#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACVR1B	91	genome.wustl.edu	37	12	52387803	52387803	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr12:52387803G>A	ENST00000257963.4	+	9	1504	c.1427G>A	c.(1426-1428)tGt>tAt	p.C476Y	ACVR1B_ENST00000541224.1_Missense_Mutation_p.C517Y|ACVR1B_ENST00000542485.1_Missense_Mutation_p.C424Y	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	476	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	ATGCGAGAGTGTTGGTATGCC	0.607																																						dbGAP											0													145.0	126.0	132.0					12																	52387803		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1427G>A	12.37:g.52387803G>A	ENSP00000257963:p.Cys476Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C476Y	ENST00000257963.4	37	c.1427	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127398	0.77549	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000542485	D;D;D	0.95307	-3.67;-3.67;-3.67	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98686	0.9559	H	0.99117	4.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.99679	1.0998	10	0.87932	D	0	.	18.9733	0.92724	0.0:0.0:1.0:0.0	.	517;476	P36896-4;P36896	.;ACV1B_HUMAN	Y	476;517;424	ENSP00000257963:C476Y;ENSP00000442656:C517Y;ENSP00000442885:C424Y	ENSP00000257963:C476Y	C	+	2	0	ACVR1B	50674070	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.869000	0.99810	2.487000	0.83934	0.467000	0.42956	TGT	ACVR1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135503		0.607	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	106	0.00	0	G	NM_020328		52387803	52387803	+1	no_errors	ENST00000257963	ensembl	human	known	69_37n	missense	35	55.70	44	SNP	1.000	A
AHNAK2	113146	genome.wustl.edu	37	14	105420635	105420635	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr14:105420635G>A	ENST00000333244.5	-	7	1272	c.1153C>T	c.(1153-1155)Cga>Tga	p.R385*	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	385						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATCACTTCTCGATCCTGTTCT	0.632																																						dbGAP											0													89.0	95.0	93.0					14																	105420635		2071	4214	6285	-	-	-	SO:0001587	stop_gained	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1153C>T	14.37:g.105420635G>A	ENSP00000353114:p.Arg385*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Nonsense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R385*	ENST00000333244.5	37	c.1153	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	26.6	4.753718	0.89753	.	.	ENSG00000185567	ENST00000333244	.	.	.	3.67	-1.34	0.09143	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	8.3326	0.32195	0.0:0.4426:0.3168:0.2406	.	.	.	.	X	385	.	ENSP00000353114:R385X	R	-	1	2	AHNAK2	104491680	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.064000	0.11636	-0.120000	0.11809	0.650000	0.86243	CGA	AHNAK2	-	NULL	ENSG00000185567		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	26	0.00	0	G	NM_138420		105420635	105420635	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	nonsense	27	28.95	11	SNP	0.000	A
ANK1	286	genome.wustl.edu	37	8	41552742	41552742	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr8:41552742C>T	ENST00000347528.4	-	27	3151	c.3068G>A	c.(3067-3069)cGc>cAc	p.R1023H	ANK1_ENST00000396945.1_Missense_Mutation_p.R1023H|ANK1_ENST00000379758.2_Missense_Mutation_p.R1023H|ANK1_ENST00000289734.7_Missense_Mutation_p.R1023H|ANK1_ENST00000265709.8_Missense_Mutation_p.R1064H|ANK1_ENST00000352337.4_Missense_Mutation_p.R1023H|ANK1_ENST00000396942.1_Missense_Mutation_p.R1023H	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1023	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTCTCCATAGCGGCTCCTGTG	0.627																																						dbGAP											0													122.0	120.0	120.0					8																	41552742		2203	4300	6503	-	-	-	SO:0001583	missense	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3068G>A	8.37:g.41552742C>T	ENSP00000339620:p.Arg1023His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.R1023H	ENST00000347528.4	37	c.3068	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830920	0.91036	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.66460	-0.2;-0.21;-0.18;-0.16;-0.18;-0.17;-0.2	5.09	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.72252	0.3437	L	0.40543	1.245	0.58432	D	0.999992	D;D;P;D;D;D	0.76494	0.988;0.999;0.947;0.994;0.978;0.994	P;P;B;P;P;P	0.62813	0.856;0.907;0.376;0.461;0.856;0.812	T	0.73461	-0.3975	10	0.52906	T	0.07	.	13.7341	0.62807	0.0:0.9247:0.0:0.0753	.	1064;1023;1023;1023;1023;339	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	H	1023;1023;1023;1023;1023;1023;1064;1023	ENSP00000339620:R1023H;ENSP00000289734:R1023H;ENSP00000369082:R1023H;ENSP00000380149:R1023H;ENSP00000380147:R1023H;ENSP00000309131:R1023H;ENSP00000265709:R1064H	ENSP00000265709:R1064H	R	-	2	0	ANK1	41671899	1.000000	0.71417	0.907000	0.35723	0.984000	0.73092	3.345000	0.52182	1.117000	0.41842	0.563000	0.77884	CGC	ANK1	-	NULL	ENSG00000029534		0.627	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	53	0.00	0	C	NM_020475		41552742	41552742	-1	no_errors	ENST00000396942	ensembl	human	known	69_37n	missense	25	39.02	16	SNP	1.000	T
ANKRD26	22852	genome.wustl.edu	37	10	27326874	27326874	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr10:27326874C>T	ENST00000376087.4	-	22	2650	c.2485G>A	c.(2485-2487)Gtg>Atg	p.V829M	ANKRD26_ENST00000376070.3_Missense_Mutation_p.V386M|ANKRD26_ENST00000436985.2_Missense_Mutation_p.V845M	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	828					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TGTTGTTTCACTTCAACTTCT	0.313																																						dbGAP											0													158.0	142.0	147.0					10																	27326874		1841	4081	5922	-	-	-	SO:0001583	missense	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.2485G>A	10.37:g.27326874C>T	ENSP00000365255:p.Val829Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V845M	ENST00000376087.4	37	c.2533	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	C	5.077	0.199797	0.09652	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.18960	2.18;2.18;2.18	5.11	-5.65	0.02459	.	0.934497	0.08914	N	0.875449	T	0.07234	0.0183	N	0.03281	-0.365	0.09310	N	1	B;B;B	0.25312	0.123;0.075;0.031	B;B;B	0.22152	0.038;0.017;0.009	T	0.36504	-0.9745	10	0.32370	T	0.25	.	7.0992	0.25327	0.0:0.4248:0.2131:0.3622	.	829;828;845	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	M	386;829;845	ENSP00000365238:V386M;ENSP00000365255:V829M;ENSP00000405112:V845M	ENSP00000365238:V386M	V	-	1	0	ANKRD26	27366880	0.123000	0.22298	0.000000	0.03702	0.073000	0.16967	0.460000	0.21924	-1.179000	0.02737	-0.237000	0.12165	GTG	ANKRD26	-	NULL	ENSG00000107890		0.313	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	133	0.00	0	C			27326874	27326874	-1	no_errors	ENST00000436985	ensembl	human	known	69_37n	missense	103	24.82	34	SNP	0.000	T
APOL1	8542	genome.wustl.edu	37	22	36661744	36661744	+	Nonsense_Mutation	SNP	C	C	T	rs186196175	byFrequency	TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr22:36661744C>T	ENST00000397278.3	+	6	1091	c.862C>T	c.(862-864)Cga>Tga	p.R288*	APOL1_ENST00000426053.1_Nonsense_Mutation_p.R270*|APOL1_ENST00000319136.4_Nonsense_Mutation_p.R304*|APOL1_ENST00000347595.7_Nonsense_Mutation_p.R167*|APOL1_ENST00000422706.1_Nonsense_Mutation_p.R288*|APOL1_ENST00000397279.4_Nonsense_Mutation_p.R288*	NM_003661.3	NP_003652.2	O14791	APOL1_HUMAN	apolipoprotein L, 1	288					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cholesterol metabolic process (GO:0008203)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|intrinsic component of membrane (GO:0031224)|very-low-density lipoprotein particle (GO:0034361)	chloride channel activity (GO:0005254)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	14						TGCCCTCAGACGAGCCAGAGC	0.542																																						dbGAP											0													110.0	99.0	103.0					22																	36661744		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF019225	CCDS13925.1, CCDS13926.1, CCDS46702.1	22q13.1	2014-09-17			ENSG00000100342	ENSG00000100342		"""Apolipoproteins"""	618	protein-coding gene	gene with protein product		603743		APOL		9325276, 11374903, 16020735	Standard	NM_003661		Approved		uc011amp.2	O14791	OTTHUMG00000030427	ENST00000397278.3:c.862C>T	22.37:g.36661744C>T	ENSP00000380448:p.Arg288*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLQ4|B4DU12|E9PF24|O60804|Q5R3P7|Q5R3P8|Q96AB8|Q96PM4|Q9BQ03	Nonsense_Mutation	SNP	pfam_ApoL	p.R304*	ENST00000397278.3	37	c.910	CCDS13926.1	22	.	.	.	.	.	.	.	.	.	.	c	16.15	3.041621	0.55003	.	.	ENSG00000100342	ENST00000397278;ENST00000422706;ENST00000426053;ENST00000319136;ENST00000347595;ENST00000397279	.	.	.	2.56	-5.13	0.02884	.	2.359860	0.02098	N	0.053689	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	1.0112	0.01498	0.213:0.2432:0.3334:0.2104	.	.	.	.	X	288;288;270;304;167;288	.	ENSP00000317674:R304X	R	+	1	2	APOL1	34991690	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.391000	0.00037	-2.746000	0.00377	-1.026000	0.02426	CGA	APOL1	-	pfam_ApoL	ENSG00000100342		0.542	APOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL1	HGNC	protein_coding	OTTHUMT00000319100.4	135	0.00	0	C	NM_145343		36661744	36661744	+1	no_errors	ENST00000319136	ensembl	human	known	69_37n	nonsense	90	35.71	50	SNP	0.000	T
