00000524765.1	37	c.362	CCDS8500.1	11	.	.	.	.	.	.	.	.	.	.	G	37	6.157327	0.97334	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.82857	0.5128	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.87709	0.2565	10	0.87932	D	0	-25.0957	18.702	0.91623	0.0:0.0:1.0:0.0	.	121;108	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	K	108;108;108;121	ENSP00000376359:T108K;ENSP00000307875:T108K;ENSP00000433847:T108K;ENSP00000445983:T121K	ENSP00000307875:T108K	T	-	2	0	B3GAT1	133759082	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.844000	0.99494	2.420000	0.82092	0.561000	0.74099	ACG	B3GAT1	-	pfam_Glyco_trans_43	ENSG00000109956		0.721	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	B3GAT1	HGNC	protein_coding	OTTHUMT00000393639.1	13	0.00	0	G	NM_018644		134253872	134253872	-1	no_errors	ENST00000537389	ensembl	human	known	69_37n	missense	2	66.67	4	SNP	1.000	T
BAG3	9531	genome.wustl.edu	37	10	121429661	121429662	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr10:121429661_121429662delCC	ENST00000369085.3	+	2	785_786	c.479_480delCC	c.(478-480)gccfs	p.A160fs		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	160					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)				endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		GCGGCGGCAGCCCAGCCCCCAG	0.683																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.479_480delCC	10.37:g.121429661_121429662delCC	ENSP00000358081:p.Ala160fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L8|Q3B763|Q9NT20|Q9P120	Frame_Shift_Del	DEL	pfam_BAG_domain,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_BAG_domain,pfscan_BAG_domain,pfscan_WW_Rsp5_WWP	p.Q161fs	ENST00000369085.3	37	c.479_480	CCDS7615.1	10																																																																																			BAG3	-	NULL	ENSG00000151929		0.683	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG3	HGNC	protein_coding	OTTHUMT00000050662.1	24	0.00	0	CC	NM_004281		121429661	121429662	+1	no_errors	ENST00000369085	ensembl	human	known	69_37n	frame_shift_del	7	22.22	2	DEL	0.176:0.104	-
BEND6	221336	genome.wustl.edu	37	6	56857343	56857343	+	Silent	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:56857343C>A	ENST00000370746.3	+	3	557	c.288C>A	c.(286-288)gtC>gtA	p.V96V	BEND6_ENST00000370748.3_Silent_p.V96V|BEND6_ENST00000370750.2_Silent_p.V96V|BEND6_ENST00000370745.1_Silent_p.V96V	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	96					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						AGTCTTTGGTCATGCTTCAAG	0.358																																						dbGAP											0													142.0	146.0	145.0					6																	56857343		1817	4078	5895	-	-	-	SO:0001819	synonymous_variant	0			AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914	ENST00000370746.3:c.288C>A	6.37:g.56857343C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0W8|Q8N662|Q96NS6	Silent	SNP	pfam_BEN_domain	p.V96	ENST00000370746.3	37	c.288	CCDS43476.1	6																																																																																			BEND6	-	NULL	ENSG00000151917		0.358	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND6	HGNC	protein_coding	OTTHUMT00000041032.4	339	0.00	0	C	NM_152731		56857343	56857343	+1	no_errors	ENST00000370746	ensembl	human	known	69_37n	silent	206	19.84	51	SNP	0.998	A
BRWD1	54014	genome.wustl.edu	37	21	40571202	40571202	+	Nonsense_Mutation	SNP	C	C	A	rs4561736		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr21:40571202C>A	ENST00000333229.2	-	40	5467	c.5140G>T	c.(5140-5142)Gaa>Taa	p.E1714*	BRWD1_ENST00000380800.3_Nonsense_Mutation_p.E1714*|BRWD1_ENST00000342449.3_Nonsense_Mutation_p.E1714*	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1714					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TTTTCAGATTCATCAACATTG	0.418																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													101.0	92.0	95.0					21																	40571202		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5140G>T	21.37:g.40571202C>A	ENSP00000330753:p.Glu1714*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1714*	ENST00000333229.2	37	c.5140	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	42	9.236549	0.99110	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	.	.	.	5.16	4.27	0.50696	.	0.203975	0.33753	N	0.004591	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-3.9143	11.8932	0.52641	0.0:0.9189:0.0:0.0811	.	.	.	.	X	1714	.	ENSP00000330753:E1714X	E	-	1	0	BRWD1	39493072	0.127000	0.22367	0.191000	0.23289	0.386000	0.30323	2.303000	0.43646	1.169000	0.42739	0.655000	0.94253	GAA	BRWD1	-	NULL	ENSG00000185658		0.418	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	66	0.00	0	C	NM_033656		40571202	40571202	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	nonsense	41	32.79	20	SNP	0.574	A
BTBD17	388419	genome.wustl.edu	37	17	72352875	72352875	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:72352875T>A	ENST00000375366.3	-	3	1484	c.1358A>T	c.(1357-1359)gAg>gTg	p.E453V		NM_001080466.1	NP_001073935.1	A6NE02	BTBDH_HUMAN	BTB (POZ) domain containing 17	453					negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|lung(4)	6						AACCAGGTACTCGGAGTTGCG	0.652																																						dbGAP											0													67.0	63.0	64.0					17																	72352875		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32719.1	17q25.1	2013-01-08			ENSG00000204347	ENSG00000204347		"""BTB/POZ domain containing"""	33758	protein-coding gene	gene with protein product	"""transport and golgi organization 10 homolog A (Drosophila)"""						Standard	NM_001080466		Approved	LGALS3BPL, BTBD17A, TANGO10A	uc002jkn.2	A6NE02	OTTHUMG00000178580	ENST00000375366.3:c.1358A>T	17.37:g.72352875T>A	ENSP00000364515:p.Glu453Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.E453V	ENST00000375366.3	37	c.1358	CCDS32719.1	17	.	.	.	.	.	.	.	.	.	.	T	27.1	4.795944	0.90453	.	.	ENSG00000204347	ENST00000375366	D	0.81499	-1.5	5.17	5.17	0.71159	.	0.127747	0.51477	D	0.000091	D	0.82287	0.5004	L	0.32530	0.975	0.58432	D	0.999997	D	0.63880	0.993	P	0.58721	0.844	D	0.84506	0.0619	10	0.66056	D	0.02	-21.6351	15.0474	0.71838	0.0:0.0:0.0:1.0	.	453	A6NE02	BTBDH_HUMAN	V	453	ENSP00000364515:E453V	ENSP00000364515:E453V	E	-	2	0	BTBD17	69864470	1.000000	0.71417	0.991000	0.47740	0.939000	0.58152	6.109000	0.71528	1.956000	0.56807	0.454000	0.30748	GAG	BTBD17	-	NULL	ENSG00000204347		0.652	BTBD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD17	HGNC	protein_coding	OTTHUMT00000442542.1	23	0.00	0	T	NM_001080466		72352875	72352875	-1	no_errors	ENST00000375366	ensembl	human	known	69_37n	missense	3	75.00	9	SNP	1.000	A
BTN1A1	696	genome.wustl.edu	37	6	26509208	26509208	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:26509208T>G	ENST00000244513.6	+	7	1453	c.1387T>G	c.(1387-1389)Tgg>Ggg	p.W463G		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	463	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						CTTTTGCCTATGGTCTAGCGG	0.493																																						dbGAP											0													76.0	72.0	73.0					6																	26509208		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1387T>G	6.37:g.26509208T>G	ENSP00000244513:p.Trp463Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.W463G	ENST00000244513.6	37	c.1387	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	T	13.17	2.158110	0.38119	.	.	ENSG00000124557	ENST00000244513	T	0.66460	-0.21	5.84	4.61	0.57282	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.119890	0.39210	N	0.001432	T	0.46328	0.1387	N	0.17345	0.48	0.38878	D	0.956833	D	0.89917	1.0	D	0.81914	0.995	T	0.54105	-0.8343	10	0.07644	T	0.81	.	5.5381	0.17023	0.0:0.0861:0.1753:0.7385	.	463	Q13410	BT1A1_HUMAN	G	463	ENSP00000244513:W463G	ENSP00000244513:W463G	W	+	1	0	BTN1A1	26617187	0.979000	0.34478	0.989000	0.46669	0.842000	0.47809	-0.324000	0.07986	2.216000	0.71823	0.533000	0.62120	TGG	BTN1A1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000124557		0.493	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	HGNC	protein_coding	OTTHUMT00000043776.1	98	0.00	0	T	NM_001732		26509208	26509208	+1	no_errors	ENST00000244513	ensembl	human	known	69_37n	missense	92	17.12	19	SNP	0.696	G
C2orf16	84226	genome.wustl.edu	37	2	27802013	27802013	+	Silent	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:27802013G>C	ENST00000408964.2	+	1	2625	c.2574G>C	c.(2572-2574)ggG>ggC	p.G858G	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	858						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					CAGAATCAGGGGTTCAGAAAG	0.483																																						dbGAP											0													52.0	55.0	54.0					2																	27802013		2038	4217	6255	-	-	-	SO:0001819	synonymous_variant	0			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.2574G>C	2.37:g.27802013G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	NULL	p.G858	ENST00000408964.2	37	c.2574	CCDS42666.1	2																																																																																			C2orf16	-	NULL	ENSG00000221843		0.483	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	53	0.00	0	G	NM_032266		27802013	27802013	+1	no_errors	ENST00000408964	ensembl	human	known	69_37n	silent	62	25.30	21	SNP	0.000	C
C9orf156	51531	genome.wustl.edu	37	9	100675657	100675657	+	Intron	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr9:100675657G>C	ENST00000375119.3	-	3	486				C9orf156_ENST00000478126.1_Intron|Y_RNA_ENST00000364960.1_RNA	NM_016481.3	NP_057565.3	Q9BU70	NAP1_HUMAN	chromosome 9 open reading frame 156						viral process (GO:0016032)		hydrolase activity (GO:0016787)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)	13		Acute lymphoblastic leukemia(62;0.158)				GAGGAAAAAGGTAAAAGTAGA	0.428																																						dbGAP											0													88.0	93.0	91.0					9																	100675657		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK023069	CCDS6730.1	9q31.1	2011-03-02			ENSG00000136932	ENSG00000136932			30967	protein-coding gene	gene with protein product	"""Nef (lentivirus myristoylated factor) associated protein 1"""						Standard	NM_016481		Approved	HSPC219, NAP1	uc004axv.1	Q9BU70	OTTHUMG00000021007	ENST00000375119.3:c.409+25C>G	9.37:g.100675657G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T113|Q86SK0|Q9NXJ7|Q9P0Q7	Nonsense_Mutation	SNP	pfam_UPF0066,superfamily_UPF0066_YaeB	p.Y143*	ENST00000375119.3	37	c.429	CCDS6730.1	9	.	.	.	.	.	.	.	.	.	.	G	9.872	1.199141	0.22121	.	.	ENSG00000136932	ENST00000455506	.	.	.	5.24	-6.41	0.01938	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	0.9036	0.01279	0.3776:0.1001:0.2228:0.2994	.	.	.	.	X	143	.	ENSP00000408473:Y143X	Y	-	3	2	C9orf156	99715478	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.499000	0.06413	-1.358000	0.02177	-0.150000	0.13652	TAC	C9orf156	-	superfamily_UPF0066_YaeB	ENSG00000136932		0.428	C9orf156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf156	HGNC	protein_coding	OTTHUMT00000055401.1	151	0.00	0	G	NM_016481		100675657	100675657	-1	no_start_codon	ENST00000455506	ensembl	human	known	69_37n	nonsense	44	53.68	51	SNP	0.000	C
CACNA1E	777	genome.wustl.edu	37	1	181680207	181680207	+	Splice_Site	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:181680207T>C	ENST00000367573.2	+	8	1171		c.e8+2		CACNA1E_ENST00000360108.3_Splice_Site|CACNA1E_ENST00000358338.5_Splice_Site|CACNA1E_ENST00000526775.1_Splice_Site|CACNA1E_ENST00000357570.5_Splice_Site|CACNA1E_ENST00000367567.4_Splice_Site|CACNA1E_ENST00000367570.1_Splice_Site	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit						calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACAAAGCAGGTAGGCCTGGGG	0.607																																						dbGAP											0													41.0	47.0	45.0					1																	181680207		1990	4160	6150	-	-	-	SO:0001630	splice_region_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1171+2T>C	1.37:g.181680207T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Splice_Site	SNP	-	e8+2	ENST00000367573.2	37	c.1171+2	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.261593	0.80358	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000360108;ENST00000367573	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4052	0.67079	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1E	179946830	1.000000	0.71417	0.927000	0.36925	0.810000	0.45777	7.859000	0.86982	1.888000	0.54679	0.460000	0.39030	.	CACNA1E	-	-	ENSG00000198216		0.607	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	119	0.79	1	T	NM_000721	Intron	181680207	181680207	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	splice_site	102	12.90	16	SNP	1.000	C
CFAP36	112942	genome.wustl.edu	37	2	55763007	55763007	+	Intron	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:55763007T>C	ENST00000349456.4	+	6	685				CCDC104_ENST00000407816.3_Intron|CCDC104_ENST00000403007.3_Silent_p.F215F|CCDC104_ENST00000490934.1_Intron|CCDC104_ENST00000339012.3_Intron|CCDC104_ENST00000406691.3_Intron			Q96G28	CFA36_HUMAN												breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TACATAATTTTAAGTACAATG	0.249																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0																														ENST00000349456.4:c.537+108T>C	2.37:g.55763007T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SF0|Q53ST9|Q6UY34	Silent	SNP	pfam_ARF-like_2-bdp_dom	p.F215	ENST00000349456.4	37	c.645	CCDS1854.2	2																																																																																			CCDC104	-	NULL	ENSG00000163001		0.249	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC104	HGNC	protein_coding	OTTHUMT00000319610.2	248	0.00	0	T			55763007	55763007	+1	no_errors	ENST00000403007	ensembl	human	putative	69_37n	silent	266	18.90	62	SNP	0.001	C
CCDC168	643677	genome.wustl.edu	37	13	103386074	103386074	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr13:103386074T>G	ENST00000322527.2	-	1	3085	c.3086A>C	c.(3085-3087)gAt>gCt	p.D1029A		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1029																	AATGTCCTCATCCCGTGAGTT	0.428																																						dbGAP											0													48.0	40.0	42.0					13																	103386074		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.3086A>C	13.37:g.103386074T>G	ENSP00000320232:p.Asp1029Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N800	Missense_Mutation	SNP	NULL	p.D1029A	ENST00000322527.2	37	c.3086		13	.	.	.	.	.	.	.	.	.	.	T	7.388	0.630213	0.14257	.	.	ENSG00000175820	ENST00000322527	T	0.03524	3.9	3.0	0.5	0.16919	.	.	.	.	.	T	0.01765	0.0056	N	0.08118	0	0.09310	N	1	B	0.27732	0.187	B	0.26770	0.073	T	0.48927	-0.8991	9	0.21014	T	0.42	.	3.1329	0.06429	0.0:0.1391:0.2518:0.6091	.	1029	Q8NDH2	CC168_HUMAN	A	1029	ENSP00000320232:D1029A	ENSP00000320232:D1029A	D	-	2	0	CCDC168	102184075	0.000000	0.05858	0.001000	0.08648	0.138000	0.21146	0.086000	0.14935	0.097000	0.17492	0.460000	0.39030	GAT	CCDC168	-	NULL	ENSG00000175820		0.428	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		171	0.00	0	T	NM_001146197		103386074	103386074	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	missense	160	15.34	29	SNP	0.002	G
CCER1	196477	genome.wustl.edu	37	12	91347376	91347376	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:91347376T>A	ENST00000358859.2	-	1	1577	c.1144A>T	c.(1144-1146)Act>Tct	p.T382S	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	382																	TTTAAAAAAGTGCAGCTTATA	0.423																																						dbGAP											0													105.0	111.0	109.0					12																	91347376		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.1144A>T	12.37:g.91347376T>A	ENSP00000351727:p.Thr382Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TC47	Missense_Mutation	SNP	NULL	p.T382S	ENST00000358859.2	37	c.1144	CCDS9036.1	12	.	.	.	.	.	.	.	.	.	.	T	0.025	-1.375855	0.01214	.	.	ENSG00000197651	ENST00000358859	T	0.21932	1.98	5.41	-10.8	0.00216	.	1.244940	0.06115	N	0.667950	T	0.07999	0.0200	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.20338	-1.0278	10	0.06494	T	0.89	0.0182	4.476	0.11739	0.1683:0.3745:0.3395:0.1176	.	382	Q8TC90	CL012_HUMAN	S	382	ENSP00000351727:T382S	ENSP00000351727:T382S	T	-	1	0	C12orf12	89871507	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.464000	0.00230	-2.732000	0.00383	-1.208000	0.01637	ACT	CCER1	-	NULL	ENSG00000197651		0.423	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCER1	HGNC	protein_coding	OTTHUMT00000407142.2	209	0.48	1	T	NM_152638		91347376	91347376	-1	no_errors	ENST00000358859	ensembl	human	known	69_37n	missense	76	38.89	49	SNP	0.000	A
CCDC60	160777	genome.wustl.edu	37	12	119943035	119943035	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:119943035G>C	ENST00000327554.2	+	7	1275	c.810G>C	c.(808-810)caG>caC	p.Q270H	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	270										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TGAACACCCAGGTGACCAGCA	0.537																																						dbGAP											0													157.0	157.0	157.0					12																	119943035		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.810G>C	12.37:g.119943035G>C	ENSP00000333374:p.Gln270His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q270H	ENST00000327554.2	37	c.810	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	G	4.983	0.182541	0.09495	.	.	ENSG00000183273	ENST00000327554	T	0.23552	1.9	4.7	1.68	0.24146	.	0.769023	0.10693	N	0.644974	T	0.32941	0.0846	L	0.51422	1.61	0.09310	N	0.999999	D	0.60160	0.987	P	0.57468	0.821	T	0.13176	-1.0519	9	.	.	.	-6.7209	3.6814	0.08312	0.2065:0.0:0.6002:0.1933	.	270	Q8IWA6	CCD60_HUMAN	H	270	ENSP00000333374:Q270H	.	Q	+	3	2	CCDC60	118427418	0.996000	0.38824	0.021000	0.16686	0.001000	0.01503	2.145000	0.42207	0.413000	0.25759	-0.781000	0.03364	CAG	CCDC60	-	NULL	ENSG00000183273		0.537	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	92	0.00	0	G	NM_178499		119943035	119943035	+1	no_errors	ENST00000327554	ensembl	human	known	69_37n	missense	43	52.22	47	SNP	0.011	C
CD36	948	genome.wustl.edu	37	7	80303418	80303418	+	Silent	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr7:80303418T>G	ENST00000435819.1	+	17	2058	c.1374T>G	c.(1372-1374)gcT>gcG	p.A458A	CD36_ENST00000432207.1_Silent_p.A458A|CD36_ENST00000534394.1_Silent_p.A382A|CD36_ENST00000544133.1_3'UTR|CD36_ENST00000309881.7_Silent_p.A458A|CD36_ENST00000447544.2_Silent_p.A458A|CD36_ENST00000394788.3_Silent_p.A458A|CD36_ENST00000538969.1_Silent_p.A398A|CD36_ENST00000433696.2_Silent_p.A419A			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	458					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)	p.A458A(2)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						TGTTTGTTGCTTTTATGATTT	0.313																																						dbGAP											2	Substitution - coding silent(2)	ovary(2)											149.0	146.0	147.0					7																	80303418		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.1374T>G	7.37:g.80303418T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	pfam_CD36,prints_CD36_antigen	p.F52V	ENST00000435819.1	37	c.154	CCDS34673.1	7	.	.	.	.	.	.	.	.	.	.	T	10.03	1.237685	0.22711	.	.	ENSG00000135218	ENST00000488048	.	.	.	5.84	-2.97	0.05530	.	.	.	.	.	T	0.47967	0.1474	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44097	-0.9350	4	.	.	.	-26.4173	5.4806	0.16721	0.5064:0.288:0.0:0.2056	.	.	.	.	V	52	.	.	F	+	1	0	CD36	80141354	0.002000	0.14202	0.997000	0.53966	0.876000	0.50452	-0.805000	0.04530	-0.103000	0.12175	0.459000	0.35465	TTT	CD36	-	pfam_CD36,prints_CD36_antigen	ENSG00000135218		0.313	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD36	HGNC	protein_coding	OTTHUMT00000339767.6	364	0.00	0	T	NM_001001547		80303418	80303418	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000488048	ensembl	human	putative	69_37n	missense	262	37.02	154	SNP	0.964	G
CDH13	1012	genome.wustl.edu	37	16	83378511	83378511	+	Silent	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr16:83378511G>C	ENST00000566620.1	+	6	971	c.681G>C	c.(679-681)ggG>ggC	p.G227G	CDH13_ENST00000428848.3_Silent_p.G188G|CDH13_ENST00000268613.10_Silent_p.G274G|CDH13_ENST00000569454.1_3'UTR	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	227	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CTCTCGAGGGGCCGGTGCCTC	0.473																																						dbGAP											0													83.0	84.0	84.0					16																	83378511		1869	4095	5964	-	-	-	SO:0001819	synonymous_variant	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.681G>C	16.37:g.83378511G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G227	ENST00000566620.1	37	c.681	CCDS58486.1	16																																																																																			CDH13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000140945		0.473	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH13	HGNC	protein_coding	OTTHUMT00000432917.1	80	0.00	0	G	NM_001257		83378511	83378511	+1	no_errors	ENST00000566620	ensembl	human	known	69_37n	silent	22	62.07	36	SNP	0.423	C
CELSR1	9620	genome.wustl.edu	37	22	46777911	46777911	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr22:46777911G>A	ENST00000262738.3	-	21	6919	c.6920C>T	c.(6919-6921)aCc>aTc	p.T2307I		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2307					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGTCTGCGGGGTGGTCCTCCG	0.692																																						dbGAP											0													7.0	8.0	7.0					22																	46777911		2128	4167	6295	-	-	-	SO:0001583	missense	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6920C>T	22.37:g.46777911G>A	ENSP00000262738:p.Thr2307Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.T2307I	ENST00000262738.3	37	c.6920	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	G	9.243	1.038687	0.19669	.	.	ENSG00000075275	ENST00000262738	T	0.68331	-0.32	4.89	0.307	0.15811	Domain of unknown function DUF3497 (1);	0.828936	0.10228	U	0.700106	T	0.56688	0.2002	L	0.36672	1.1	0.09310	N	1	P;P	0.46395	0.877;0.457	P;B	0.45232	0.474;0.216	T	0.44651	-0.9314	10	0.31617	T	0.26	.	7.9978	0.30277	0.1434:0.2506:0.606:0.0	.	628;2307	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	I	2307	ENSP00000262738:T2307I	ENSP00000262738:T2307I	T	-	2	0	CELSR1	45156575	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.213000	0.17521	-0.368000	0.08040	-1.358000	0.01219	ACC	CELSR1	-	pfam_DUF3497	ENSG00000075275		0.692	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	19	0.00	0	G	NM_014246		46777911	46777911	-1	no_errors	ENST00000262738	ensembl	human	known	69_37n	missense	3	62.50	5	SNP	0.001	A
CEP95	90799	genome.wustl.edu	37	17	62510391	62510391	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:62510391A>T	ENST00000556440.2	+	4	792	c.282A>T	c.(280-282)aaA>aaT	p.K94N	CEP95_ENST00000553412.1_5'UTR|CEP95_ENST00000581056.1_Missense_Mutation_p.K94N	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	94						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AAGGAGATAAAGAATCTATTA	0.308																																						dbGAP											0													31.0	28.0	29.0					17																	62510391		1701	3811	5512	-	-	-	SO:0001583	missense	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.282A>T	17.37:g.62510391A>T	ENSP00000450461:p.Lys94Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMD2|Q96M81	Nonsense_Mutation	SNP	NULL	p.R22*	ENST00000556440.2	37	c.64	CCDS45763.1	17	.	.	.	.	.	.	.	.	.	.	A	12.16	1.853853	0.32791	.	.	ENSG00000258890	ENST00000556440	T	0.33865	1.39	5.41	-0.89	0.10577	.	0.332965	0.35067	N	0.003470	T	0.20210	0.0486	L	0.33485	1.01	0.80722	D	1	B	0.15141	0.012	B	0.16722	0.016	T	0.04413	-1.0953	10	0.29301	T	0.29	-8.9846	4.0292	0.09701	0.4091:0.0:0.2586:0.3323	.	94	Q96GE4	CEP95_HUMAN	N	94	ENSP00000450461:K94N	ENSP00000437744:K94N	K	+	3	2	CEP95	59940853	0.999000	0.42202	0.995000	0.50966	0.986000	0.74619	0.672000	0.25187	-0.128000	0.11641	0.477000	0.44152	AAA	CEP95	-	NULL	ENSG00000258890		0.308	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	70	0.00	0	A	NM_138363		62510391	62510391	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000582724	ensembl	human	putative	69_37n	nonsense	50	30.56	22	SNP	0.895	T
CNTN1	1272	genome.wustl.edu	37	12	41337509	41337509	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:41337509G>A	ENST00000551295.2	+	13	1607	c.1490G>A	c.(1489-1491)gGa>gAa	p.G497E	CNTN1_ENST00000547849.1_Missense_Mutation_p.G497E|CNTN1_ENST00000347616.1_Missense_Mutation_p.G497E|CNTN1_ENST00000547702.1_Missense_Mutation_p.G497E|CNTN1_ENST00000348761.2_Missense_Mutation_p.G486E|CNTN1_ENST00000360099.3_Missense_Mutation_p.G497E	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	497	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AATAGCACTGGAACCCTTGTT	0.353																																						dbGAP											0													110.0	107.0	108.0					12																	41337509		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1490G>A	12.37:g.41337509G>A	ENSP00000447006:p.Gly497Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G497E	ENST00000551295.2	37	c.1490	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	G	17.44	3.390636	0.62066	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.2	4.24	0.50183	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.054529	0.64402	D	0.000001	D	0.82595	0.5071	M	0.85710	2.77	0.49582	D	0.999803	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.77557	0.978;0.978;0.99	D	0.85465	0.1169	10	0.72032	D	0.01	.	14.9886	0.71368	0.0:0.2508:0.7492:0.0	.	497;486;497	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	E	497;497;497;497;497;486	ENSP00000448004:G497E;ENSP00000447006:G497E;ENSP00000448653:G497E;ENSP00000325660:G497E;ENSP00000353213:G497E;ENSP00000261160:G486E	ENSP00000325660:G497E	G	+	2	0	CNTN1	39623776	1.000000	0.71417	0.919000	0.36401	0.774000	0.43823	6.032000	0.70918	2.600000	0.87896	0.561000	0.74099	GGA	CNTN1	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000018236		0.353	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	285	0.00	0	G	NM_001843		41337509	41337509	+1	no_errors	ENST00000347616	ensembl	human	known	69_37n	missense	118	42.44	87	SNP	0.991	A
CNTN3	5067	genome.wustl.edu	37	3	74313557	74313557	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:74313557A>G	ENST00000263665.6	-	22	3109	c.3082T>C	c.(3082-3084)Tgg>Cgg	p.W1028R	CNTN3_ENST00000477856.1_5'UTR	NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	1028					cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TAATATCACCACAGGACATAT	0.348																																						dbGAP											0													96.0	89.0	92.0					3																	74313557		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.3082T>C	3.37:g.74313557A>G	ENSP00000263665:p.Trp1028Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.W1028R	ENST00000263665.6	37	c.3082	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	A	15.45	2.838674	0.51057	.	.	ENSG00000113805	ENST00000263665	T	0.59906	0.23	4.99	4.99	0.66335	.	0.319961	0.26116	N	0.026256	T	0.45875	0.1364	N	0.14661	0.345	0.30196	N	0.799021	D	0.56035	0.974	P	0.45913	0.497	T	0.54316	-0.8312	10	0.87932	D	0	.	13.5601	0.61784	1.0:0.0:0.0:0.0	.	1028	Q9P232	CNTN3_HUMAN	R	1028	ENSP00000263665:W1028R	ENSP00000263665:W1028R	W	-	1	0	CNTN3	74396247	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	4.014000	0.57145	1.997000	0.58415	0.528000	0.53228	TGG	CNTN3	-	NULL	ENSG00000113805		0.348	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	107	0.00	0	A	NM_020872		74313557	74313557	-1	no_errors	ENST00000263665	ensembl	human	known	69_37n	missense	60	10.29	7	SNP	0.994	G
CNTNAP1	8506	genome.wustl.edu	37	17	40840974	40840974	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:40840974G>A	ENST00000264638.4	+	10	1754	c.1537G>A	c.(1537-1539)Gat>Aat	p.D513N	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	513	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GCTCAAGGTGGATGGTCAACT	0.572																																						dbGAP											0													141.0	127.0	132.0					17																	40840974		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1537G>A	17.37:g.40840974G>A	ENSP00000264638:p.Asp513Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.D513N	ENST00000264638.4	37	c.1537	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578812	0.65878	.	.	ENSG00000108797	ENST00000264638	T	0.69435	-0.4	4.73	4.73	0.59995	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.64402	D	0.000001	T	0.68824	0.3043	M	0.62088	1.915	0.47037	D	0.999293	P	0.38922	0.651	P	0.44561	0.453	T	0.64956	-0.6285	10	0.15499	T	0.54	.	17.9018	0.88906	0.0:0.0:1.0:0.0	.	513	P78357	CNTP1_HUMAN	N	513	ENSP00000264638:D513N	ENSP00000264638:D513N	D	+	1	0	CNTNAP1	38094500	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.993000	0.93524	2.449000	0.82847	0.561000	0.74099	GAT	CNTNAP1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000108797		0.572	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	253	0.00	0	G	NM_003632		40840974	40840974	+1	no_errors	ENST00000264638	ensembl	human	known	69_37n	missense	125	37.19	74	SNP	1.000	A
COPE	11316	genome.wustl.edu	37	19	19016390	19016390	+	Silent	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:19016390G>A	ENST00000262812.4	-	5	540	c.492C>T	c.(490-492)ctC>ctT	p.L164L	COPE_ENST00000349893.4_Silent_p.L164L|COPE_ENST00000600932.1_Silent_p.L187L|COPE_ENST00000351079.4_Silent_p.L113L|COPE_ENST00000598969.1_5'UTR	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon	164					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						CTCACCGGGCGAGGTCCAGGC	0.662																																						dbGAP											0													68.0	69.0	68.0					19																	19016390		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.492C>T	19.37:g.19016390G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	Silent	SNP	pfam_Coatomer_esu,pirsf_Coatomer_esu	p.L164	ENST00000262812.4	37	c.492	CCDS12387.1	19																																																																																			COPE	-	pfam_Coatomer_esu,pirsf_Coatomer_esu	ENSG00000105669		0.662	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPE	HGNC	protein_coding	OTTHUMT00000464801.1	53	0.00	0	G	NM_007263		19016390	19016390	-1	no_errors	ENST00000262812	ensembl	human	known	69_37n	silent	43	55.67	54	SNP	0.725	A
CP	1356	genome.wustl.edu	37	3	148903026	148903026	+	Splice_Site	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:148903026T>G	ENST00000264613.6	-	12	2547	c.2285A>C	c.(2284-2286)aAt>aCt	p.N762T	CP_ENST00000462336.1_5'Flank	NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	762	F5/8 type A 3.|Plastocyanin-like 5.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GGAGAATTACTTCTGCTCTTG	0.393																																						dbGAP											0													173.0	176.0	175.0					3																	148903026		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.2285+1A>C	3.37:g.148903026T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.N762T	ENST00000264613.6	37	c.2285	CCDS3141.1	3	.	.	.	.	.	.	.	.	.	.	T	13.49	2.253608	0.39797	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.98937	-5.25;-5.25	5.46	4.3	0.51218	Cupredoxin (2);	0.244325	0.46758	D	0.000267	D	0.95532	0.8548	L	0.39020	1.185	0.35112	D	0.766273	B;B;B	0.16802	0.019;0.007;0.017	B;B;B	0.17433	0.018;0.018;0.018	D	0.93040	0.6456	10	0.25106	T	0.35	-32.9867	6.1775	0.20451	0.0:0.3036:0.0:0.6964	.	762;762;762	A8K5A4;P00450;Q1L857	.;CERU_HUMAN;.	T	762;545	ENSP00000264613:N762T;ENSP00000420545:N545T	ENSP00000264613:N762T	N	-	2	0	CP	150385716	1.000000	0.71417	0.985000	0.45067	0.912000	0.54170	2.357000	0.44125	0.910000	0.36722	0.454000	0.30748	AAT	CP	-	superfamily_Cupredoxin	ENSG00000047457		0.393	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	HGNC	protein_coding	OTTHUMT00000317498.1	159	0.00	0	T	NM_000096	Missense_Mutation	148903026	148903026	-1	no_errors	ENST00000264613	ensembl	human	known	69_37n	missense	177	23.71	55	SNP	0.997	G