BRWD3	254065	genome.wustl.edu	37	X	79932420	79932420	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chrX:79932420T>A	ENST00000373275.4	-	41	5313	c.5097A>T	c.(5095-5097)agA>agT	p.R1699S	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1699	Gly-rich.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						cacctccacctcttcctcgac	0.577																																						dbGAP											0													144.0	112.0	123.0					X																	79932420		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.5097A>T	X.37:g.79932420T>A	ENSP00000362372:p.Arg1699Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.R1699S	ENST00000373275.4	37	c.5097	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	t	10.07	1.248870	0.22880	.	.	ENSG00000165288	ENST00000373275	T	0.81330	-1.48	4.37	4.37	0.52481	.	0.240443	0.33834	N	0.004502	T	0.74635	0.3742	N	0.08118	0	0.33702	D	0.614712	D	0.54601	0.967	P	0.60789	0.879	T	0.78401	-0.2218	9	.	.	.	-2.6992	11.171	0.48571	0.0:0.0:0.0:1.0	.	1699	Q6RI45	BRWD3_HUMAN	S	1699	ENSP00000362372:R1699S	.	R	-	3	2	BRWD3	79819076	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.709000	0.54853	1.630000	0.50440	0.417000	0.27973	AGA	BRWD3	-	NULL	ENSG00000165288		0.577	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	297	0.00	0	T	NM_153252		79932420	79932420	-1	no_errors	ENST00000373275	ensembl	human	known	69_37n	missense	389	22.38	113	SNP	1.000	A
C11orf88	399949	genome.wustl.edu	37	11	111385565	111385566	+	Frame_Shift_Ins	INS	-	-	C	rs570525399	byFrequency	TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr11:111385565_111385566insC	ENST00000375618.4	+	1	56_57	c.56_57insC	c.(55-60)tgccccfs	p.CP19fs	BTG4_ENST00000356018.2_5'Flank|RP11-794P6.6_ENST00000530283.1_RNA|BTG4_ENST00000525791.1_5'Flank|MIR34C_ENST00000384831.1_RNA|C11orf88_ENST00000529167.1_Frame_Shift_Ins_p.CP19fs|C11orf88_ENST00000332814.6_Frame_Shift_Ins_p.CP19fs|MIR34B_ENST00000385076.1_RNA	NM_001100388.1	NP_001093858.1	Q6PI97	CK088_HUMAN	chromosome 11 open reading frame 88	19										endometrium(1)|large_intestine(3)|lung(2)	6						CAGGAAATGTGCCCCCCGGGAT	0.584											OREG0021329	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	CCCCCC|CCCCCC|CCCCCCC|insertion	3	0.000599042	0.0023	0.0	5008	,	,		12204	0.0		0.0	False		,,,				2504	0.0					dbGAP											0									,	2,3658		0,2,1828					,	-2.8	0.0			59	1,7885		0,1,3942	no	frameshift,frameshift	C11orf88	NM_207430.2,NM_001100388.1	,	0,3,5770	A1A1,A1R,RR		0.0127,0.0546,0.026	,	,		3,11543				-	-	-	SO:0001589	frameshift_variant	0			BC039505, AK128145	CCDS41712.1, CCDS41713.1	11q23.1	2012-08-10			ENSG00000183644	ENSG00000183644			25061	protein-coding gene	gene with protein product	"""hypothetical gene supported by BC039505"""					12477932	Standard	NM_001100388		Approved	FLJ46266	uc009yyd.3	Q6PI97	OTTHUMG00000166720	ENST00000375618.4:c.62dupC	11.37:g.111385571_111385571dupC	ENSP00000364768:p.Cys19fs	Somatic	1434	WXS	Illumina GAIIx	Phase_IV	E9PAN0|Q6ZRL3	Frame_Shift_Ins	INS	NULL	p.G23fs	ENST00000375618.4	37	c.56_57	CCDS41713.1	11																																																																																			C11orf88	-	NULL	ENSG00000183644		0.584	C11orf88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf88	HGNC	protein_coding	OTTHUMT00000391181.1	38	0.00	0	-	NM_001100388		111385565	111385566	+1	no_errors	ENST00000529167	ensembl	human	known	69_37n	frame_shift_ins	12	20.00	3	INS	0.000:0.000	C
ARIH2OS	646450	genome.wustl.edu	37	3	48956169	48956169	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr3:48956169C>G	ENST00000408959.2	-	1	649	c.414G>C	c.(412-414)ttG>ttC	p.L138F	ARIH2_ENST00000356401.4_5'Flank|ARIH2_ENST00000449376.1_5'Flank	NM_001123040.1	NP_001116512.1	Q8N7S6	ARI2O_HUMAN	ariadne homolog 2 opposite strand	138						integral component of membrane (GO:0016021)											CGCTAAGTTTCAAGGAGGCGG	0.647																																						dbGAP											0													21.0	24.0	23.0					3																	48956169		1567	3578	5145	-	-	-	SO:0001583	missense	0			DA461567	CCDS43088.1	3p21.31	2012-10-08	2012-10-08	2012-10-08	ENSG00000221883	ENSG00000221883			34425	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 71"""	C3orf71			Standard	NM_001123040		Approved		uc010hkk.1	Q8N7S6	OTTHUMG00000156672	ENST00000408959.2:c.414G>C	3.37:g.48956169C>G	ENSP00000386193:p.Leu138Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L138F	ENST00000408959.2	37	c.414	CCDS43088.1	3	.	.	.	.	.	.	.	.	.	.	C	9.522	1.108425	0.20714	.	.	ENSG00000221883	ENST00000408959	.	.	.	3.3	-1.82	0.07857	.	.	.	.	.	T	0.17195	0.0413	N	0.08118	0	0.09310	N	1	D	0.57899	0.981	P	0.50934	0.654	T	0.09100	-1.0690	8	0.87932	D	0	.	0.4751	0.00538	0.1826:0.3133:0.1792:0.3249	.	138	Q8N7S6	CC071_HUMAN	F	138	.	ENSP00000386193:L138F	L	-	3	2	C3orf71	48931173	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.050000	0.11904	-0.432000	0.07297	0.655000	0.94253	TTG	C3orf71	-	NULL	ENSG00000221883		0.647	ARIH2OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf71	HGNC	protein_coding	OTTHUMT00000345247.1	21	0.00	0	C	NM_001123040		48956169	48956169	-1	no_errors	ENST00000408959	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	0.000	G
C9orf129	445577	genome.wustl.edu	37	9	96097916	96097916	+	Silent	SNP	G	G	A	rs199652907	byFrequency	TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr9:96097916G>A	ENST00000375419.1	-	3	468	c.105C>T	c.(103-105)ggC>ggT	p.G35G		NM_001098808.1	NP_001092278.1	Q5T035	CI129_HUMAN	chromosome 9 open reading frame 129	35										endometrium(2)|large_intestine(1)|lung(1)|ovary(2)	6						GGCCCGGGGCGCCCCCTGGGC	0.657													G|||	314	0.0626997	0.0197	0.0749	5008	,	,		15080	0.0357		0.1481	False		,,,				2504	0.0521					dbGAP											0													8.0	8.0	8.0					9																	96097916		2112	4177	6289	-	-	-	SO:0001819	synonymous_variant	0				CCDS43850.1	9q22.31	2012-04-02			ENSG00000204352	ENSG00000204352			31116	protein-coding gene	gene with protein product							Standard	NM_001098808		Approved	bA165J3.3	uc010mre.3	Q5T035	OTTHUMG00000020248	ENST00000375419.1:c.105C>T	9.37:g.96097916G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.G35	ENST00000375419.1	37	c.105	CCDS43850.1	9																																																																																			C9orf129	-	NULL	ENSG00000204352		0.657	C9orf129-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	C9orf129	HGNC	protein_coding	OTTHUMT00000053147.1	8	0.00	0	G	NM_001098808		96097916	96097916	-1	no_errors	ENST00000375419	ensembl	human	known	69_37n	silent	2	81.82	9	SNP	0.631	A
CACNA1D	776	genome.wustl.edu	37	3	53842707	53842707	+	Silent	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr3:53842707C>T	ENST00000350061.5	+	46	6292	c.5781C>T	c.(5779-5781)tgC>tgT	p.C1927C	CACNA1D_ENST00000544977.1_Silent_p.C306C|CACNA1D_ENST00000422281.2_Silent_p.C1903C|CACNA1D_ENST00000288139.4_Silent_p.C1947C	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1927					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACTTTGAGTGCCTGCGCCGGC	0.602																																						dbGAP											0													84.0	75.0	78.0					3																	53842707		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5781C>T	3.37:g.53842707C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.C1947	ENST00000350061.5	37	c.5841	CCDS46848.1	3																																																																																			CACNA1D	-	NULL	ENSG00000157388		0.602	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	24	0.00	0	C	NM_000720		53842707	53842707	+1	no_errors	ENST00000288139	ensembl	human	known	69_37n	silent	22	38.89	14	SNP	1.000	T
CBFB	865	genome.wustl.edu	37	16	67070595	67070596	+	Nonsense_Mutation	DNP	GC	GC	AA			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G|C	G|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr16:67070595_67070596GC>AA	ENST00000290858.6	+	3	480_481	c.219_220GC>AA	c.(217-222)tgGCag>tgAAag	p.73_74WQ>*K	CBFB_ENST00000412916.2_Nonsense_Mutation_p.73_74WQ>*K|CBFB_ENST00000561924.2_5'UTR	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	73					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		CGGCCAGCTGGCAGGGAGAACA	0.441			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	0																																										-	-	-	SO:0001587	stop_gained	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	Exception_encountered	16.37:g.67070595_67070596delinsAA	ENSP00000290858:p.W73_Q74delins*K	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K347|Q13124|Q9HCT2	Nonsense_Mutation|Missense_Mutation	SNP	pfam_CBF_beta,superfamily_CBF_beta	p.W73*|p.Q74K	ENST00000290858.6	37	c.219|c.220	CCDS10827.1	16																																																																																			CBFB	-	pfam_CBF_beta,superfamily_CBF_beta	ENSG00000067955		0.441	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	HGNC	protein_coding	OTTHUMT00000268843.2	119|123	0.00	0	G|C	NM_001755		67070595|67070596	67070595|67070596	+1	no_errors	ENST00000290858	ensembl	human	known	69_37n	nonsense|missense	27|26	61.97|62.32	44|43	SNP	1.000	A
CCDC85A	114800	genome.wustl.edu	37	2	56419808	56419808	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr2:56419808delT	ENST00000407595.2	+	2	975	c.473delT	c.(472-474)gtgfs	p.V159fs	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	159										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CAGGAGGAAGTGGTGAAGGAG	0.587																																						dbGAP											0													54.0	62.0	59.0					2																	56419808		2086	4221	6307	-	-	-	SO:0001589	frameshift_variant	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.473delT	2.37:g.56419808delT	ENSP00000384040:p.Val159fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_DUF2216_coiled-coil	p.V158fs	ENST00000407595.2	37	c.473	CCDS46290.1	2																																																																																			CCDC85A	-	pfam_DUF2216_coiled-coil	ENSG00000055813		0.587	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	96	0.00	0	T			56419808	56419808	+1	no_errors	ENST00000407595	ensembl	human	known	69_37n	frame_shift_del	71	61.90	117	DEL	1.000	-
CCDC85A	114800	genome.wustl.edu	37	2	56419810	56419811	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr2:56419810_56419811delGT	ENST00000407595.2	+	2	977_978	c.475_476delGT	c.(475-477)gtgfs	p.V159fs	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	159										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGAGGAAGTGGTGAAGGAGAAC	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.475_476delGT	2.37:g.56419810_56419811delGT	ENSP00000384040:p.Val159fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_DUF2216_coiled-coil	p.V159fs	ENST00000407595.2	37	c.475_476	CCDS46290.1	2																																																																																			CCDC85A	-	pfam_DUF2216_coiled-coil	ENSG00000055813		0.589	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	95	0.00	0	GT			56419810	56419811	+1	no_errors	ENST00000407595	ensembl	human	known	69_37n	frame_shift_del	84	58.21	117	DEL	1.000:1.000	-
CHPF	79586	genome.wustl.edu	37	2	220404537	220404537	+	Silent	SNP	G	G	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr2:220404537G>A	ENST00000243776.6	-	4	2144	c.1896C>T	c.(1894-1896)gcC>gcT	p.A632A	CHPF_ENST00000535926.1_Silent_p.A470A	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	632					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AGCCGGAGATGGCATGCATGC	0.637																																						dbGAP											0													78.0	81.0	80.0					2																	220404537		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1896C>T	2.37:g.220404537G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Silent	SNP	pfam_Chond_GalNAc	p.A632	ENST00000243776.6	37	c.1896	CCDS2443.1	2																																																																																			CHPF	-	pfam_Chond_GalNAc	ENSG00000123989		0.637	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	HGNC	protein_coding	OTTHUMT00000130268.1	93	0.00	0	G	NM_024536		220404537	220404537	-1	no_errors	ENST00000243776	ensembl	human	known	69_37n	silent	26	36.59	15	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16946434	16946434	+	lincRNA	SNP	C	C	T	rs367060	byFrequency	TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr1:16946434C>T	ENST00000412962.1	-	0	1085				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CTCAGCCTTCCGCCGGGCCAG	0.672													.|||	253	0.0505192	0.115	0.0533	5008	,	,		65734	0.0119		0.0437	False		,,,				2504	0.0082					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946434C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.672	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	C	NR_026752.1		16946434	16946434	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	3	62.50	5	SNP	0.987	T
CTNND2	1501	genome.wustl.edu	37	5	11346597	11346597	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr5:11346597C>A	ENST00000304623.8	-	9	1704	c.1515G>T	c.(1513-1515)caG>caT	p.Q505H	CTNND2_ENST00000503622.1_Missense_Mutation_p.Q168H|CTNND2_ENST00000511377.1_Missense_Mutation_p.Q414H|CTNND2_ENST00000359640.2_Missense_Mutation_p.Q505H|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Missense_Mutation_p.Q72H	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	505					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q505H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						AATACTGCAGCTGTCGGTAGG	0.637																																						dbGAP											1	Substitution - Missense(1)	lung(1)											99.0	103.0	102.0					5																	11346597		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1515G>T	5.37:g.11346597C>A	ENSP00000307134:p.Gln505His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q505H	ENST00000304623.8	37	c.1515	CCDS3881.1	5	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050058	0.36181	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.77098	-0.95;-1.02;-0.95;-1.07;-1.06	5.8	4.94	0.65067	.	0.330345	0.29362	N	0.012370	T	0.61739	0.2371	N	0.08118	0	0.34537	D	0.709855	B;B;B	0.10296	0.0;0.0;0.003	B;B;B	0.06405	0.0;0.0;0.002	T	0.66468	-0.5916	10	0.62326	D	0.03	-8.5755	14.6717	0.68948	0.0:0.9306:0.0:0.0694	.	168;72;505	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	H	505;505;414;72;168	ENSP00000307134:Q505H;ENSP00000352661:Q505H;ENSP00000426510:Q414H;ENSP00000391155:Q72H;ENSP00000426887:Q168H	ENSP00000307134:Q505H	Q	-	3	2	CTNND2	11399597	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.383000	0.44354	1.477000	0.48234	0.585000	0.79938	CAG	CTNND2	-	NULL	ENSG00000169862		0.637	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1	39	0.00	0	C	NM_001332		11346597	11346597	-1	no_errors	ENST00000304623	ensembl	human	known	69_37n	missense	35	39.66	23	SNP	1.000	A
DACH2	117154	genome.wustl.edu	37	X	86071092	86071092	+	Silent	SNP	T	T	C			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chrX:86071092T>C	ENST00000373125.4	+	11	1740	c.1740T>C	c.(1738-1740)gcT>gcC	p.A580A	DACH2_ENST00000508860.1_Silent_p.A413A|DACH2_ENST00000510272.1_Silent_p.A361A|DACH2_ENST00000373131.1_Silent_p.A567A	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	580					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						ATGATAGTGCTGCTATGCAAG	0.408																																						dbGAP											0													78.0	72.0	74.0					X																	86071092		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1740T>C	X.37:g.86071092T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.A580	ENST00000373125.4	37	c.1740	CCDS14455.1	X																																																																																			DACH2	-	NULL	ENSG00000126733		0.408	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	76	0.00	0	T	NM_053281		86071092	86071092	+1	no_errors	ENST00000373125	ensembl	human	known	69_37n	silent	74	30.84	33	SNP	1.000	C
DNAJC4	3338	genome.wustl.edu	37	11	64000185	64000186	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr11:64000185_64000186insC	ENST00000321685.3	+	5	840_841	c.375_376insC	c.(376-378)cccfs	p.P126fs	RP11-783K16.14_ENST00000539963.1_RNA|VEGFB_ENST00000426086.2_5'Flank|DNAJC4_ENST00000355040.4_Intron|RP11-783K16.14_ENST00000534988.1_RNA|VEGFB_ENST00000309422.2_5'Flank|DNAJC4_ENST00000321460.5_Frame_Shift_Ins_p.P127fs	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	126					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)			endometrium(1)|lung(1)|prostate(1)	3						GCTCCTGGACACCCCCCAACGC	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.381dupC	11.37:g.64000191_64000191dupC	ENSP00000396896:p.Pro126fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O14716	Frame_Shift_Ins	INS	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.N127fs	ENST00000321685.3	37	c.375_376	CCDS41666.1	11																																																																																			DNAJC4	-	NULL	ENSG00000110011		0.574	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC4	HGNC	protein_coding	OTTHUMT00000396305.1	38	0.00	0	-			64000185	64000186	+1	no_errors	ENST00000321685	ensembl	human	known	69_37n	frame_shift_ins	9	18.18	2	INS	0.001:0.002	C
G6PD	2539	genome.wustl.edu	37	X	153761953	153761953	+	Intron	SNP	A	A	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chrX:153761953A>T	ENST00000393564.2	-	8	883				G6PD_ENST00000369620.2_Silent_p.G280G|G6PD_ENST00000497281.1_5'Flank|G6PD_ENST00000393562.2_Intron	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase						carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGGCATGGGGACCCCAAACAA	0.562																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.771-69T>A	X.37:g.153761953A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Silent	SNP	pfam_G6P_DH_C,pfam_G6P_DH_NAD-bd,pirsf_G6P_DH,prints_G6P_DH	p.G280	ENST00000393564.2	37	c.840	CCDS44023.1	X																																																																																			G6PD	-	pirsf_G6P_DH	ENSG00000160211		0.562	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	G6PD	HGNC	protein_coding	OTTHUMT00000061170.3	14	0.00	0	A	NM_000402		153761953	153761953	-1	no_errors	ENST00000369620	ensembl	human	known	69_37n	silent	5	61.54	8	SNP	0.000	T