CPEB4	80315	genome.wustl.edu	37	5	173317753	173317753	+	Silent	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr5:173317753A>G	ENST00000265085.5	+	1	2471	c.1017A>G	c.(1015-1017)gcA>gcG	p.A339A	CPEB4_ENST00000519835.1_Silent_p.A339A|CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000334035.5_Silent_p.A339A|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000520867.1_Silent_p.A339A	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	339					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AAAATTTTGCAAGCAATCATA	0.502																																						dbGAP											0													52.0	52.0	52.0					5																	173317753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1017A>G	5.37:g.173317753A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	NULL	p.Q25R	ENST00000265085.5	37	c.74	CCDS4390.1	5	.	.	.	.	.	.	.	.	.	.	A	5.175	0.217793	0.09810	.	.	ENSG00000113742	ENST00000519152	.	.	.	5.33	4.16	0.48862	.	.	.	.	.	T	0.58380	0.2118	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54173	-0.8333	4	.	.	.	-10.6439	8.2392	0.31650	0.7956:0.1333:0.0711:0.0	.	.	.	.	R	25	.	.	Q	+	2	0	CPEB4	173250359	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.928000	0.40104	0.863000	0.35553	0.455000	0.32223	CAA	CPEB4	-	NULL	ENSG00000113742		0.502	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPEB4	HGNC	protein_coding	OTTHUMT00000252964.2	61	0.00	0	A	NM_030627		173317753	173317753	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000519152	ensembl	human	novel	69_37n	missense	28	26.32	10	SNP	1.000	G
CTBP1	1487	genome.wustl.edu	37	4	1244492	1244492	+	5'Flank	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:1244492G>C	ENST00000290921.6	-	0	0				CTBP1_ENST00000382952.3_5'Flank|CTBP1-AS2_ENST00000357591.2_RNA|CTBP1-AS2_ENST00000578730.1_RNA|CTBP1-AS2_ENST00000581398.1_RNA|CTBP1-AS2_ENST00000507044.1_RNA|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		CCCCAGGGGAGCTGGGGTCAG	0.592																																						dbGAP											0													75.0	78.0	77.0					4																	1244492		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244492G>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5N3|Q7Z2Q5	RNA	SNP	-	NULL	ENST00000290921.6	37	NULL	CCDS3348.1	4	.	.	.	.	.	.	.	.	.	.	G	8.816	0.936489	0.18206	.	.	ENSG00000196810	ENST00000357591	.	.	.	1.41	-0.693	0.11298	.	.	.	.	.	T	0.26448	0.0646	.	.	.	0.21105	N	0.999784	D	0.55172	0.97	B	0.43680	0.427	T	0.26643	-1.0097	6	0.87932	D	0	.	2.0034	0.03472	0.2189:0.0:0.4705:0.3106	.	44	Q0VAR9	CD042_HUMAN	T	44	.	ENSP00000350204:S44T	S	+	2	0	C4orf42	1234492	0.005000	0.15991	0.004000	0.12327	0.318000	0.28184	1.596000	0.36718	-0.254000	0.09500	0.462000	0.41574	AGC	CTBP1-AS1	-	-	ENSG00000196810		0.592	CTBP1-001	KNOWN	basic|CCDS	protein_coding	CTBP1-AS1	HGNC	protein_coding	OTTHUMT00000202938.1	24	0.00	0	G	NM_001328		1244492	1244492	+1	no_errors	ENST00000357591	ensembl	human	known	69_37n	rna	31	16.22	6	SNP	0.004	C
CUX2	23316	genome.wustl.edu	37	12	111785467	111785467	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:111785467G>C	ENST00000261726.6	+	22	3953	c.3799G>C	c.(3799-3801)Gac>Cac	p.D1267H		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1267					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						TGAGACTGAGGACCAGAAGCC	0.622																																						dbGAP											0													52.0	61.0	58.0					12																	111785467		2007	4158	6165	-	-	-	SO:0001583	missense	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3799G>C	12.37:g.111785467G>C	ENSP00000261726:p.Asp1267His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.D1267H	ENST00000261726.6	37	c.3799	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631400	0.28978	.	.	ENSG00000111249	ENST00000261726	T	0.49139	0.79	5.78	5.78	0.91487	.	0.048705	0.85682	D	0.000000	T	0.51601	0.1684	L	0.34521	1.04	0.58432	D	0.999999	D	0.69078	0.997	P	0.55667	0.781	T	0.52411	-0.8579	10	0.66056	D	0.02	-38.6449	14.3152	0.66446	0.0:0.0:0.8509:0.1491	.	1267	O14529	CUX2_HUMAN	H	1267	ENSP00000261726:D1267H	ENSP00000261726:D1267H	D	+	1	0	CUX2	110269850	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	7.519000	0.81809	2.729000	0.93468	0.650000	0.86243	GAC	CUX2	-	NULL	ENSG00000111249		0.622	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	75	0.00	0	G	NM_015267		111785467	111785467	+1	no_errors	ENST00000261726	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	C
CXorf67	340602	genome.wustl.edu	37	X	51150094	51150094	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:51150094G>A	ENST00000342995.2	+	1	328	c.226G>A	c.(226-228)Gcc>Acc	p.A76T				Q86X51	CX067_HUMAN	chromosome X open reading frame 67	76										breast(1)|endometrium(4)|large_intestine(1)|lung(11)|ovary(3)|prostate(1)	21						CACCTCCGCCGCCATTTTCAT	0.642																																						dbGAP											0													20.0	20.0	20.0					X																	51150094		2201	4293	6494	-	-	-	SO:0001583	missense	0			BC046248		Xp11.22	2014-04-30			ENSG00000187690	ENSG00000187690			33738	protein-coding gene	gene with protein product						23959973	Standard	XR_113306		Approved			Q86X51	OTTHUMG00000187481	ENST00000342995.2:c.226G>A	X.37:g.51150094G>A	ENSP00000342680:p.Ala76Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A76T	ENST00000342995.2	37	c.226		X	.	.	.	.	.	.	.	.	.	.	G	16.85	3.237983	0.58886	.	.	ENSG00000187690	ENST00000342995	T	0.57107	0.42	4.16	2.3	0.28687	.	1.525520	0.04427	N	0.368609	T	0.59838	0.2223	.	.	.	0.09310	N	1	D	0.64830	0.994	P	0.53861	0.736	T	0.35992	-0.9766	9	0.66056	D	0.02	-6.8636	5.2036	0.15279	0.1165:0.0:0.6827:0.2009	.	76	Q86X51	CX067_HUMAN	T	76	ENSP00000342680:A76T	ENSP00000342680:A76T	A	+	1	0	CXorf67	51166834	.	.	0.000000	0.03702	0.096000	0.18686	.	.	0.299000	0.22661	0.529000	0.55759	GCC	CXorf67	-	NULL	ENSG00000187690		0.642	CXorf67-201	KNOWN	basic|appris_principal	protein_coding	CXorf67	HGNC	protein_coding		46	0.00	0	G	NM_203407		51150094	51150094	+1	no_errors	ENST00000342995	ensembl	human	known	69_37n	missense	22	36.11	13	SNP	0.001	A
CYB5R1	51706	genome.wustl.edu	37	1	202935152	202935152	+	Intron	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:202935152T>C	ENST00000367249.4	-	4	313				CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1						sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	TACATAAGGGTTGTCTGTGAT	0.507																																						dbGAP											0													91.0	83.0	85.0					1																	202935152		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.239-31A>G	1.37:g.202935152T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	RNA	SNP	-	NULL	ENST00000367249.4	37	NULL	CCDS1431.1	1																																																																																			CYB5R1	-	-	ENSG00000159348		0.507	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R1	HGNC	protein_coding	OTTHUMT00000099155.1	178	0.00	0	T	NM_016243		202935152	202935152	-1	no_errors	ENST00000473599	ensembl	human	known	69_37n	rna	175	14.76	31	SNP	0.000	C
DCAF12L2	340578	genome.wustl.edu	37	X	125298656	125298656	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:125298656C>G	ENST00000360028.2	-	1	1278	c.1252G>C	c.(1252-1254)Gtg>Ctg	p.V418L	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.V418L			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	418								p.V418L(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						AAGTAGTTCACCCAGACGTCA	0.622																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											109.0	111.0	110.0					X																	125298656		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1252G>C	X.37:g.125298656C>G	ENSP00000353128:p.Val418Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V418L	ENST00000360028.2	37	c.1252	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	C	3.545	-0.092892	0.07053	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.17213	2.29;2.29	4.14	2.36	0.29203	.	0.262289	0.20197	N	0.097188	T	0.10895	0.0266	L	0.44542	1.39	0.29425	N	0.860247	B	0.15719	0.014	B	0.14023	0.01	T	0.30387	-0.9980	10	0.11485	T	0.65	.	3.8079	0.08785	0.0:0.5753:0.1996:0.225	.	418	Q5VW00	DC122_HUMAN	L	418	ENSP00000441489:V418L;ENSP00000353128:V418L	ENSP00000353128:V418L	V	-	1	0	DCAF12L2	125126337	1.000000	0.71417	0.961000	0.40146	0.820000	0.46376	2.620000	0.46410	0.508000	0.28173	-0.990000	0.02549	GTG	DCAF12L2	-	NULL	ENSG00000198354		0.622	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	75	0.00	0	C	NM_001013628		125298656	125298656	-1	no_errors	ENST00000360028	ensembl	human	known	69_37n	missense	49	10.91	6	SNP	1.000	G
DCAF13	25879	genome.wustl.edu	37	8	104452383	104452383	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr8:104452383A>G	ENST00000297579.5	+	9	1703	c.1426A>G	c.(1426-1428)Aga>Gga	p.R476G	DCAF13_ENST00000521999.1_3'UTR	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	324					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TCATACAAAGAGAATGCAACA	0.353																																						dbGAP											0													159.0	161.0	160.0					8																	104452383		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.1426A>G	8.37:g.104452383A>G	ENSP00000297579:p.Arg476Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	pfam_Sof1,pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R476G	ENST00000297579.5	37	c.1426	CCDS34934.1	8	.	.	.	.	.	.	.	.	.	.	A	13.70	2.316237	0.40996	.	.	ENSG00000164934	ENST00000297579	T	0.01279	5.06	5.0	-3.2	0.05156	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.08313	0.0207	M	0.87381	2.88	0.80722	D	1	D	0.71674	0.998	D	0.69307	0.963	T	0.04140	-1.0974	10	0.87932	D	0	-19.2931	17.6219	0.88084	0.5915:0.4085:0.0:0.0	.	324	Q9NV06	DCA13_HUMAN	G	476	ENSP00000297579:R476G	ENSP00000297579:R476G	R	+	1	2	DCAF13	104521559	1.000000	0.71417	0.799000	0.32177	0.238000	0.25445	1.092000	0.30927	-0.335000	0.08451	-1.195000	0.01675	AGA	DCAF13	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000164934		0.353	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF13	HGNC	protein_coding	OTTHUMT00000380797.2	297	0.00	0	A	NM_015420		104452383	104452383	+1	no_errors	ENST00000297579	ensembl	human	known	69_37n	missense	524	13.51	82	SNP	0.961	G
DNAH7	56171	genome.wustl.edu	37	2	196753032	196753032	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:196753032A>G	ENST00000312428.6	-	33	5456	c.5356T>C	c.(5356-5358)Ttt>Ctt	p.F1786L		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1786	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ATTCTGTCAAATAAGCCCATT	0.373																																						dbGAP											0													68.0	62.0	64.0					2																	196753032		1831	4090	5921	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5356T>C	2.37:g.196753032A>G	ENSP00000311273:p.Phe1786Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.F1786L	ENST00000312428.6	37	c.5356	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	A	17.03	3.283828	0.59867	.	.	ENSG00000118997	ENST00000312428	D	0.85411	-1.98	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.87517	0.6197	M	0.83118	2.625	0.80722	D	1	P	0.39326	0.668	B	0.40066	0.318	D	0.88661	0.3189	10	0.56958	D	0.05	.	15.9736	0.80040	1.0:0.0:0.0:0.0	.	1786	Q8WXX0	DYH7_HUMAN	L	1786	ENSP00000311273:F1786L	ENSP00000311273:F1786L	F	-	1	0	DNAH7	196461277	1.000000	0.71417	0.998000	0.56505	0.711000	0.40976	5.834000	0.69361	2.308000	0.77769	0.533000	0.62120	TTT	DNAH7	-	NULL	ENSG00000118997		0.373	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	91	0.00	0	A	NM_018897		196753032	196753032	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	55	22.54	16	SNP	1.000	G
DNAH8	1769	genome.wustl.edu	37	6	38825426	38825426	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:38825426C>A	ENST00000359357.3	+	40	5469	c.5215C>A	c.(5215-5217)Cag>Aag	p.Q1739K	DNAH8_ENST00000441566.1_Missense_Mutation_p.Q1739K|DNAH8_ENST00000449981.2_Missense_Mutation_p.Q1956K			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1739					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TCTCATTAGTCAGACAACACA	0.358																																						dbGAP											0													118.0	114.0	115.0					6																	38825426		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5215C>A	6.37:g.38825426C>A	ENSP00000352312:p.Gln1739Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q1739K	ENST00000359357.3	37	c.5215		6	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527114	0.44969	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T;T	0.26373	1.74;1.88;1.87;1.84	5.75	5.75	0.90469	.	0.266437	0.36815	N	0.002385	T	0.11665	0.0284	L	0.31120	0.905	0.41243	D	0.986653	B	0.19331	0.035	B	0.17098	0.017	T	0.02713	-1.1120	10	0.54805	T	0.06	.	14.7604	0.69602	0.1444:0.8556:0.0:0.0	.	1739	Q96JB1	DYH8_HUMAN	K	1944;1944;1739;1739	ENSP00000415331:Q1944K;ENSP00000333363:Q1944K;ENSP00000352312:Q1739K;ENSP00000402294:Q1739K	ENSP00000333363:Q1944K	Q	+	1	0	DNAH8	38933404	0.898000	0.30612	0.976000	0.42696	0.985000	0.73830	1.752000	0.38349	2.716000	0.92895	0.655000	0.94253	CAG	DNAH8	-	NULL	ENSG00000124721		0.358	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	288	0.00	0	C	NM_001206927		38825426	38825426	+1	no_errors	ENST00000359357	ensembl	human	known	69_37n	missense	351	14.36	59	SNP	1.000	A
DUOX1	53905	genome.wustl.edu	37	15	45437157	45437157	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr15:45437157A>T	ENST00000321429.4	+	19	2608	c.2201A>T	c.(2200-2202)aAg>aTg	p.K734M	DUOX1_ENST00000389037.3_Missense_Mutation_p.K734M|DUOX1_ENST00000561166.1_Missense_Mutation_p.K380M	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	734					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGAGCTCTGAAGGAGAGCGGG	0.607																																						dbGAP											0													88.0	99.0	95.0					15																	45437157		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2201A>T	15.37:g.45437157A>T	ENSP00000317997:p.Lys734Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.K734M	ENST00000321429.4	37	c.2201	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	A	10.39	1.338152	0.24253	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.86497	-2.13;-2.13	4.81	3.66	0.41972	.	0.729507	0.14168	N	0.336930	T	0.81394	0.4813	L	0.43152	1.355	0.42207	D	0.991799	B	0.28552	0.215	B	0.25614	0.062	T	0.76721	-0.2855	10	0.48119	T	0.1	-27.227	9.2555	0.37581	0.8382:0.0:0.0:0.1618	.	734	Q9NRD9	DUOX1_HUMAN	M	734	ENSP00000317997:K734M;ENSP00000373689:K734M	ENSP00000317997:K734M	K	+	2	0	DUOX1	43224449	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	2.925000	0.48884	0.945000	0.37605	-0.333000	0.08304	AAG	DUOX1	-	NULL	ENSG00000137857		0.607	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	117	0.00	0	A	NM_017434		45437157	45437157	+1	no_errors	ENST00000321429	ensembl	human	known	69_37n	missense	63	16.88	13	SNP	1.000	T
EDNRB	1910	genome.wustl.edu	37	13	78474078	78474078	+	Silent	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr13:78474078A>G	ENST00000334286.5	-	6	1346	c.1110T>C	c.(1108-1110)atT>atC	p.I370I	EDNRB_ENST00000446573.1_Silent_p.I370I|EDNRB_ENST00000377211.4_Silent_p.I460I	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	370					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TGTTGATACCAATATAGTCCA	0.363																																						dbGAP											0													84.0	80.0	81.0					13																	78474078		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.1110T>C	13.37:g.78474078A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_ETB_rcpt,prints_Endthln_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Bombsn_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.I370	ENST00000334286.5	37	c.1110	CCDS9461.1	13																																																																																			EDNRB	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000136160		0.363	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	187	0.00	0	A			78474078	78474078	-1	no_errors	ENST00000334286	ensembl	human	known	69_37n	silent	127	25.73	44	SNP	0.896	G
EFR3B	22979	genome.wustl.edu	37	2	25344626	25344626	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:25344626T>G	ENST00000403714.3	+	5	631	c.448T>G	c.(448-450)Tgc>Ggc	p.C150G	EFR3B_ENST00000402191.1_Missense_Mutation_p.C115G|EFR3B_ENST00000401432.3_Missense_Mutation_p.C150G|EFR3B_ENST00000405108.1_Missense_Mutation_p.C2G	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	150										endometrium(1)	1						CAGTGAAATGTGCCACTCGAG	0.502																																						dbGAP											0													109.0	88.0	94.0					2																	25344626		692	1591	2283	-	-	-	SO:0001583	missense	0			AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.448T>G	2.37:g.25344626T>G	ENSP00000384081:p.Cys150Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPL8|Q86XU6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.C150G	ENST00000403714.3	37	c.448	CCDS46231.1	2	.	.	.	.	.	.	.	.	.	.	T	21.6	4.166322	0.78339	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000405108;ENST00000264719	T;T;T;T;T	0.66638	-0.15;-0.15;-0.22;0.61;2.18	4.38	4.38	0.52667	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81508	0.4837	M	0.83384	2.64	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.991	D	0.84056	0.0372	10	0.62326	D	0.03	-30.8379	12.5783	0.56375	0.0:0.0:0.0:1.0	.	150;150	Q9Y2G0;Q9Y2G0-3	EFR3B_HUMAN;.	G	150;150;115;115;2;29	ENSP00000386082:C150G;ENSP00000384081:C150G;ENSP00000385832:C115G;ENSP00000384454:C2G;ENSP00000264719:C29G	ENSP00000264719:C29G	C	+	1	0	EFR3B	25198130	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.708000	0.84633	1.837000	0.53436	0.402000	0.26972	TGC	EFR3B	-	superfamily_ARM-type_fold	ENSG00000084710		0.502	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFR3B	HGNC	protein_coding	OTTHUMT00000324808.1	120	0.00	0	T	NM_014971		25344626	25344626	+1	no_errors	ENST00000403714	ensembl	human	known	69_37n	missense	95	25.78	33	SNP	1.000	G
ELTD1	64123	genome.wustl.edu	37	1	79403558	79403558	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:79403558C>G	ENST00000370742.3	-	6	757	c.694G>C	c.(694-696)Gct>Cct	p.A232P		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	232					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CTTAAAGTAGCTTGTTCAACA	0.353																																						dbGAP											0													184.0	171.0	175.0					1																	79403558		1857	4103	5960	-	-	-	SO:0001583	missense	0			AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.694G>C	1.37:g.79403558C>G	ENSP00000359778:p.Ala232Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AR71|Q5KU34	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.A232P	ENST00000370742.3	37	c.694	CCDS41352.1	1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677588	0.29783	.	.	ENSG00000162618	ENST00000370742	T	0.10477	2.87	5.79	3.61	0.41365	Domain of unknown function DUF3497 (1);	0.787928	0.12481	N	0.465135	T	0.07098	0.0180	L	0.38175	1.15	0.09310	N	1	P	0.36660	0.564	P	0.48114	0.567	T	0.37572	-0.9700	9	.	.	.	.	12.0775	0.53652	0.0:0.7927:0.0:0.2073	.	232	Q9HBW9	ELTD1_HUMAN	P	232	ENSP00000359778:A232P	.	A	-	1	0	ELTD1	79176146	0.003000	0.15002	0.013000	0.15412	0.073000	0.16967	1.529000	0.35996	1.448000	0.47680	0.557000	0.71058	GCT	ELTD1	-	pfam_DUF3497	ENSG00000162618		0.353	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELTD1	HGNC	protein_coding	OTTHUMT00000026859.1	219	0.00	0	C	NM_022159		79403558	79403558	-1	no_errors	ENST00000370742	ensembl	human	known	69_37n	missense	110	23.45	34	SNP	0.003	G
EMX2	2018	genome.wustl.edu	37	10	119307628	119307628	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr10:119307628A>G	ENST00000553456.3	+	3	1468	c.644A>G	c.(643-645)gAg>gGg	p.E215G	EMX2_ENST00000442245.4_Silent_p.G153G|EMX2_ENST00000546446.1_3'UTR	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	215					anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		CAGAAGCTGGAGGAAGAAGGC	0.498																																						dbGAP											0													64.0	59.0	60.0					10																	119307628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.644A>G	10.37:g.119307628A>G	ENSP00000450962:p.Glu215Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V305|Q96NN8|Q9BQF4	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,prints_HTH_motif,pfscan_Homeodomain	p.E215G	ENST00000553456.3	37	c.644	CCDS7601.1	10	.	.	.	.	.	.	.	.	.	.	A	20.7	4.041078	0.75732	.	.	ENSG00000170370	ENST00000369201	.	.	.	5.31	5.31	0.75309	Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.50017	0.1591	.	.	.	0.80722	D	1	B	0.32731	0.382	B	0.33690	0.168	T	0.46721	-0.9171	8	0.28530	T	0.3	-13.6914	15.2513	0.73549	1.0:0.0:0.0:0.0	.	215	Q04743	EMX2_HUMAN	G	215	.	ENSP00000358202:E215G	E	+	2	0	EMX2	119297618	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.255000	0.95524	2.001000	0.58596	0.448000	0.29417	GAG	EMX2	-	superfamily_Homeodomain-like,smart_Homeodomain	ENSG00000170370		0.498	EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMX2	HGNC	protein_coding	OTTHUMT00000050569.4	113	0.00	0	A	NM_004098		119307628	119307628	+1	no_errors	ENST00000369201	ensembl	human	known	69_37n	missense	73	18.89	17	SNP	1.000	G
F5	2153	genome.wustl.edu	37	1	169510241	169510242	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:169510241_169510242GG>TT	ENST00000367797.3	-	13	4287_4288	c.4086_4087CC>AA	c.(4084-4089)agCCat>agAAat	p.1362_1363SH>RN	F5_ENST00000367796.3_Missense_Mutation_p.1367_1368SH>RN	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1362	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AGGGTTGTATGGCTGGGGTCTG	0.525																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.4086_4087delinsTT	1.37:g.169510241_169510242delinsTT	ENSP00000356771:p.S1362_H1363delinsRN	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.H1368N|p.S1367R	ENST00000367797.3	37	c.4102|c.4101	CCDS1281.1	1																																																																																			F5	-	NULL	ENSG00000198734		0.525	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	798	0.12|0.25	1|2	G	NM_000130		169510241|169510242	169510241|169510242	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	916|921	18.38|18.93	207|215	SNP	0.000	T
F5	2153	genome.wustl.edu	37	1	169510453	169510453	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:169510453G>T	ENST00000367797.3	-	13	4076	c.3875C>A	c.(3874-3876)aCa>aAa	p.T1292K	F5_ENST00000367796.3_Missense_Mutation_p.T1297K	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1292	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AGAGAGGTTTGTCTGGCTGAA	0.522																																						dbGAP											0													231.0	258.0	249.0					1																	169510453		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3875C>A	1.37:g.169510453G>T	ENSP00000356771:p.Thr1292Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.T1297K	ENST00000367797.3	37	c.3890	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	G	9.297	1.052152	0.19827	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.28069	1.63;1.63	5.07	-1.44	0.08856	.	2.147630	0.01782	N	0.031831	T	0.06781	0.0173	L	0.41710	1.295	0.19575	N	0.99997	B	0.10296	0.003	B	0.08055	0.003	T	0.10800	-1.0614	9	0.12430	T	0.62	.	3.5564	0.07866	0.2885:0.0:0.2785:0.433	.	1292	P12259	FA5_HUMAN	K	1292;1297	ENSP00000356771:T1292K;ENSP00000356770:T1297K	ENSP00000356770:T1297K	T	-	2	0	F5	167777077	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.266000	0.00136	-0.486000	0.06744	0.561000	0.74099	ACA	F5	-	NULL	ENSG00000198734		0.522	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	987	0.10	1	G	NM_000130		169510453	169510453	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	1101	24.43	356	SNP	0.000	T
FAM129C	199786	genome.wustl.edu	37	19	17653023	17653023	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:17653023C>T	ENST00000335393.4	+	11	1480	c.1342C>T	c.(1342-1344)Cgc>Tgc	p.R448C	FAM129C_ENST00000449408.2_Missense_Mutation_p.R174C|FAM129C_ENST00000600871.1_Missense_Mutation_p.R394C|FAM129C_ENST00000352727.3_Missense_Mutation_p.R448C|FAM129C_ENST00000599164.1_Missense_Mutation_p.R417C|FAM129C_ENST00000595684.1_Missense_Mutation_p.R448C|FAM129C_ENST00000300971.2_Missense_Mutation_p.R448C|FAM129C_ENST00000332386.5_Missense_Mutation_p.R448C|FAM129C_ENST00000599124.1_Missense_Mutation_p.R417C|FAM129C_ENST00000601861.1_Missense_Mutation_p.R417C	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	448										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						GAGCCGGGGGCGCTTGGGGCA	0.617																																						dbGAP											0													108.0	122.0	117.0					19																	17653023		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1342C>T	19.37:g.17653023C>T	ENSP00000335040:p.Arg448Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.R448C	ENST00000335393.4	37	c.1342	CCDS12362.1	19	.	.	.	.	.	.	.	.	.	.	c	7.095	0.572850	0.13623	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000300971;ENST00000449408;ENST00000435646	T;T;T;T;T	0.25579	2.12;2.13;1.84;1.84;1.79	4.77	1.29	0.21616	.	0.701843	0.12855	N	0.433623	T	0.12987	0.0315	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B;B	0.32203	0.116;0.36;0.36;0.36;0.049;0.36	B;B;B;B;B;B	0.20184	0.028;0.028;0.028;0.028;0.007;0.028	T	0.17745	-1.0359	10	0.34782	T	0.22	-4.587	3.1616	0.06522	0.2667:0.4981:0.0:0.2352	.	394;448;448;448;174;448	E7ENP6;Q86XR2;Q86XR2-3;Q86XR2-4;B4DNU3;Q86XR2-2	.;NIBL2_HUMAN;.;.;.;.	C	448;448;448;448;174;394	ENSP00000335040:R448C;ENSP00000333447:R448C;ENSP00000341067:R448C;ENSP00000300971:R448C;ENSP00000394929:R174C	ENSP00000300971:R448C	R	+	1	0	FAM129C	17514023	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	0.010000	0.13242	0.455000	0.26910	0.586000	0.80456	CGC	FAM129C	-	NULL	ENSG00000167483		0.617	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM129C	HGNC	protein_coding	OTTHUMT00000464206.1	88	0.00	0	C	NM_173544		17653023	17653023	+1	no_errors	ENST00000335393	ensembl	human	known	69_37n	missense	56	47.54	58	SNP	0.001	T
FAM209A	200232	genome.wustl.edu	37	20	55101071	55101071	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr20:55101071C>G	ENST00000371328.3	+	2	784	c.461C>G	c.(460-462)gCa>gGa	p.A154G	FAM209A_ENST00000481560.1_3'UTR|GCNT7_ENST00000243913.4_5'Flank	NM_001012971.3	NP_001012989.2	Q5JX71	F209A_HUMAN	family with sequence similarity 209, member A	154						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											GAGATGCCTGCAGATCCATAC	0.448																																						dbGAP											0													112.0	105.0	108.0					20																	55101071		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL109806	CCDS33493.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000124103	ENSG00000124103			16100	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 106"""	C20orf106			Standard	NM_001012971		Approved	dJ1153D9.3		Q5JX71	OTTHUMG00000032799	ENST00000371328.3:c.461C>G	20.37:g.55101071C>G	ENSP00000360379:p.Ala154Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05C43	Missense_Mutation	SNP	NULL	p.A154G	ENST00000371328.3	37	c.461	CCDS33493.1	20	.	.	.	.	.	.	.	.	.	.	C	9.560	1.118312	0.20877	.	.	ENSG00000124103	ENST00000371328	T	0.10099	2.91	4.27	-0.211	0.13172	.	1.732920	0.03220	N	0.177452	T	0.10035	0.0246	L	0.42245	1.32	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.32640	-0.9899	10	0.26408	T	0.33	0.7578	4.3264	0.11043	0.0:0.5309:0.169:0.3001	.	154	Q5JX71	CT106_HUMAN	G	154	ENSP00000360379:A154G	ENSP00000360379:A154G	A	+	2	0	C20orf106	54534478	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.277000	0.08502	-0.347000	0.08299	-0.688000	0.03733	GCA	FAM209A	-	NULL	ENSG00000124103		0.448	FAM209A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM209A	HGNC	protein_coding	OTTHUMT00000079815.2	167	0.00	0	C			55101071	55101071	+1	no_errors	ENST00000371328	ensembl	human	known	69_37n	missense	125	30.17	54	SNP	0.000	G
MTFR1L	56181	genome.wustl.edu	37	1	26153135	26153135	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:26153135G>A	ENST00000374301.3	+	5	577	c.269G>A	c.(268-270)tGg>tAg	p.W90*	MTFR1L_ENST00000374307.5_Nonsense_Mutation_p.W90*|MTFR1L_ENST00000474295.1_Nonsense_Mutation_p.W90*|MTFR1L_ENST00000524618.1_5'UTR|MTFR1L_ENST00000466284.1_Nonsense_Mutation_p.W90*|MTFR1L_ENST00000469815.1_Intron|MTFR1L_ENST00000374303.2_Nonsense_Mutation_p.W90*|MTFR1L_ENST00000374300.3_Nonsense_Mutation_p.W90*|MTFR1L_ENST00000526894.1_Nonsense_Mutation_p.W90*	NM_019557.5	NP_062457.3	Q9H019	MFR1L_HUMAN	mitochondrial fission regulator 1-like	90																	AGGCACACCTGGAAACCCAGC	0.587																																						dbGAP											0													131.0	135.0	134.0					1																	26153135		2009	4170	6179	-	-	-	SO:0001587	stop_gained	0				CCDS41284.1, CCDS44089.1	1p36.11	2012-11-30	2012-11-29	2012-11-29	ENSG00000117640	ENSG00000117640			28836	protein-coding gene	gene with protein product			"""family with sequence similarity 54, member B"""	FAM54B		8619474, 9110174	Standard	NM_019557		Approved		uc001bkq.4	Q9H019	OTTHUMG00000007377	ENST00000374301.3:c.269G>A	1.37:g.26153135G>A	ENSP00000363419:p.Trp90*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCB4|B7WNV5|D3DPJ4|Q63HP1|Q7Z2S7|Q9NUI7	Nonsense_Mutation	SNP	pfam_Mtfr1	p.W90*	ENST00000374301.3	37	c.269	CCDS41284.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.723250	0.96847	.	.	ENSG00000117640	ENST00000424294;ENST00000374303;ENST00000529116;ENST00000474295;ENST00000526894;ENST00000374307;ENST00000525713;ENST00000374301;ENST00000526158;ENST00000374300;ENST00000466284	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-11.9869	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	X	90	.	ENSP00000363418:W90X	W	+	2	0	FAM54B	26025722	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	TGG	FAM54B	-	pfam_Mtfr1	ENSG00000117640		0.587	MTFR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM54B	HGNC	protein_coding	OTTHUMT00000019319.1	43	0.00	0	G	NM_019557		26153135	26153135	+1	no_errors	ENST00000374300	ensembl	human	known	69_37n	nonsense	20	31.03	9	SNP	1.000	A
FANCI	55215	genome.wustl.edu	37	15	89807217	89807217	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr15:89807217T>C	ENST00000310775.7	+	8	715	c.629T>C	c.(628-630)aTa>aCa	p.I210T	FANCI_ENST00000300027.8_Missense_Mutation_p.I210T|FANCI_ENST00000451393.2_Missense_Mutation_p.I31T|FANCI_ENST00000567996.1_Missense_Mutation_p.I210T	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	210					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CTTCAAGAAATACCACCTTTG	0.423								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													171.0	159.0	163.0					15																	89807217		2200	4299	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.629T>C	15.37:g.89807217T>C	ENSP00000310842:p.Ile210Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	NULL	p.I210T	ENST00000310775.7	37	c.629	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	T	24.3	4.513742	0.85389	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611;ENST00000451393	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.88	5.88	0.94601	.	0.095585	0.64402	D	0.000001	T	0.63189	0.2490	M	0.65975	2.015	0.58432	D	0.999992	P;D;D	0.57899	0.915;0.981;0.981	P;P;P	0.57101	0.72;0.74;0.813	T	0.66666	-0.5866	10	0.72032	D	0.01	-7.8819	16.3015	0.82820	0.0:0.0:0.0:1.0	.	210;210;210	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	T	210;210;210;31	ENSP00000300027:I210T;ENSP00000310842:I210T;ENSP00000413249:I210T;ENSP00000390764:I31T	ENSP00000300027:I210T	I	+	2	0	FANCI	87608221	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.561000	0.82288	2.239000	0.73571	0.533000	0.62120	ATA	FANCI	-	NULL	ENSG00000140525		0.423	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	298	0.00	0	T	NM_018193		89807217	89807217	+1	no_errors	ENST00000310775	ensembl	human	known	69_37n	missense	155	33.76	79	SNP	1.000	C
FAT3	120114	genome.wustl.edu	37	11	92534181	92534181	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr11:92534181C>G	ENST00000298047.6	+	9	8019	c.8002C>G	c.(8002-8004)Cag>Gag	p.Q2668E	FAT3_ENST00000525166.1_Missense_Mutation_p.Q2518E|FAT3_ENST00000409404.2_Missense_Mutation_p.Q2668E			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2668	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TAATTTTAACCAGCTGAAAAA	0.478										TCGA Ovarian(4;0.039)																												dbGAP											0													40.0	38.0	39.0					11																	92534181		1880	4115	5995	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8002C>G	11.37:g.92534181C>G	ENSP00000298047:p.Gln2668Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.Q2668E	ENST00000298047.6	37	c.8002		11	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013809	0.54468	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.51071	0.72;0.72;0.72	6.17	6.17	0.99709	.	.	.	.	.	T	0.29914	0.0748	N	0.04132	-0.27	0.80722	D	1	P	0.35107	0.484	B	0.34038	0.174	T	0.13045	-1.0524	9	0.19590	T	0.45	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2668	Q8TDW7-3	.	E	2668;2668;2518	ENSP00000298047:Q2668E;ENSP00000387040:Q2668E;ENSP00000432586:Q2518E	ENSP00000298047:Q2668E	Q	+	1	0	FAT3	92173829	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.939000	0.70179	2.941000	0.99782	0.655000	0.94253	CAG	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.478	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		80	0.00	0	C	NM_001008781		92534181	92534181	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	29	59.72	43	SNP	1.000	G