GPR137	56834	genome.wustl.edu	37	11	64055630	64055631	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr11:64055630_64055631insC	ENST00000313074.3	+	4	832_833	c.727_728insC	c.(727-729)gccfs	p.A243fs	GPR137_ENST00000539851.1_Frame_Shift_Ins_p.A243fs|GPR137_ENST00000438980.2_Frame_Shift_Ins_p.A243fs|GPR137_ENST00000377702.4_Intron|GPR137_ENST00000411458.1_Frame_Shift_Ins_p.A301fs	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	243						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						ACTGGCCTTGGCCCCCCAGAGC	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.733dupC	11.37:g.64055636_64055636dupC	ENSP00000321698:p.Ala243fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Frame_Shift_Ins	INS	NULL	p.Q245fs	ENST00000313074.3	37	c.727_728	CCDS8066.1	11																																																																																			GPR137	-	NULL	ENSG00000173264		0.639	GPR137-003	KNOWN	basic|CCDS	protein_coding	GPR137	HGNC	protein_coding	OTTHUMT00000396412.1	26	0.00	0	-	NM_020155		64055630	64055631	+1	no_errors	ENST00000313074	ensembl	human	known	69_37n	frame_shift_ins	5	28.57	2	INS	1.000:1.000	C
HADHB	3032	genome.wustl.edu	37	2	26505908	26505908	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr2:26505908A>T	ENST00000317799.5	+	12	1154	c.1050A>T	c.(1048-1050)caA>caT	p.Q350H	HADHB_ENST00000405867.3_Missense_Mutation_p.Q227H|HADHB_ENST00000537713.1_Missense_Mutation_p.Q335H|HADHB_ENST00000494615.1_3'UTR|HADHB_ENST00000545822.1_Missense_Mutation_p.Q328H	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	350					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAAAGATCAACTATTACTTG	0.313																																						dbGAP											0													155.0	159.0	157.0					2																	26505908		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.1050A>T	2.37:g.26505908A>T	ENSP00000325136:p.Gln350His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,tigrfam_Thiolase	p.Q350H	ENST00000317799.5	37	c.1050	CCDS1722.1	2	.	.	.	.	.	.	.	.	.	.	A	19.67	3.870270	0.72065	.	.	ENSG00000138029	ENST00000317799;ENST00000405867;ENST00000537713;ENST00000545822	D;D;D;D	0.92699	-1.58;-3.09;-1.58;-1.58	5.95	-1.52	0.08637	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, C-terminal (1);	0.104827	0.64402	D	0.000002	D	0.95614	0.8574	M	0.88310	2.945	0.80722	D	1	D;D;D;D	0.71674	0.998;0.997;0.998;0.998	D;D;D;D	0.83275	0.94;0.964;0.996;0.964	D	0.94427	0.7646	10	0.51188	T	0.08	-15.1718	13.0381	0.58882	0.3805:0.0:0.6195:0.0	.	335;328;227;350	F5GZQ3;B4E2W0;B5MD38;P55084	.;.;.;ECHB_HUMAN	H	350;227;335;328	ENSP00000325136:Q350H;ENSP00000385411:Q227H;ENSP00000444295:Q335H;ENSP00000442665:Q328H	ENSP00000325136:Q350H	Q	+	3	2	HADHB	26359412	1.000000	0.71417	0.996000	0.52242	0.865000	0.49528	1.438000	0.35002	-0.038000	0.13624	0.528000	0.53228	CAA	HADHB	-	pfam_Thiolase_C,superfamily_Thiolase-like,tigrfam_Thiolase	ENSG00000138029		0.313	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHB	HGNC	protein_coding	OTTHUMT00000214050.2	196	0.00	0	A	NM_000183		26505908	26505908	+1	no_errors	ENST00000317799	ensembl	human	known	69_37n	missense	153	27.83	59	SNP	0.999	T
HAUS8	93323	genome.wustl.edu	37	19	17169452	17169452	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr19:17169452C>G	ENST00000253669.5	-	8	742	c.552G>C	c.(550-552)gaG>gaC	p.E184D	HAUS8_ENST00000448593.2_Missense_Mutation_p.E183D|HAUS8_ENST00000593360.1_Missense_Mutation_p.E123D			Q9BT25	HAUS8_HUMAN	HAUS augmin-like complex, subunit 8	184					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	12						GCTTCTCCTTCTCCTTACACA	0.468																																						dbGAP											0													68.0	63.0	64.0					19																	17169452		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004398	CCDS32948.1, CCDS46009.1	19p13.11	2013-10-11	2009-04-20	2009-04-20	ENSG00000131351	ENSG00000131351		"""HAUS augmin-like complex subunits"""	30532	protein-coding gene	gene with protein product		613434	"""HEC1/NDC80 interacting, centrosome associated 1"""	HICE1		19427217	Standard	XM_005260154		Approved	MGC20533, NY-SAR-48	uc002nfe.3	Q9BT25		ENST00000253669.5:c.552G>C	19.37:g.17169452C>G	ENSP00000253669:p.Glu184Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJA7|C9JBZ4|Q49AC4|Q86WF0|Q96FX3	Missense_Mutation	SNP	NULL	p.E184D	ENST00000253669.5	37	c.552	CCDS32948.1	19	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611481	0.46631	.	.	ENSG00000131351	ENST00000253669;ENST00000448593	T;T	0.76186	-1.0;-1.0	4.73	0.897	0.19258	.	0.069121	0.56097	N	0.000039	T	0.79488	0.4454	M	0.65498	2.005	0.09310	N	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.68765	0.96;0.94;0.94	T	0.66826	-0.5825	10	0.62326	D	0.03	-36.4935	5.5151	0.16902	0.0:0.5909:0.0:0.4091	.	123;183;184	Q9BT25-2;C9JBZ4;Q9BT25	.;.;HAUS8_HUMAN	D	184;183	ENSP00000253669:E184D;ENSP00000395298:E183D	ENSP00000253669:E184D	E	-	3	2	HAUS8	17030452	0.994000	0.37717	0.016000	0.15963	0.006000	0.05464	1.293000	0.33353	0.537000	0.28751	-0.258000	0.10820	GAG	HAUS8	-	NULL	ENSG00000131351		0.468	HAUS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HAUS8	HGNC	protein_coding	OTTHUMT00000463015.1	139	0.00	0	C	NM_001011699		17169452	17169452	-1	no_errors	ENST00000253669	ensembl	human	known	69_37n	missense	105	23.36	32	SNP	0.056	G
HDAC6	10013	genome.wustl.edu	37	X	48672895	48672895	+	Silent	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chrX:48672895C>T	ENST00000334136.5	+	11	1033	c.855C>T	c.(853-855)ccC>ccT	p.P285P	HDAC6_ENST00000444343.2_Silent_p.P299P|HDAC6_ENST00000376619.2_Silent_p.P285P|HDAC6_ENST00000413163.2_Silent_p.P230P			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	285	Histone deacetylase 1.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GGTTCTGGCCCCACCTGAAGG	0.537																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													107.0	95.0	99.0					X																	48672895		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.855C>T	X.37:g.48672895C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.P299	ENST00000334136.5	37	c.897	CCDS14306.1	X																																																																																			HDAC6	-	pfam_His_deacetylse_dom	ENSG00000094631		0.537	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	146	0.00	0	C	NM_006044		48672895	48672895	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	silent	83	31.97	39	SNP	1.000	T
INSRR	3645	genome.wustl.edu	37	1	156814052	156814053	+	Frame_Shift_Ins	INS	-	-	C	rs372329556		TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr1:156814052_156814053insC	ENST00000368195.3	-	15	3153_3154	c.2757_2758insG	c.(2755-2760)gggctgfs	p.L920fs	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	920					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L920fs*37(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGGACATGCAGCCCCCCAGCAT	0.564																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)																																								-	-	-	SO:0001589	frameshift_variant	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2758dupG	1.37:g.156814058_156814058dupC	ENSP00000357178:p.Leu920fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60724|Q5VZS3	Frame_Shift_Ins	INS	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L919fs	ENST00000368195.3	37	c.2758_2757	CCDS1160.1	1																																																																																			INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt	ENSG00000027644		0.564	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	46	0.00	0	-	NM_014215		156814052	156814053	-1	no_errors	ENST00000368195	ensembl	human	known	69_37n	frame_shift_ins	15	11.76	2	INS	0.075:0.002	C
JAK1	3716	genome.wustl.edu	37	1	65301180	65301180	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr1:65301180T>G	ENST00000342505.4	-	24	3516	c.3268A>C	c.(3268-3270)Aaa>Caa	p.K1090Q		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	1090	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CCTATCATTTTCAGGAACAAC	0.373			Mis		ALL																																	dbGAP		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													88.0	82.0	84.0					1																	65301180		1817	4084	5901	-	-	-	SO:0001583	missense	0			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.3268A>C	1.37:g.65301180T>G	ENSP00000343204:p.Lys1090Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GQ2|Q9UD26	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.K1090Q	ENST00000342505.4	37	c.3268	CCDS41346.1	1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.994315	0.54041	.	.	ENSG00000162434	ENST00000342505	T	0.75938	-0.98	4.96	4.96	0.65561	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.44829	0.1312	N	0.20986	0.625	0.46521	D	0.999084	B	0.33494	0.414	B	0.23150	0.044	T	0.52403	-0.8580	9	0.36615	T	0.2	-5.2888	14.8236	0.70091	0.0:0.0:0.0:1.0	.	1090	P23458	JAK1_HUMAN	Q	1090	ENSP00000343204:K1090Q	ENSP00000343204:K1090Q	K	-	1	0	JAK1	65073768	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.475000	0.66787	2.081000	0.62600	0.533000	0.62120	AAA	JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162434		0.373	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	244	0.00	0	T	NM_002227		65301180	65301180	-1	no_errors	ENST00000342505	ensembl	human	known	69_37n	missense	150	34.78	80	SNP	1.000	G
KCNT2	343450	genome.wustl.edu	37	1	196311258	196311258	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr1:196311258C>T	ENST00000294725.9	-	15	2419	c.1504G>A	c.(1504-1506)Gaa>Aaa	p.E502K	KCNT2_ENST00000367433.5_Missense_Mutation_p.E502K|KCNT2_ENST00000367431.4_Intron|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Intron|KCNT2_ENST00000451324.2_Missense_Mutation_p.E113K			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	502	RCK N-terminal.				potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CCTTCATATTCAGCAAAAAAT	0.383																																						dbGAP											0													129.0	119.0	122.0					1																	196311258		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1504G>A	1.37:g.196311258C>T	ENSP00000294725:p.Glu502Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.E502K	ENST00000294725.9	37	c.1504	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.478220	0.96291	.	.	ENSG00000162687	ENST00000367433;ENST00000535608;ENST00000451324;ENST00000294725	T;T;T	0.32988	2.16;1.43;2.4	5.87	5.87	0.94306	Potassium channel, calcium-activated, BK, alpha subunit (1);	0.000000	0.64402	D	0.000003	T	0.46502	0.1396	L	0.60957	1.885	0.80722	D	1	P;B;P;P	0.52316	0.952;0.109;0.756;0.952	P;B;P;P	0.51945	0.685;0.103;0.591;0.685	T	0.25117	-1.0141	10	0.49607	T	0.09	-23.1646	20.1991	0.98252	0.0:1.0:0.0:0.0	.	502;484;502;502	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3	.;.;.;KCNT2_HUMAN	K	502;323;113;502	ENSP00000356403:E502K;ENSP00000405474:E113K;ENSP00000294725:E502K	ENSP00000294725:E502K	E	-	1	0	KCNT2	194577881	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.773000	0.85462	2.775000	0.95449	0.650000	0.86243	GAA	KCNT2	-	pfam_K_chnl_Ca-activ_BK_asu	ENSG00000162687		0.383	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	159	0.00	0	C	NM_198503		196311258	196311258	-1	no_errors	ENST00000294725	ensembl	human	known	69_37n	missense	227	12.36	32	SNP	1.000	T
LILRA3	11026	genome.wustl.edu	37	19	54802507	54802507	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr19:54802507C>T	ENST00000251390.3	-	5	1025	c.934G>A	c.(934-936)Gac>Aac	p.D312N	LILRA3_ENST00000391744.3_Missense_Mutation_p.D248N|LILRA3_ENST00000391745.1_Missense_Mutation_p.D329N	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	312	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCCAGGGGGTCGCTGGGGGCC	0.672																																						dbGAP											0													24.0	28.0	27.0					19																	54802507		2190	4163	6353	-	-	-	SO:0001583	missense	0			U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.934G>A	19.37:g.54802507C>T	ENSP00000251390:p.Asp312Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.D312N	ENST00000251390.3	37	c.934	CCDS12887.1	19	.	.	.	.	.	.	.	.	.	.	c	13.29	2.192935	0.38707	.	.	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	T;T;T	0.00873	5.59;5.59;5.59	2.21	-1.41	0.08941	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.846370	0.03220	N	0.177389	T	0.05273	0.0140	M	0.83312	2.635	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.974;0.996	T	0.28364	-1.0046	10	0.59425	D	0.04	.	5.2061	0.15291	0.0:0.5322:0.0:0.4678	.	312;312	E7EU74;Q8N6C8	.;LIRA3_HUMAN	N	312;248;329	ENSP00000251390:D312N;ENSP00000375624:D248N;ENSP00000375625:D329N	ENSP00000251390:D312N	D	-	1	0	LILRA3	59494319	0.001000	0.12720	0.031000	0.17742	0.028000	0.11728	0.127000	0.15790	-0.192000	0.10432	-0.192000	0.12808	GAC	LILRA3	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	ENSG00000170866		0.672	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA3	HGNC	protein_coding	OTTHUMT00000140236.1	59	0.00	0	C			54802507	54802507	-1	no_errors	ENST00000251390	ensembl	human	known	69_37n	missense	23	37.84	14	SNP	0.038	T
LUZP2	338645	genome.wustl.edu	37	11	25098915	25098915	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr11:25098915C>T	ENST00000336930.6	+	11	965	c.899C>T	c.(898-900)cCa>cTa	p.P300L	LUZP2_ENST00000533227.1_Missense_Mutation_p.P214L			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	300						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						GAAAGTCCCCCAAGTAATGCC	0.388																																						dbGAP											0													154.0	151.0	152.0					11																	25098915		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.899C>T	11.37:g.25098915C>T	ENSP00000336817:p.Pro300Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	NULL	p.P300L	ENST00000336930.6	37	c.899	CCDS31446.1	11	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433260	0.25813	.	.	ENSG00000187398	ENST00000336930;ENST00000533227	T;T	0.41758	0.99;0.99	5.05	-0.368	0.12537	.	0.742515	0.11758	N	0.532349	T	0.22360	0.0539	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.17107	-1.0380	10	0.30854	T	0.27	0.6341	4.2592	0.10733	0.1547:0.4781:0.0:0.3672	.	214;300	E9PN53;Q86TE4	.;LUZP2_HUMAN	L	300;214	ENSP00000336817:P300L;ENSP00000432952:P214L	ENSP00000336817:P300L	P	+	2	0	LUZP2	25055491	0.000000	0.05858	0.001000	0.08648	0.237000	0.25408	-0.213000	0.09305	-0.018000	0.14079	-0.269000	0.10298	CCA	LUZP2	-	NULL	ENSG00000187398		0.388	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP2	HGNC	protein_coding	OTTHUMT00000387861.1	472	0.00	0	C	NM_001009909		25098915	25098915	+1	no_errors	ENST00000336930	ensembl	human	known	69_37n	missense	392	33.33	196	SNP	0.000	T
NBPF9	400818	genome.wustl.edu	37	1	144827878	144827879	+	In_Frame_Ins	INS	-	-	AGG			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr1:144827878_144827879insAGG	ENST00000440491.2	+	15	1757_1758	c.1757_1758insAGG	c.(1756-1761)gaagaa>gaAGGagaa	p.586_587EE>EGE	NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000281815.8_Intron|NBPF9_ENST00000338347.4_In_Frame_Ins_p.513_513R>RR	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	0	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						agaaggaaagaagaaggggaag	0.426																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	Exception_encountered	1.37:g.144827878_144827879insAGG	ENSP00000390934:p.Glu586_Glu587insGly	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Ins	INS	pfam_NBPF_dom	p.587in_frame_insG	ENST00000440491.2	37	c.1757_1758		1																																																																																			NBPF9	-	NULL	ENSG00000168614		0.426	NBPF9-203	KNOWN	basic	protein_coding	NBPF9	HGNC	protein_coding		25	0.00	0	-	NM_001037675		144827878	144827879	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000375552	ensembl	human	known	69_37n	in_frame_ins	44	12.00	6	INS	0.025:0.025	AGG
NCOA3	8202	genome.wustl.edu	37	20	46264773	46264773	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr20:46264773T>G	ENST00000371998.3	+	12	1834	c.1643T>G	c.(1642-1644)tTg>tGg	p.L548W	NCOA3_ENST00000372004.3_Missense_Mutation_p.L548W|NCOA3_ENST00000371997.3_Missense_Mutation_p.L558W|NCOA3_ENST00000341724.6_Missense_Mutation_p.L558W			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	548	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GGCCCCAAATTGGATAACTCT	0.468																																						dbGAP											0													92.0	90.0	91.0					20																	46264773		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1643T>G	20.37:g.46264773T>G	ENSP00000361066:p.Leu548Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.L548W	ENST00000371998.3	37	c.1643	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	T	18.94	3.729975	0.69074	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.72	5.72	0.89469	.	0.267120	0.31685	N	0.007222	T	0.39937	0.1097	M	0.64997	1.995	0.35001	D	0.755998	D;D;D;D;D;D	0.76494	0.991;0.999;0.991;0.991;0.995;0.991	P;D;P;P;D;P	0.71870	0.874;0.975;0.874;0.874;0.941;0.874	T	0.53464	-0.8435	10	0.72032	D	0.01	-4.2791	15.9912	0.80206	0.0:0.0:0.0:1.0	.	548;558;552;548;548;548	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	W	548;558;548;548;558	ENSP00000342123:L558W;ENSP00000361073:L548W;ENSP00000361066:L548W;ENSP00000361065:L558W	ENSP00000345671:L548W	L	+	2	0	NCOA3	45698180	1.000000	0.71417	0.994000	0.49952	0.981000	0.71138	5.634000	0.67833	2.172000	0.68678	0.533000	0.62120	TTG	NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.468	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1	219	0.45	1	T	NM_006534		46264773	46264773	+1	no_errors	ENST00000371998	ensembl	human	known	69_37n	missense	180	33.33	90	SNP	0.999	G