FCHO1	23149	genome.wustl.edu	37	19	17889452	17889452	+	Silent	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:17889452C>T	ENST00000596536.1	+	20	1669	c.1386C>T	c.(1384-1386)tcC>tcT	p.S462S	FCHO1_ENST00000597512.1_Silent_p.S469S|FCHO1_ENST00000595033.1_Silent_p.S412S|FCHO1_ENST00000252771.7_Silent_p.S462S|FCHO1_ENST00000389133.4_Silent_p.S462S|FCHO1_ENST00000600676.1_Silent_p.S462S|FCHO1_ENST00000539407.1_Silent_p.S462S|FCHO1_ENST00000596951.1_Silent_p.S462S|FCHO1_ENST00000594202.1_Silent_p.S462S	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	462					clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CCAGCCCCTCCCCTTTCTCCT	0.692																																						dbGAP											0													29.0	29.0	29.0					19																	17889452		2194	4287	6481	-	-	-	SO:0001819	synonymous_variant	0			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1386C>T	19.37:g.17889452C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Silent	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,superfamily_Clathrin_mu_C,smart_FCH,pfscan_FCH	p.S462	ENST00000596536.1	37	c.1386	CCDS32955.1	19																																																																																			FCHO1	-	NULL	ENSG00000130475		0.692	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	24	0.00	0	C	NM_015122		17889452	17889452	+1	no_errors	ENST00000252771	ensembl	human	known	69_37n	silent	34	48.48	32	SNP	0.958	T
FETUB	26998	genome.wustl.edu	37	3	186362642	186362642	+	Missense_Mutation	SNP	C	C	G	rs149523201		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:186362642C>G	ENST00000265029.3	+	4	628	c.527C>G	c.(526-528)gCg>gGg	p.A176G	FETUB_ENST00000382136.3_Missense_Mutation_p.A139G|FETUB_ENST00000450521.1_Missense_Mutation_p.A176G|RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000488561.1_3'UTR|FETUB_ENST00000382134.3_Missense_Mutation_p.A111G|FETUB_ENST00000539949.1_Missense_Mutation_p.A28G|RP11-134F2.2_ENST00000428501.1_RNA	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	176	Cystatin fetuin-B-type 2. {ECO:0000255|PROSITE-ProRule:PRU00862}.				binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		GAGTCTCTTGCGAAATACAAC	0.478																																						dbGAP											0													110.0	105.0	107.0					3																	186362642		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.527C>G	3.37:g.186362642C>G	ENSP00000265029:p.Ala176Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.A176G	ENST00000265029.3	37	c.527	CCDS3279.1	3	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030901	0.54790	.	.	ENSG00000090512	ENST00000450521;ENST00000431018;ENST00000539949;ENST00000265029;ENST00000382134;ENST00000382136	T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6	5.29	1.03	0.20045	Proteinase inhibitor I25, cystatin (2);	0.194955	0.36374	N	0.002624	T	0.47173	0.1431	M	0.78223	2.4	0.29123	N	0.88011	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.75484	0.986;0.986;0.974	T	0.38308	-0.9667	10	0.62326	D	0.03	-3.8635	3.6035	0.08034	0.2918:0.4798:0.1424:0.0859	.	139;111;176	E9PG06;E9PG08;Q9UGM5	.;.;FETUB_HUMAN	G	176;28;28;176;111;139	ENSP00000404288:A176G;ENSP00000396581:A28G;ENSP00000443704:A28G;ENSP00000265029:A176G;ENSP00000371569:A111G;ENSP00000371571:A139G	ENSP00000265029:A176G	A	+	2	0	FETUB	187845336	0.371000	0.25056	0.943000	0.38184	0.588000	0.36517	-0.357000	0.07651	0.276000	0.22118	0.655000	0.94253	GCG	FETUB	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	ENSG00000090512		0.478	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FETUB	HGNC	protein_coding	OTTHUMT00000344679.1	97	0.00	0	C	NM_014375		186362642	186362642	+1	no_errors	ENST00000265029	ensembl	human	known	69_37n	missense	59	62.66	99	SNP	0.961	G
FGD3	89846	genome.wustl.edu	37	9	95795090	95795090	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr9:95795090A>T	ENST00000375482.3	+	16	2216	c.1720A>T	c.(1720-1722)Agc>Tgc	p.S574C	FGD3_ENST00000538555.1_Missense_Mutation_p.S177C|FGD3_ENST00000416701.2_Missense_Mutation_p.S574C|FGD3_ENST00000337352.6_Missense_Mutation_p.S574C	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	574					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						GGCCGAGAACAGCCGGCAGAG	0.607																																						dbGAP											0													122.0	137.0	132.0					9																	95795090		2094	4200	6294	-	-	-	SO:0001583	missense	0			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1720A>T	9.37:g.95795090A>T	ENSP00000364631:p.Ser574Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S574C	ENST00000375482.3	37	c.1720	CCDS43849.1	9	.	.	.	.	.	.	.	.	.	.	A	17.65	3.442317	0.63067	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352;ENST00000538555	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	4.54	2.27	0.28462	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.336775	0.21776	N	0.069282	T	0.82019	0.4946	M	0.67517	2.055	0.38096	D	0.937125	D;D	0.76494	0.999;0.991	D;D	0.68353	0.957;0.95	T	0.79834	-0.1636	10	0.87932	D	0	.	3.2199	0.06711	0.6631:0.0:0.1291:0.2078	.	574;574	F8W7P2;Q5JSP0	.;FGD3_HUMAN	C	574;574;574;177	ENSP00000364631:S574C;ENSP00000413833:S574C;ENSP00000336914:S574C;ENSP00000442560:S177C	ENSP00000336914:S574C	S	+	1	0	FGD3	94834911	1.000000	0.71417	0.997000	0.53966	0.933000	0.57130	4.469000	0.60169	0.289000	0.22422	-0.516000	0.04426	AGC	FGD3	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000127084		0.607	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	HGNC	protein_coding	OTTHUMT00000055493.1	123	0.00	0	A	NM_033086		95795090	95795090	+1	no_errors	ENST00000337352	ensembl	human	known	69_37n	missense	30	53.12	34	SNP	0.999	T
FIGN	55137	genome.wustl.edu	37	2	164466580	164466580	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:164466580C>G	ENST00000333129.3	-	3	2076	c.1762G>C	c.(1762-1764)Gac>Cac	p.D588H	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	588					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						AGAAGCATGTCAATGTCACTA	0.468																																						dbGAP											0													63.0	63.0	63.0					2																	164466580		1978	4148	6126	-	-	-	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1762G>C	2.37:g.164466580C>G	ENSP00000333836:p.Asp588His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.D588H	ENST00000333129.3	37	c.1762	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	C	16.58	3.163301	0.57476	.	.	ENSG00000182263	ENST00000333129	D	0.95588	-3.75	5.6	5.6	0.85130	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.047513	0.85682	D	0.000000	D	0.98520	0.9506	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99097	1.0842	10	0.87932	D	0	-24.1195	19.9756	0.97304	0.0:1.0:0.0:0.0	.	588	Q5HY92	FIGN_HUMAN	H	588	ENSP00000333836:D588H	ENSP00000333836:D588H	D	-	1	0	FIGN	164174826	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.793000	0.96121	0.563000	0.77884	GAC	FIGN	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000182263		0.468	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	145	0.00	0	C	NM_018086		164466580	164466580	-1	no_errors	ENST00000333129	ensembl	human	known	69_37n	missense	88	20.00	22	SNP	1.000	G
FKBP6	8468	genome.wustl.edu	37	7	72756874	72756874	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr7:72756874G>T	ENST00000252037.4	+	8	1030	c.961G>T	c.(961-963)Ggt>Tgt	p.G321C	FKBP6_ENST00000431982.2_Missense_Mutation_p.G316C|FKBP6_ENST00000413573.2_Missense_Mutation_p.G291C	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	321					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				CTGTGGCGATGGTTCTACAGC	0.532											OREG0018106	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													112.0	116.0	115.0					7																	72756874		2033	4192	6225	-	-	-	SO:0001583	missense	0			AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.961G>T	7.37:g.72756874G>T	ENSP00000252037:p.Gly321Cys	Somatic	1140	WXS	Illumina GAIIx	Phase_IV	B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.G321C	ENST00000252037.4	37	c.961	CCDS43595.1	7	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542879	0.45280	.	.	ENSG00000077800	ENST00000431982;ENST00000413573;ENST00000252037	T;T;T	0.59224	0.57;0.28;0.59	5.22	0.343	0.16001	.	1.930350	0.02531	N	0.093613	T	0.40015	0.1100	N	0.08118	0	0.09310	N	1	D;D;D	0.57257	0.973;0.979;0.979	P;B;P	0.46975	0.513;0.41;0.533	T	0.32745	-0.9895	10	0.56958	D	0.05	-4.8688	1.2964	0.02070	0.1881:0.1318:0.4449:0.2353	.	316;321;291	O75344-2;O75344;Q7Z4T4	.;FKBP6_HUMAN;.	C	316;291;321	ENSP00000416277:G316C;ENSP00000394952:G291C;ENSP00000252037:G321C	ENSP00000252037:G321C	G	+	1	0	FKBP6	72394810	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	0.137000	0.15995	0.252000	0.21531	0.644000	0.83932	GGT	FKBP6	-	NULL	ENSG00000077800		0.532	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FKBP6	HGNC	protein_coding	OTTHUMT00000318723.1	134	0.00	0	G	NM_003602		72756874	72756874	+1	no_errors	ENST00000252037	ensembl	human	known	69_37n	missense	82	22.64	24	SNP	0.000	T
FNDC7	163479	genome.wustl.edu	37	1	109268596	109268596	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:109268596C>T	ENST00000370017.3	+	6	1358	c.1081C>T	c.(1081-1083)Cct>Tct	p.P361S	FNDC7_ENST00000271311.2_Missense_Mutation_p.P362S	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	361	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		AGGGCAAAGTCCTTTGGGTGA	0.403																																						dbGAP											0													155.0	149.0	151.0					1																	109268596		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.1081C>T	1.37:g.109268596C>T	ENSP00000359034:p.Pro361Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P362S	ENST00000370017.3	37	c.1084	CCDS44185.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.1|27.1	4.796363|4.796363	0.90453|0.90453	.|.	.|.	ENSG00000143107|ENSG00000143107	ENST00000370017;ENST00000271311|ENST00000445274	T;T|T	0.24723|0.58797	1.84;1.84|0.31	6.05|6.05	6.05|6.05	0.98169|0.98169	Fibronectin, type III (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69735|0.69735	0.3144|0.3144	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.76575|.	0.988;0.948|.	T|T	0.70353|0.70353	-0.4895|-0.4895	10|7	0.27785|0.87932	T|D	0.31|0	-17.896|-17.896	20.6086|20.6086	0.99469|0.99469	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	362;361|.	Q5VTL7;E9PAZ5|.	FNDC7_HUMAN;.|.	S|F	361;362|136	ENSP00000359034:P361S;ENSP00000271311:P362S|ENSP00000405986:S136F	ENSP00000271311:P362S|ENSP00000405986:S136F	P|S	+|+	1|2	0|0	FNDC7|FNDC7	109070119|109070119	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.926000|0.926000	0.56050|0.56050	5.554000|5.554000	0.67294|0.67294	2.880000|2.880000	0.98712|0.98712	0.655000|0.655000	0.94253|0.94253	CCT|TCC	FNDC7	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000143107		0.403	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FNDC7	HGNC	protein_coding	OTTHUMT00000030589.4	129	0.00	0	C	NM_173532		109268596	109268596	+1	no_errors	ENST00000271311	ensembl	human	known	69_37n	missense	80	21.57	22	SNP	1.000	T
FPR2	2358	genome.wustl.edu	37	19	52272299	52272299	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:52272299C>A	ENST00000598776.1	+	2	1160	c.388C>A	c.(388-390)Cca>Aca	p.P130T	FPR2_ENST00000598953.1_Missense_Mutation_p.P130T|FPR2_ENST00000340023.6_Missense_Mutation_p.P130T	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	130					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)			endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						TGTCCTGCATCCAGTCTGGGC	0.498																																						dbGAP											0													142.0	126.0	131.0					19																	52272299		2203	4300	6503	-	-	-	SO:0001583	missense	0			M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.388C>A	19.37:g.52272299C>A	ENSP00000468897:p.Pro130Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3E2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Frt_met_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_P2_purnocptor,prints_DEZorph_rcpt	p.P130T	ENST00000598776.1	37	c.388	CCDS12840.1	19	.	.	.	.	.	.	.	.	.	.	.	21.1	4.093361	0.76756	.	.	ENSG00000171049	ENST00000340023	T	0.61392	0.11	3.62	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000001	T	0.78591	0.4307	M	0.89658	3.05	0.47584	D	0.999462	D	0.71674	0.998	D	0.80764	0.994	D	0.83674	0.0168	10	0.87932	D	0	.	13.1307	0.59380	0.0:1.0:0.0:0.0	.	130	P25090	FPR2_HUMAN	T	130	ENSP00000340191:P130T	ENSP00000340191:P130T	P	+	1	0	FPR2	56964111	1.000000	0.71417	0.954000	0.39281	0.961000	0.63080	5.327000	0.65881	2.031000	0.59945	0.491000	0.48974	CCA	FPR2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Frt_met_rcpt,prints_Anphylx_rcpt,prints_P2_purnocptor,prints_DEZorph_rcpt	ENSG00000171049		0.498	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FPR2	HGNC	protein_coding	OTTHUMT00000466912.2	440	0.00	0	C	NM_001005738		52272299	52272299	+1	no_errors	ENST00000340023	ensembl	human	known	69_37n	missense	246	27.70	95	SNP	1.000	A
FXR2	9513	genome.wustl.edu	37	17	7497244	7497244	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:7497244A>G	ENST00000250113.7	-	11	1433	c.1099T>C	c.(1099-1101)Tac>Cac	p.Y367H	FXR2_ENST00000573057.1_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	367						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		ACCTGCAGGTAGGAGAGGTGA	0.512																																						dbGAP											0													61.0	58.0	59.0					17																	7497244		1865	4104	5969	-	-	-	SO:0001583	missense	0			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1099T>C	17.37:g.7497244A>G	ENSP00000250113:p.Tyr367His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.Y367H	ENST00000250113.7	37	c.1099	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	A	14.42	2.531307	0.45073	.	.	ENSG00000129245	ENST00000250113	T	0.38240	1.15	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.26702	0.0653	L	0.31926	0.97	0.58432	D	0.999999	B	0.15719	0.014	B	0.17979	0.02	T	0.07712	-1.0758	10	0.09590	T	0.72	2.1088	13.6401	0.62246	1.0:0.0:0.0:0.0	.	367	P51116	FXR2_HUMAN	H	367	ENSP00000250113:Y367H	ENSP00000250113:Y367H	Y	-	1	0	FXR2	7437969	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	8.816000	0.91979	2.317000	0.78254	0.460000	0.39030	TAC	FXR2	-	NULL	ENSG00000129245		0.512	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1	85	0.00	0	A			7497244	7497244	-1	no_errors	ENST00000250113	ensembl	human	known	69_37n	missense	33	51.47	35	SNP	1.000	G
FZD6	8323	genome.wustl.edu	37	8	104340619	104340619	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr8:104340619T>G	ENST00000358755.4	+	5	1833	c.1516T>G	c.(1516-1518)Ttt>Gtt	p.F506V	FZD6_ENST00000523739.1_Missense_Mutation_p.F474V|FZD6_ENST00000540287.1_Missense_Mutation_p.F201V|FZD6_ENST00000522566.1_Missense_Mutation_p.F506V	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	506					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			ATGGGCTGGGTTTTTTAAACG	0.333																																						dbGAP											0													89.0	93.0	92.0					8																	104340619		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.1516T>G	8.37:g.104340619T>G	ENSP00000351605:p.Phe506Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.F506V	ENST00000358755.4	37	c.1516	CCDS6298.1	8	.	.	.	.	.	.	.	.	.	.	T	24.8	4.573969	0.86542	.	.	ENSG00000164930	ENST00000522566;ENST00000358755;ENST00000523739;ENST00000540287;ENST00000539487	D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55	5.45	5.45	0.79879	.	0.142143	0.64402	N	0.000004	D	0.89942	0.6861	M	0.68952	2.095	0.58432	D	0.999997	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.87578	0.996;0.997;0.998;0.996	D	0.90285	0.4318	10	0.52906	T	0.07	.	15.8118	0.78571	0.0:0.0:0.0:1.0	.	451;201;506;506	B4E236;F5H831;B2R9H9;O60353	.;.;.;FZD6_HUMAN	V	506;506;474;201;451	ENSP00000429055:F506V;ENSP00000351605:F506V;ENSP00000429528:F474V;ENSP00000443757:F201V	ENSP00000351605:F506V	F	+	1	0	FZD6	104409795	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.798000	0.85924	2.194000	0.70268	0.383000	0.25322	TTT	FZD6	-	pfam_Frizzled	ENSG00000164930		0.333	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	HGNC	protein_coding	OTTHUMT00000380560.1	253	0.00	0	T	NM_003506		104340619	104340619	+1	no_errors	ENST00000358755	ensembl	human	known	69_37n	missense	406	21.28	110	SNP	1.000	G
GALNT13	114805	genome.wustl.edu	37	2	155115571	155115571	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:155115571A>T	ENST00000392825.3	+	8	1462	c.895A>T	c.(895-897)Aga>Tga	p.R299*	GALNT13_ENST00000487047.1_3'UTR|GALNT13_ENST00000409237.1_Nonsense_Mutation_p.R299*	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	299	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TTCTATTGACAGAAACTACTT	0.338																																						dbGAP											0													94.0	100.0	98.0					2																	155115571		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.895A>T	2.37:g.155115571A>T	ENSP00000376570:p.Arg299*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Nonsense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R299*	ENST00000392825.3	37	c.895	CCDS2199.1	2	.	.	.	.	.	.	.	.	.	.	A	45	11.525320	0.99572	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	.	.	.	5.85	5.85	0.93711	.	0.047828	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4171	0.74977	1.0:0.0:0.0:0.0	.	.	.	.	X	299	.	ENSP00000376570:R299X	R	+	1	2	GALNT13	154823817	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.818000	0.62657	2.237000	0.73441	0.528000	0.53228	AGA	GALNT13	-	pfam_Glyco_trans_2	ENSG00000144278		0.338	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	HGNC	protein_coding	OTTHUMT00000254870.2	252	0.00	0	A	NM_052917		155115571	155115571	+1	no_errors	ENST00000409237	ensembl	human	known	69_37n	nonsense	146	19.23	35	SNP	1.000	T
GSS	2937	genome.wustl.edu	37	20	33530406	33530406	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr20:33530406A>C	ENST00000216951.2	-	5	474	c.376T>G	c.(376-378)Tca>Gca	p.S126A	GSS_ENST00000451957.2_Intron|GSS_ENST00000541098.1_5'UTR	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	126					aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	ATGTAGTCTGAGCGATTCAGG	0.582																																						dbGAP											0													85.0	78.0	80.0					20																	33530406		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.376T>G	20.37:g.33530406A>C	ENSP00000216951:p.Ser126Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R697|B6F210|E1P5P9|Q4TTD9	Missense_Mutation	SNP	pfam_Glutathione_synthase_euk,pfam_Glutathione_synth_subst-bd_euk,superfamily_PreATP-grasp_fold,pirsf_Glutathione_synthase_euk,tigrfam_Glutathione_synthase_euk	p.S126A	ENST00000216951.2	37	c.376	CCDS13245.1	20	.	.	.	.	.	.	.	.	.	.	A	29.7	5.024403	0.93518	.	.	ENSG00000100983	ENST00000216951	D	0.93076	-3.16	5.77	5.77	0.91146	Glutathione synthase, N-terminal, eukaryotic (1);	0.056285	0.64402	D	0.000001	D	0.97303	0.9118	M	0.90977	3.165	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.97907	1.0306	10	0.59425	D	0.04	-4.441	15.7572	0.78043	1.0:0.0:0.0:0.0	.	126	P48637	GSHB_HUMAN	A	126	ENSP00000216951:S126A	ENSP00000216951:S126A	S	-	1	0	GSS	32994067	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.872000	0.92352	2.199000	0.70637	0.533000	0.62120	TCA	GSS	-	pfam_Glutathione_synthase_euk,pirsf_Glutathione_synthase_euk,tigrfam_Glutathione_synthase_euk	ENSG00000100983		0.582	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSS	HGNC	protein_coding	OTTHUMT00000078821.2	167	0.00	0	A			33530406	33530406	-1	no_errors	ENST00000216951	ensembl	human	known	69_37n	missense	81	21.36	22	SNP	1.000	C
HERC4	26091	genome.wustl.edu	37	10	69793826	69793829	+	Frame_Shift_Del	DEL	TGCA	TGCA	-			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	TGCA	TGCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr10:69793826_69793829delTGCA	ENST00000395198.3	-	6	825_828	c.578_581delTGCA	c.(577-582)atgcaafs	p.MQ193fs	HERC4_ENST00000277817.6_Frame_Shift_Del_p.MQ83fs|HERC4_ENST00000373700.4_Frame_Shift_Del_p.MQ193fs|HERC4_ENST00000412272.2_Frame_Shift_Del_p.MQ193fs|HERC4_ENST00000395187.2_3'UTR	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	193					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						TGCTGCAACTTGCATGAAAGGGAT	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.578_581delTGCA	10.37:g.69793826_69793829delTGCA	ENSP00000378624:p.Met193fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Frame_Shift_Del	DEL	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.M193fs	ENST00000395198.3	37	c.581_578	CCDS41533.1	10																																																																																			HERC4	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000148634		0.446	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	HGNC	protein_coding	OTTHUMT00000359262.1	184	0.00	0	TGCA	NM_015601		69793826	69793829	-1	no_errors	ENST00000395198	ensembl	human	known	69_37n	frame_shift_del	70	26.04	25	DEL	1.000:1.000:1.000:1.000	-
IL17A	3605	genome.wustl.edu	37	6	52053964	52053964	+	Silent	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:52053964C>A	ENST00000340057.1	+	3	387	c.342C>A	c.(340-342)ccC>ccA	p.P114P		NM_002190.2	NP_002181.1	Q16552	IL17_HUMAN	interleukin 17A	114					apoptotic process (GO:0006915)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|cellular response to interleukin-1 (GO:0071347)|fibroblast activation (GO:0072537)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein glycosylation (GO:0006486)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(3)|large_intestine(2)|lung(8)|prostate(3)|skin(1)	17	Lung NSC(77;0.116)					ACTCTGTCCCCATCCAGCAAG	0.587																																						dbGAP											0													102.0	85.0	91.0					6																	52053964		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U32659	CCDS4937.1	6p12	2011-07-14	2006-04-26	2006-04-26	ENSG00000112115	ENSG00000112115		"""Interleukins and interleukin receptors"""	5981	protein-coding gene	gene with protein product	"""cytotoxic T-lymphocyte-associated protein 8"""	603149	"""interleukin 17 (cytotoxic T-lymphocyte-associated serine esterase 8)"""	CTLA8, IL17		8390535	Standard	NM_002190		Approved	IL-17A, IL-17	uc003pak.1	Q16552	OTTHUMG00000014840	ENST00000340057.1:c.342C>A	6.37:g.52053964C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2P0	Silent	SNP	pfam_Interleukin-17,prints_Interleukin-17_chordata	p.P114	ENST00000340057.1	37	c.342	CCDS4937.1	6																																																																																			IL17A	-	pfam_Interleukin-17	ENSG00000112115		0.587	IL17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17A	HGNC	protein_coding	OTTHUMT00000040892.1	201	0.00	0	C	NM_002190		52053964	52053964	+1	no_errors	ENST00000340057	ensembl	human	known	69_37n	silent	229	17.63	49	SNP	1.000	A
IQCF2	389123	genome.wustl.edu	37	3	51897216	51897216	+	Silent	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:51897216T>C	ENST00000333127.3	+	3	354	c.325T>C	c.(325-327)Ttg>Ctg	p.L109L	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	109	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.									endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCTCCAGTCTTTGGTCCGTAT	0.597																																						dbGAP											0													132.0	127.0	129.0					3																	51897216		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.325T>C	3.37:g.51897216T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.L109	ENST00000333127.3	37	c.325	CCDS2835.1	3																																																																																			IQCF2	-	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000184345		0.597	IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF2	HGNC	protein_coding	OTTHUMT00000346594.1	215	0.00	0	T	NM_203424		51897216	51897216	+1	no_errors	ENST00000333127	ensembl	human	known	69_37n	silent	140	24.32	45	SNP	0.016	C
ITGAX	3687	genome.wustl.edu	37	16	31371718	31371718	+	Silent	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr16:31371718C>T	ENST00000268296.4	+	8	916	c.795C>T	c.(793-795)gaC>gaT	p.D265D	ITGAX_ENST00000562522.1_Silent_p.D265D	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	265	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						AAGAAGGCGACAGCCTGGATT	0.537																																						dbGAP											0													99.0	101.0	100.0					16																	31371718		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.795C>T	16.37:g.31371718C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.D265	ENST00000268296.4	37	c.795	CCDS10711.1	16																																																																																			ITGAX	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000140678		0.537	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	29	0.00	0	C	NM_000887		31371718	31371718	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.011	T
JARID2	3720	genome.wustl.edu	37	6	15496556	15496556	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:15496556C>G	ENST00000341776.2	+	7	1344	c.1100C>G	c.(1099-1101)cCc>cGc	p.P367R	JARID2_ENST00000541660.1_Missense_Mutation_p.P329R|JARID2_ENST00000397311.3_Missense_Mutation_p.P195R	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	367					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CACCACAAGCCCAGTTCCGCT	0.522																																						dbGAP											0													226.0	178.0	194.0					6																	15496556		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1100C>G	6.37:g.15496556C>G	ENSP00000341280:p.Pro367Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_TF_JmjN,pfam_Znf_C5HC2,superfamily_ARID/BRIGHT_DNA-bd,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_ARID/BRIGHT_DNA-bd	p.P367R	ENST00000341776.2	37	c.1100	CCDS4533.1	6	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754397	0.49362	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.33865	1.39;1.39;1.39	4.65	4.65	0.58169	.	0.110266	0.64402	D	0.000007	T	0.26376	0.0644	L	0.27053	0.805	0.48696	D	0.999699	D;P;P	0.53462	0.96;0.947;0.779	P;P;B	0.54312	0.748;0.663;0.168	T	0.01956	-1.1240	10	0.15952	T	0.53	-14.5892	17.7033	0.88301	0.0:1.0:0.0:0.0	.	329;231;367	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	R	231;367;195;329	ENSP00000341280:P367R;ENSP00000380478:P195R;ENSP00000444623:P329R	ENSP00000341280:P367R	P	+	2	0	JARID2	15604535	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.097000	0.57741	2.409000	0.81822	0.650000	0.86243	CCC	JARID2	-	NULL	ENSG00000008083		0.522	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JARID2	HGNC	protein_coding	OTTHUMT00000039926.1	269	0.00	0	C	NM_004973		15496556	15496556	+1	no_errors	ENST00000341776	ensembl	human	known	69_37n	missense	164	14.51	28	SNP	1.000	G
KIAA0226	9711	genome.wustl.edu	37	3	197421305	197421305	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:197421305C>T	ENST00000296343.5	-	10	1624	c.1625G>A	c.(1624-1626)cGg>cAg	p.R542Q	KIAA0226_ENST00000273582.5_Missense_Mutation_p.R497Q|KIAA0226_ENST00000389665.5_Missense_Mutation_p.R542Q	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	542					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TTGCTGGCGCCGAAGGCGGAT	0.547																																					Esophageal Squamous(3;167 355 3763 15924)	dbGAP											0													152.0	163.0	160.0					3																	197421305		2069	4198	6267	-	-	-	SO:0001583	missense	0			D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.1625G>A	3.37:g.197421305C>T	ENSP00000296343:p.Arg542Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CK5	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.R542Q	ENST00000296343.5	37	c.1625	CCDS43195.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.712501|5.712501	0.96830|0.96830	.|.	.|.	ENSG00000145016|ENSG00000145016	ENST00000415452|ENST00000273582;ENST00000296343;ENST00000389665;ENST00000447048	.|.	.|.	.|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.75561|0.75561	0.3866|0.3866	L|L	0.55990|0.55990	1.75|1.75	0.58432|0.58432	D|D	0.999993|0.999993	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.99;0.999;0.999;0.997	T|T	0.73839|0.73839	-0.3856|-0.3856	5|9	.|0.35671	.|T	.|0.21	.|.	18.3225|18.3225	0.90243|0.90243	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|390;542;497;542	.|Q5HYI6;Q92622-3;Q92622-2;Q92622	.|.;.;.;RUBIC_HUMAN	S|Q	301|497;542;542;142	.|.	.|ENSP00000273582:R497Q	G|R	-|-	1|2	0|0	KIAA0226|KIAA0226	198905702|198905702	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	7.358000|7.358000	0.79466|0.79466	2.338000|2.338000	0.79540|0.79540	0.558000|0.558000	0.71614|0.71614	GGC|CGG	KIAA0226	-	NULL	ENSG00000145016		0.547	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0226	HGNC	protein_coding	OTTHUMT00000340184.1	246	0.00	0	C	XM_032901		197421305	197421305	-1	no_errors	ENST00000296343	ensembl	human	known	69_37n	missense	229	24.42	74	SNP	1.000	T
KIAA0319L	79932	genome.wustl.edu	37	1	35908580	35908580	+	Silent	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:35908580T>C	ENST00000325722.3	-	18	2940	c.2706A>G	c.(2704-2706)aaA>aaG	p.K902K	KIAA0319L_ENST00000373266.4_Silent_p.K339K|KIAA0319L_ENST00000485551.1_5'UTR	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	902						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGATACAGCGTTTGGTGAACG	0.507																																						dbGAP											0													113.0	97.0	102.0					1																	35908580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.2706A>G	1.37:g.35908580T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Silent	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.K902	ENST00000325722.3	37	c.2706	CCDS390.1	1																																																																																			KIAA0319L	-	NULL	ENSG00000142687		0.507	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	154	0.65	1	T	NM_024874		35908580	35908580	-1	no_errors	ENST00000325722	ensembl	human	known	69_37n	silent	79	55.62	99	SNP	0.928	C
KIAA0368	23392	genome.wustl.edu	37	9	114145598	114145598	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr9:114145598C>A	ENST00000338205.5	-	34	3915	c.3696G>T	c.(3694-3696)atG>atT	p.M1232I	KIAA0368_ENST00000259335.4_Missense_Mutation_p.M1410I|KIAA0368_ENST00000374378.3_5'UTR			Q5VYK3	ECM29_HUMAN	KIAA0368	1238					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						CAGGGTCACACATTTTCACAC	0.483																																						dbGAP											0													47.0	49.0	48.0					9																	114145598		2027	4186	6213	-	-	-	SO:0001583	missense	0			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.3696G>T	9.37:g.114145598C>A	ENSP00000339889:p.Met1232Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O15074|Q8WU82	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M1410I	ENST00000338205.5	37	c.4230		9	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004326	0.54254	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.28895	1.59	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.21841	0.0526	N	0.13327	0.33	0.80722	D	1	B	0.15473	0.013	B	0.15870	0.014	T	0.07309	-1.0779	10	0.17832	T	0.49	.	20.1076	0.97898	0.0:1.0:0.0:0.0	.	707	B3KXF2	.	I	1232;1410;707	ENSP00000259335:M1410I	ENSP00000259335:M1410I	M	-	3	0	KIAA0368	113185419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.018000	0.76406	2.823000	0.97156	0.650000	0.86243	ATG	KIAA0368	-	superfamily_ARM-type_fold	ENSG00000136813		0.483	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	KIAA0368	HGNC	protein_coding	OTTHUMT00000053637.2	143	0.00	0	C	NM_014686		114145598	114145598	-1	no_errors	ENST00000259335	ensembl	human	known	69_37n	missense	64	61.68	103	SNP	1.000	A
KIF4A	24137	genome.wustl.edu	37	X	69594088	69594088	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:69594088G>A	ENST00000374403.3	+	16	1844	c.1762G>A	c.(1762-1764)Gat>Aat	p.D588N	KIF4A_ENST00000374388.3_Missense_Mutation_p.D588N	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	588					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AGCAAAGAAGGATGCCAACCA	0.353																																						dbGAP											0													66.0	58.0	61.0					X																	69594088		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1762G>A	X.37:g.69594088G>A	ENSP00000363524:p.Asp588Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D588N	ENST00000374403.3	37	c.1762	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002726	0.35320	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.70282	-0.47;-0.44	4.57	4.57	0.56435	.	0.000000	0.52532	D	0.000069	T	0.69061	0.3069	M	0.71581	2.175	0.80722	D	1	B;B	0.25521	0.128;0.001	B;B	0.27500	0.08;0.008	T	0.66093	-0.6009	10	0.19590	T	0.45	.	15.4851	0.75560	0.0:0.0:1.0:0.0	.	588;588	O95239;O95239-2	KIF4A_HUMAN;.	N	588	ENSP00000363509:D588N;ENSP00000363524:D588N	ENSP00000363509:D588N	D	+	1	0	KIF4A	69510813	1.000000	0.71417	1.000000	0.80357	0.551000	0.35334	8.615000	0.90920	2.103000	0.63969	0.523000	0.50628	GAT	KIF4A	-	NULL	ENSG00000090889		0.353	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	100	0.00	0	G	NM_012310		69594088	69594088	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	57	30.49	25	SNP	1.000	A
KLRC1	3821	genome.wustl.edu	37	12	10600152	10600152	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:10600152delT	ENST00000359151.3	-	6	750	c.569delA	c.(568-570)aatfs	p.N190fs	KLRC1_ENST00000544822.1_Frame_Shift_Del_p.N190fs|KLRC1_ENST00000536188.1_Frame_Shift_Del_p.N190fs|KLRC1_ENST00000347831.5_Frame_Shift_Del_p.N172fs|KLRC1_ENST00000408006.3_Frame_Shift_Del_p.N172fs	NM_002259.4	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C, member 1	190	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16						AGCCAAACCATTCATTGTCAC	0.313																																						dbGAP											0													117.0	108.0	111.0					12																	10600152		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U54782	CCDS8625.1, CCDS8626.1	12p13	2010-06-30			ENSG00000134545	ENSG00000134545		"""Killer cell lectin-like receptors"", ""CD molecules"""	6374	protein-coding gene	gene with protein product	"""NKG2-1/B activating NK receptor"""	161555		NKG2		9598306	Standard	NM_002259		Approved	NKG2-A, NKG2-B, CD159a	uc001qyl.3	P26715		ENST00000359151.3:c.569delA	12.37:g.10600152delT	ENSP00000352064:p.Asn190fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.N190fs	ENST00000359151.3	37	c.569	CCDS8625.1	12																																																																																			KLRC1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000134545		0.313	KLRC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLRC1	HGNC	protein_coding	OTTHUMT00000400115.1	257	0.00	0	T	NM_002259		10600152	10600152	-1	no_errors	ENST00000359151	ensembl	human	known	69_37n	frame_shift_del	144	17.42	31	DEL	0.196	-
KRT79	338785	genome.wustl.edu	37	12	53218090	53218090	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:53218090G>C	ENST00000330553.5	-	5	946	c.912C>G	c.(910-912)gaC>gaG	p.D304E		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	304	Linker 12.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGCGGTTGTTGTCCATGGACA	0.607																																						dbGAP											0													105.0	81.0	90.0					12																	53218090		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.912C>G	12.37:g.53218090G>C	ENSP00000328358:p.Asp304Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P465|Q7Z793	Missense_Mutation	SNP	pfam_F,superfamily_STAT_TF_coiled-coil,prints_Keratin_II	p.D304E	ENST00000330553.5	37	c.912	CCDS8839.1	12	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303251	0.81136	.	.	ENSG00000185640	ENST00000330553	T	0.76578	-1.03	4.08	3.19	0.36642	Filament (1);	0.000000	0.52532	D	0.000077	D	0.83413	0.5249	L	0.58969	1.84	0.40220	D	0.977726	D	0.61080	0.989	D	0.65573	0.936	D	0.85273	0.1057	10	0.87932	D	0	.	11.703	0.51581	0.0891:0.0:0.9109:0.0	.	304	Q5XKE5	K2C79_HUMAN	E	304	ENSP00000328358:D304E	ENSP00000328358:D304E	D	-	3	2	KRT79	51504357	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.396000	0.66297	1.291000	0.44653	0.561000	0.74099	GAC	KRT79	-	pfam_F	ENSG00000185640		0.607	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT79	HGNC	protein_coding	OTTHUMT00000406376.1	170	0.00	0	G	NM_175834		53218090	53218090	-1	no_errors	ENST00000330553	ensembl	human	known	69_37n	missense	91	18.75	21	SNP	1.000	C
L1CAM	3897	genome.wustl.edu	37	X	153136574	153136574	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:153136574A>G	ENST00000370060.1	-	6	650	c.461T>C	c.(460-462)gTg>gCg	p.V154A	L1CAM_ENST00000538883.1_Missense_Mutation_p.V156A|L1CAM_ENST00000370055.1_Missense_Mutation_p.V149A|L1CAM_ENST00000370057.3_Missense_Mutation_p.V154A|L1CAM_ENST00000361981.3_Missense_Mutation_p.V149A|L1CAM_ENST00000361699.4_Missense_Mutation_p.V154A|L1CAM_ENST00000543994.1_Missense_Mutation_p.V156A	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	154	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGCAGAACCACTGACTCCCC	0.637																																						dbGAP											0													51.0	44.0	46.0					X																	153136574		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.461T>C	X.37:g.153136574A>G	ENSP00000359077:p.Val154Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V156A	ENST00000370060.1	37	c.467	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	A	9.525	1.109250	0.20714	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000540065;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.12	5.12	0.69794	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.232645	0.29579	N	0.011759	T	0.69450	0.3112	L	0.39020	1.185	0.09310	N	1	P;P;P	0.38565	0.584;0.584;0.637	B;B;B	0.43251	0.289;0.268;0.413	T	0.59936	-0.7360	10	0.24483	T	0.36	.	8.0574	0.30612	0.905:0.0:0.095:0.0	.	149;154;154	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	A	154;156;154;156;149;24;149;154	ENSP00000359077:V154A;ENSP00000438430:V156A;ENSP00000359074:V154A;ENSP00000439645:V156A;ENSP00000354712:V149A;ENSP00000359072:V149A;ENSP00000355380:V154A	ENSP00000355380:V154A	V	-	2	0	L1CAM	152789768	0.061000	0.20836	0.009000	0.14445	0.174000	0.22865	3.508000	0.53378	1.891000	0.54761	0.356000	0.21956	GTG	L1CAM	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000198910		0.637	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	23	0.00	0	A	NM_024003		153136574	153136574	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	missense	2	77.78	7	SNP	0.003	G
LRBA	987	genome.wustl.edu	37	4	151829594	151829594	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:151829594G>C	ENST00000357115.3	-	11	1628	c.1385C>G	c.(1384-1386)tCc>tGc	p.S462C	LRBA_ENST00000510413.1_Missense_Mutation_p.S462C|LRBA_ENST00000535741.1_Missense_Mutation_p.S462C|LRBA_ENST00000507224.1_Missense_Mutation_p.S462C	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	462						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					ACTTTGGATGGAATGTGTTAA	0.323																																						dbGAP											0													109.0	101.0	104.0					4																	151829594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1385C>G	4.37:g.151829594G>C	ENSP00000349629:p.Ser462Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.S462C	ENST00000357115.3	37	c.1385	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632185	0.87660	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.59638	0.67;0.82;0.67;0.25	5.63	5.63	0.86233	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79724	0.4495	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.993;0.998;0.991	T	0.81324	-0.0984	10	0.72032	D	0.01	.	20.047	0.97613	0.0:0.0:1.0:0.0	.	462;462;462	E9PEM5;P50851;P50851-2	.;LRBA_HUMAN;.	C	462	ENSP00000446299:S462C;ENSP00000421552:S462C;ENSP00000349629:S462C;ENSP00000422180:S462C	ENSP00000349629:S462C	S	-	2	0	LRBA	152049044	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.752000	0.98900	2.802000	0.96397	0.563000	0.77884	TCC	LRBA	-	superfamily_ARM-type_fold	ENSG00000198589		0.323	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	406	0.00	0	G			151829594	151829594	-1	no_errors	ENST00000357115	ensembl	human	known	69_37n	missense	181	34.18	94	SNP	1.000	C
LRFN1	57622	genome.wustl.edu	37	19	39798427	39798427	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:39798427C>G	ENST00000248668.4	-	2	2161	c.2162G>C	c.(2161-2163)cGc>cCc	p.R721P		NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	721						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CCGGGCGCGGCGCGGGTAACT	0.741																																						dbGAP											0													10.0	13.0	12.0					19																	39798427		1845	4047	5892	-	-	-	SO:0001583	missense	0			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.2162G>C	19.37:g.39798427C>G	ENSP00000248668:p.Arg721Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBS9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R721P	ENST00000248668.4	37	c.2162	CCDS46071.1	19	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523303	0.85600	.	.	ENSG00000128011	ENST00000248668	T	0.72051	-0.62	4.36	4.36	0.52297	.	0.000000	0.37857	N	0.001910	T	0.73830	0.3637	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.76666	-0.2875	10	0.52906	T	0.07	.	14.394	0.66999	0.0:1.0:0.0:0.0	.	721	Q9P244	LRFN1_HUMAN	P	721	ENSP00000248668:R721P	ENSP00000248668:R721P	R	-	2	0	LRFN1	44490267	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.977000	0.76141	1.977000	0.57605	0.462000	0.41574	CGC	LRFN1	-	NULL	ENSG00000128011		0.741	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	HGNC	protein_coding	OTTHUMT00000463835.1	16	0.00	0	C	NM_020862		39798427	39798427	-1	no_errors	ENST00000248668	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	1.000	G
LRPPRC	10128	genome.wustl.edu	37	2	44190742	44190742	+	Frame_Shift_Del	DEL	T	T	-	rs536356730	byFrequency	TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:44190742delT	ENST00000260665.7	-	12	1530	c.1473delA	c.(1471-1473)gcafs	p.A491fs	LRPPRC_ENST00000409946.1_Frame_Shift_Del_p.A491fs|LRPPRC_ENST00000409659.1_Frame_Shift_Del_p.A491fs	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	491					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AAATGGCTCGTGCTGAGTTTA	0.348																																						dbGAP											0													106.0	102.0	103.0					2																	44190742		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1473delA	2.37:g.44190742delT	ENSP00000260665:p.Ala491fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Frame_Shift_Del	DEL	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.R492fs	ENST00000260665.7	37	c.1473	CCDS33189.1	2																																																																																			LRPPRC	-	NULL	ENSG00000138095		0.348	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	277	0.00	0	T	NM_133259		44190742	44190742	-1	no_errors	ENST00000260665	ensembl	human	known	69_37n	frame_shift_del	231	11.41	30	DEL	0.002	-
NRROS	375387	genome.wustl.edu	37	3	196386694	196386694	+	Silent	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:196386694G>T	ENST00000328557.4	+	3	383	c.180G>T	c.(178-180)cgG>cgT	p.R60R		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	60					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CCCACGCCCGGATGCTCACCC	0.672																																						dbGAP											0													63.0	55.0	58.0					3																	196386694		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.180G>T	3.37:g.196386694G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R60	ENST00000328557.4	37	c.180	CCDS3319.1	3																																																																																			LRRC33	-	NULL	ENSG00000174004		0.672	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC33	HGNC	protein_coding	OTTHUMT00000340676.1	54	0.00	0	G	NM_198565		196386694	196386694	+1	no_errors	ENST00000328557	ensembl	human	known	69_37n	silent	67	12.99	10	SNP	0.004	T
LRRC46	90506	genome.wustl.edu	37	17	45909569	45909569	+	Silent	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:45909569G>A	ENST00000269025.4	+	2	477	c.114G>A	c.(112-114)aaG>aaA	p.K38K	MRPL10_ENST00000290208.7_5'Flank|MRPL10_ENST00000414011.1_5'Flank|MRPL10_ENST00000351111.2_5'Flank	NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	38										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						TGTCAGAGAAGATGTGAGTGC	0.512																																						dbGAP											0													82.0	76.0	78.0					17																	45909569		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.114G>A	17.37:g.45909569G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Q0	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K38	ENST00000269025.4	37	c.114	CCDS11518.1	17																																																																																			LRRC46	-	NULL	ENSG00000141294		0.512	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC46	HGNC	protein_coding	OTTHUMT00000441377.1	228	0.00	0	G	NM_033413		45909569	45909569	+1	no_errors	ENST00000269025	ensembl	human	known	69_37n	silent	123	41.15	86	SNP	1.000	A
LRRD1	401387	genome.wustl.edu	37	7	91775484	91775484	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr7:91775484A>T	ENST00000458448.1	-	5	2509	c.2309T>A	c.(2308-2310)gTt>gAt	p.V770D	CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000422722.1_Intron|LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000430130.2_Missense_Mutation_p.V770D			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	770	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						GTTGTTGGCAACTATCTTGAA	0.269																																						dbGAP											0													210.0	167.0	180.0					7																	91775484		692	1588	2280	-	-	-	SO:0001583	missense	0			BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.2309T>A	7.37:g.91775484A>T	ENSP00000405987:p.Val770Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMM9|Q49AT9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_typical-subtyp,pfscan_Death	p.V770D	ENST00000458448.1	37	c.2309	CCDS55124.1	7	.	.	.	.	.	.	.	.	.	.	A	16.79	3.219896	0.58560	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	D;D	0.94758	-3.51;-3.51	5.8	5.8	0.92144	DEATH-like (1);	.	.	.	.	D	0.95680	0.8595	L	0.56769	1.78	0.80722	D	1	D	0.64830	0.994	P	0.58077	0.832	D	0.95534	0.8606	9	0.51188	T	0.08	.	15.8031	0.78471	1.0:0.0:0.0:0.0	.	770	A4D1F6	LRRD1_HUMAN	D	770	ENSP00000405987:V770D;ENSP00000411568:V770D	ENSP00000411568:V770D	V	-	2	0	LRRD1	91613420	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.497000	0.66924	2.209000	0.71365	0.482000	0.46254	GTT	LRRD1	-	superfamily_DEATH-like	ENSG00000240720		0.269	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRD1	HGNC	protein_coding	OTTHUMT00000342027.2	99	0.00	0	A	NM_001045475		91775484	91775484	-1	no_errors	ENST00000430130	ensembl	human	known	69_37n	missense	60	36.84	35	SNP	0.999	T
LTBP1	4052	genome.wustl.edu	37	2	33482526	33482526	+	Silent	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:33482526G>A	ENST00000404816.2	+	12	2696	c.2343G>A	c.(2341-2343)gtG>gtA	p.V781V	LTBP1_ENST00000407925.1_Silent_p.V455V|LTBP1_ENST00000404525.1_Silent_p.V402V|LTBP1_ENST00000402934.1_Silent_p.V402V|LTBP1_ENST00000390003.4_Silent_p.V455V|LTBP1_ENST00000354476.3_Silent_p.V781V|LTBP1_ENST00000418533.2_Silent_p.V455V			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	781					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGAGCCAGTGGAGGCCCTGA	0.527																																						dbGAP											0													69.0	61.0	64.0					2																	33482526		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2343G>A	2.37:g.33482526G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.V781	ENST00000404816.2	37	c.2343	CCDS33177.2	2																																																																																			LTBP1	-	NULL	ENSG00000049323		0.527	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	42	0.00	0	G	NM_206943		33482526	33482526	+1	no_errors	ENST00000354476	ensembl	human	known	69_37n	silent	32	30.43	14	SNP	1.000	A
MAP3K7	6885	genome.wustl.edu	37	6	91257871	91257871	+	Silent	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:91257871T>G	ENST00000369329.3	-	10	1136	c.975A>C	c.(973-975)acA>acC	p.T325T	MAP3K7_ENST00000369327.3_Silent_p.T325T|MAP3K7_ENST00000369325.3_Silent_p.T325T|MAP3K7_ENST00000369320.1_Silent_p.T6T|MAP3K7_ENST00000369332.3_Silent_p.T325T	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	325					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TACTCGTATTTGTAGAAGCAA	0.348																																						dbGAP											0													136.0	131.0	132.0					6																	91257871		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.975A>C	6.37:g.91257871T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Silent	SNP	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T325	ENST00000369329.3	37	c.975	CCDS5028.1	6																																																																																			MAP3K7	-	pirsf_MAPKKK7	ENSG00000135341		0.348	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1	244	0.00	0	T	NM_145331		91257871	91257871	-1	no_errors	ENST00000369329	ensembl	human	known	69_37n	silent	178	23.61	55	SNP	1.000	G
MAP4K1	11184	genome.wustl.edu	37	19	39098533	39098533	+	Silent	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:39098533C>T	ENST00000591517.1	-	16	1156	c.1128G>A	c.(1126-1128)tcG>tcA	p.S376S	MAP4K1_ENST00000396857.2_Silent_p.S376S|MAP4K1_ENST00000423454.2_Silent_p.S38S|MAP4K1_ENST00000586296.1_Intron|MAP4K1_ENST00000589130.1_Silent_p.S372S|MAP4K1_ENST00000589002.1_5'UTR	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	376					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CATCGTCAGACGACTCTGACA	0.607																																						dbGAP											0													35.0	39.0	38.0					19																	39098533		2078	4208	6286	-	-	-	SO:0001819	synonymous_variant	0			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1128G>A	19.37:g.39098533C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,smart_Citron	p.R80H	ENST00000591517.1	37	c.239	CCDS59385.1	19																																																																																			MAP4K1	-	NULL	ENSG00000104814		0.607	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	HGNC	protein_coding	OTTHUMT00000453390.1	38	0.00	0	C	NM_001042600		39098533	39098533	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000591921	ensembl	human	novel	69_37n	missense	15	28.57	6	SNP	0.051	T
MED15	51586	genome.wustl.edu	37	22	20918843	20918843	+	Silent	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr22:20918843G>A	ENST00000263205.7	+	6	627	c.558G>A	c.(556-558)caG>caA	p.Q186Q	MED15_ENST00000382974.2_Silent_p.Q115Q|MED15_ENST00000425759.2_Silent_p.Q75Q|MED15_ENST00000541476.1_Silent_p.Q160Q|MED15_ENST00000406969.1_Silent_p.Q160Q|MED15_ENST00000292733.7_Silent_p.Q186Q|MED15_ENST00000542773.1_5'UTR	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	186	Poly-Gln.			Missing (in Ref. 4; CAG30423). {ECO:0000305}.|QQ -> EL (in Ref. 7; AAB91443). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			agcagcaacagcagcagttcc	0.632											OREG0026319	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													22.0	20.0	21.0					22																	20918843		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.558G>A	22.37:g.20918843G>A		Somatic	744	WXS	Illumina GAIIx	Phase_IV	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	pfam_Mediator_Med15_met	p.A127T	ENST00000263205.7	37	c.379	CCDS33602.1	22	.	.	.	.	.	.	.	.	.	.	G	7.736	0.700238	0.15106	.	.	ENSG00000099917	ENST00000423862	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	T	0.71091	0.3299	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69079	-0.5240	4	.	.	.	.	14.9537	0.71094	0.0:0.0:1.0:0.0	.	.	.	.	T	127	.	.	A	+	1	0	MED15	19248843	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	0.474000	0.22148	2.666000	0.90696	0.655000	0.94253	GCA	MED15	-	NULL	ENSG00000099917		0.632	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2	19	0.00	0	G	NM_015889		20918843	20918843	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423862	ensembl	human	novel	69_37n	missense	9	47.06	8	SNP	1.000	A
MAPK8IP2	23542	genome.wustl.edu	37	22	51041670	51041670	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr22:51041670C>T	ENST00000329492.3	+	3	307	c.190C>T	c.(190-192)Cgc>Tgc	p.R64C	MAPK8IP2_ENST00000341339.4_Missense_Mutation_p.R64C|CHKB_ENST00000463053.1_5'Flank|MAPK8IP2_ENST00000399908.2_5'UTR|MAPK8IP2_ENST00000442429.2_Missense_Mutation_p.R64C|MAPK8IP2_ENST00000008876.5_Missense_Mutation_p.R37C|MAPK8IP2_ENST00000399912.1_5'UTR	NM_012324.3	NP_036456.1	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting protein 2	64					behavioral fear response (GO:0001662)|dendrite morphogenesis (GO:0048813)|MAPK cascade (GO:0000165)|nonassociative learning (GO:0046958)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of signal transduction (GO:0009967)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of JNK cascade (GO:0046328)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of receptor activity (GO:0010469)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal complex assembly (GO:0007172)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|neuronal postsynaptic density (GO:0097481)	beta-amyloid binding (GO:0001540)|kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTCCCTGGGGCGCTCGGAGCA	0.612																																						dbGAP											0													13.0	16.0	15.0					22																	51041670		1956	4151	6107	-	-	-	SO:0001583	missense	0			AL021708	CCDS74886.1	22q13.33	2010-04-06			ENSG00000008735	ENSG00000008735			6883	protein-coding gene	gene with protein product	"""islet-brain 2"", ""JNK-interacting protein 2"""	607755	"""PRKM8 interacting protein-like"""	PRKM8IPL		10490659	Standard	NM_012324		Approved	IB2, JIP2	uc003bmy.3	Q13387	OTTHUMG00000150181	ENST00000329492.3:c.190C>T	22.37:g.51041670C>T	ENSP00000330572:p.Arg64Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96G62|Q99771|Q9NZ59|Q9UKQ4	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom,pfscan_SH3_domain	p.R64C	ENST00000329492.3	37	c.190		22	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534105	0.85812	.	.	ENSG00000008735	ENST00000329492;ENST00000442429;ENST00000341339;ENST00000008876	T;T;T;T	0.57107	0.85;0.42;1.1;1.71	5.55	5.55	0.83447	.	0.284746	0.34802	N	0.003680	T	0.68522	0.3010	L	0.55481	1.735	0.36131	D	0.84614	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.939	T	0.75428	-0.3321	10	0.87932	D	0	-1.5235	17.0686	0.86567	0.0:1.0:0.0:0.0	.	37;64	E7EQG6;Q13387	.;JIP2_HUMAN	C	64;64;64;37	ENSP00000330572:R64C;ENSP00000404914:R64C;ENSP00000340015:R64C;ENSP00000008876:R37C	ENSP00000008876:R37C	R	+	1	0	MAPK8IP2	49388536	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	3.967000	0.56802	2.638000	0.89438	0.555000	0.69702	CGC	MAPK8IP2	-	NULL	ENSG00000008735		0.612	MAPK8IP2-202	KNOWN	basic|appris_principal	protein_coding	MAPK8IP2	HGNC	protein_coding		23	0.00	0	C	NM_012324		51041670	51041670	+1	no_errors	ENST00000329492	ensembl	human	known	69_37n	missense	20	32.26	10	SNP	1.000	T
METTL23	124512	genome.wustl.edu	37	17	74729704	74729704	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:74729704C>G	ENST00000341249.6	+	5	841	c.509C>G	c.(508-510)tCt>tGt	p.S170C	METTL23_ENST00000588822.1_Missense_Mutation_p.S103C|MFSD11_ENST00000588460.1_5'Flank|MFSD11_ENST00000586622.1_5'Flank|METTL23_ENST00000588302.1_3'UTR|METTL23_ENST00000586200.1_Missense_Mutation_p.S51C|METTL23_ENST00000590964.1_Missense_Mutation_p.S103C|METTL23_ENST00000588783.1_3'UTR|METTL23_ENST00000586738.1_3'UTR|RP11-318A15.7_ENST00000587459.1_Intron|METTL23_ENST00000586752.1_Missense_Mutation_p.S103C|MIR636_ENST00000384825.1_RNA	NM_001206984.1	NP_001193913.1	Q86XA0	MET23_HUMAN	methyltransferase like 23	170						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	methyltransferase activity (GO:0008168)			large_intestine(2)|lung(1)	3						ATAGCAGAATCTACCCTTCCA	0.403																																						dbGAP											0													149.0	148.0	148.0					17																	74729704		1895	4110	6005	-	-	-	SO:0001583	missense	0				CCDS45787.1, CCDS59298.1	17q25.2	2011-03-03	2011-03-03	2011-03-03	ENSG00000181038	ENSG00000181038			26988	protein-coding gene	gene with protein product		615262	"""chromosome 17 open reading frame 95"""	C17orf95		12477932	Standard	NM_001080510		Approved	LOC124512	uc021udl.1	Q86XA0		ENST00000341249.6:c.509C>G	17.37:g.74729704C>G	ENSP00000341543:p.Ser170Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	H9ZYJ0|K7EK32	Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.S170C	ENST00000341249.6	37	c.509	CCDS45787.1	17	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854073	0.91355	.	.	ENSG00000181038	ENST00000317409;ENST00000341249	T	0.24908	1.83	5.93	5.93	0.95920	.	0.071185	0.64402	D	0.000002	T	0.51398	0.1672	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.40496	-0.9560	10	0.54805	T	0.06	-22.3831	20.3539	0.98825	0.0:1.0:0.0:0.0	.	170	Q86XA0	MET23_HUMAN	C	249;170	ENSP00000341543:S170C	ENSP00000316862:S249C	S	+	2	0	METTL23	72241299	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.315000	0.78998	2.826000	0.97356	0.655000	0.94253	TCT	METTL23	-	NULL	ENSG00000181038		0.403	METTL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL23	HGNC	protein_coding	OTTHUMT00000451002.1	72	0.00	0	C	NM_001080510		74729704	74729704	+1	no_errors	ENST00000341249	ensembl	human	known	69_37n	missense	66	29.79	28	SNP	0.999	G
MIR622	693207	genome.wustl.edu	37	13	90883493	90883493	+	RNA	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr13:90883493C>G	ENST00000385123.1	+	0	58					NR_030754.1				microRNA 622																		CAGTGGTCATCACACAGTCTG	0.522																																						dbGAP											0													51.0	48.0	49.0					13																	90883493		1568	3582	5150	-	-	-			0					13q31.3	2011-09-12		2008-12-18	ENSG00000207858	ENSG00000207858		"""ncRNAs / Micro RNAs"""	32878	non-coding RNA	RNA, micro				MIRN622			Standard	NR_030754		Approved	hsa-mir-622	uc021rld.1				13.37:g.90883493C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000385123.1	37	NULL		13																																																																																			MIR622	-	-	ENSG00000207858		0.522	MIR622-201	KNOWN	basic	miRNA	MIR622	HGNC	miRNA		130	0.00	0	C	NR_030754		90883493	90883493	+1	no_errors	ENST00000385123	ensembl	human	known	69_37n	rna	40	56.04	51	SNP	0.040	G
MLIP	90523	genome.wustl.edu	37	6	53986383	53986383	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:53986383C>G	ENST00000274897.5	+	2	315	c.202C>G	c.(202-204)Cca>Gca	p.P68A	MLIP_ENST00000514921.1_Missense_Mutation_p.P68A|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000502396.1_Missense_Mutation_p.P79A|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000358276.5_Missense_Mutation_p.P62A|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000511744.1_3'UTR	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	68						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						TGATAAGAGTCCAGAAACTGT	0.313																																						dbGAP											0													55.0	56.0	56.0					6																	53986383		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.202C>G	6.37:g.53986383C>G	ENSP00000274897:p.Pro68Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NULL	p.P68A	ENST00000274897.5	37	c.202	CCDS4954.1	6	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945761	0.53079	.	.	ENSG00000146147	ENST00000274897;ENST00000514921;ENST00000502396;ENST00000358276;ENST00000514433	T;T;T;T;T	0.30448	2.29;1.95;1.93;1.53;1.95	5.22	4.33	0.51752	.	1.111190	0.06999	N	0.823063	T	0.16769	0.0403	L	0.57536	1.79	0.24417	N	0.994632	B;P;B	0.42248	0.008;0.774;0.297	B;B;B	0.40066	0.015;0.318;0.078	T	0.20240	-1.0281	10	0.23891	T	0.37	0.3658	11.8968	0.52661	0.0:0.8239:0.1761:0.0	.	79;68;68	Q5VWP3-3;Q5VWP3;D6RE05	.;MLIP_HUMAN;.	A	68;68;79;62;69	ENSP00000274897:P68A;ENSP00000425142:P68A;ENSP00000426290:P79A;ENSP00000351019:P62A;ENSP00000421444:P69A	ENSP00000274897:P68A	P	+	1	0	MLIP	54094342	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	2.727000	0.47311	1.291000	0.44653	0.655000	0.94253	CCA	MLIP	-	NULL	ENSG00000146147		0.313	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	97	0.00	0	C	NM_138569		53986383	53986383	+1	no_errors	ENST00000274897	ensembl	human	known	69_37n	missense	114	12.31	16	SNP	0.997	G
MSL3	10943	genome.wustl.edu	37	X	11781914	11781915	+	Nonsense_Mutation	DNP	GG	GG	AT			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:11781914_11781915GG>AT	ENST00000312196.4	+	8	870_871	c.765_766GG>AT	c.(763-768)aaGGag>aaATag	p.E256*	MSL3_ENST00000380693.3_Nonsense_Mutation_p.E90*|MSL3_ENST00000398527.2_Nonsense_Mutation_p.E244*|MSL3_ENST00000361672.2_Nonsense_Mutation_p.E107*|MSL3_ENST00000337339.2_Nonsense_Mutation_p.E256*	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)	256	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						ACCTTTGTAAGGAGATGGTGGA	0.366																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	Exception_encountered	X.37:g.11781914_11781915delinsAT	ENSP00000312244:p.Glu256*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Silent|Nonsense_Mutation	SNP	pfam_MRG,pfam_Tudor-knot,superfamily_Chromodomain-like,smart_Chromo_domain/shadow	p.K255|p.E256*	ENST00000312196.4	37	c.765|c.766	CCDS14147.1	X																																																																																			MSL3	-	pfam_MRG	ENSG00000005302		0.366	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	MSL3	HGNC	protein_coding	OTTHUMT00000055757.1	191|192	0.00	0	G	NM_006800		11781914|11781915	11781914|11781915	+1	no_errors	ENST00000312196	ensembl	human	known	69_37n	silent|nonsense	108|106	28.00|27.89	42|41	SNP	1.000	A|T
MUC12	10071	genome.wustl.edu	37	7	100646595	100646595	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr7:100646595C>T	ENST00000379442.3	+	5	13180	c.13180C>T	c.(13180-13182)Cca>Tca	p.P4394S	MUC12_ENST00000536621.1_Missense_Mutation_p.P4251S			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4394	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CCACAGCAGCCCAGGCTCCAC	0.572																																						dbGAP											0													25.0	55.0	46.0					7																	100646595		672	1569	2241	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.13180C>T	7.37:g.100646595C>T	ENSP00000368755:p.Pro4394Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.P4394S	ENST00000379442.3	37	c.13180		7	.	.	.	.	.	.	.	.	.	.	c	2.869	-0.234493	0.05983	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.14640	2.5;2.49	0.801	0.801	0.18679	.	.	.	.	.	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.43376	-0.9395	7	0.20519	T	0.43	.	7.4962	0.27490	0.0:1.0:0.0:0.0	.	.	.	.	S	4394;4251	ENSP00000368755:P4394S;ENSP00000441929:P4251S	ENSP00000368755:P4394S	P	+	1	0	MUC12	100433315	0.019000	0.18553	0.002000	0.10522	0.003000	0.03518	0.905000	0.28504	0.741000	0.32674	0.423000	0.28283	CCA	MUC12	-	NULL	ENSG00000205277		0.572	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	409	0.00	0	C	XM_379904		100646595	100646595	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	364	26.76	133	SNP	0.005	T
MUC4	4585	genome.wustl.edu	37	3	195511438	195511438	+	Missense_Mutation	SNP	G	G	T	rs201323238	byFrequency	TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:195511438G>T	ENST00000463781.3	-	2	7472	c.7013C>A	c.(7012-7014)cCt>cAt	p.P2338H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2338H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTAGTGACAGGAAGAGGCGT	0.587													.|||	39	0.00778754	0.0129	0.0	5008	,	,		19888	0.0		0.0149	False		,,,				2504	0.0072					dbGAP											0													5.0	6.0	6.0					3																	195511438		562	1469	2031	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7013C>A	3.37:g.195511438G>T	ENSP00000417498:p.Pro2338His	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.P2338H	ENST00000463781.3	37	c.7013	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	3.084	-0.188260	0.06299	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37235	1.21;1.32	.	.	.	.	.	.	.	.	T	0.28797	0.0714	N	0.19112	0.55	0.09310	N	1	D	0.54964	0.969	P	0.52481	0.7	T	0.15521	-1.0434	7	.	.	.	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	2338	E7ESK3	.	H	2338	ENSP00000417498:P2338H;ENSP00000420243:P2338H	.	P	-	2	0	MUC4	196995833	0.018000	0.18449	0.018000	0.16275	0.022000	0.10575	2.239000	0.43079	0.064000	0.16427	0.064000	0.15345	CCT	MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	26	0.00	0	G	NM_018406		195511438	195511438	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	0.157	T