NHS	4810	genome.wustl.edu	37	X	17745318	17745318	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chrX:17745318C>T	ENST00000380060.3	+	6	3367	c.3029C>T	c.(3028-3030)aCg>aTg	p.T1010M	NHS_ENST00000398097.3_Missense_Mutation_p.T854M	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1031					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					CAGTCTGAAACGCCAACATCC	0.458																																						dbGAP											0													88.0	79.0	83.0					X																	17745318		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3029C>T	X.37:g.17745318C>T	ENSP00000369400:p.Thr1010Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.T1010M	ENST00000380060.3	37	c.3029	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	C	17.65	3.443180	0.63067	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.74421	-0.8;-0.84	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.87684	0.6239	M	0.81802	2.56	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.88657	0.3186	10	0.87932	D	0	-15.6957	19.3108	0.94187	0.0:1.0:0.0:0.0	.	1031;852;854;1010	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	M	1010;854;852	ENSP00000369400:T1010M;ENSP00000381170:T854M	ENSP00000369397:T852M	T	+	2	0	NHS	17655239	1.000000	0.71417	0.979000	0.43373	0.948000	0.59901	7.776000	0.85560	2.513000	0.84729	0.544000	0.68410	ACG	NHS	-	NULL	ENSG00000188158		0.458	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	HGNC	protein_coding	OTTHUMT00000059120.1	581	0.00	0	C	NM_198270		17745318	17745318	+1	no_errors	ENST00000380060	ensembl	human	known	69_37n	missense	498	21.17	134	SNP	1.000	T
OPHN1	4983	genome.wustl.edu	37	X	67339171	67339171	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chrX:67339171G>C	ENST00000355520.5	-	16	1921	c.1280C>G	c.(1279-1281)cCt>cGt	p.P427R	OPHN1_ENST00000540071.1_Missense_Mutation_p.P427R	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	427	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						TGGGCATTTAGGATCTATTTG	0.313																																						dbGAP											0													54.0	48.0	50.0					X																	67339171		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1280C>G	X.37:g.67339171G>C	ENSP00000347710:p.Pro427Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.P427R	ENST00000355520.5	37	c.1280	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787521	0.49997	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.21734	1.99;1.99	4.63	3.77	0.43336	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.176618	0.50627	D	0.000107	T	0.20170	0.0485	N	0.16307	0.4	0.50313	D	0.999864	P;D	0.56968	0.871;0.978	B;P	0.56042	0.241;0.79	T	0.03060	-1.1077	10	0.23891	T	0.37	.	9.5878	0.39528	0.1053:0.0:0.8947:0.0	.	427;427	F5H2E3;O60890	.;OPHN1_HUMAN	R	427	ENSP00000347710:P427R;ENSP00000438617:P427R	ENSP00000347710:P427R	P	-	2	0	OPHN1	67255896	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.839000	0.86812	0.963000	0.38082	0.513000	0.50165	CCT	OPHN1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000079482		0.313	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1	132	0.00	0	G	NM_002547		67339171	67339171	-1	no_errors	ENST00000355520	ensembl	human	known	69_37n	missense	87	43.87	68	SNP	1.000	C
PCDH19	57526	genome.wustl.edu	37	X	99657715	99657715	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chrX:99657715G>A	ENST00000373034.4	-	3	4098	c.2423C>T	c.(2422-2424)aCc>aTc	p.T808I	PCDH19_ENST00000255531.7_Missense_Mutation_p.T761I|PCDH19_ENST00000420881.2_Missense_Mutation_p.T761I	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	808					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						GAGGGAGGAGGTCAGGGAAGA	0.527																																						dbGAP											0													136.0	123.0	127.0					X																	99657715		2050	4155	6205	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.2423C>T	X.37:g.99657715G>A	ENSP00000362125:p.Thr808Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T808I	ENST00000373034.4	37	c.2423	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	g	14.69	2.610158	0.46527	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.54279	0.58;0.62;0.58	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.66655	0.2811	L	0.43152	1.355	0.80722	D	1	D;B;B	0.76494	0.999;0.383;0.264	D;B;B	0.78314	0.991;0.19;0.093	T	0.64166	-0.6471	10	0.38643	T	0.18	.	18.6987	0.91613	0.0:0.0:1.0:0.0	.	808;761;761	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	I	761;808;761	ENSP00000400327:T761I;ENSP00000362125:T808I;ENSP00000255531:T761I	ENSP00000255531:T761I	T	-	2	0	PCDH19	99544371	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	7.629000	0.83207	2.360000	0.80028	0.591000	0.81541	ACC	PCDH19	-	NULL	ENSG00000165194		0.527	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	46	0.00	0	G	NM_020766		99657715	99657715	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	24	41.46	17	SNP	1.000	A
PCF11	51585	genome.wustl.edu	37	11	82877733	82877733	+	Silent	SNP	A	A	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr11:82877733A>G	ENST00000298281.4	+	5	2246	c.1794A>G	c.(1792-1794)aaA>aaG	p.K598K		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	598					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						AAAGATGGAAATCTGGTTGGG	0.333																																						dbGAP											0													74.0	77.0	76.0					11																	82877733		1738	3791	5529	-	-	-	SO:0001819	synonymous_variant	0			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1794A>G	11.37:g.82877733A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W7|O43671|Q6P0X8	Silent	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.K598	ENST00000298281.4	37	c.1794	CCDS44689.1	11																																																																																			PCF11	-	NULL	ENSG00000165494		0.333	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	HGNC	protein_coding	OTTHUMT00000392548.2	209	0.00	0	A	NM_015885		82877733	82877733	+1	no_errors	ENST00000298281	ensembl	human	known	69_37n	silent	171	36.53	99	SNP	1.000	G
PDZD8	118987	genome.wustl.edu	37	10	119043132	119043132	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr10:119043132A>G	ENST00000334464.5	-	5	3351	c.3112T>C	c.(3112-3114)Ttc>Ctc	p.F1038L	PDZD8_ENST00000482496.1_5'Flank	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	1038					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		TCCAACATGAACTCTAGTTTC	0.398																																						dbGAP											0													116.0	116.0	116.0					10																	119043132		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.3112T>C	10.37:g.119043132A>G	ENSP00000334642:p.Phe1038Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	pfam_PDZ,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_PDZ,smart_PDZ,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_PDZ,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.F1038L	ENST00000334464.5	37	c.3112	CCDS7600.1	10	.	.	.	.	.	.	.	.	.	.	A	3.505	-0.101026	0.06967	.	.	ENSG00000165650	ENST00000334464	D	0.84516	-1.86	5.71	4.59	0.56863	.	0.118662	0.64402	N	0.000014	T	0.69450	0.3112	N	0.17082	0.46	0.35454	D	0.795929	B	0.15719	0.014	B	0.13407	0.009	T	0.62770	-0.6784	10	0.08599	T	0.76	-7.3104	7.9878	0.30222	0.7925:0.137:0.0705:0.0	.	1038	Q8NEN9	PDZD8_HUMAN	L	1038	ENSP00000334642:F1038L	ENSP00000334642:F1038L	F	-	1	0	PDZD8	119033122	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.740000	0.47418	1.006000	0.39211	0.482000	0.46254	TTC	PDZD8	-	NULL	ENSG00000165650		0.398	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD8	HGNC	protein_coding	OTTHUMT00000050565.1	370	0.00	0	A	NM_173791		119043132	119043132	-1	no_errors	ENST00000334464	ensembl	human	known	69_37n	missense	233	31.47	107	SNP	1.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	113	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	82	35.43	45	SNP	1.000	A
PMS2	5395	genome.wustl.edu	37	7	6031635	6031635	+	Silent	SNP	T	T	C			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr7:6031635T>C	ENST00000265849.7	-	9	1062	c.957A>G	c.(955-957)ccA>ccG	p.P319P	PMS2_ENST00000382321.4_Intron|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Silent_p.P319P|PMS2_ENST00000441476.2_Silent_p.P213P	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	319					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GAACAACAAATGGATACTGGT	0.368			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													106.0	87.0	93.0					7																	6031635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.957A>G	7.37:g.6031635T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Silent	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.P319	ENST00000265849.7	37	c.957	CCDS5343.1	7																																																																																			PMS2	-	pfam_DNA_mismatch_repair_C,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	ENSG00000122512		0.368	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3	47	0.00	0	T	NM_000535		6031635	6031635	-1	no_errors	ENST00000265849	ensembl	human	known	69_37n	silent	65	23.53	20	SNP	0.966	C