MUM1L1	139221	genome.wustl.edu	37	X	105450903	105450903	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:105450903A>G	ENST00000357175.2	+	4	2127	c.1478A>G	c.(1477-1479)tAt>tGt	p.Y493C	MUM1L1_ENST00000337685.2_Missense_Mutation_p.Y493C|MUM1L1_ENST00000372552.1_Missense_Mutation_p.Y493C	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	493						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTTGAGTATTATGCTGCTGAT	0.398																																						dbGAP											0													66.0	59.0	62.0					X																	105450903		1832	4084	5916	-	-	-	SO:0001583	missense	0			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1478A>G	X.37:g.105450903A>G	ENSP00000349699:p.Tyr493Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase_major_dom	p.Y493C	ENST00000357175.2	37	c.1478	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	A	12.28	1.891788	0.33442	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.40225	1.04;1.04;1.04	4.84	2.34	0.29019	.	0.138673	0.33534	N	0.004811	T	0.49287	0.1548	L	0.44542	1.39	0.31028	N	0.717754	D	0.89917	1.0	D	0.70487	0.969	T	0.51458	-0.8703	10	0.54805	T	0.06	-29.2539	6.8243	0.23874	0.6182:0.0:0.0:0.3818	.	493	Q5H9M0	MUML1_HUMAN	C	493	ENSP00000349699:Y493C;ENSP00000338641:Y493C;ENSP00000361632:Y493C	ENSP00000338641:Y493C	Y	+	2	0	MUM1L1	105337559	0.992000	0.36948	0.984000	0.44739	0.803000	0.45373	0.754000	0.26390	0.243000	0.21327	-0.499000	0.04595	TAT	MUM1L1	-	NULL	ENSG00000157502		0.398	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	HGNC	protein_coding	OTTHUMT00000057795.1	117	0.00	0	A	NM_152423		105450903	105450903	+1	no_errors	ENST00000337685	ensembl	human	known	69_37n	missense	45	26.23	16	SNP	0.970	G
MYH6	4624	genome.wustl.edu	37	14	23862941	23862941	+	Silent	SNP	C	C	T	rs375226438		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr14:23862941C>T	ENST00000356287.3	-	21	2891	c.2862G>A	c.(2860-2862)aaG>aaA	p.K954K	MYH6_ENST00000405093.3_Silent_p.K954K			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	954					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CATCAATGTCCTTCTTGAGCT	0.552																																						dbGAP											0													218.0	178.0	191.0					14																	23862941		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2862G>A	14.37:g.23862941C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K954	ENST00000356287.3	37	c.2862	CCDS9600.1	14																																																																																			MYH6	-	NULL	ENSG00000197616		0.552	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	338	0.00	0	C			23862941	23862941	-1	no_errors	ENST00000356287	ensembl	human	known	69_37n	silent	342	14.50	58	SNP	0.988	T
NALCN	259232	genome.wustl.edu	37	13	101733990	101733990	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr13:101733990A>C	ENST00000251127.6	-	34	3854	c.3773T>G	c.(3772-3774)aTg>aGg	p.M1258R		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1258					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TATGATCTTCATGGTAACCTG	0.403																																						dbGAP											0													98.0	86.0	90.0					13																	101733990		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3773T>G	13.37:g.101733990A>C	ENSP00000251127:p.Met1258Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.M1258R	ENST00000251127.6	37	c.3773	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	22.6	4.305699	0.81247	.	.	ENSG00000102452	ENST00000251127	D	0.98419	-4.92	5.62	5.62	0.85841	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98836	0.9607	M	0.81942	2.565	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	D	0.99838	1.1059	10	0.87932	D	0	.	15.8388	0.78824	1.0:0.0:0.0:0.0	.	1258	Q8IZF0	NALCN_HUMAN	R	1258	ENSP00000251127:M1258R	ENSP00000251127:M1258R	M	-	2	0	NALCN	100531991	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.962000	0.93254	2.129000	0.65627	0.533000	0.62120	ATG	NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.403	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	378	0.00	0	A	NM_052867		101733990	101733990	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	missense	142	50.69	146	SNP	1.000	C
NCAM1	4684	genome.wustl.edu	37	11	113103076	113103076	+	Splice_Site	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr11:113103076G>C	ENST00000533760.1	+	10	1640	c.1041G>C	c.(1039-1041)gaG>gaC	p.E347D	NCAM1_ENST00000316851.7_Splice_Site_p.E465D|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Splice_Site_p.E474D	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	475	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCTATCTGGAGGTGAGTCAGG	0.542																																						dbGAP											0													61.0	59.0	60.0					11																	113103076		1975	4171	6146	-	-	-	SO:0001630	splice_region_variant	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1041+1G>C	11.37:g.113103076G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,prints_Neural_cell_adh,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E465D	ENST00000533760.1	37	c.1395		11	.	.	.	.	.	.	.	.	.	.	G	35	5.511537	0.96402	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.68025	-0.3;-0.3	5.73	5.73	0.89815	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.80979	0.4728	.	.	.	0.80722	D	1	D;P;P;P	0.53619	0.961;0.914;0.954;0.931	P;P;P;P	0.59546	0.728;0.589;0.859;0.779	T	0.81180	-0.1050	9	0.62326	D	0.03	-3.0009	20.2786	0.98501	0.0:0.0:1.0:0.0	.	475;465;475;465	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	D	347;474;465	ENSP00000384055:E474D;ENSP00000318472:E465D	ENSP00000318472:E465D	E	+	3	2	NCAM1	112608286	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.807000	0.99171	2.868000	0.98415	0.557000	0.71058	GAG	NCAM1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000149294		0.542	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	NCAM1	HGNC	protein_coding	OTTHUMT00000394068.2	120	0.00	0	G	NM_000615	Missense_Mutation	113103076	113103076	+1	no_errors	ENST00000316851	ensembl	human	known	69_37n	missense	97	22.40	28	SNP	1.000	C
NCAPD3	23310	genome.wustl.edu	37	11	134073802	134073802	+	Splice_Site	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr11:134073802C>G	ENST00000534548.2	-	11	1280		c.e11-1			NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GGTGTGGGATCTGGTAAAGCA	0.418																																						dbGAP											0													67.0	72.0	70.0					11																	134073802		2201	4294	6495	-	-	-	SO:0001630	splice_region_variant	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1216-1G>C	11.37:g.134073802C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS2|Q4KMQ9	Splice_Site	SNP	-	e11-1	ENST00000534548.2	37	c.1216-1	CCDS31723.1	11	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255565	0.80135	.	.	ENSG00000151503	ENST00000534548	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NCAPD3	133579012	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	3.646000	0.54396	2.884000	0.98904	0.655000	0.94253	.	NCAPD3	-	-	ENSG00000151503		0.418	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	67	0.00	0	C	NM_015261	Intron	134073802	134073802	-1	no_errors	ENST00000534548	ensembl	human	known	69_37n	splice_site	49	20.97	13	SNP	1.000	G
NCOR1	9611	genome.wustl.edu	37	17	15938204	15938204	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:15938204G>A	ENST00000268712.3	-	45	7267	c.7010C>T	c.(7009-7011)tCt>tTt	p.S2337F	NCOR1_ENST00000395857.3_Missense_Mutation_p.S921F|NCOR1_ENST00000395851.1_Missense_Mutation_p.S2234F	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2337	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AGGTATAGGAGACTTAGATTT	0.448																																						dbGAP											0													114.0	110.0	111.0					17																	15938204		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.7010C>T	17.37:g.15938204G>A	ENSP00000268712:p.Ser2337Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S2337F	ENST00000268712.3	37	c.7010	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841049	0.91197	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.63580	-0.05;0.55;0.07	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.80618	0.4657	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.998;0.998;1.0;0.999	D;D;D;D;D	0.91635	0.996;0.991;0.995;0.999;0.997	T	0.82368	-0.0492	10	0.87932	D	0	-10.0321	18.6453	0.91408	0.0:0.0:1.0:0.0	.	2240;2337;2234;856;350	E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;NCOR1_HUMAN;.;.;.	F	2337;2234;2240;921	ENSP00000268712:S2337F;ENSP00000379192:S2234F;ENSP00000379198:S921F	ENSP00000268712:S2337F	S	-	2	0	NCOR1	15878929	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.728000	0.93425	0.650000	0.86243	TCT	NCOR1	-	NULL	ENSG00000141027		0.448	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	330	0.00	0	G	NM_006311		15938204	15938204	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	106	36.14	60	SNP	1.000	A
NDUFB3	4709	genome.wustl.edu	37	2	201950321	201950321	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:201950321G>C	ENST00000237889.4	+	3	603	c.280G>C	c.(280-282)Gat>Cat	p.D94H	NDUFB3_ENST00000454214.1_Missense_Mutation_p.D94H|NDUFB3_ENST00000433898.1_Missense_Mutation_p.D94H	NM_001257102.1|NM_002491.2	NP_001244031.1|NP_002482.1	O43676	NDUB3_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa	94					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			large_intestine(1)|lung(1)|urinary_tract(1)	3						CCTGAATAAAGATAAGAAGCA	0.373																																						dbGAP											0													97.0	93.0	94.0					2																	201950321		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047183	CCDS2336.1	2q33.1	2011-07-04	2002-08-29		ENSG00000119013	ENSG00000119013		"""Mitochondrial respiratory chain complex / Complex I"""	7698	protein-coding gene	gene with protein product	"""complex I B12 subunit"""	603839	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3 (12kD, B12)"""			9425316, 11474204	Standard	NM_002491		Approved	B12	uc002uwx.4	O43676	OTTHUMG00000132820	ENST00000237889.4:c.280G>C	2.37:g.201950321G>C	ENSP00000237889:p.Asp94His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IB80	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_B12_su	p.D94H	ENST00000237889.4	37	c.280	CCDS2336.1	2	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365172	0.61513	.	.	ENSG00000119013	ENST00000237889;ENST00000433898;ENST00000454214	T;T;T	0.78246	-1.16;-1.16;-1.16	5.65	3.84	0.44239	.	0.554768	0.18562	N	0.137582	T	0.78953	0.4365	.	.	.	0.23401	N	0.997758	P	0.50819	0.939	P	0.54499	0.754	T	0.68663	-0.5349	8	.	.	.	14.2364	6.1795	0.20463	0.1578:0.0:0.6899:0.1523	.	94	O43676	NDUB3_HUMAN	H	94	ENSP00000237889:D94H;ENSP00000410600:D94H;ENSP00000407336:D94H	.	D	+	1	0	NDUFB3	201658566	1.000000	0.71417	0.874000	0.34290	0.801000	0.45260	1.648000	0.37271	1.538000	0.49270	0.655000	0.94253	GAT	NDUFB3	-	pfam_NADH_UbQ_OxRdtase_B12_su	ENSG00000119013		0.373	NDUFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB3	HGNC	protein_coding	OTTHUMT00000256277.1	222	0.00	0	G	NM_002491		201950321	201950321	+1	no_errors	ENST00000237889	ensembl	human	known	69_37n	missense	133	27.17	50	SNP	0.605	C
NEK4	6787	genome.wustl.edu	37	3	52786050	52786050	+	Silent	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:52786050T>C	ENST00000233027.5	-	7	1468	c.1266A>G	c.(1264-1266)gaA>gaG	p.E422E	NEK4_ENST00000535191.1_Silent_p.E333E|NEK4_ENST00000383721.4_Silent_p.E422E	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	422					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		GAATCAGGTTTTCAGGCTGGG	0.463																																						dbGAP											0													246.0	245.0	245.0					3																	52786050		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.1266A>G	3.37:g.52786050T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	NULL	p.K13E	ENST00000233027.5	37	c.37	CCDS2863.1	3																																																																																			NEK4	-	NULL	ENSG00000114904		0.463	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEK4	HGNC	protein_coding	OTTHUMT00000352386.2	415	0.00	0	T	NM_003157		52786050	52786050	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000487068	ensembl	human	known	69_37n	missense	165	48.29	155	SNP	0.010	C
NELL1	4745	genome.wustl.edu	37	11	20949974	20949974	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr11:20949974C>T	ENST00000357134.5	+	9	1098	c.946C>T	c.(946-948)Cca>Tca	p.P316S	NELL1_ENST00000298925.5_Missense_Mutation_p.P344S|NELL1_ENST00000325319.5_Missense_Mutation_p.P259S|NELL1_ENST00000532434.1_Missense_Mutation_p.P316S	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	316	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CAATTGCTCCCCAGACTCCCT	0.512																																						dbGAP											0													180.0	142.0	155.0					11																	20949974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.946C>T	11.37:g.20949974C>T	ENSP00000349654:p.Pro316Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_VWF_C	p.P316S	ENST00000357134.5	37	c.946	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505152	0.26949	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45	5.93	4.07	0.47477	von Willebrand factor, type C (4);	0.406531	0.28161	N	0.016365	T	0.47060	0.1425	N	0.16233	0.39	0.21020	N	0.999806	B;B;B;B	0.14012	0.002;0.005;0.009;0.003	B;B;B;B	0.17979	0.007;0.012;0.02;0.012	T	0.26189	-1.0110	10	0.19590	T	0.45	-0.3558	9.9877	0.41852	0.0:0.8016:0.0:0.1984	.	259;344;316;316	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	S	344;316;259;316	ENSP00000298925:P344S;ENSP00000349654:P316S;ENSP00000317837:P259S;ENSP00000437170:P316S	ENSP00000298925:P344S	P	+	1	0	NELL1	20906550	0.068000	0.21057	0.561000	0.28357	0.977000	0.68977	1.743000	0.38258	0.846000	0.35142	0.561000	0.74099	CCA	NELL1	-	pfam_VWF_C,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000165973		0.512	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	238	0.00	0	C	NM_006157		20949974	20949974	+1	no_errors	ENST00000357134	ensembl	human	known	69_37n	missense	90	36.17	51	SNP	0.285	T
NPFFR2	10886	genome.wustl.edu	37	4	73013148	73013148	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:73013148G>T	ENST00000308744.6	+	4	1286	c.1188G>T	c.(1186-1188)atG>atT	p.M396I	NPFFR2_ENST00000358749.3_Missense_Mutation_p.M294I|NPFFR2_ENST00000395999.1_Missense_Mutation_p.M297I|NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000506359.1_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	396					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			GGACTCTAATGATGCTCTCAG	0.488																																						dbGAP											0													92.0	87.0	89.0					4																	73013148		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1188G>T	4.37:g.73013148G>T	ENSP00000307822:p.Met396Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96RV1|Q9NR49	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NPFF_rcpt_2,prints_NPFF_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.M396I	ENST00000308744.6	37	c.1188	CCDS3551.1	4	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926221	0.52759	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.35973	1.28;1.28;1.28	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.077147	0.56097	D	0.000030	T	0.46964	0.1420	L	0.53729	1.69	0.80722	D	1	P;P	0.42248	0.575;0.774	B;P	0.48873	0.312;0.593	T	0.08638	-1.0712	10	0.22109	T	0.4	.	19.9007	0.96985	0.0:0.0:1.0:0.0	.	297;396	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	I	396;297;294	ENSP00000307822:M396I;ENSP00000379321:M297I;ENSP00000351599:M294I	ENSP00000307822:M396I	M	+	3	0	NPFFR2	73232012	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	9.704000	0.98716	2.791000	0.96007	0.655000	0.94253	ATG	NPFFR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000056291		0.488	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	NPFFR2	HGNC	protein_coding	OTTHUMT00000252170.2	120	0.00	0	G	NM_004885		73013148	73013148	+1	no_errors	ENST00000308744	ensembl	human	known	69_37n	missense	47	38.96	30	SNP	1.000	T
NUP205	23165	genome.wustl.edu	37	7	135300790	135300790	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr7:135300790A>G	ENST00000285968.6	+	24	3463	c.3437A>G	c.(3436-3438)gAc>gGc	p.D1146G		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1146					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TTACTGGATGACATGCCAGTG	0.438																																						dbGAP											0													160.0	143.0	149.0					7																	135300790		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3437A>G	7.37:g.135300790A>G	ENSP00000285968:p.Asp1146Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X3|Q86YC1	Missense_Mutation	SNP	pfam_DUF3414	p.D1146G	ENST00000285968.6	37	c.3437	CCDS34759.1	7	.	.	.	.	.	.	.	.	.	.	A	27.5	4.836468	0.91117	.	.	ENSG00000155561	ENST00000285968	T	0.32515	1.45	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	N	0.02916	-0.46	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.47355	-0.9124	10	0.25106	T	0.35	-0.0571	16.8061	0.85666	1.0:0.0:0.0:0.0	.	1146	Q92621	NU205_HUMAN	G	1146	ENSP00000285968:D1146G	ENSP00000285968:D1146G	D	+	2	0	NUP205	134951330	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	8.962000	0.93254	2.367000	0.80283	0.528000	0.53228	GAC	NUP205	-	pfam_DUF3414	ENSG00000155561		0.438	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1	196	0.00	0	A			135300790	135300790	+1	no_errors	ENST00000285968	ensembl	human	known	69_37n	missense	129	14.00	21	SNP	1.000	G
OR10H4	126541	genome.wustl.edu	37	19	16060405	16060405	+	Silent	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:16060405T>G	ENST00000322107.1	+	1	588	c.588T>G	c.(586-588)tcT>tcG	p.S196S		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						AGACATCATCTGTCATCATGG	0.453																																						dbGAP											0													309.0	273.0	285.0					19																	16060405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.588T>G	19.37:g.16060405T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ2|Q96R57	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S196	ENST00000322107.1	37	c.588	CCDS32941.1	19																																																																																			OR10H4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176231		0.453	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H4	HGNC	protein_coding	OTTHUMT00000460311.1	431	0.00	0	T			16060405	16060405	+1	no_errors	ENST00000322107	ensembl	human	known	69_37n	silent	387	67.75	813	SNP	0.000	G
OR52M1	119772	genome.wustl.edu	37	11	4566606	4566606	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr11:4566606C>A	ENST00000360213.1	+	1	186	c.186C>A	c.(184-186)taC>taA	p.Y62*		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCCCATGTACTTTTTCTTGT	0.517																																						dbGAP											0													147.0	137.0	140.0					11																	4566606		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.186C>A	11.37:g.4566606C>A	ENSP00000353343:p.Tyr62*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Y62*	ENST00000360213.1	37	c.186	CCDS31353.1	11	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233652	0.79688	.	.	ENSG00000197790	ENST00000360213	.	.	.	4.71	1.83	0.25207	.	0.000000	0.42964	D	0.000635	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6777	0.40050	0.0:0.7504:0.0:0.2496	.	.	.	.	X	62	.	ENSP00000353343:Y62X	Y	+	3	2	OR52M1	4523182	0.079000	0.21365	1.000000	0.80357	0.956000	0.61745	0.583000	0.23849	0.706000	0.31912	-0.136000	0.14681	TAC	OR52M1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197790		0.517	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52M1	HGNC	protein_coding	OTTHUMT00000385847.1	398	0.00	0	C	NM_001004137		4566606	4566606	+1	no_errors	ENST00000360213	ensembl	human	known	69_37n	nonsense	175	18.22	39	SNP	0.685	A
OR5V1	81696	genome.wustl.edu	37	6	29323667	29323667	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:29323667delA	ENST00000377154.1	-	4	605	c.306delT	c.(304-306)tttfs	p.F102fs	OR5V1_ENST00000543825.1_Frame_Shift_Del_p.F102fs			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAACAAATGCAAAAAGTTGAA	0.418																																					Ovarian(32;43 883 21137 32120 42650)	dbGAP											0													67.0	69.0	68.0					6																	29323667		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.306delT	6.37:g.29323667delA	ENSP00000366359:p.Phe102fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F102fs	ENST00000377154.1	37	c.306	CCDS4657.1	6																																																																																			OR5V1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000243729		0.418	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	HGNC	protein_coding	OTTHUMT00000076398.3	197	0.00	0	A			29323667	29323667	-1	no_errors	ENST00000377151	ensembl	human	known	69_37n	frame_shift_del	180	12.98	27	DEL	0.000	-
PAX5	5079	genome.wustl.edu	37	9	37015189	37015189	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr9:37015189T>C	ENST00000358127.4	-	3	289	c.215A>G	c.(214-216)tAt>tGt	p.Y72C	PAX5_ENST00000520281.1_Missense_Mutation_p.Y72C|PAX5_ENST00000377852.2_Missense_Mutation_p.Y72C|PAX5_ENST00000414447.1_Missense_Mutation_p.Y72C|PAX5_ENST00000377853.2_Missense_Mutation_p.Y72C|PAX5_ENST00000523241.1_Missense_Mutation_p.Y72C|PAX5_ENST00000523145.1_5'UTR|PAX5_ENST00000520154.1_Missense_Mutation_p.Y72C|PAX5_ENST00000522003.1_5'UTR|PAX5_ENST00000446742.1_Intron|PAX5_ENST00000377847.2_Missense_Mutation_p.Y72C	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	72	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(42)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		TGTCTCATAATACCTAGGACC	0.468			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																	dbGAP		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	42	Unknown(42)	haematopoietic_and_lymphoid_tissue(42)											147.0	154.0	152.0					9																	37015189		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.215A>G	9.37:g.37015189T>C	ENSP00000350844:p.Tyr72Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.Y72C	ENST00000358127.4	37	c.215	CCDS6607.1	9	.	.	.	.	.	.	.	.	.	.	T	22.3	4.268596	0.80469	.	.	ENSG00000196092	ENST00000358127;ENST00000377853;ENST00000377852;ENST00000523241;ENST00000520154;ENST00000520281;ENST00000414447;ENST00000377847	D;D;D;D;D;D;D;D	0.99598	-6.26;-6.26;-6.26;-6.26;-6.26;-6.26;-6.26;-6.26	5.68	5.68	0.88126	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.275088	0.36591	N	0.002515	D	0.99736	0.9896	H	0.95004	3.61	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.85130	0.997;0.954;0.997;0.985;0.976;0.997;0.997;0.997	D	0.97226	0.9881	10	0.87932	D	0	.	15.9657	0.79968	0.0:0.0:0.0:1.0	.	72;72;72;72;72;72;72;72	C0KTF8;C0KTF7;C0KTF6;E7ERW5;E7EQT0;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;.;PAX5_HUMAN	C	72	ENSP00000350844:Y72C;ENSP00000367084:Y72C;ENSP00000367083:Y72C;ENSP00000429637:Y72C;ENSP00000429291:Y72C;ENSP00000430773:Y72C;ENSP00000412188:Y72C;ENSP00000367078:Y72C	ENSP00000350844:Y72C	Y	-	2	0	PAX5	37005189	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.012000	0.88631	2.172000	0.68678	0.529000	0.55759	TAT	PAX5	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	ENSG00000196092		0.468	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX5	HGNC	protein_coding	OTTHUMT00000052433.1	96	0.00	0	T			37015189	37015189	-1	no_errors	ENST00000358127	ensembl	human	known	69_37n	missense	76	24.00	24	SNP	1.000	C
PCDHGA7	56108	genome.wustl.edu	37	5	140763532	140763532	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr5:140763532A>G	ENST00000518325.1	+	1	1066	c.1066A>G	c.(1066-1068)Atc>Gtc	p.I356V	PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	356	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGTAGCTCAATCCCTGAAGA	0.423																																						dbGAP											0													66.0	66.0	66.0					5																	140763532		1987	4190	6177	-	-	-	SO:0001583	missense	0			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.1066A>G	5.37:g.140763532A>G	ENSP00000430024:p.Ile356Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN87|Q9Y5D0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I356V	ENST00000518325.1	37	c.1066	CCDS54927.1	5	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.337167	0.00224	.	.	ENSG00000253537	ENST00000518325	T	0.47869	0.83	5.3	-10.1	0.00402	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.22704	0.0548	N	0.05592	-0.015	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.15870	0.014;0.011	T	0.51124	-0.8745	9	0.02654	T	1	.	20.4411	0.99115	0.3369:0.0:0.6631:0.0	.	356;356	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	V	356	ENSP00000430024:I356V	ENSP00000430024:I356V	I	+	1	0	PCDHGA7	140743716	0.000000	0.05858	0.001000	0.08648	0.492000	0.33523	-1.066000	0.03454	-2.310000	0.00650	-0.912000	0.02778	ATC	PCDHGA7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253537		0.423	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA7	HGNC	protein_coding	OTTHUMT00000374744.1	43	0.00	0	A	NM_018920		140763532	140763532	+1	no_errors	ENST00000518325	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.000	G
PCDHGB7	56099	genome.wustl.edu	37	5	140797618	140797618	+	Silent	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr5:140797618C>T	ENST00000398594.2	+	1	192	c.192C>T	c.(190-192)cgC>cgT	p.R64R	PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	64	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCGGCTCGCGAGCTGCGAG	0.592											OREG0016863	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													52.0	60.0	57.0					5																	140797618		1947	4145	6092	-	-	-	SO:0001819	synonymous_variant	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.192C>T	5.37:g.140797618C>T		Somatic	1659	WXS	Illumina GAIIx	Phase_IV	Q9UN63	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R64	ENST00000398594.2	37	c.192	CCDS47293.1	5																																																																																			PCDHGB7	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000254122		0.592	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	111	0.00	0	C	NM_018927		140797618	140797618	+1	no_errors	ENST00000398594	ensembl	human	known	69_37n	silent	45	43.90	36	SNP	0.871	T
PDCL2	132954	genome.wustl.edu	37	4	56435917	56435917	+	Missense_Mutation	SNP	A	A	C	rs537768850		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:56435917A>C	ENST00000295645.4	-	4	432	c.330T>G	c.(328-330)gaT>gaG	p.D110E		NM_152401.2	NP_689614.2	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	110	Thioredoxin fold. {ECO:0000250}.									endometrium(1)|kidney(1)|lung(4)|ovary(1)	7	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			TAACCCACACATCTTCTTCTG	0.274																																						dbGAP											0													75.0	64.0	67.0					4																	56435917		1794	4039	5833	-	-	-	SO:0001583	missense	0			BC034431	CCDS47059.1	4q12	2008-02-05			ENSG00000163440	ENSG00000163440			29524	protein-coding gene	gene with protein product		611676				12424248	Standard	NM_152401		Approved	GCPHLP	uc003hbb.3	Q8N4E4	OTTHUMG00000160674	ENST00000295645.4:c.330T>G	4.37:g.56435917A>C	ENSP00000295645:p.Asp110Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWA2|B9ZVQ9	Missense_Mutation	SNP	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold	p.D110E	ENST00000295645.4	37	c.330	CCDS47059.1	4	.	.	.	.	.	.	.	.	.	.	A	15.58	2.874986	0.51695	.	.	ENSG00000163440	ENST00000295645	T	0.14893	2.47	5.55	4.38	0.52667	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.000000	0.64402	D	0.000002	T	0.12732	0.0309	L	0.31120	0.905	0.33263	D	0.559962	B	0.21309	0.054	B	0.23150	0.044	T	0.13335	-1.0513	10	0.27082	T	0.32	-14.0545	10.6448	0.45613	0.9237:0.0:0.0763:0.0	.	110	Q8N4E4	PDCL2_HUMAN	E	110	ENSP00000295645:D110E	ENSP00000295645:D110E	D	-	3	2	PDCL2	56130674	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	1.055000	0.30467	0.951000	0.37770	0.533000	0.62120	GAT	PDCL2	-	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold	ENSG00000163440		0.274	PDCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCL2	HGNC	protein_coding	OTTHUMT00000361659.1	190	0.00	0	A	NM_152401		56435917	56435917	-1	no_errors	ENST00000295645	ensembl	human	known	69_37n	missense	214	19.17	51	SNP	1.000	C
PDE4DIP	9659	genome.wustl.edu	37	1	144923716	144923716	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:144923716delT	ENST00000369354.3	-	6	931	c.742delA	c.(742-744)atcfs	p.I248fs	PDE4DIP_ENST00000530740.1_Frame_Shift_Del_p.I385fs|PDE4DIP_ENST00000369351.3_Frame_Shift_Del_p.I248fs|PDE4DIP_ENST00000479408.2_Frame_Shift_Del_p.I35fs|PDE4DIP_ENST00000313431.9_Frame_Shift_Del_p.I411fs|PDE4DIP_ENST00000369359.4_Frame_Shift_Del_p.I385fs|PDE4DIP_ENST00000529945.1_Frame_Shift_Del_p.I411fs|PDE4DIP_ENST00000369349.3_Frame_Shift_Del_p.I248fs|PDE4DIP_ENST00000369356.4_Frame_Shift_Del_p.I248fs|PDE4DIP_ENST00000313382.9_Frame_Shift_Del_p.I314fs			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	248					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GTTTGCTGGATTTTTTCCTGG	0.453			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													390.0	353.0	365.0					1																	144923716		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.742delA	1.37:g.144923716delT	ENSP00000358360:p.Ile248fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Frame_Shift_Del	DEL	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.I248fs	ENST00000369354.3	37	c.742	CCDS30824.1	1																																																																																			PDE4DIP	-	NULL	ENSG00000178104		0.453	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	540	0.00	0	T	NM_022359		144923716	144923716	-1	no_errors	ENST00000369356	ensembl	human	known	69_37n	frame_shift_del	427	13.65	68	DEL	0.989	-
PDLIM5	10611	genome.wustl.edu	37	4	95539203	95539203	+	Silent	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:95539203A>T	ENST00000317968.4	+	8	1105	c.969A>T	c.(967-969)acA>acT	p.T323T	PDLIM5_ENST00000380176.3_3'UTR|PDLIM5_ENST00000437932.1_Silent_p.T214T|PDLIM5_ENST00000514743.1_Silent_p.T352T|PDLIM5_ENST00000542407.1_Silent_p.T201T	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	323					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TAGCTTCCACACGGAGCATGC	0.547																																						dbGAP											0													48.0	48.0	48.0					4																	95539203		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.969A>T	4.37:g.95539203A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.H66L	ENST00000317968.4	37	c.197	CCDS3641.1	4																																																																																			PDLIM5	-	NULL	ENSG00000163110		0.547	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM5	HGNC	protein_coding	OTTHUMT00000253586.1	166	0.00	0	A			95539203	95539203	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000506632	ensembl	human	known	69_37n	missense	87	12.87	13	SNP	0.000	T
PHKB	5257	genome.wustl.edu	37	16	47683069	47683069	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr16:47683069A>G	ENST00000323584.5	+	18	1775	c.1751A>G	c.(1750-1752)gAt>gGt	p.D584G	PHKB_ENST00000299167.8_Missense_Mutation_p.D584G|PHKB_ENST00000566044.1_Missense_Mutation_p.D577G|PHKB_ENST00000455779.1_Missense_Mutation_p.D577G	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	584					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GACCTAAGTGATTTCTACATG	0.338																																						dbGAP											0													171.0	160.0	163.0					16																	47683069		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1751A>G	16.37:g.47683069A>G	ENSP00000313504:p.Asp584Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4T5	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.D584G	ENST00000323584.5	37	c.1751	CCDS10729.1	16	.	.	.	.	.	.	.	.	.	.	A	27.0	4.791783	0.90453	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.91295	-2.82;-2.82	5.89	5.89	0.94794	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.94951	0.8367	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94846	0.8009	10	0.51188	T	0.08	-29.7077	15.9685	0.79995	1.0:0.0:0.0:0.0	.	584;577	Q93100;Q93100-4	KPBB_HUMAN;.	G	577;577;584	ENSP00000414345:D577G;ENSP00000313504:D584G	ENSP00000299167:D577G	D	+	2	0	PHKB	46240570	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.550000	0.90675	2.250000	0.74265	0.477000	0.44152	GAT	PHKB	-	pfam_Glyco_hydro_15	ENSG00000102893		0.338	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	HGNC	protein_coding	OTTHUMT00000430413.1	354	0.00	0	A			47683069	47683069	+1	no_errors	ENST00000299167	ensembl	human	known	69_37n	missense	167	14.80	29	SNP	1.000	G