POU4F2	5458	genome.wustl.edu	37	4	147561836	147561836	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr4:147561836G>A	ENST00000281321.3	+	2	1354	c.1106G>A	c.(1105-1107)cGg>cAg	p.R369Q	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	369					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R369Q(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					ATTCAGCCTCGGCCCTCCTCT	0.572																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											58.0	63.0	61.0					4																	147561836		2203	4300	6503	-	-	-	SO:0001583	missense	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.1106G>A	4.37:g.147561836G>A	ENSP00000281321:p.Arg369Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.R369Q	ENST00000281321.3	37	c.1106	CCDS34074.1	4	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306935	0.81247	.	.	ENSG00000151615	ENST00000281321	D	0.96073	-3.9	5.55	5.55	0.83447	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98108	0.9376	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.98758	1.0723	10	0.87932	D	0	.	19.5152	0.95160	0.0:0.0:1.0:0.0	.	369	Q12837	PO4F2_HUMAN	Q	369	ENSP00000281321:R369Q	ENSP00000281321:R369Q	R	+	2	0	POU4F2	147781286	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.841000	0.99482	2.630000	0.89119	0.561000	0.74099	CGG	POU4F2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000151615		0.572	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	148	0.67	1	G	NM_004575		147561836	147561836	+1	no_errors	ENST00000281321	ensembl	human	known	69_37n	missense	59	25.32	20	SNP	1.000	A
PPARGC1B	133522	genome.wustl.edu	37	5	149212267	149212267	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr5:149212267C>T	ENST00000309241.5	+	5	663	c.631C>T	c.(631-633)Cga>Tga	p.R211*	PPARGC1B_ENST00000403750.1_Nonsense_Mutation_p.R147*|PPARGC1B_ENST00000360453.4_Nonsense_Mutation_p.R172*|PPARGC1B_ENST00000394320.3_Nonsense_Mutation_p.R211*	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	211					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GTCTCAGAGCCGAAGTTGTAC	0.602																																						dbGAP											0													190.0	178.0	182.0					5																	149212267		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.631C>T	5.37:g.149212267C>T	ENSP00000312649:p.Arg211*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R211*	ENST00000309241.5	37	c.631	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.630677	0.96682	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.	.	.	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.7978	14.7746	0.69713	0.1443:0.8557:0.0:0.0	.	.	.	.	X	172;211;211;147	.	ENSP00000312649:R211X	R	+	1	2	PPARGC1B	149192460	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	3.568000	0.53820	2.713000	0.92767	0.655000	0.94253	CGA	PPARGC1B	-	NULL	ENSG00000155846		0.602	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	115	0.00	0	C	NM_133263		149212267	149212267	+1	no_errors	ENST00000309241	ensembl	human	known	69_37n	nonsense	90	10.89	11	SNP	1.000	T
PRPF4	9128	genome.wustl.edu	37	9	116050502	116050502	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr9:116050502delG	ENST00000374198.4	+	10	1085	c.983delG	c.(982-984)cggfs	p.R328fs	PRPF4_ENST00000374199.4_Frame_Shift_Del_p.R327fs	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	328					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						CGTGTGGCGCGGGTAATGTGG	0.433																																						dbGAP											0													141.0	114.0	123.0					9																	116050502		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.983delG	9.37:g.116050502delG	ENSP00000363313:p.Arg328fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_PRP4,superfamily_WD40_repeat_dom,smart_SFM,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V329fs	ENST00000374198.4	37	c.983	CCDS6791.1	9																																																																																			PRPF4	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000136875		0.433	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRPF4	HGNC	protein_coding	OTTHUMT00000053708.2	68	0.00	0	G	NM_004697		116050502	116050502	+1	no_errors	ENST00000374198	ensembl	human	known	69_37n	frame_shift_del	52	32.91	26	DEL	1.000	-
PSMA8	143471	genome.wustl.edu	37	18	23731889	23731889	+	Silent	SNP	G	G	T	rs138692405		TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr18:23731889G>T	ENST00000308268.6	+	3	404	c.315G>T	c.(313-315)acG>acT	p.T105T	PSMA8_ENST00000343848.6_Silent_p.T61T|PSMA8_ENST00000415576.2_Silent_p.T99T	NM_001025096.1|NM_144662.2	NP_001020267.1|NP_653263.2	Q8TAA3	PSA7L_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 8	105					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome core complex, alpha-subunit complex (GO:0019773)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|skin(2)	16	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			ATAAGCTTACGGTTGAGGACC	0.388																																						dbGAP											0													112.0	104.0	107.0					18																	23731889		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC047355	CCDS32808.1, CCDS45842.1, CCDS45843.1	18q11.2	2006-12-18				ENSG00000154611		"""Proteasome (prosome, macropain) subunits"""	22985	protein-coding gene	gene with protein product							Standard	XM_005258199		Approved	MGC26605, PSMA7L	uc002kvq.3	Q8TAA3		ENST00000308268.6:c.315G>T	18.37:g.23731889G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ75|Q8IVP4|Q8TA98|Q8TAA2	Silent	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.T105	ENST00000308268.6	37	c.315	CCDS32808.1	18																																																																																			PSMA8	-	pfam_Proteasome_sua/b	ENSG00000154611		0.388	PSMA8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMA8	HGNC	protein_coding	OTTHUMT00000446255.1	151	0.00	0	G	NM_144662		23731889	23731889	+1	no_errors	ENST00000308268	ensembl	human	known	69_37n	silent	239	21.57	66	SNP	0.913	T
RAB11FIP5	26056	genome.wustl.edu	37	2	73316121	73316121	+	Silent	SNP	G	G	A			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr2:73316121G>A	ENST00000258098.6	-	2	994	c.754C>T	c.(754-756)Ctg>Ttg	p.L252L	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	252					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TCCGAGCCCAGCGAGGTGTTG	0.647																																						dbGAP											0													79.0	75.0	76.0					2																	73316121		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.754C>T	2.37:g.73316121G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94939|Q9P0M1	Silent	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L252	ENST00000258098.6	37	c.754	CCDS1923.1	2																																																																																			RAB11FIP5	-	NULL	ENSG00000135631		0.647	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	HGNC	protein_coding	OTTHUMT00000251995.1	49	0.00	0	G	NM_015470		73316121	73316121	-1	no_errors	ENST00000258098	ensembl	human	known	69_37n	silent	17	48.48	16	SNP	0.967	A
SDE2	163859	genome.wustl.edu	37	1	226173176	226173176	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr1:226173176C>G	ENST00000272091.7	-	7	1201	c.1183G>C	c.(1183-1185)Gaa>Caa	p.E395Q		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	395																	AACTCCAGTTCTGCAACAGAG	0.438																																						dbGAP											0													88.0	84.0	85.0					1																	226173176		1898	4112	6010	-	-	-	SO:0001583	missense	0			BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.1183G>C	1.37:g.226173176C>G	ENSP00000272091:p.Glu395Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	superfamily_Mopterin_synth/thiamin_S_b	p.E395Q	ENST00000272091.7	37	c.1183	CCDS41473.1	1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.194819	0.58017	.	.	ENSG00000143751	ENST00000272091;ENST00000366818;ENST00000366817	T;T	0.56275	0.51;0.47	5.53	4.61	0.57282	.	0.149585	0.64402	N	0.000013	T	0.61261	0.2333	M	0.73372	2.23	0.47094	D	0.99931	P	0.38535	0.635	P	0.44811	0.461	T	0.65236	-0.6217	10	0.54805	T	0.06	-7.8058	16.5071	0.84274	0.0:0.8692:0.1308:0.0	.	395	Q6IQ49	CA055_HUMAN	Q	395;383;300	ENSP00000272091:E395Q;ENSP00000355782:E300Q	ENSP00000272091:E395Q	E	-	1	0	C1orf55	224239799	1.000000	0.71417	0.022000	0.16811	0.672000	0.39443	4.885000	0.63142	1.326000	0.45319	0.591000	0.81541	GAA	SDE2	-	NULL	ENSG00000143751		0.438	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDE2	HGNC	protein_coding	OTTHUMT00000091310.1	193	0.00	0	C	NM_152608		226173176	226173176	-1	no_errors	ENST00000272091	ensembl	human	known	69_37n	missense	414	11.70	55	SNP	0.977	G
SHD	56961	genome.wustl.edu	37	19	4283129	4283129	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr19:4283129C>T	ENST00000543264.2	+	3	1945	c.482C>T	c.(481-483)tCt>tTt	p.S161F	SHD_ENST00000599689.1_Missense_Mutation_p.S161F	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	161										breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACCCCCTTCTGGGCAGAAG	0.587																																						dbGAP											0													46.0	49.0	48.0					19																	4283129		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.482C>T	19.37:g.4283129C>T	ENSP00000446058:p.Ser161Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96NC2	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.S161F	ENST00000543264.2	37	c.482	CCDS12125.1	19	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823822	0.50739	.	.	ENSG00000105251	ENST00000543264;ENST00000221852	T	0.33438	1.41	4.46	-0.51	0.11973	.	1.330100	0.04653	N	0.407455	T	0.34077	0.0885	L	0.50333	1.59	0.09310	N	1	B;P	0.36990	0.203;0.577	B;P	0.46510	0.122;0.519	T	0.35375	-0.9791	10	0.56958	D	0.05	-16.2667	1.3974	0.02264	0.1729:0.4565:0.1686:0.202	.	75;161	Q9NPN8;Q96IW2	.;SHD_HUMAN	F	161;76	ENSP00000446058:S161F	ENSP00000221852:S76F	S	+	2	0	SHD	4234129	0.007000	0.16637	0.000000	0.03702	0.611000	0.37282	0.220000	0.17660	0.109000	0.17891	0.448000	0.29417	TCT	SHD	-	NULL	ENSG00000105251		0.587	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SHD	HGNC	protein_coding	OTTHUMT00000458082.1	35	0.00	0	C	NM_020209		4283129	4283129	+1	no_errors	ENST00000543264	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	0.001	T