PHLDA1	22822	genome.wustl.edu	37	12	76425062	76425062	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:76425062C>A	ENST00000266671.5	-	1	2650	c.460G>T	c.(460-462)Ggc>Tgc	p.G154C	RP11-290L1.3_ENST00000552367.1_RNA|RP11-290L1.2_ENST00000547721.1_RNA|PHLDA1_ENST00000602540.1_Missense_Mutation_p.G13C			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	154	PH.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				TCCAGCACGCCCTCCTTCAGC	0.642																																						dbGAP											0													23.0	22.0	22.0					12																	76425062		2199	4294	6493	-	-	-	SO:0001583	missense	0			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.460G>T	12.37:g.76425062C>A	ENSP00000266671:p.Gly154Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.G154C	ENST00000266671.5	37	c.460	CCDS31861.1	12	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044351	0.93685	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	T	0.78924	-1.22	4.35	4.35	0.52113	Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	D	0.85630	0.5741	M	0.62088	1.915	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	D	0.87498	0.2431	10	0.87932	D	0	-11.8392	16.1334	0.81461	0.0:1.0:0.0:0.0	.	154	Q8WV24	PHLA1_HUMAN	C	154;13	ENSP00000266671:G154C	ENSP00000266671:G154C	G	-	1	0	PHLDA1	74711329	1.000000	0.71417	0.987000	0.45799	0.993000	0.82548	7.185000	0.77714	2.403000	0.81681	0.555000	0.69702	GGC	PHLDA1	-	smart_Pleckstrin_homology	ENSG00000139289		0.642	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHLDA1	HGNC	protein_coding	OTTHUMT00000405846.2	25	0.00	0	C	NM_007350		76425062	76425062	-1	no_errors	ENST00000266671	ensembl	human	known	69_37n	missense	8	52.94	9	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178937452	178937452	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:178937452T>A	ENST00000263967.3	+	12	1997	c.1840T>A	c.(1840-1842)Ttt>Att	p.F614I		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	614	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GGTTCGAGGTTTTGCTGTTCG	0.353		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													76.0	68.0	70.0					3																	178937452		1824	4071	5895	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1840T>A	3.37:g.178937452T>A	ENSP00000263967:p.Phe614Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.F614I	ENST00000263967.3	37	c.1840	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985351	0.93044	.	.	ENSG00000121879	ENST00000263967	T	0.68624	-0.34	5.97	5.97	0.96955	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	M	0.66378	2.025	0.80722	D	1	P	0.45044	0.849	B	0.43575	0.424	T	0.69837	-0.5037	10	0.38643	T	0.18	-10.3046	16.4534	0.84003	0.0:0.0:0.0:1.0	.	614	P42336	PK3CA_HUMAN	I	614	ENSP00000263967:F614I	ENSP00000263967:F614I	F	+	1	0	PIK3CA	180420146	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	7.698000	0.84413	2.285000	0.76669	0.477000	0.44152	TTT	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	160	0.00	0	T			178937452	178937452	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	243	11.96	33	SNP	1.000	A
PJA2	9867	genome.wustl.edu	37	5	108704338	108704338	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr5:108704338C>G	ENST00000361189.2	-	5	1632	c.1393G>C	c.(1393-1395)Gat>Cat	p.D465H	PJA2_ENST00000361557.3_Missense_Mutation_p.D465H	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	465					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		TCATTCTCATCTTTTCCTGGC	0.423																																						dbGAP											0													170.0	171.0	170.0					5																	108704338		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.1393G>C	5.37:g.108704338C>G	ENSP00000354775:p.Asp465His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D465H	ENST00000361189.2	37	c.1393	CCDS4099.1	5	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670224	0.67814	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05925	3.37;3.37	5.39	5.39	0.77823	.	0.143821	0.48286	D	0.000184	T	0.20251	0.0487	L	0.53249	1.67	0.44985	D	0.998009	D	0.89917	1.0	D	0.72982	0.979	T	0.00014	-1.2406	10	0.72032	D	0.01	-31.3992	14.7387	0.69437	0.0:0.8564:0.1436:0.0	.	465	O43164	PJA2_HUMAN	H	465	ENSP00000354775:D465H;ENSP00000355284:D465H	ENSP00000354775:D465H	D	-	1	0	PJA2	108732237	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.501000	0.53325	2.809000	0.96659	0.467000	0.42956	GAT	PJA2	-	NULL	ENSG00000198961		0.423	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PJA2	HGNC	protein_coding	OTTHUMT00000250663.1	197	0.00	0	C	NM_014819		108704338	108704338	-1	no_errors	ENST00000361189	ensembl	human	known	69_37n	missense	86	11.34	11	SNP	1.000	G
PPP5D1	100506012	genome.wustl.edu	37	19	47030324	47030324	+	Silent	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:47030324G>T	ENST00000414155.1	-	2	323	c.93C>A	c.(91-93)gtC>gtA	p.V31V				E7EU14	PP5D1_HUMAN	PPP5 tetratricopeptide repeat domain containing 1	31																	GCTTCACCTTGACCACCTGGG	0.622																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					19q13.32	2013-01-11	2012-07-20		ENSG00000230510	ENSG00000230510		"""Tetratricopeptide (TTC) repeat domain containing"""	44209	protein-coding gene	gene with protein product							Standard	NM_001205281		Approved		uc021uwg.1	E7EU14		ENST00000414155.1:c.93C>A	19.37:g.47030324G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSW5	Silent	SNP	pfam_PPP_dom	p.V31	ENST00000414155.1	37	c.93		19																																																																																			PPP5D1	-	NULL	ENSG00000230510		0.622	PPP5D1-001	PUTATIVE	basic|appris_principal	protein_coding	PPP5D1	HGNC	protein_coding	OTTHUMT00000466560.1	146	0.00	0	G	NM_001205281		47030324	47030324	-1	no_errors	ENST00000414155	ensembl	human	known	69_37n	silent	100	31.51	46	SNP	0.991	T
PRAME	23532	genome.wustl.edu	37	22	22890750	22890750	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr22:22890750C>G	ENST00000398741.1	-	6	1575	c.1269G>C	c.(1267-1269)ttG>ttC	p.L423F	PRAME_ENST00000543184.1_Missense_Mutation_p.L423F|PRAME_ENST00000398743.2_Missense_Mutation_p.L423F|PRAME_ENST00000539862.1_Missense_Mutation_p.L407F|PRAME_ENST00000424204.2_Missense_Mutation_p.L407F|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000405655.3_Missense_Mutation_p.L423F|PRAME_ENST00000402697.1_Missense_Mutation_p.L423F	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	423	Mediates interaction with RARA.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		GGAGACTCTGCAAGGCAGATA	0.557																																					Melanoma(73;1707 1838 15168 27201)	dbGAP											0													97.0	90.0	92.0					22																	22890750		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.1269G>C	22.37:g.22890750C>G	ENSP00000381726:p.Leu423Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Y7|O43481|Q8IXN8	Missense_Mutation	SNP	NULL	p.L423F	ENST00000398741.1	37	c.1269	CCDS13801.1	22	.	.	.	.	.	.	.	.	.	.	C	10.54	1.378547	0.24944	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204	T;T;T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39;2.39;2.39	3.43	0.0423	0.14217	.	0.000000	0.64402	D	0.000011	T	0.40719	0.1128	M	0.91459	3.21	0.09310	N	1	D	0.71674	0.998	D	0.71184	0.972	T	0.16867	-1.0388	10	0.87932	D	0	.	5.2973	0.15758	0.0:0.6205:0.1699:0.2096	.	423	P78395	PRAME_HUMAN	F	423;423;423;423;407;423;407	ENSP00000381728:L423F;ENSP00000445675:L423F;ENSP00000381726:L423F;ENSP00000384343:L423F;ENSP00000445097:L407F;ENSP00000385198:L423F;ENSP00000407342:L407F	ENSP00000381726:L423F	L	-	3	2	PRAME	21220750	0.060000	0.20803	0.011000	0.14972	0.003000	0.03518	-0.443000	0.06862	0.096000	0.17463	0.643000	0.83706	TTG	PRAME	-	NULL	ENSG00000185686		0.557	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAME	HGNC	protein_coding	OTTHUMT00000321644.1	109	0.00	0	C	NM_206953		22890750	22890750	-1	no_errors	ENST00000398741	ensembl	human	known	69_37n	missense	47	60.83	73	SNP	0.024	G
PRAMEF10	343071	genome.wustl.edu	37	1	12954759	12954759	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:12954759C>G	ENST00000235347.4	-	3	603	c.524G>C	c.(523-525)aGa>aCa	p.R175T		NM_001039361.3	NP_001034450.2	O60809	PRA10_HUMAN	PRAME family member 10	175					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|breast(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CACTAGGCCTCTTCTGTAGTG	0.463																																						dbGAP											0													1.0	1.0	1.0					1																	12954759		298	618	916	-	-	-	SO:0001583	missense	0			AL049682	CCDS41255.1	1p36.21	2013-01-17			ENSG00000187545	ENSG00000187545		"""-"""	27997	protein-coding gene	gene with protein product							Standard	NM_001039361		Approved		uc001auo.3	O60809	OTTHUMG00000001981	ENST00000235347.4:c.524G>C	1.37:g.12954759C>G	ENSP00000235347:p.Arg175Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1V2	Missense_Mutation	SNP	NULL	p.R175T	ENST00000235347.4	37	c.524	CCDS41255.1	1	.	.	.	.	.	.	.	.	.	.	.	5.791	0.330361	0.10956	.	.	ENSG00000187545	ENST00000235347	T	0.16743	2.32	1.86	-1.76	0.08006	.	1.699630	0.02823	N	0.125832	T	0.19927	0.0479	L	0.46614	1.455	0.09310	N	1	P	0.41232	0.743	P	0.46172	0.506	T	0.15292	-1.0442	10	0.52906	T	0.07	.	2.579	0.04814	0.0:0.368:0.287:0.345	.	175	O60809	PRA10_HUMAN	T	175	ENSP00000235347:R175T	ENSP00000235347:R175T	R	-	2	0	PRAMEF10	12877346	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.495000	0.02294	-0.395000	0.07715	0.194000	0.17425	AGA	PRAMEF10	-	NULL	ENSG00000187545		0.463	PRAMEF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF10	HGNC	protein_coding	OTTHUMT00000005512.2	58	0.00	0	C	XM_496342		12954759	12954759	-1	no_errors	ENST00000235347	ensembl	human	known	69_37n	missense	39	37.10	23	SNP	0.000	G
PREX1	57580	genome.wustl.edu	37	20	47305213	47305213	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr20:47305213G>T	ENST00000371941.3	-	10	1338	c.1316C>A	c.(1315-1317)cCc>cAc	p.P439H	PREX1_ENST00000396220.1_Missense_Mutation_p.P439H	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	439	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AAAGCACTTGGGGACAGTGCT	0.557																																						dbGAP											0													159.0	117.0	131.0					20																	47305213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1316C>A	20.37:g.47305213G>T	ENSP00000361009:p.Pro439His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.P439H	ENST00000371941.3	37	c.1316	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	G	19.95	3.920974	0.73213	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.24350	1.86;1.86	5.01	4.05	0.47172	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.53938	U	0.000044	T	0.46444	0.1393	L	0.60012	1.86	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.46373	-0.9196	10	0.62326	D	0.03	.	14.698	0.69136	0.0:0.0:0.8539:0.1461	.	439	Q8TCU6	PREX1_HUMAN	H	439	ENSP00000361009:P439H;ENSP00000379522:P439H	ENSP00000361009:P439H	P	-	2	0	PREX1	46738620	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.722000	0.98770	1.078000	0.41014	0.563000	0.77884	CCC	PREX1	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000124126		0.557	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	145	0.00	0	G	NM_020820		47305213	47305213	-1	no_errors	ENST00000371941	ensembl	human	known	69_37n	missense	55	36.05	31	SNP	1.000	T
PRPF38B	55119	genome.wustl.edu	37	1	109238761	109238761	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:109238761C>G	ENST00000370025.4	+	3	711	c.442C>G	c.(442-444)Ctt>Gtt	p.L148V	PRPF38B_ENST00000370021.1_Missense_Mutation_p.L37V|PRPF38B_ENST00000370022.5_Missense_Mutation_p.L148V|PRPF38B_ENST00000467302.1_3'UTR	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	148					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		AGTGATGGGTCTTATAACACA	0.353																																						dbGAP											0													120.0	119.0	119.0					1																	109238761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.442C>G	1.37:g.109238761C>G	ENSP00000359042:p.Leu148Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Missense_Mutation	SNP	pfam_PRP38	p.L148V	ENST00000370025.4	37	c.442	CCDS788.1	1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663477	0.88251	.	.	ENSG00000134186	ENST00000370025;ENST00000370022;ENST00000370021	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.83050	0.5170	M	0.91196	3.185	0.80722	D	1	D	0.58620	0.983	P	0.62885	0.908	D	0.86484	0.1793	9	0.72032	D	0.01	.	19.2615	0.93970	0.0:1.0:0.0:0.0	.	148	Q5VTL8	PR38B_HUMAN	V	148;148;37	.	ENSP00000359038:L37V	L	+	1	0	PRPF38B	109040284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.757000	0.85209	2.561000	0.86390	0.591000	0.81541	CTT	PRPF38B	-	pfam_PRP38	ENSG00000134186		0.353	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38B	HGNC	protein_coding	OTTHUMT00000030231.1	234	0.00	0	C	NM_018061		109238761	109238761	+1	no_errors	ENST00000370025	ensembl	human	known	69_37n	missense	179	11.39	23	SNP	1.000	G
PYGL	5836	genome.wustl.edu	37	14	51398410	51398410	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr14:51398410T>G	ENST00000216392.7	-	4	841	c.509A>C	c.(508-510)aAg>aCg	p.K170T	PYGL_ENST00000544180.2_Missense_Mutation_p.K136T|PYGL_ENST00000532462.1_Missense_Mutation_p.K170T	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	170					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	ATCTCGGATCTTCTGATTGAA	0.428																																						dbGAP											0													114.0	106.0	109.0					14																	51398410		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.509A>C	14.37:g.51398410T>G	ENSP00000216392:p.Lys170Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.K170T	ENST00000216392.7	37	c.509	CCDS32080.1	14	.	.	.	.	.	.	.	.	.	.	T	18.39	3.612518	0.66672	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.93247	-3.19;-3.19;-3.19	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.93488	0.7922	L	0.59436	1.845	0.80722	D	1	P;B;B	0.43607	0.812;0.048;0.121	P;B;B	0.48677	0.586;0.058;0.06	D	0.92968	0.6395	10	0.42905	T	0.14	-9.9034	14.1281	0.65235	0.0:0.0:0.0:1.0	.	136;192;170	F5H816;Q6P1L4;P06737	.;.;PYGL_HUMAN	T	170;136;170	ENSP00000431657:K170T;ENSP00000443787:K136T;ENSP00000216392:K170T	ENSP00000216392:K170T	K	-	2	0	PYGL	50468160	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.701000	0.61810	2.279000	0.76181	0.533000	0.62120	AAG	PYGL	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100504		0.428	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGL	HGNC	protein_coding	OTTHUMT00000390654.3	55	0.00	0	T	NM_002863		51398410	51398410	-1	no_errors	ENST00000216392	ensembl	human	known	69_37n	missense	28	46.15	24	SNP	1.000	G
RAD51AP1	10635	genome.wustl.edu	37	12	4653024	4653024	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:4653024C>G	ENST00000544927.1	+	3	173	c.163C>G	c.(163-165)Ctc>Gtc	p.L55V	RAD51AP1_ENST00000352618.4_Missense_Mutation_p.L55V|RAD51AP1_ENST00000228843.9_Missense_Mutation_p.L55V|RAD51AP1_ENST00000321524.7_Missense_Mutation_p.L55V|RAD51AP1_ENST00000543041.1_5'UTR					RAD51 associated protein 1											breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00306)|COAD - Colon adenocarcinoma(12;0.0389)			CTTGAACAATCTCCGGAAAGA	0.333																																						dbGAP											0													66.0	64.0	65.0					12																	4653024		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF006259	CCDS8529.1, CCDS44805.1	12p13.2-p13.1	2004-09-16			ENSG00000111247	ENSG00000111247			16956	protein-coding gene	gene with protein product		603070				9396801	Standard	NM_001130862		Approved	PIR51	uc001qmw.3	Q96B01	OTTHUMG00000168125	ENST00000544927.1:c.163C>G	12.37:g.4653024C>G	ENSP00000446296:p.Leu55Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L55V	ENST00000544927.1	37	c.163		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.456|9.456	1.091891|1.091891	0.20471|0.20471	.|.	.|.	ENSG00000111247|ENSG00000111247	ENST00000321524;ENST00000228843;ENST00000352618;ENST00000544927|ENST00000536117	T;T;T;T|.	0.44482|.	0.92;0.92;0.92;0.92|.	5.06|5.06	-5.62|-5.62	0.02481|0.02481	.|.	1.478240|.	0.04159|.	N|.	0.322633|.	T|T	0.40171|0.40171	0.1106|0.1106	M|M	0.72894|0.72894	2.215|2.215	0.09310|0.09310	N|N	0.999997|0.999997	B;B|.	0.12013|.	0.004;0.005|.	B;B|.	0.11329|.	0.003;0.006|.	T|T	0.47420|0.47420	-0.9119|-0.9119	10|5	0.35671|.	T|.	0.21|.	3.4854|3.4854	3.4161|3.4161	0.07376|0.07376	0.1421:0.3106:0.388:0.1593|0.1421:0.3106:0.388:0.1593	.|.	55;55|.	Q96B01;Q96B01-2|.	R51A1_HUMAN;.|.	V|C	55|49	ENSP00000323750:L55V;ENSP00000228843:L55V;ENSP00000309479:L55V;ENSP00000446296:L55V|.	ENSP00000228843:L55V|.	L|S	+|+	1|2	0|0	RAD51AP1|RAD51AP1	4523285|4523285	0.003000|0.003000	0.15002|0.15002	0.004000|0.004000	0.12327|0.12327	0.050000|0.050000	0.14768|0.14768	0.535000|0.535000	0.23114|0.23114	-0.801000|-0.801000	0.04427|0.04427	-0.237000|-0.237000	0.12165|0.12165	CTC|TCT	RAD51AP1	-	NULL	ENSG00000111247		0.333	RAD51AP1-012	PUTATIVE	basic|exp_conf	protein_coding	RAD51AP1	HGNC	protein_coding	OTTHUMT00000399208.1	196	0.00	0	C	NM_006479		4653024	4653024	+1	no_errors	ENST00000228843	ensembl	human	known	69_37n	missense	87	23.68	27	SNP	0.000	G
RALYL	138046	genome.wustl.edu	37	8	85833143	85833143	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr8:85833143G>T	ENST00000521268.1	+	9	1978	c.873G>T	c.(871-873)aaG>aaT	p.K291N	snoU13_ENST00000458801.1_RNA|RALYL_ENST00000522455.1_Missense_Mutation_p.K291N|RALYL_ENST00000523850.1_Missense_Mutation_p.K218N|RALYL_ENST00000518566.1_Missense_Mutation_p.K280N|RALYL_ENST00000521376.1_Missense_Mutation_p.V145L|RALYL_ENST00000521695.1_Missense_Mutation_p.K291N|RALYL_ENST00000517638.1_Missense_Mutation_p.K304N	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	291							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						TACAGATAAAGTGATCTGAAA	0.333																																						dbGAP											0													27.0	24.0	25.0					8																	85833143		1732	3954	5686	-	-	-	SO:0001583	missense	0				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.873G>T	8.37:g.85833143G>T	ENSP00000430367:p.Lys291Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.K291N	ENST00000521268.1	37	c.873	CCDS55253.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.21|13.21	2.168945|2.168945	0.38315|0.38315	.|.	.|.	ENSG00000184672|ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850|ENST00000521376	T;T;T;T;T;T|T	0.16324|0.17213	2.77;2.77;2.77;2.78;2.75;2.35|2.29	5.86|5.86	4.99|4.99	0.66335|0.66335	.|.	.|.	.|.	.|.	.|.	T|T	0.14830|0.14830	0.0358|0.0358	N|N	0.19112|0.19112	0.55|0.55	0.21220|0.21220	N|N	0.999757|0.999757	D;D;D;D|.	0.61080|.	0.981;0.989;0.989;0.981|.	D;D;D;D|.	0.75020|.	0.966;0.985;0.985;0.966|.	T|T	0.19063|0.19063	-1.0317|-1.0317	9|7	0.87932|0.46703	D|T	0|0.11	.|.	10.2064|10.2064	0.43116|0.43116	0.1507:0.0:0.8493:0.0|0.1507:0.0:0.8493:0.0	.|.	280;218;304;291|.	B3KT61;Q86SE5-2;G3V129;Q86SE5|.	.;.;.;RALYL_HUMAN|.	N|L	291;291;291;280;304;218|145	ENSP00000430394:K291N;ENSP00000428667:K291N;ENSP00000430367:K291N;ENSP00000430065:K280N;ENSP00000430128:K304N;ENSP00000428807:K218N|ENSP00000428310:V145L	ENSP00000430128:K304N|ENSP00000428310:V145L	K|V	+|+	3|1	2|0	RALYL|RALYL	85995698|85995698	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	1.854000|1.854000	0.39368|0.39368	1.489000|1.489000	0.48450|0.48450	0.591000|0.591000	0.81541|0.81541	AAG|GTG	RALYL	-	NULL	ENSG00000184672		0.333	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	HGNC	protein_coding	OTTHUMT00000379448.1	62	0.00	0	G			85833143	85833143	+1	no_errors	ENST00000521268	ensembl	human	known	69_37n	missense	74	17.78	16	SNP	1.000	T
RBM47	54502	genome.wustl.edu	37	4	40427971	40427971	+	Missense_Mutation	SNP	G	G	T	rs140354506		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:40427971G>T	ENST00000381793.2	-	6	2128	c.1732C>A	c.(1732-1734)Cct>Act	p.P578T	RBM47_ENST00000295971.7_Missense_Mutation_p.P578T|RBM47_ENST00000381795.6_Missense_Mutation_p.P509T|RBM47_ENST00000514014.1_Missense_Mutation_p.P540T|RP11-588L15.2_ENST00000514187.1_RNA|RBM47_ENST00000319592.4_Missense_Mutation_p.P509T			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	578	Ala-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCAGCAGCAGGGAAGGCCTGA	0.592																																						dbGAP											0													120.0	99.0	106.0					4																	40427971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.1732C>A	4.37:g.40427971G>T	ENSP00000371212:p.Pro578Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.P578T	ENST00000381793.2	37	c.1732	CCDS43223.1	4	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629635	0.87660	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000514014	T;T;T;T;T	0.43688	0.94;1.65;0.94;1.65;1.75	6.04	6.04	0.98038	.	0.293936	0.43919	D	0.000514	T	0.57021	0.2025	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.915	T	0.57551	-0.7792	10	0.87932	D	0	-14.9517	20.5792	0.99380	0.0:0.0:1.0:0.0	.	509;578	A0AV96-2;A0AV96	.;RBM47_HUMAN	T	509;578;509;578;540	ENSP00000320108:P509T;ENSP00000371212:P578T;ENSP00000371214:P509T;ENSP00000295971:P578T;ENSP00000423243:P540T	ENSP00000295971:P578T	P	-	1	0	RBM47	40122728	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.425000	0.97467	2.873000	0.98535	0.561000	0.74099	CCT	RBM47	-	tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000163694		0.592	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM47	HGNC	protein_coding	OTTHUMT00000250456.2	113	0.00	0	G	NM_019027		40427971	40427971	-1	no_errors	ENST00000295971	ensembl	human	known	69_37n	missense	46	53.06	52	SNP	1.000	T
RDH5	5959	genome.wustl.edu	37	12	56118203	56118203	+	Silent	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:56118203C>T	ENST00000257895.5	+	5	983	c.831C>T	c.(829-831)ccC>ccT	p.P277P	RDH5_ENST00000548082.1_Silent_p.P277P|RDH5_ENST00000547072.1_Silent_p.P180P|RP11-644F5.10_ENST00000550412.1_3'UTR	NM_001199771.1|NM_002905.3	NP_001186700.1|NP_002896.2	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis/9-cis)	277					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)	12					Vitamin A(DB00162)	CTCGACACCCCCGAACCCGCT	0.612											OREG0021908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													143.0	126.0	132.0					12																	56118203		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89717	CCDS31829.1	12q13-q14	2013-06-03	2006-05-09			ENSG00000135437	1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	9940	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 5"""	601617	"""retinol dehydrogenase 5 (11-cis and 9-cis)"""	RDH1		9115228, 8884265, 19027726	Standard	NM_002905		Approved	HSD17B9, SDR9C5	uc001shl.3	Q92781	OTTHUMG00000170126	ENST00000257895.5:c.831C>T	12.37:g.56118203C>T		Somatic	1013	WXS	Illumina GAIIx	Phase_IV	O00179|Q8TAI2	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.P277	ENST00000257895.5	37	c.831	CCDS31829.1	12																																																																																			RDH5	-	NULL	ENSG00000135437		0.612	RDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH5	HGNC	protein_coding	OTTHUMT00000407493.1	83	0.00	0	C	NM_002905		56118203	56118203	+1	no_errors	ENST00000257895	ensembl	human	known	69_37n	silent	76	12.64	11	SNP	1.000	T
RFC4	5984	genome.wustl.edu	37	3	186508118	186508118	+	Silent	SNP	G	G	C	rs200590902		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:186508118G>C	ENST00000392481.2	-	9	1160	c.879C>G	c.(877-879)gtC>gtG	p.V293V	RFC4_ENST00000433496.1_Intron|SNORA63_ENST00000363450.1_RNA|RFC4_ENST00000296273.2_Silent_p.V293V|SNORA4_ENST00000584302.1_RNA	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	293					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		ACTTTACCTTGACCACAGCTT	0.368																																						dbGAP											0													110.0	110.0	110.0					3																	186508118		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.879C>G	3.37:g.186508118G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM41|D3DNV2|Q6FHX7	Silent	SNP	pfam_Rep_factorC_C_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.V293	ENST00000392481.2	37	c.879	CCDS3283.1	3																																																																																			RFC4	-	pfam_Rep_factorC_C_dom,superfamily_DNA_pol3_clamp-load_cplx_C	ENSG00000163918		0.368	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC4	HGNC	protein_coding	OTTHUMT00000344471.1	361	0.00	0	G	NM_002916		186508118	186508118	-1	no_errors	ENST00000296273	ensembl	human	known	69_37n	silent	454	22.79	134	SNP	0.837	C
RGL3	57139	genome.wustl.edu	37	19	11507984	11507984	+	Silent	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:11507984C>T	ENST00000380456.3	-	18	2013	c.1950G>A	c.(1948-1950)aaG>aaA	p.K650K	RGL3_ENST00000393423.3_Silent_p.K656K|RGL3_ENST00000568628.1_5'UTR	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	650	Interaction with HRAS, MRAS and RIT1. {ECO:0000250}.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						GCACATTGTGCTTCTGCAAGG	0.657																																					GBM(174;751 2067 17998 27979 33959)	dbGAP											0													79.0	81.0	80.0					19																	11507984		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.1950G>A	19.37:g.11507984C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME84|B7ZL22|Q0P6G0	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.K656	ENST00000380456.3	37	c.1968	CCDS32910.1	19																																																																																			RGL3	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000205517		0.657	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	HGNC	protein_coding	OTTHUMT00000421208.3	46	0.00	0	C	XM_290867		11507984	11507984	-1	no_errors	ENST00000393423	ensembl	human	known	69_37n	silent	12	62.86	22	SNP	1.000	T
RIMS2	9699	genome.wustl.edu	37	8	104973347	104973347	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr8:104973347T>C	ENST00000436393.2	+	13	2331	c.2090T>C	c.(2089-2091)aTt>aCt	p.I697T	RIMS2_ENST00000507740.1_Missense_Mutation_p.I711T|RIMS2_ENST00000262231.10_Missense_Mutation_p.I758T|RIMS2_ENST00000406091.3_Missense_Mutation_p.I919T			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	981	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GATGATGGAATTGGTGTAGTA	0.274										HNSCC(12;0.0054)																												dbGAP											0													100.0	108.0	106.0					8																	104973347		1799	4056	5855	-	-	-	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2090T>C	8.37:g.104973347T>C	ENSP00000390665:p.Ile697Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.I919T	ENST00000436393.2	37	c.2756		8	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522233	0.44866	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.20069	2.1;2.58;2.31;2.3;2.22;2.63	5.71	5.71	0.89125	.	.	.	.	.	T	0.19525	0.0469	L	0.38175	1.15	0.80722	D	1	B;B;B;P;P;B	0.41929	0.43;0.011;0.325;0.64;0.765;0.15	B;B;B;B;B;B	0.40825	0.184;0.034;0.097;0.341;0.281;0.189	T	0.01920	-1.1247	9	0.34782	T	0.22	.	13.5005	0.61452	0.0:0.0:0.0:1.0	.	981;981;697;758;711;919	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	T	919;934;919;981;758;711;711;697	ENSP00000427018:I919T;ENSP00000384892:I919T;ENSP00000262231:I758T;ENSP00000423559:I711T;ENSP00000386228:I711T;ENSP00000390665:I697T	ENSP00000262231:I758T	I	+	2	0	RIMS2	105042523	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.065000	0.71176	2.189000	0.69895	0.402000	0.26972	ATT	RIMS2	-	NULL	ENSG00000176406		0.274	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	271	0.00	0	T	NM_001100117		104973347	104973347	+1	no_errors	ENST00000406091	ensembl	human	known	69_37n	missense	438	12.05	60	SNP	1.000	C
RNF220	55182	genome.wustl.edu	37	1	44877905	44877905	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:44877905C>T	ENST00000355387.2	+	2	586	c.136C>T	c.(136-138)Cga>Tga	p.R46*	RNF220_ENST00000372247.2_Nonsense_Mutation_p.R46*|RNF220_ENST00000361799.2_Nonsense_Mutation_p.R46*			Q5VTB9	RN220_HUMAN	ring finger protein 220	46					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TCAGCAGCCACGACCCTTTGG	0.557																																						dbGAP											0													179.0	163.0	169.0					1																	44877905		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.136C>T	1.37:g.44877905C>T	ENSP00000347548:p.Arg46*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Nonsense_Mutation	SNP	superfamily_Peptidase_M20_dimer,pfscan_Znf_RING	p.R46*	ENST00000355387.2	37	c.136	CCDS510.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625723	0.87560	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2116	0.73227	0.1731:0.8269:0.0:0.0	.	.	.	.	X	46	.	ENSP00000347548:R46X	R	+	1	2	RNF220	44650492	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.613000	0.61176	2.880000	0.98712	0.655000	0.94253	CGA	RNF220	-	NULL	ENSG00000187147		0.557	RNF220-001	KNOWN	basic|CCDS	protein_coding	RNF220	HGNC	protein_coding	OTTHUMT00000020683.4	113	0.00	0	C	NM_018150		44877905	44877905	+1	no_errors	ENST00000355387	ensembl	human	known	69_37n	nonsense	83	46.45	72	SNP	1.000	T
ROPN1	54763	genome.wustl.edu	37	3	123688911	123688911	+	Silent	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:123688911G>A	ENST00000184183.4	-	6	890	c.550C>T	c.(550-552)Cta>Tta	p.L184L	ROPN1_ENST00000405845.3_Silent_p.L184L	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	184						cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		ATGTAGTTTAGCATCCTGCTG	0.458																																						dbGAP											0													156.0	138.0	144.0					3																	123688911		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.550C>T	3.37:g.123688911G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN99|Q9UF38	Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.L184	ENST00000184183.4	37	c.550	CCDS3026.1	3																																																																																			ROPN1	-	NULL	ENSG00000065371		0.458	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROPN1	HGNC	protein_coding	OTTHUMT00000356188.2	223	0.45	1	G	NM_017578		123688911	123688911	-1	no_errors	ENST00000184183	ensembl	human	known	69_37n	silent	72	42.40	53	SNP	1.000	A
RSBN1	54665	genome.wustl.edu	37	1	114340575	114340575	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:114340575G>C	ENST00000261441.5	-	2	850	c.787C>G	c.(787-789)Cga>Gga	p.R263G		NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	263						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTCTTCTCGGTGTTTCTTT	0.403																																						dbGAP											0													145.0	144.0	145.0					1																	114340575		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.787C>G	1.37:g.114340575G>C	ENSP00000261441:p.Arg263Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	NULL	p.R263G	ENST00000261441.5	37	c.787	CCDS862.1	1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347699	0.41599	.	.	ENSG00000081019	ENST00000261441	.	.	.	6.17	5.26	0.73747	.	0.226336	0.37623	N	0.002004	T	0.36193	0.0958	L	0.47716	1.5	0.48975	D	0.999737	B	0.33857	0.429	B	0.35470	0.203	T	0.47459	-0.9116	9	0.72032	D	0.01	-5.0721	9.0652	0.36458	0.0669:0.0:0.6808:0.2522	.	263	Q5VWQ0	RSBN1_HUMAN	G	263	.	ENSP00000261441:R263G	R	-	1	2	RSBN1	114142098	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.490000	0.53245	1.630000	0.50440	0.655000	0.94253	CGA	RSBN1	-	NULL	ENSG00000081019		0.403	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1	HGNC	protein_coding	OTTHUMT00000033022.2	332	0.00	0	G	NM_018364		114340575	114340575	-1	no_errors	ENST00000261441	ensembl	human	known	69_37n	missense	288	17.24	60	SNP	1.000	C
SAGE1	55511	genome.wustl.edu	37	X	134991072	134991072	+	Silent	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:134991072A>G	ENST00000370709.3	+	12	1491	c.1491A>G	c.(1489-1491)aaA>aaG	p.K497K	SAGE1_ENST00000324447.3_Silent_p.K497K|SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000535938.1_Silent_p.K497K			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	497						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					AAAGTGGCAAACCCCAAACTG	0.458																																						dbGAP											0													216.0	153.0	174.0					X																	134991072		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.1491A>G	X.37:g.134991072A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JNW0	Silent	SNP	NULL	p.K497	ENST00000370709.3	37	c.1491	CCDS14652.1	X																																																																																			SAGE1	-	NULL	ENSG00000181433		0.458	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	201	0.00	0	A	NM_018666		134991072	134991072	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	silent	90	45.56	77	SNP	0.000	G
SAP130	79595	genome.wustl.edu	37	2	128750777	128750777	+	Silent	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:128750777A>T	ENST00000259235.3	-	12	1668	c.1539T>A	c.(1537-1539)acT>acA	p.T513T	SAP130_ENST00000357702.5_Silent_p.T513T|SAP130_ENST00000259234.6_Silent_p.T487T	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	513					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ACTGTCGGATAGTGGACACGG	0.438																																						dbGAP											0													142.0	137.0	139.0					2																	128750777		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1539T>A	2.37:g.128750777A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Silent	SNP	NULL	p.T513	ENST00000259235.3	37	c.1539	CCDS2153.1	2																																																																																			SAP130	-	NULL	ENSG00000136715		0.438	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	HGNC	protein_coding	OTTHUMT00000254436.3	144	0.00	0	A	NM_024545		128750777	128750777	-1	no_errors	ENST00000357702	ensembl	human	known	69_37n	silent	121	18.12	27	SNP	0.995	T
SGCA	6442	genome.wustl.edu	37	17	48247563	48247563	+	Silent	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:48247563G>C	ENST00000262018.3	+	7	843	c.807G>C	c.(805-807)ctG>ctC	p.L269L	SGCA_ENST00000543315.1_Intron|SGCA_ENST00000344627.6_Intron|HILS1_ENST00000504307.1_RNA|SGCA_ENST00000513942.1_Intron	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	269					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						ATGGGATCCTGGAGCATGACC	0.637																																						dbGAP											0													119.0	102.0	108.0					17																	48247563		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.807G>C	17.37:g.48247563G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	pfam_Sarcoglycan_2	p.G42R	ENST00000262018.3	37	c.124	CCDS32679.1	17	.	.	.	.	.	.	.	.	.	.	G	8.246	0.807835	0.16467	.	.	ENSG00000108823	ENST00000504073	.	.	.	5.8	4.84	0.62591	.	.	.	.	.	T	0.69878	0.3160	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69094	-0.5236	4	.	.	.	-12.5948	14.0361	0.64646	0.0738:0.0:0.9262:0.0	.	.	.	.	R	42	.	.	G	+	1	0	SGCA	45602562	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	2.854000	0.48325	1.473000	0.48159	-0.137000	0.14449	GGA	SGCA	-	pfam_Sarcoglycan_2	ENSG00000108823		0.637	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCA	HGNC	protein_coding	OTTHUMT00000366841.1	110	0.00	0	G	NM_000023		48247563	48247563	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000504073	ensembl	human	novel	69_37n	missense	49	49.48	48	SNP	1.000	C
SGMS1	259230	genome.wustl.edu	37	10	52103376	52103376	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr10:52103376G>A	ENST00000361781.2	-	7	1458	c.499C>T	c.(499-501)Cct>Tct	p.P167S	SGMS1_ENST00000361543.2_Missense_Mutation_p.P167S|SGMS1_ENST00000492601.2_5'Flank|SGMS1_ENST00000429490.1_Intron	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	173					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						GGTAGTGGAGGCTGCACCTCC	0.458																																						dbGAP											0													48.0	44.0	45.0					10																	52103376		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.499C>T	10.37:g.52103376G>A	ENSP00000354829:p.Pro167Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_P_Acid_Pase_2/haloperoxidase,pfscan_SAM	p.P167S	ENST00000361781.2	37	c.499	CCDS7240.1	10	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461691	0.63513	.	.	ENSG00000198964	ENST00000361781;ENST00000361543	T;T	0.58358	0.71;0.34	5.62	4.67	0.58626	.	0.100972	0.64402	D	0.000001	T	0.60792	0.2296	M	0.72894	2.215	0.51767	D	0.999934	P	0.52316	0.952	P	0.49597	0.616	T	0.66791	-0.5834	10	0.87932	D	0	-14.8506	13.8271	0.63357	0.0:0.2344:0.7655:0.0	.	173	Q86VZ5	SMS1_HUMAN	S	167	ENSP00000354829:P167S;ENSP00000355235:P167S	ENSP00000355235:P167S	P	-	1	0	SGMS1	51773382	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.117000	0.71577	2.648000	0.89879	0.650000	0.86243	CCT	SGMS1	-	NULL	ENSG00000198964		0.458	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SGMS1	HGNC	protein_coding	OTTHUMT00000048074.2	98	0.00	0	G	NM_147156		52103376	52103376	-1	no_errors	ENST00000361781	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	1.000	A
SHROOM3	57619	genome.wustl.edu	37	4	77675773	77675773	+	Silent	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:77675773G>T	ENST00000296043.6	+	7	5090	c.4137G>T	c.(4135-4137)ccG>ccT	p.P1379P	RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1379					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			AGCCTCTCCCGCCCTACACCC	0.642																																						dbGAP											0													45.0	43.0	44.0					4																	77675773		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.4137G>T	4.37:g.77675773G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P1379	ENST00000296043.6	37	c.4137	CCDS3579.2	4																																																																																			SHROOM3	-	NULL	ENSG00000138771		0.642	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	97	0.00	0	G	NM_020859		77675773	77675773	+1	no_errors	ENST00000296043	ensembl	human	known	69_37n	silent	65	26.09	24	SNP	0.000	T
SI	6476	genome.wustl.edu	37	3	164773011	164773011	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:164773011G>C	ENST00000264382.3	-	13	1545	c.1483C>G	c.(1483-1485)Caa>Gaa	p.Q495E		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	495	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TGCACTTCTTGATGGAAAATA	0.348										HNSCC(35;0.089)																												dbGAP											0													124.0	118.0	120.0					3																	164773011		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1483C>G	3.37:g.164773011G>C	ENSP00000264382:p.Gln495Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.Q495E	ENST00000264382.3	37	c.1483	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	G	0.098	-1.157056	0.01686	.	.	ENSG00000090402	ENST00000264382	D	0.90620	-2.7	5.13	0.978	0.19740	Glycoside hydrolase, superfamily (1);	0.349110	0.31392	N	0.007723	T	0.71779	0.3380	N	0.02658	-0.545	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.60732	-0.7205	10	0.17832	T	0.49	.	7.6096	0.28122	0.0:0.3799:0.297:0.3231	.	495	P14410	SUIS_HUMAN	E	495	ENSP00000264382:Q495E	ENSP00000264382:Q495E	Q	-	1	0	SI	166255705	0.073000	0.21202	0.101000	0.21167	0.034000	0.12701	0.069000	0.14552	0.516000	0.28340	-0.283000	0.09986	CAA	SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.348	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	152	0.00	0	G	NM_001041		164773011	164773011	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	56	58.09	79	SNP	0.300	C
SIGLEC9	27180	genome.wustl.edu	37	19	51628959	51628959	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:51628959C>T	ENST00000250360.3	+	2	594	c.527C>T	c.(526-528)cCt>cTt	p.P176L	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.P176L	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	176	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GGGACACCCCCTATGATCTCC	0.667																																						dbGAP											0													91.0	93.0	92.0					19																	51628959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.527C>T	19.37:g.51628959C>T	ENSP00000250360:p.Pro176Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.P176L	ENST00000250360.3	37	c.527	CCDS12825.1	19	.	.	.	.	.	.	.	.	.	.	.	11.01	1.511730	0.27036	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.03468	3.92;3.92	2.88	-0.91	0.10511	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.40908	D	0.000986	T	0.07863	0.0197	L	0.54908	1.71	0.09310	N	1	D	0.71674	0.998	D	0.70016	0.967	T	0.22556	-1.0213	10	0.36615	T	0.2	.	2.2333	0.04002	0.2464:0.4475:0.0:0.3061	.	176	Q9Y336	SIGL9_HUMAN	L	176	ENSP00000413861:P176L;ENSP00000250360:P176L	ENSP00000250360:P176L	P	+	2	0	SIGLEC9	56320771	0.000000	0.05858	0.004000	0.12327	0.009000	0.06853	-0.090000	0.11163	0.394000	0.25230	0.514000	0.50259	CCT	SIGLEC9	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	ENSG00000129450		0.667	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	96	0.00	0	C	NM_014441		51628959	51628959	+1	no_errors	ENST00000440804	ensembl	human	known	69_37n	missense	58	15.94	11	SNP	0.000	T
SLC11A2	4891	genome.wustl.edu	37	12	51384687	51384687	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:51384687G>C	ENST00000262051.7	-	15	1553	c.1466C>G	c.(1465-1467)tCc>tGc	p.S489C	SLC11A2_ENST00000394904.3_Missense_Mutation_p.S518C|SLC11A2_ENST00000547198.1_Missense_Mutation_p.S489C|SLC11A2_ENST00000547688.1_Missense_Mutation_p.S518C|SLC11A2_ENST00000262052.5_Missense_Mutation_p.S489C|SLC11A2_ENST00000546743.1_Missense_Mutation_p.S410C|SLC11A2_ENST00000541174.2_Missense_Mutation_p.S489C|SLC11A2_ENST00000545993.2_Missense_Mutation_p.S485C	NM_001174126.1|NM_001174127.1	NP_001167597.1|NP_001167598.1	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2	489					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cadmium ion transmembrane transport (GO:0070574)|cation transmembrane transport (GO:0098655)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to iron ion (GO:0071281)|cellular response to oxidative stress (GO:0034599)|cellular response to tumor necrosis factor (GO:0071356)|cobalt ion transport (GO:0006824)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detection of oxygen (GO:0003032)|erythrocyte development (GO:0048821)|ferrous iron import (GO:0070627)|ferrous iron transport (GO:0015684)|heme biosynthetic process (GO:0006783)|lead ion transport (GO:0015692)|learning or memory (GO:0007611)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organismal iron ion homeostasis (GO:0060586)|nickel cation transmembrane transport (GO:0035444)|nickel cation transport (GO:0015675)|response to cadmium ion (GO:0046686)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to manganese ion (GO:0010042)|transmembrane transport (GO:0055085)|vanadium ion transport (GO:0015676)|zinc ion transmembrane transport (GO:0071577)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|brush border (GO:0005903)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|paraferritin complex (GO:0070826)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)	cadmium ion binding (GO:0046870)|cadmium ion transmembrane transporter activity (GO:0015086)|cobalt ion binding (GO:0050897)|cobalt ion transmembrane transporter activity (GO:0015087)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|ferrous iron transmembrane transporter activity (GO:0015093)|hydrogen ion transmembrane transporter activity (GO:0015078)|inorganic cation transmembrane transporter activity (GO:0022890)|iron ion binding (GO:0005506)|lead ion transmembrane transporter activity (GO:0015094)|manganese ion binding (GO:0030145)|manganese ion transmembrane transporter activity (GO:0005384)|nickel cation binding (GO:0016151)|nickel cation transmembrane transporter activity (GO:0015099)|solute:proton symporter activity (GO:0015295)|vanadium ion transmembrane transporter activity (GO:0015100)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|cervix(1)|endometrium(3)|kidney(16)|large_intestine(4)|lung(9)|upper_aerodigestive_tract(1)	36						CATATTGATGGAACAGATGAT	0.478																																						dbGAP											0													130.0	105.0	114.0					12																	51384687		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015355	CCDS8805.1, CCDS53791.1, CCDS53792.1, CCDS53793.1	12q13	2013-07-18	2013-07-18		ENSG00000110911	ENSG00000110911		"""Solute carriers"""	10908	protein-coding gene	gene with protein product		600523		NRAMP2		7613023	Standard	NM_000617		Approved	DCT1, DMT1	uc001rxk.2	P49281	OTTHUMG00000169493	ENST00000262051.7:c.1466C>G	12.37:g.51384687G>C	ENSP00000262051:p.Ser489Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT08|B4DK84|F5H741|O43288|O60932|O94801|Q498Z5|Q8IUD7|Q96J35	Missense_Mutation	SNP	pfam_Nat-R-assoc-macro_Nramp,prints_Nat-R-assoc-macro_Nramp,tigrfam_Nat-R-assoc-macro_Nramp	p.S518C	ENST00000262051.7	37	c.1553	CCDS53792.1	12	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361788	0.24684	.	.	ENSG00000110911	ENST00000262051;ENST00000547198;ENST00000262052;ENST00000394904;ENST00000547688;ENST00000541174;ENST00000545993;ENST00000546743	T;T;T;T;T;T;T;T	0.31247	1.92;1.92;1.92;1.9;1.9;1.92;1.91;1.5	5.91	2.97	0.34412	.	0.338270	0.33327	N	0.005021	T	0.27594	0.0678	L	0.50333	1.59	0.35942	D	0.833269	B;B;B;B;B;B	0.09022	0.001;0.002;0.002;0.002;0.001;0.002	B;B;B;B;B;B	0.15052	0.003;0.012;0.012;0.012;0.003;0.005	T	0.25152	-1.0140	10	0.54805	T	0.06	-4.6649	10.5292	0.44967	0.0804:0.3695:0.5501:0.0	.	452;485;518;489;338;489	B7Z9M2;F5H741;P49281-3;P49281-2;B3KY44;P49281	.;.;.;.;.;NRAM2_HUMAN	C	489;489;489;518;518;489;485;410	ENSP00000262051:S489C;ENSP00000446769:S489C;ENSP00000262052:S489C;ENSP00000378364:S518C;ENSP00000449200:S518C;ENSP00000444542:S489C;ENSP00000442810:S485C;ENSP00000446914:S410C	ENSP00000262051:S489C	S	-	2	0	SLC11A2	49670954	0.993000	0.37304	0.998000	0.56505	0.419000	0.31324	0.912000	0.28597	0.814000	0.34374	-0.145000	0.13849	TCC	SLC11A2	-	NULL	ENSG00000110911		0.478	SLC11A2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC11A2	HGNC	protein_coding	OTTHUMT00000404383.1	187	0.00	0	G			51384687	51384687	-1	no_errors	ENST00000394904	ensembl	human	known	69_37n	missense	147	13.53	23	SNP	0.974	C
SLC12A5	57468	genome.wustl.edu	37	20	44678383	44678383	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr20:44678383A>T	ENST00000454036.2	+	17	2253	c.2204A>T	c.(2203-2205)gAg>gTg	p.E735V	SLC12A5_ENST00000243964.3_Missense_Mutation_p.E712V	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	735					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCTGTCCTTGAGGGCACCTTT	0.597																																						dbGAP											0													47.0	33.0	38.0					20																	44678383		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2204A>T	20.37:g.44678383A>T	ENSP00000387694:p.Glu735Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.E735V	ENST00000454036.2	37	c.2204	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	A	14.72	2.618254	0.46736	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.92348	-3.02;-3.02	4.43	4.43	0.53597	.	0.316060	0.31495	N	0.007556	D	0.88731	0.6516	L	0.54863	1.705	0.80722	D	1	B;B	0.20550	0.046;0.035	B;B	0.22880	0.032;0.042	D	0.84525	0.0630	10	0.20046	T	0.44	.	12.6596	0.56806	1.0:0.0:0.0:0.0	.	735;712	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	V	735;712	ENSP00000387694:E735V;ENSP00000243964:E712V	ENSP00000243964:E712V	E	+	2	0	SLC12A5	44111790	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.058000	0.64300	1.850000	0.53721	0.383000	0.25322	GAG	SLC12A5	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.597	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	53	0.00	0	A			44678383	44678383	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	missense	48	20.97	13	SNP	1.000	T
SLC23A1	9963	genome.wustl.edu	37	5	138715509	138715509	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr5:138715509G>C	ENST00000348729.3	-	8	829	c.783C>G	c.(781-783)atC>atG	p.I261M	SLC23A1_ENST00000353963.3_Missense_Mutation_p.I265M|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	261					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	ACACGGTCATGATGGCCAGCA	0.617																																						dbGAP											0													112.0	92.0	99.0					5																	138715509		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.783C>G	5.37:g.138715509G>C	ENSP00000302701:p.Ile261Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.I265M	ENST00000348729.3	37	c.795	CCDS4212.1	5	.	.	.	.	.	.	.	.	.	.	G	14.69	2.610133	0.46527	.	.	ENSG00000170482	ENST00000353963;ENST00000348729	T;T	0.25250	1.81;1.81	4.54	2.71	0.32032	.	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	L	0.45744	1.44	0.53688	D	0.999976	D;P	0.76494	0.999;0.918	D;P	0.83275	0.996;0.835	T	0.14615	-1.0466	10	0.51188	T	0.08	-0.9848	3.7218	0.08459	0.2679:0.0:0.5534:0.1787	.	261;265	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	M	265;261	ENSP00000302851:I265M;ENSP00000302701:I261M	ENSP00000302701:I261M	I	-	3	3	SLC23A1	138743408	1.000000	0.71417	0.937000	0.37676	0.973000	0.67179	2.179000	0.42528	1.133000	0.42147	0.561000	0.74099	ATC	SLC23A1	-	pfam_Xant/urac/vitC	ENSG00000170482		0.617	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	SLC23A1	HGNC	protein_coding	OTTHUMT00000374185.1	66	0.00	0	G	NM_152685		138715509	138715509	-1	no_errors	ENST00000353963	ensembl	human	known	69_37n	missense	58	13.43	9	SNP	0.999	C
SLC25A4	291	genome.wustl.edu	37	4	186066044	186066044	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:186066044C>T	ENST00000281456.6	+	2	370	c.238C>T	c.(238-240)Cgt>Tgt	p.R80C		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	80					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	CAACGTGATCCGTTACTTCCC	0.522																																						dbGAP											0													159.0	154.0	156.0					4																	186066044		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.238C>T	4.37:g.186066044C>T	ENSP00000281456:p.Arg80Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP59	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor,prints_Mit_uncoupling	p.R80C	ENST00000281456.6	37	c.238	CCDS34114.1	4	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676096	0.88445	.	.	ENSG00000151729	ENST00000281456	D	0.81739	-1.53	5.37	5.37	0.77165	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.94049	0.8093	H	0.99974	5.14	0.80722	D	1	D	0.59767	0.986	P	0.52554	0.702	D	0.96746	0.9550	10	0.66056	D	0.02	1.2813	19.3071	0.94167	0.0:1.0:0.0:0.0	.	80	P12235	ADT1_HUMAN	C	80	ENSP00000281456:R80C	ENSP00000281456:R80C	R	+	1	0	SLC25A4	186303038	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.610000	0.61155	2.793000	0.96121	0.563000	0.77884	CGT	SLC25A4	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000151729		0.522	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A4	HGNC	protein_coding	OTTHUMT00000259170.3	77	0.00	0	C	NM_001151		186066044	186066044	+1	no_errors	ENST00000281456	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	T
SMG1	23049	genome.wustl.edu	37	16	18846446	18846446	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr16:18846446A>G	ENST00000446231.2	-	49	8510	c.8098T>C	c.(8098-8100)Tgt>Cgt	p.C2700R	SMG1_ENST00000389467.3_Missense_Mutation_p.C2700R			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2700					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATGAACTGACACACTGTTGGG	0.443																																						dbGAP											0													99.0	96.0	97.0					16																	18846446		1915	4128	6043	-	-	-	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8098T>C	16.37:g.18846446A>G	ENSP00000402515:p.Cys2700Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.C2700R	ENST00000446231.2	37	c.8098	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	A	17.63	3.437160	0.62955	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01034	5.42;5.42	5.77	5.77	0.91146	Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.02649	0.0080	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.68769	-0.5321	10	0.66056	D	0.02	.	16.3892	0.83528	1.0:0.0:0.0:0.0	.	2700	Q96Q15	SMG1_HUMAN	R	2700	ENSP00000402515:C2700R;ENSP00000374118:C2700R	ENSP00000374118:C2700R	C	-	1	0	SMG1	18753947	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.771000	0.91751	2.330000	0.79161	0.477000	0.44152	TGT	SMG1	-	superfamily_ARM-type_fold	ENSG00000157106		0.443	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	81	0.00	0	A	NM_015092		18846446	18846446	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	missense	48	33.33	24	SNP	1.000	G
STAB1	23166	genome.wustl.edu	37	3	52548829	52548831	+	In_Frame_Del	DEL	ACG	ACG	-	rs372965499		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	ACG	ACG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:52548829_52548831delACG	ENST00000321725.6	+	35	3867_3869	c.3791_3793delACG	c.(3790-3795)cacgct>cct	p.1264_1265HA>P		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1264					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CTGCATAGCCACGCTGAGGCCCT	0.68																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3791_3793delACG	3.37:g.52548829_52548831delACG	ENSP00000312946:p.His1264_Ala1265delinsPro	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E297|Q8IUH0|Q8IUH1|Q93072	In_Frame_Del	DEL	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EGF-like,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.HA1264in_frame_delP	ENST00000321725.6	37	c.3791_3793	CCDS33768.1	3																																																																																			STAB1	-	NULL	ENSG00000010327		0.680	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	13	0.00	0	ACG	NM_015136		52548829	52548831	+1	no_errors	ENST00000321725	ensembl	human	known	69_37n	in_frame_del	9	35.71	5	DEL	0.983:0.001:0.003	-
SYNE1	23345	genome.wustl.edu	37	6	152576053	152576053	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:152576053G>A	ENST00000367255.5	-	104	20033	c.19432C>T	c.(19432-19434)Cag>Tag	p.Q6478*	SYNE1_ENST00000341594.5_Nonsense_Mutation_p.Q6090*|SYNE1_ENST00000356820.4_Nonsense_Mutation_p.Q1002*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.Q6478*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.Q6407*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.Q6407*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6478					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTTCATCTGATGACATCGT	0.368										HNSCC(10;0.0054)																												dbGAP											0													95.0	86.0	89.0					6																	152576053		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19432C>T	6.37:g.152576053G>A	ENSP00000356224:p.Gln6478*	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q6478*	ENST00000367255.5	37	c.19432	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	42	9.175065	0.99091	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	.	.	.	5.76	5.76	0.90799	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	19.9596	0.97236	0.0:0.0:1.0:0.0	.	.	.	.	X	6478;6407;6478;6407;6090;1002	.	ENSP00000265368:Q6478X	Q	-	1	0	SYNE1	152617746	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.380000	0.59581	2.726000	0.93360	0.655000	0.94253	CAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.368	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	144	0.00	0	G	NM_182961		152576053	152576053	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	nonsense	85	20.56	22	SNP	1.000	A
TADA3	10474	genome.wustl.edu	37	3	9822135	9822135	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr3:9822135C>T	ENST00000301964.2	-	9	1763	c.1205G>A	c.(1204-1206)cGg>cAg	p.R402Q	TADA3_ENST00000440161.1_Missense_Mutation_p.R402Q	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	402					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						CTTCTTCTGCCGGGCAGCCAT	0.602																																						dbGAP											0													87.0	82.0	84.0					3																	9822135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.1205G>A	3.37:g.9822135C>T	ENSP00000307684:p.Arg402Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FI83|Q9UFS2	Missense_Mutation	SNP	pfam_Histone_AcTrfase_su3	p.R402Q	ENST00000301964.2	37	c.1205	CCDS2583.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.467928	0.96257	.	.	ENSG00000171148	ENST00000301964;ENST00000440161	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	L	0.61218	1.895	0.80722	D	1	P;P	0.40794	0.729;0.729	B;B	0.35470	0.203;0.203	T	0.62497	-0.6842	9	0.56958	D	0.05	-16.3884	17.5743	0.87944	0.0:1.0:0.0:0.0	.	402;402	O75528;A8K899	TADA3_HUMAN;.	Q	402	.	ENSP00000307684:R402Q	R	-	2	0	TADA3	9797135	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.753000	0.85153	2.590000	0.87494	0.561000	0.74099	CGG	TADA3	-	pfam_Histone_AcTrfase_su3	ENSG00000171148		0.602	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA3	HGNC	protein_coding	OTTHUMT00000250236.1	115	0.00	0	C			9822135	9822135	-1	no_errors	ENST00000301964	ensembl	human	known	69_37n	missense	46	57.39	66	SNP	1.000	T
TAS2R9	50835	genome.wustl.edu	37	12	10961953	10961953	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr12:10961953A>T	ENST00000240691.2	-	1	814	c.722T>A	c.(721-723)cTc>cAc	p.L241H	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	241					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GTACACGATGAGGAGGAGCAG	0.473																																						dbGAP											0													114.0	108.0	110.0					12																	10961953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.722T>A	12.37:g.10961953A>T	ENSP00000240691:p.Leu241His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q502V7|Q50KT0|Q50KT1|Q645W9	Missense_Mutation	SNP	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.L241H	ENST00000240691.2	37	c.722	CCDS8633.1	12	.	.	.	.	.	.	.	.	.	.	A	16.78	3.217135	0.58560	.	.	ENSG00000121381	ENST00000240691	T	0.00724	5.78	3.53	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	0.326617	0.22714	U	0.056538	T	0.01627	0.0052	L	0.37800	1.135	0.09310	N	1	D	0.76494	0.999	D	0.70227	0.968	T	0.50346	-0.8839	10	0.87932	D	0	.	2.9994	0.06009	0.6663:0.0:0.1209:0.2128	.	241	Q9NYW1	TA2R9_HUMAN	H	241	ENSP00000240691:L241H	ENSP00000240691:L241H	L	-	2	0	TAS2R9	10853220	0.007000	0.16637	0.010000	0.14722	0.716000	0.41182	1.836000	0.39191	0.546000	0.28920	0.477000	0.44152	CTC	TAS2R9	-	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000121381		0.473	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R9	HGNC	protein_coding	OTTHUMT00000399933.1	189	0.00	0	A			10961953	10961953	-1	no_errors	ENST00000240691	ensembl	human	known	69_37n	missense	135	19.16	32	SNP	0.011	T
TCEA1	6917	genome.wustl.edu	37	8	54900706	54900706	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr8:54900706C>A	ENST00000521604.2	-	5	837	c.434G>T	c.(433-435)aGg>aTg	p.R145M	TCEA1_ENST00000396401.3_Missense_Mutation_p.R124M|TCEA1_ENST00000522635.1_Intron|TCEA1_ENST00000521086.2_5'UTR	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	145	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			AAGCATCTCCCTACACTTCAA	0.483			T	PLAG1	salivary adenoma																																	dbGAP		Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	0													84.0	85.0	85.0					8																	54900706		2047	4203	6250	-	-	-	SO:0001583	missense	0			X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.434G>T	8.37:g.54900706C>A	ENSP00000428426:p.Arg145Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF25|A8K339|Q15563|Q6FG87	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_Znf_TFIIS,pfam_TFIIS_N,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.R145M	ENST00000521604.2	37	c.434	CCDS47858.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.200738	0.94997	.	.	ENSG00000187735	ENST00000396401;ENST00000521604	T;T	0.48522	0.81;0.81	5.49	5.49	0.81192	Transcription elongation factor S-IIM (1);Transcription elongation factor S-II, central domain (4);	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	M	0.91354	3.2	0.80722	D	1	D;D	0.89917	1.0;0.971	D;P	0.97110	1.0;0.898	T	0.81088	-0.1091	10	0.62326	D	0.03	-25.8907	19.7365	0.96208	0.0:1.0:0.0:0.0	.	124;145	P23193-2;P23193	.;TCEA1_HUMAN	M	124;145	ENSP00000395483:R124M;ENSP00000428426:R145M	ENSP00000395483:R124M	R	-	2	0	TCEA1	55063259	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.374000	0.79633	2.749000	0.94314	0.491000	0.48974	AGG	TCEA1	-	pfam_TFIIS_cen_dom,superfamily_TFIIS_cen_dom,smart_TFS2M,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000187735		0.483	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA1	HGNC	protein_coding	OTTHUMT00000377975.2	205	0.00	0	C	NM_006756		54900706	54900706	-1	no_errors	ENST00000521604	ensembl	human	known	69_37n	missense	275	17.42	58	SNP	1.000	A
TEC	7006	genome.wustl.edu	37	4	48230590	48230590	+	Silent	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr4:48230590C>T	ENST00000381501.3	-	2	199	c.42G>A	c.(40-42)agG>agA	p.R14R		NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	14	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						TCTGCTGTGACCTTTTAATAA	0.388																																						dbGAP											0													144.0	135.0	138.0					4																	48230590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.42G>A	4.37:g.48230590C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKZ6|Q3MIS5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom	p.R14	ENST00000381501.3	37	c.42	CCDS3481.1	4																																																																																			TEC	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000135605		0.388	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	HGNC	protein_coding	OTTHUMT00000250492.3	443	0.00	0	C			48230590	48230590	-1	no_errors	ENST00000381501	ensembl	human	known	69_37n	silent	352	18.14	78	SNP	0.966	T
TFE3	7030	genome.wustl.edu	37	X	48896923	48896923	+	Silent	SNP	T	T	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chrX:48896923T>A	ENST00000315869.7	-	3	502	c.243A>T	c.(241-243)tcA>tcT	p.S81S	TFE3_ENST00000487451.1_Intron	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	81					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						TGGCCTGCAGTGATATTGGGA	0.537			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																	dbGAP		Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	0													34.0	23.0	27.0					X																	48896923		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.243A>T	X.37:g.48896923T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Silent	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S81	ENST00000315869.7	37	c.243	CCDS14315.3	X																																																																																			TFE3	-	NULL	ENSG00000068323		0.537	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFE3	HGNC	protein_coding	OTTHUMT00000058872.2	111	0.00	0	T	NM_006521		48896923	48896923	-1	no_errors	ENST00000315869	ensembl	human	known	69_37n	silent	41	38.57	27	SNP	1.000	A
TFEC	22797	genome.wustl.edu	37	7	115580952	115580952	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr7:115580952G>T	ENST00000265440.7	-	8	877	c.697C>A	c.(697-699)Cca>Aca	p.P233T	TFEC_ENST00000320239.7_Missense_Mutation_p.P204T|TFEC_ENST00000457268.1_Missense_Mutation_p.P166T|TFEC_ENST00000393485.1_3'UTR	NM_012252.3	NP_036384.1	O14948	TFEC_HUMAN	transcription factor EC	233					cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			GCCAGGGTTGGCAGACCATGA	0.413																																						dbGAP											0													91.0	92.0	92.0					7																	115580952		2202	4299	6501	-	-	-	SO:0001583	missense	0			D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000265440.7:c.697C>A	7.37:g.115580952G>T	ENSP00000265440:p.Pro233Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Missense_Mutation	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.P233T	ENST00000265440.7	37	c.697	CCDS5762.1	7	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035946	0.75617	.	.	ENSG00000105967	ENST00000265440;ENST00000457268;ENST00000320239	T;T;T	0.62941	-0.01;-0.01;-0.01	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000006	T	0.78811	0.4342	M	0.69523	2.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78386	-0.2224	10	0.42905	T	0.14	-15.6924	18.7272	0.91718	0.0:0.0:1.0:0.0	.	204;233	O14948-2;O14948	.;TFEC_HUMAN	T	233;166;204	ENSP00000265440:P233T;ENSP00000387650:P166T;ENSP00000318676:P204T	ENSP00000265440:P233T	P	-	1	0	TFEC	115368188	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	7.324000	0.79115	2.487000	0.83934	0.650000	0.86243	CCA	TFEC	-	pfam_bHLH_ZIP_TF_MiT/TFE	ENSG00000105967		0.413	TFEC-001	KNOWN	basic|CCDS	protein_coding	TFEC	HGNC	protein_coding	OTTHUMT00000059839.4	69	0.00	0	G	NM_012252		115580952	115580952	-1	no_errors	ENST00000265440	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	1.000	T