SLC9C1	285335	genome.wustl.edu	37	3	111988846	111988846	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr3:111988846T>G	ENST00000305815.5	-	7	944	c.692A>C	c.(691-693)cAa>cCa	p.Q231P	SLC9C1_ENST00000487372.1_Missense_Mutation_p.Q231P	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	231					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										CATCCAAAATTGAATCAGTTT	0.333																																						dbGAP											0													67.0	73.0	71.0					3																	111988846		2203	4294	6497	-	-	-	SO:0001583	missense	0			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.692A>C	3.37:g.111988846T>G	ENSP00000306627:p.Gln231Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.Q231P	ENST00000305815.5	37	c.692	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	T	14.00	2.403991	0.42613	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.06449	3.3;3.3	5.9	4.68	0.58851	Cation/H+ exchanger (1);	0.443136	0.21647	N	0.071254	T	0.14657	0.0354	L	0.50333	1.59	0.09310	N	1	D;D	0.71674	0.998;0.996	D;P	0.67725	0.953;0.834	T	0.11966	-1.0566	10	0.24483	T	0.36	-13.177	8.6596	0.34084	0.1697:0.0:0.0:0.8303	.	231;231	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	P	231	ENSP00000306627:Q231P;ENSP00000420688:Q231P	ENSP00000306627:Q231P	Q	-	2	0	SLC9A10	113471536	0.072000	0.21174	0.237000	0.24090	0.320000	0.28249	1.398000	0.34554	2.258000	0.74832	0.413000	0.27773	CAA	SLC9C1	-	pfam_Cation/H_exchanger	ENSG00000172139		0.333	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1	214	0.00	0	T	NM_183061		111988846	111988846	-1	no_errors	ENST00000305815	ensembl	human	known	69_37n	missense	154	37.50	93	SNP	0.087	G
TCF20	6942	genome.wustl.edu	37	22	42609296	42609298	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	GTT	GTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr22:42609296_42609298delGTT	ENST00000359486.3	-	1	2150_2152	c.2014_2016delAAC	c.(2014-2016)aacdel	p.N672del	TCF20_ENST00000335626.4_In_Frame_Del_p.N672del	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	672					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TATGGTTGGAGTTGTTATCGCCA	0.537																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.2014_2016delAAC	22.37:g.42609299_42609301delGTT	ENSP00000352463:p.Asn672del	Somatic		WXS	Illumina GAIIx	Phase_IV	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	In_Frame_Del	DEL	smart_Znf_PHD	p.N672in_frame_del	ENST00000359486.3	37	c.2016_2014	CCDS14033.1	22																																																																																			TCF20	-	NULL	ENSG00000100207		0.537	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	341	0.00	0	GTT	NM_181492		42609296	42609298	-1	no_errors	ENST00000359486	ensembl	human	known	69_37n	in_frame_del	285	16.42	56	DEL	0.563:0.551:0.499	-
TOX4	9878	genome.wustl.edu	37	14	21961324	21961324	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr14:21961324G>T	ENST00000405508.1	+	8	1825	c.1549G>T	c.(1549-1551)Gag>Tag	p.E517*	TOX4_ENST00000262709.3_Nonsense_Mutation_p.E517*|TOX4_ENST00000448790.2_Nonsense_Mutation_p.E494*			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	517	Gln/Pro-rich.					chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.E517Q(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		AAGTAGTCCTGAGCGGCCTAT	0.507																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											75.0	72.0	73.0					14																	21961324		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1549G>T	14.37:g.21961324G>T	ENSP00000385102:p.Glu517*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPY8|B4DSM0|E7EV69	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E517*	ENST00000405508.1	37	c.1549	CCDS32043.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.652040	0.96714	.	.	ENSG00000092203	ENST00000405508;ENST00000262709;ENST00000448790;ENST00000545559	.	.	.	5.07	5.07	0.68467	.	0.478604	0.22087	N	0.064802	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.7451	0.88418	0.0:0.0:1.0:0.0	.	.	.	.	X	517;517;494;445	.	ENSP00000262709:E517X	E	+	1	0	TOX4	21031164	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.643000	0.61390	2.800000	0.96347	0.455000	0.32223	GAG	TOX4	-	NULL	ENSG00000092203		0.507	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX4	HGNC	protein_coding	OTTHUMT00000317287.2	131	0.00	0	G	NM_014828		21961324	21961324	+1	no_errors	ENST00000262709	ensembl	human	known	69_37n	nonsense	103	41.48	73	SNP	1.000	T
TRIM49C	642612	genome.wustl.edu	37	11	89774388	89774388	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr11:89774388G>T	ENST00000448984.1	+	8	1358	c.1029G>T	c.(1027-1029)tgG>tgT	p.W343C	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	343	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						AATATTACTGGGAGGTCCATG	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.1029G>T	11.37:g.89774388G>T	ENSP00000388299:p.Trp343Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.W343C	ENST00000448984.1	37	c.1029	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	G	11.05	1.526038	0.27299	.	.	ENSG00000204449	ENST00000448984	D	0.86432	-2.12	0.823	0.823	0.18812	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.94145	0.8122	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91451	0.5181	8	.	.	.	.	4.9575	0.14050	0.0:0.0:1.0:0.0	.	343	P0CI26	T49L2_HUMAN	C	343	ENSP00000388299:W343C	.	W	+	3	0	TRIM49L2	89414036	1.000000	0.71417	0.122000	0.21767	0.071000	0.16799	2.431000	0.44775	0.742000	0.32697	0.305000	0.20034	TGG	TRIM49C	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000204449		0.448	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	318	0.00	0	G	NM_001195234		89774388	89774388	+1	no_errors	ENST00000448984	ensembl	human	known	69_37n	missense	190	38.51	119	SNP	0.984	T
VILL	50853	genome.wustl.edu	37	3	38039624	38039625	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr3:38039624_38039625insC	ENST00000283713.6	+	8	1074_1075	c.808_809insC	c.(808-810)accfs	p.T270fs	VILL_ENST00000465644.1_Intron|VILL_ENST00000383759.2_Frame_Shift_Ins_p.T270fs			O15195	VILL_HUMAN	villin-like	270					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GGAGTTGGCGACCCCCCCACTG	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.815dupC	3.37:g.38039631_38039631dupC	ENSP00000283713:p.Thr270fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZP1|Q9BT80|Q9BWH7	Frame_Shift_Ins	INS	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.L273fs	ENST00000283713.6	37	c.808_809	CCDS2670.2	3																																																																																			VILL	-	pfam_Gelsolin_dom,smart_Gelsolin	ENSG00000136059		0.644	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VILL	HGNC	protein_coding	OTTHUMT00000253360.3	9	0.00	0	-	NM_015873		38039624	38039625	+1	no_errors	ENST00000283713	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.589:0.638	C
ZNF639	51193	genome.wustl.edu	37	3	179051631	179051631	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08T-01A-21W-A019-09	TCGA-A8-A08T-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	af5f43d9-5ff3-4fd8-9c1c-30a88d2bab8e	84831f09-08af-4e3c-93a5-49b058ab40d5	g.chr3:179051631G>T	ENST00000326361.3	+	7	1324	c.879G>T	c.(877-879)caG>caT	p.Q293H	ZNF639_ENST00000496856.1_Missense_Mutation_p.Q293H|ZNF639_ENST00000484866.1_Missense_Mutation_p.Q293H	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	293					negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GGTGTGAACAGTGTGATGTAC	0.403																																						dbGAP											0													149.0	137.0	141.0					3																	179051631		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.879G>T	3.37:g.179051631G>T	ENSP00000325634:p.Gln293His	Somatic		WXS	Illumina GAIIx	Phase_IV	A9X3Z9|D3DNR3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q293H	ENST00000326361.3	37	c.879	CCDS3227.1	3	.	.	.	.	.	.	.	.	.	.	G	13.46	2.243460	0.39697	.	.	ENSG00000121864	ENST00000496856;ENST00000326361;ENST00000484866	T;T;T	0.15487	2.42;2.42;2.42	5.78	4.91	0.64330	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.26412	0.0645	N	0.25380	0.74	0.34654	D	0.721963	D	0.67145	0.996	D	0.79108	0.992	T	0.37549	-0.9701	10	0.87932	D	0	.	9.5031	0.39031	0.2117:0.0:0.7883:0.0	.	293	Q9UID6	ZN639_HUMAN	H	293	ENSP00000417740:Q293H;ENSP00000325634:Q293H;ENSP00000418766:Q293H	ENSP00000325634:Q293H	Q	+	3	2	ZNF639	180534325	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	2.379000	0.44318	1.590000	0.49995	0.655000	0.94253	CAG	ZNF639	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000121864		0.403	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF639	HGNC	protein_coding	OTTHUMT00000348855.1	125	0.00	0	G	NM_016331		179051631	179051631	+1	no_errors	ENST00000326361	ensembl	human	known	69_37n	missense	94	35.17	51	SNP	1.000	T