TMEM107	84314	genome.wustl.edu	37	17	8077909	8077909	+	Silent	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:8077909G>C	ENST00000437139.2	-	4	369	c.282C>G	c.(280-282)tcC>tcG	p.S94S	TMEM107_ENST00000449985.2_Intron|SNORD118_ENST00000363593.1_RNA|TMEM107_ENST00000316425.5_Silent_p.S100S|RP11-599B13.7_ENST00000581248.1_lincRNA|TMEM107_ENST00000431792.2_Intron|TMEM107_ENST00000532998.1_3'UTR|TMEM107_ENST00000533070.1_Silent_p.S100S	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107	94					cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						ACAGGGCCACGGATGCACTAC	0.502																																						dbGAP											0													211.0	192.0	199.0					17																	8077909		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40		ENST00000437139.2:c.282C>G	17.37:g.8077909G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	Silent	SNP	NULL	p.S100	ENST00000437139.2	37	c.300	CCDS45607.1	17																																																																																			TMEM107	-	NULL	ENSG00000179029		0.502	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM107	HGNC	protein_coding	OTTHUMT00000388844.1	127	0.00	0	G	NM_032354		8077909	8077909	-1	no_errors	ENST00000316425	ensembl	human	known	69_37n	silent	48	50.00	48	SNP	0.137	C
TMEM87B	84910	genome.wustl.edu	37	2	112847241	112847241	+	Silent	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:112847241G>C	ENST00000283206.4	+	10	1347	c.978G>C	c.(976-978)ctG>ctC	p.L326L	TMEM87B_ENST00000463427.1_3'UTR	NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	326						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						TGATCGGACTGGGGCTTCTAT	0.443																																						dbGAP											0													141.0	132.0	135.0					2																	112847241		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.978G>C	2.37:g.112847241G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2M9|Q1RLN2|Q53R54	Silent	SNP	pfam_TM_rcpt_euk	p.L326	ENST00000283206.4	37	c.978	CCDS33275.1	2																																																																																			TMEM87B	-	pfam_TM_rcpt_euk	ENSG00000153214		0.443	TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM87B	HGNC	protein_coding	OTTHUMT00000330500.1	275	0.00	0	G	NM_032824		112847241	112847241	+1	no_errors	ENST00000283206	ensembl	human	known	69_37n	silent	229	18.79	53	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7577566	7577567	+	Frame_Shift_Ins	INS	-	-	A	rs193920789		TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:7577566_7577567insA	ENST00000269305.4	-	7	903_904	c.714_715insT	c.(712-717)tgtaacfs	p.N239fs	TP53_ENST00000359597.4_Frame_Shift_Ins_p.N239fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.N239fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Ins_p.N239fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.N239fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.N239fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239D(33)|p.N239fs*25(12)|p.0?(8)|p.N239Y(6)|p.N239fs*1(5)|p.?(5)|p.M237_N239delMCN(4)|p.C238*(4)|p.N239_C242delNSSC(3)|p.N239fs*8(2)|p.C238W(2)|p.N239_S240delNS(2)|p.N239fs*26(1)|p.N146D(1)|p.N146fs*1(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.C238fs*21(1)|p.C238C(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGAACTGTTACACATGTAGT	0.574		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	103	Substitution - Missense(42)|Insertion - Frameshift(18)|Deletion - In frame(15)|Whole gene deletion(8)|Deletion - Frameshift(7)|Substitution - Nonsense(5)|Unknown(5)|Complex - frameshift(1)|Substitution - coding silent(1)|Insertion - In frame(1)	ovary(14)|haematopoietic_and_lymphoid_tissue(11)|oesophagus(11)|central_nervous_system(9)|lung(8)|biliary_tract(7)|large_intestine(7)|upper_aerodigestive_tract(6)|breast(6)|endometrium(5)|urinary_tract(5)|bone(5)|stomach(4)|prostate(2)|liver(1)|skin(1)|pancreas(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.715dupT	17.37:g.7577567_7577567dupA	ENSP00000269305:p.Asn239fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N238fs	ENST00000269305.4	37	c.715_714	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.574	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	218	0.00	0	-	NM_000546		7577566	7577567	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_ins	98	34.67	52	INS	1.000:0.999	A
TP53BP2	7159	genome.wustl.edu	37	1	223989890	223989890	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:223989890G>C	ENST00000343537.7	-	9	1444	c.1153C>G	c.(1153-1155)Cag>Gag	p.Q385E	TP53BP2_ENST00000391878.2_Missense_Mutation_p.Q256E|TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391879.2_5'Flank	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	379					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TCTGAAGCCTGAATGACCAAG	0.517																																						dbGAP											0													88.0	90.0	90.0					1																	223989890		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.1153C>G	1.37:g.223989890G>C	ENSP00000341957:p.Gln385Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.Q385E	ENST00000343537.7	37	c.1153	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384963	0.82792	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.44083	0.93;1.09	5.71	5.71	0.89125	.	0.228496	0.48286	D	0.000200	T	0.53206	0.1782	L	0.41236	1.265	0.80722	D	1	D;P	0.54964	0.969;0.92	D;P	0.64877	0.93;0.474	T	0.31806	-0.9930	10	0.09590	T	0.72	.	19.8632	0.96793	0.0:0.0:1.0:0.0	.	385;379	B4DG66;Q13625	.;ASPP2_HUMAN	E	256;385	ENSP00000375750:Q256E;ENSP00000341957:Q385E	ENSP00000341957:Q385E	Q	-	1	0	TP53BP2	222056513	1.000000	0.71417	0.751000	0.31187	0.783000	0.44284	5.911000	0.69939	2.699000	0.92147	0.655000	0.94253	CAG	TP53BP2	-	NULL	ENSG00000143514		0.517	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	84	0.00	0	G	NM_001031685, NM_005426		223989890	223989890	-1	no_errors	ENST00000343537	ensembl	human	known	69_37n	missense	99	23.85	31	SNP	1.000	C
TRAP1	10131	genome.wustl.edu	37	16	3729754	3729754	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr16:3729754G>C	ENST00000246957.5	-	5	597	c.509C>G	c.(508-510)tCc>tGc	p.S170C	TRAP1_ENST00000573872.1_5'Flank|TRAP1_ENST00000538171.1_Missense_Mutation_p.S117C|TRAP1_ENST00000575671.1_5'Flank	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	170					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				CCCCAGGTTGGACACCAGCTC	0.627																																						dbGAP											0													76.0	62.0	67.0					16																	3729754		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.509C>G	16.37:g.3729754G>C	ENSP00000246957:p.Ser170Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Missense_Mutation	SNP	pfam_Hsp90,pfam_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pirsf_Hsp90,prints_Hsp90_N	p.S170C	ENST00000246957.5	37	c.509	CCDS10508.1	16	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057705	0.76074	.	.	ENSG00000126602	ENST00000246957;ENST00000538171	D;D	0.95171	-3.63;-3.63	5.26	5.26	0.73747	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.054385	0.85682	D	0.000000	D	0.97114	0.9057	M	0.86953	2.85	0.80722	D	1	D;D	0.62365	0.967;0.991	P;P	0.58520	0.753;0.84	D	0.97734	1.0204	10	0.87932	D	0	-39.4566	18.2067	0.89857	0.0:0.0:1.0:0.0	.	117;170	F5H897;Q12931	.;TRAP1_HUMAN	C	170;117	ENSP00000246957:S170C;ENSP00000442070:S117C	ENSP00000246957:S170C	S	-	2	0	TRAP1	3669755	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	5.870000	0.69620	2.610000	0.88304	0.655000	0.94253	TCC	TRAP1	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pirsf_Hsp90,prints_Hsp90_N	ENSG00000126602		0.627	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAP1	HGNC	protein_coding	OTTHUMT00000251586.2	42	0.00	0	G	NM_016292		3729754	3729754	-1	no_errors	ENST00000246957	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	1.000	C
AC005013.5	0	genome.wustl.edu	37	7	28996897	28996897	+	lincRNA	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr7:28996897C>G	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							GAGAGCAGGCCGAGACGTGGC	0.687																																						dbGAP											0													17.0	22.0	21.0					7																	28996897		2141	4238	6379	-	-	-			0																															7.37:g.28996897C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000436594.1	37	NULL		7																																																																																			TRIL	-	-	ENSG00000176734		0.687	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	TRIL	HGNC	lincRNA	OTTHUMT00000327953.3	21	0.00	0	C			28996897	28996897	-1	no_errors	ENST00000322982	ensembl	human	known	69_37n	rna	7	41.67	5	SNP	0.997	G
TRIM47	91107	genome.wustl.edu	37	17	73872166	73872166	+	Silent	SNP	T	T	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr17:73872166T>G	ENST00000254816.2	-	4	1043	c.1017A>C	c.(1015-1017)ctA>ctC	p.L339L	RP11-552F3.9_ENST00000586076.1_RNA|TRIM47_ENST00000587339.1_Silent_p.L101L	NM_033452.2	NP_258411.2	Q96LD4	TRI47_HUMAN	tripartite motif containing 47	339						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGGCCAGCCTTAGTGCCAGCA	0.617																																						dbGAP											0													48.0	49.0	49.0					17																	73872166		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY026763	CCDS32737.1	17q25	2013-01-09	2011-01-25			ENSG00000132481		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19020	protein-coding gene	gene with protein product		611041	"""tripartite motif-containing 47"""				Standard	NM_033452		Approved	GOA, RNF100	uc002jpw.3	Q96LD4		ENST00000254816.2:c.1017A>C	17.37:g.73872166T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AD0|Q96GU5|Q9BRN7	Silent	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.L339	ENST00000254816.2	37	c.1017	CCDS32737.1	17																																																																																			TRIM47	-	NULL	ENSG00000132481		0.617	TRIM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM47	HGNC	protein_coding	OTTHUMT00000448934.1	27	0.00	0	T			73872166	73872166	-1	no_errors	ENST00000254816	ensembl	human	known	69_37n	silent	16	27.27	6	SNP	0.004	G
TTLL7	79739	genome.wustl.edu	37	1	84356005	84356005	+	Splice_Site	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:84356005C>T	ENST00000260505.8	-	19	2745	c.2368G>A	c.(2368-2370)Gga>Aga	p.G790R	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	790					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		AGAGCTTACCCTGAATCACAG	0.318																																						dbGAP											0													50.0	53.0	52.0					1																	84356005		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.2369+1G>A	1.37:g.84356005C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.G790R	ENST00000260505.8	37	c.2368	CCDS690.2	1	.	.	.	.	.	.	.	.	.	.	C	33	5.193696	0.94960	.	.	ENSG00000137941	ENST00000260505;ENST00000370704	T	0.04156	3.69	5.12	5.12	0.69794	.	0.051767	0.85682	D	0.000000	T	0.11110	0.0271	M	0.68952	2.095	0.58432	D	0.999999	D	0.61080	0.989	P	0.56474	0.799	T	0.01349	-1.1378	10	0.87932	D	0	.	18.9434	0.92612	0.0:1.0:0.0:0.0	.	790	Q6ZT98	TTLL7_HUMAN	R	790;567	ENSP00000260505:G790R	ENSP00000260505:G790R	G	-	1	0	TTLL7	84128593	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.137000	0.77295	2.538000	0.85594	0.650000	0.86243	GGA	TTLL7	-	NULL	ENSG00000137941		0.318	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL7	HGNC	protein_coding	OTTHUMT00000027498.1	116	0.00	0	C	NM_024686	Missense_Mutation	84356005	84356005	-1	no_errors	ENST00000260505	ensembl	human	known	69_37n	missense	63	22.22	18	SNP	1.000	T
TTF2	8458	genome.wustl.edu	37	1	117618186	117618186	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:117618186G>C	ENST00000369466.4	+	5	1024	c.980G>C	c.(979-981)gGa>gCa	p.G327A		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	327					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		GCTCCTGGAGGACCAGCGGCT	0.612																																						dbGAP											0													44.0	42.0	43.0					1																	117618186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.980G>C	1.37:g.117618186G>C	ENSP00000358478:p.Gly327Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G327A	ENST00000369466.4	37	c.980	CCDS892.1	1	.	.	.	.	.	.	.	.	.	.	G	1.380	-0.583600	0.03827	.	.	ENSG00000116830	ENST00000369466	D	0.86497	-2.13	5.31	-0.0467	0.13846	.	0.413030	0.17976	N	0.155718	T	0.44746	0.1308	N	0.19112	0.55	0.09310	N	1	B;P	0.35628	0.022;0.513	B;B	0.29524	0.011;0.103	T	0.59069	-0.7523	10	0.02654	T	1	-5.3165	5.3465	0.16012	0.2951:0.2752:0.4296:0.0	.	327;327	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	A	327	ENSP00000358478:G327A	ENSP00000358478:G327A	G	+	2	0	TTF2	117419709	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.492000	0.06467	0.041000	0.15688	-0.305000	0.09177	GGA	TTF2	-	NULL	ENSG00000116830		0.612	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	125	0.00	0	G			117618186	117618186	+1	no_errors	ENST00000369466	ensembl	human	known	69_37n	missense	79	28.83	32	SNP	0.010	C
TTN	7273	genome.wustl.edu	37	2	179501201	179501201	+	Silent	SNP	G	G	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr2:179501201G>A	ENST00000591111.1	-	175	36554	c.36330C>T	c.(36328-36330)tcC>tcT	p.S12110S	TTN_ENST00000589042.1_Silent_p.S13751S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Silent_p.S11183S|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000342175.6_Silent_p.S4878S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Silent_p.S4811S|TTN_ENST00000460472.2_Silent_p.S4686S			Q8WZ42	TITIN_HUMAN	titin	12110	Ig-like 80.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCAGCATCGGAAAGTTGAA	0.418																																						dbGAP											0													86.0	82.0	83.0					2																	179501201		1844	4105	5949	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36330C>T	2.37:g.179501201G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.S11183	ENST00000591111.1	37	c.33549		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	73	0.00	0	G	NM_133378		179501201	179501201	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	49	16.95	10	SNP	0.174	A
TUBE1	51175	genome.wustl.edu	37	6	112397239	112397239	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:112397239C>A	ENST00000368662.5	-	8	791	c.713G>T	c.(712-714)aGt>aTt	p.S238I	TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	238					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	AGTAACCAGACTCTTTGGCTT	0.403																																						dbGAP											0													163.0	175.0	171.0					6																	112397239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.713G>T	6.37:g.112397239C>A	ENSP00000357651:p.Ser238Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H8W8|Q8NEG3	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Epsilon_tubulin,prints_Tubulin	p.S238I	ENST00000368662.5	37	c.713	CCDS5100.1	6	.	.	.	.	.	.	.	.	.	.	C	22.5	4.291907	0.80914	.	.	ENSG00000074935	ENST00000368658;ENST00000368662;ENST00000441191	T	0.79141	-1.24	5.92	5.92	0.95590	Tubulin/FtsZ, GTPase domain (3);	0.074333	0.85682	D	0.000000	D	0.85465	0.5703	M	0.79123	2.44	0.80722	D	1	D	0.61697	0.99	P	0.58331	0.837	D	0.86237	0.1641	10	0.87932	D	0	.	20.327	0.98704	0.0:1.0:0.0:0.0	.	238	Q9UJT0	TBE_HUMAN	I	194;238;194	ENSP00000357651:S238I	ENSP00000357647:S194I	S	-	2	0	TUBE1	112503932	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.690000	0.61731	2.794000	0.96219	0.650000	0.86243	AGT	TUBE1	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase	ENSG00000074935		0.403	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBE1	HGNC	protein_coding	OTTHUMT00000041867.1	182	0.00	0	C	NM_016262		112397239	112397239	-1	no_errors	ENST00000368662	ensembl	human	known	69_37n	missense	121	27.54	46	SNP	1.000	A
WDR36	134430	genome.wustl.edu	37	5	110445999	110445999	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr5:110445999C>G	ENST00000513710.2	+	13	1610	c.1606C>G	c.(1606-1608)Caa>Gaa	p.Q536E	WDR36_ENST00000506538.2_Missense_Mutation_p.Q536E|WDR36_ENST00000505303.1_Missense_Mutation_p.Q480E			Q8NI36	WDR36_HUMAN	WD repeat domain 36	536					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TGGCAAGGATCAAGGTAGAGA	0.358																																						dbGAP											0													161.0	155.0	158.0					5																	110445999		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1606C>G	5.37:g.110445999C>G	ENSP00000424628:p.Gln536Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q536E	ENST00000513710.2	37	c.1606	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	C	9.557	1.117522	0.20877	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.80653	-1.4;-1.4;0.4	5.42	3.28	0.37604	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.360511	0.34046	N	0.004320	T	0.68632	0.3022	N	0.24115	0.695	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.67872	-0.5558	10	0.87932	D	0	-3.9289	11.9786	0.53107	0.6013:0.3987:0.0:0.0	.	536	Q8NI36	WDR36_HUMAN	E	536;536;480	ENSP00000423067:Q536E;ENSP00000424628:Q536E;ENSP00000422158:Q480E	ENSP00000422158:Q480E	Q	+	1	0	WDR36	110473898	1.000000	0.71417	0.999000	0.59377	0.565000	0.35776	3.240000	0.51368	1.353000	0.45828	0.650000	0.86243	CAA	WDR36	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000134987		0.358	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	293	0.00	0	C	NM_139281		110445999	110445999	+1	no_errors	ENST00000506538	ensembl	human	known	69_37n	missense	103	33.55	52	SNP	1.000	G
WDR64	128025	genome.wustl.edu	37	1	241912926	241912926	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:241912926G>T	ENST00000366552.2	+	13	1849	c.1642G>T	c.(1642-1644)Gag>Tag	p.E548*	WDR64_ENST00000437684.2_Nonsense_Mutation_p.E548*	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	548										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GAAGGAGGACGAGCACTGCCT	0.527																																						dbGAP											0													156.0	151.0	153.0					1																	241912926		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1642G>T	1.37:g.241912926G>T	ENSP00000355510:p.Glu548*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANT0|Q7Z573|Q96LY9	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E548*	ENST00000366552.2	37	c.1642		1	.	.	.	.	.	.	.	.	.	.	G	39	7.544549	0.98348	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	.	.	.	6.06	6.06	0.98353	.	0.081748	0.51477	D	0.000087	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-13.9398	17.5376	0.87837	0.0:0.0:1.0:0.0	.	.	.	.	X	548;548;319	.	ENSP00000355510:E548X	E	+	1	0	WDR64	239979549	1.000000	0.71417	0.392000	0.26245	0.006000	0.05464	5.617000	0.67716	2.882000	0.98803	0.655000	0.94253	GAG	WDR64	-	superfamily_WD40_repeat_dom	ENSG00000162843		0.527	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		543	0.00	0	G	NM_144625		241912926	241912926	+1	no_errors	ENST00000366552	ensembl	human	known	69_37n	nonsense	343	48.19	320	SNP	0.851	T
WDR64	128025	genome.wustl.edu	37	1	241953984	241953984	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:241953984C>G	ENST00000366552.2	+	24	3160	c.2953C>G	c.(2953-2955)Ctt>Gtt	p.L985V	WDR64_ENST00000437684.2_Missense_Mutation_p.L818V	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	985										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TTTCAAGTCTCTTTCTTCTCC	0.343																																						dbGAP											0													115.0	120.0	118.0					1																	241953984		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2953C>G	1.37:g.241953984C>G	ENSP00000355510:p.Leu985Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L985V	ENST00000366552.2	37	c.2953		1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.267073	0.59540	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.72051	-0.38;-0.62;-0.57	5.18	5.18	0.71444	.	0.000000	0.53938	D	0.000053	T	0.81317	0.4797	M	0.71581	2.175	0.23192	N	0.998146	D;D	0.89917	1.0;0.993	D;D	0.83275	0.996;0.987	T	0.73445	-0.3980	10	0.72032	D	0.01	-19.4221	10.1518	0.42799	0.0:0.9087:0.0:0.0913	.	985;538	B1ANS9;D1MPS4	WDR64_HUMAN;.	V	985;818;589	ENSP00000355510:L985V;ENSP00000402446:L818V;ENSP00000406656:L589V	ENSP00000355510:L985V	L	+	1	0	WDR64	240020607	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.770000	0.47662	2.576000	0.86940	0.655000	0.94253	CTT	WDR64	-	NULL	ENSG00000162843		0.343	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		421	0.00	0	C	NM_144625		241953984	241953984	+1	no_errors	ENST00000366552	ensembl	human	known	69_37n	missense	460	12.48	66	SNP	1.000	G
XPO5	57510	genome.wustl.edu	37	6	43491629	43491629	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr6:43491629G>T	ENST00000265351.7	-	32	3802	c.3592C>A	c.(3592-3594)Ctg>Atg	p.L1198M	POLR1C_ENST00000304004.3_Intron	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	1198					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			ATGGTGGCCAGGCCACCCCCA	0.483																																						dbGAP											0													110.0	113.0	112.0					6																	43491629		1940	4130	6070	-	-	-	SO:0001583	missense	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.3592C>A	6.37:g.43491629G>T	ENSP00000265351:p.Leu1198Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.L1198M	ENST00000265351.7	37	c.3592	CCDS47430.1	6	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052607	0.55218	.	.	ENSG00000124571	ENST00000265351;ENST00000439465	T	0.48836	0.8	6.05	2.91	0.33838	.	0.000000	0.64402	D	0.000001	T	0.48040	0.1478	M	0.72118	2.19	0.41915	D	0.990482	D	0.60160	0.987	P	0.55871	0.786	T	0.55166	-0.8183	10	0.72032	D	0.01	-11.0339	11.1626	0.48524	0.2829:0.0:0.7171:0.0	.	1198	Q9HAV4	XPO5_HUMAN	M	1198;826	ENSP00000265351:L1198M	ENSP00000265351:L1198M	L	-	1	2	XPO5	43599607	1.000000	0.71417	0.997000	0.53966	0.619000	0.37552	2.524000	0.45589	0.894000	0.36317	0.650000	0.86243	CTG	XPO5	-	NULL	ENSG00000124571		0.483	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	135	0.00	0	G	NM_020750		43491629	43491629	-1	no_errors	ENST00000265351	ensembl	human	known	69_37n	missense	144	30.29	63	SNP	0.896	T
ZC3H12C	85463	genome.wustl.edu	37	11	110035764	110035764	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr11:110035764C>T	ENST00000278590.3	+	6	2005	c.1954C>T	c.(1954-1956)Ccc>Tcc	p.P652S	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.P653S|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.P621S	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	652							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TGTCAGCTCCCCCGACCCACA	0.527																																						dbGAP											0													106.0	112.0	110.0					11																	110035764		2035	4196	6231	-	-	-	SO:0001583	missense	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1954C>T	11.37:g.110035764C>T	ENSP00000278590:p.Pro652Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.P652S	ENST00000278590.3	37	c.1954	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981178	0.53827	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.30182	1.54;1.54;1.55	5.84	5.84	0.93424	.	0.212673	0.46145	D	0.000302	T	0.49490	0.1560	L	0.41710	1.295	0.37492	D	0.916401	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.39800	-0.9596	10	0.36615	T	0.2	-15.5593	20.1386	0.98045	0.0:1.0:0.0:0.0	.	653;652;652	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	S	652;653;621	ENSP00000278590:P652S;ENSP00000431821:P653S;ENSP00000413094:P621S	ENSP00000278590:P652S	P	+	1	0	ZC3H12C	109540974	0.965000	0.33210	0.975000	0.42487	0.994000	0.84299	2.872000	0.48467	2.767000	0.95098	0.561000	0.74099	CCC	ZC3H12C	-	NULL	ENSG00000149289		0.527	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	64	0.00	0	C	NM_033390		110035764	110035764	+1	no_errors	ENST00000278590	ensembl	human	known	69_37n	missense	63	22.22	18	SNP	0.914	T
ZFPM2	23414	genome.wustl.edu	37	8	106814808	106814808	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr8:106814808G>C	ENST00000407775.2	+	8	2748	c.2498G>C	c.(2497-2499)aGc>aCc	p.S833T	ZFPM2_ENST00000517361.1_Missense_Mutation_p.S701T|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S564T|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S701T|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000524045.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	833	Interaction with CTBP2. {ECO:0000305}.				blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S833I(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ATAGATCTCAGCAAAAAGTGT	0.458																																						dbGAP											1	Substitution - Missense(1)	lung(1)											48.0	43.0	45.0					8																	106814808		1950	4167	6117	-	-	-	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2498G>C	8.37:g.106814808G>C	ENSP00000384179:p.Ser833Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S833T	ENST00000407775.2	37	c.2498	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497593	0.64186	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.34072	1.38;1.5;1.5;2.7	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.61009	0.2313	M	0.68593	2.085	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.57700	-0.7766	10	0.49607	T	0.09	.	20.1802	0.98196	0.0:0.0:1.0:0.0	.	833	Q8WW38	FOG2_HUMAN	T	833;701;701;564	ENSP00000384179:S833T;ENSP00000430757:S701T;ENSP00000428720:S701T;ENSP00000367733:S564T	ENSP00000367733:S564T	S	+	2	0	ZFPM2	106883984	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.777000	0.95525	0.655000	0.94253	AGC	ZFPM2	-	NULL	ENSG00000169946		0.458	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	52	0.00	0	G			106814808	106814808	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	missense	109	20.29	28	SNP	1.000	C
ZNF30	90075	genome.wustl.edu	37	19	35435393	35435393	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:35435393G>C	ENST00000601142.1	+	5	1760	c.1523G>C	c.(1522-1524)gGt>gCt	p.G508A	ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000426813.2_Missense_Mutation_p.G427A|ZNF30_ENST00000439785.1_Missense_Mutation_p.G509A|ZNF30_ENST00000303586.7_Missense_Mutation_p.G509A			P17039	ZNF30_HUMAN	zinc finger protein 30	508					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		ATCCATACTGGTAAGAAGCCC	0.428																																						dbGAP											0													77.0	85.0	82.0					19																	35435393		2187	4292	6479	-	-	-	SO:0001583	missense	0			X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1523G>C	19.37:g.35435393G>C	ENSP00000469954:p.Gly508Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G509A	ENST00000601142.1	37	c.1526	CCDS46045.1	19	.	.	.	.	.	.	.	.	.	.	g	16.03	3.005987	0.54361	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813;ENST00000342559	T;T	0.26373	1.74;1.74	2.42	0.135	0.14775	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37461	0.1004	M	0.77486	2.375	0.24833	N	0.992515	D;D	0.61080	0.986;0.989	P;P	0.53102	0.673;0.718	T	0.21415	-1.0246	9	0.72032	D	0.01	.	6.0424	0.19742	0.2909:0.0:0.7091:0.0	.	509;508	P17039-2;P17039	.;ZNF30_HUMAN	A	509;508;427;217	ENSP00000403441:G509A;ENSP00000416457:G427A	ENSP00000303889:G508A	G	+	2	0	ZNF30	40127233	0.936000	0.31750	0.001000	0.08648	0.134000	0.20937	2.325000	0.43840	-0.026000	0.13895	0.508000	0.49915	GGT	ZNF30	-	pfscan_Znf_C2H2	ENSG00000168661		0.428	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	ZNF30	HGNC	protein_coding	OTTHUMT00000464432.1	194	0.00	0	G	NM_194325		35435393	35435393	+1	no_errors	ENST00000439785	ensembl	human	known	69_37n	missense	201	11.45	26	SNP	0.997	C
ZNF565	147929	genome.wustl.edu	37	19	36673699	36673699	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:36673699G>T	ENST00000355114.5	-	5	2015	c.1289C>A	c.(1288-1290)cCc>cAc	p.P430H	ZNF565_ENST00000304116.5_Missense_Mutation_p.P390H|ZNF565_ENST00000392173.2_Missense_Mutation_p.P390H			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	430					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			ACATTCATAGGGTCTGTCGCC	0.473																																						dbGAP											0													132.0	109.0	117.0					19																	36673699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.1289C>A	19.37:g.36673699G>T	ENSP00000347234:p.Pro430His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ35|Q6NUS2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P390H	ENST00000355114.5	37	c.1169		19	.	.	.	.	.	.	.	.	.	.	g	15.46	2.841425	0.51057	.	.	ENSG00000196357	ENST00000392173;ENST00000304116;ENST00000355114	T;T;T	0.17528	2.27;2.27;2.27	4.7	4.7	0.59300	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39687	N	0.001300	T	0.45458	0.1343	M	0.92459	3.31	0.41890	D	0.990367	D	0.63880	0.993	P	0.56216	0.794	T	0.60214	-0.7307	10	0.72032	D	0.01	.	15.559	0.76223	0.0:0.0:1.0:0.0	.	390	Q8N9K5	ZN565_HUMAN	H	390;390;430	ENSP00000376013:P390H;ENSP00000306869:P390H;ENSP00000347234:P430H	ENSP00000306869:P390H	P	-	2	0	ZNF565	41365539	1.000000	0.71417	0.988000	0.46212	0.035000	0.12851	7.381000	0.79718	2.602000	0.87976	0.650000	0.86243	CCC	ZNF565	-	pfscan_Znf_C2H2	ENSG00000196357		0.473	ZNF565-003	PUTATIVE	basic	protein_coding	ZNF565	HGNC	protein_coding	OTTHUMT00000451697.1	98	0.00	0	G	NM_152477		36673699	36673699	-1	no_errors	ENST00000304116	ensembl	human	known	69_37n	missense	91	24.79	30	SNP	1.000	T
ZNF570	148268	genome.wustl.edu	37	19	37975362	37975362	+	Silent	SNP	A	A	C			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr19:37975362A>C	ENST00000330173.1	+	5	1367	c.838A>C	c.(838-840)Agg>Cgg	p.R280R	ZNF570_ENST00000388801.3_Silent_p.R77R|ZNF570_ENST00000586475.1_Silent_p.R336R	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAAGGAATGTAGGAAAGCCTT	0.403																																						dbGAP											0													66.0	65.0	66.0					19																	37975362		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.838A>C	19.37:g.37975362A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L472|B4DMP1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R280	ENST00000330173.1	37	c.838	CCDS12504.1	19																																																																																			ZNF570	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171827		0.403	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	60	0.00	0	A	NM_144694		37975362	37975362	+1	no_errors	ENST00000330173	ensembl	human	known	69_37n	silent	58	19.44	14	SNP	1.000	C
ZRANB2	9406	genome.wustl.edu	37	1	71532605	71532605	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08R-01A-11W-A050-09	TCGA-A8-A08R-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05362091-8e04-46e2-81e7-1efddc0d8c63	f1681b14-25e1-4bc6-a97d-18928662d45b	g.chr1:71532605C>A	ENST00000370920.3	-	9	1084	c.783G>T	c.(781-783)agG>agT	p.R261S	ZRANB2-AS1_ENST00000426999.1_RNA|MIR186_ENST00000384988.1_RNA|ZRANB2_ENST00000254821.6_Missense_Mutation_p.R261S|ZRANB2_ENST00000477096.1_5'UTR|ZRANB2-AS1_ENST00000450461.1_RNA	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	261	Arg/Ser-rich.|Required for nuclear targeting.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						CCCTGTGGGACCTGGAGCTGG	0.363																																						dbGAP											0													69.0	70.0	70.0					1																	71532605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.783G>T	1.37:g.71532605C>A	ENSP00000359958:p.Arg261Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Missense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2	p.R261S	ENST00000370920.3	37	c.783	CCDS659.1	1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054366	0.36277	.	.	ENSG00000132485	ENST00000370920;ENST00000254821	T;T	0.67523	-0.27;-0.26	5.68	2.66	0.31614	.	0.337957	0.32970	N	0.005424	T	0.20740	0.0499	N	0.11560	0.145	0.51767	D	0.999934	B;B	0.31817	0.231;0.341	B;B	0.27500	0.037;0.08	T	0.06285	-1.0835	10	0.15499	T	0.54	.	8.4429	0.32826	0.0:0.6856:0.0:0.3144	.	261;261	O95218;O95218-2	ZRAB2_HUMAN;.	S	261	ENSP00000359958:R261S;ENSP00000254821:R261S	ENSP00000254821:R261S	R	-	3	2	ZRANB2	71305193	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.865000	0.39479	0.270000	0.21984	0.650000	0.86243	AGG	ZRANB2	-	pirsf_UCP037956_Znf_RanB2	ENSG00000132485		0.363	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	218	0.00	0	C	NM_203350		71532605	71532605	-1	no_errors	ENST00000370920	ensembl	human	known	69_37n	missense	130	22.16	37	SNP	1.000	A
