#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM15	8751	genome.wustl.edu	37	1	155029769	155029769	+	Silent	SNP	C	C	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:155029769C>A	ENST00000356955.2	+	12	1355	c.1254C>A	c.(1252-1254)ccC>ccA	p.P418P	ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000449910.2_Silent_p.P418P|ADAM15_ENST00000447332.3_Silent_p.P402P|ADAM15_ENST00000368413.1_Silent_p.P124P|ADAM15_ENST00000368412.3_Silent_p.P418P|ADAM15_ENST00000531455.1_Silent_p.P428P|ADAM15_ENST00000355956.2_Silent_p.P418P|ADAM15_ENST00000359280.4_Silent_p.P418P|ADAM15_ENST00000271836.6_Silent_p.P418P|ADAM15_ENST00000360674.4_Silent_p.P418P|ADAM15_ENST00000368410.2_Silent_p.P124P	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	418					angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CTAGCCTACCCCCTATGGCTG	0.602																																						dbGAP											0													52.0	58.0	56.0					1																	155029769		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1254C>A	1.37:g.155029769C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.P418	ENST00000356955.2	37	c.1254	CCDS1087.1	1																																																																																			ADAM15	-	NULL	ENSG00000143537		0.602	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM15	HGNC	protein_coding	OTTHUMT00000387168.1	125	0.00	0	C	NM_003815		155029769	155029769	+1	no_errors	ENST00000356955	ensembl	human	known	69_37n	silent	37	21.28	10	SNP	0.000	A
AKAP9	10142	genome.wustl.edu	37	7	91632416	91632416	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr7:91632416G>A	ENST00000359028.2	+	9	3446	c.3221G>A	c.(3220-3222)gGa>gAa	p.G1074E	AKAP9_ENST00000356239.3_Missense_Mutation_p.G1062E|AKAP9_ENST00000358100.2_Missense_Mutation_p.G1074E			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1074					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATGACTGTTGGAGAAGAAAGT	0.328			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													59.0	61.0	60.0					7																	91632416		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3221G>A	7.37:g.91632416G>A	ENSP00000351922:p.Gly1074Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.G1074E	ENST00000359028.2	37	c.3221		7	.	.	.	.	.	.	.	.	.	.	G	2.763	-0.257504	0.05791	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.02606	4.23;4.23;4.23	4.83	-1.42	0.08913	.	1.540910	0.04713	N	0.418035	T	0.01905	0.0060	N	0.15975	0.35	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.06405	0.001;0.001;0.001;0.002	T	0.47886	-0.9082	10	0.15952	T	0.53	.	5.0347	0.14428	0.4596:0.0:0.3151:0.2253	.	1074;1062;1062;1074	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	E	1062;1074;1074;1074;1074	ENSP00000348573:G1062E;ENSP00000351922:G1074E;ENSP00000350813:G1074E	ENSP00000348573:G1062E	G	+	2	0	AKAP9	91470352	0.000000	0.05858	0.026000	0.17262	0.393000	0.30537	-0.438000	0.06905	-0.161000	0.10983	0.650000	0.86243	GGA	AKAP9	-	NULL	ENSG00000127914		0.328	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		162	0.00	0	G	NM_005751		91632416	91632416	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	129	33.16	64	SNP	0.002	A
ARNT	405	genome.wustl.edu	37	1	150801630	150801630	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:150801630A>G	ENST00000358595.5	-	12	1306	c.1106T>C	c.(1105-1107)aTt>aCt	p.I369T	ARNT_ENST00000515192.1_Missense_Mutation_p.I355T|ARNT_ENST00000354396.2_Missense_Mutation_p.I369T|ARNT_ENST00000468970.1_5'Flank|ARNT_ENST00000505755.1_Missense_Mutation_p.I354T	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	369	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			GATACCCTCAATGTTGTGTCG	0.463			T	ETV6	AML																																	dbGAP		Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	0													157.0	141.0	146.0					1																	150801630		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.1106T>C	1.37:g.150801630A>G	ENSP00000351407:p.Ile369Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd,prints_Nuc_translocat,tigrfam_PAS	p.I369T	ENST00000358595.5	37	c.1106	CCDS970.1	1	.	.	.	.	.	.	.	.	.	.	A	8.713	0.912404	0.17907	.	.	ENSG00000143437	ENST00000358595;ENST00000368975;ENST00000354396;ENST00000515192;ENST00000394700;ENST00000505755	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.03	1.32	0.21799	PAS (3);	0.619793	0.17788	N	0.161986	T	0.01835	0.0058	N	0.04275	-0.24	0.24642	N	0.993568	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.001;0.0;0.0;0.001;0.001;0.001;0.0	T	0.47749	-0.9093	10	0.23302	T	0.38	.	6.8206	0.23855	0.5357:0.0:0.4643:0.0	.	353;369;354;369;355;354;369	B4E3L5;A6NGV6;A8K6P0;F8WAP6;P27540-3;P27540-2;P27540	.;.;.;.;.;.;ARNT_HUMAN	T	369;369;369;355;353;354	ENSP00000351407:I369T;ENSP00000346372:I369T;ENSP00000423851:I355T;ENSP00000427571:I354T	ENSP00000346372:I369T	I	-	2	0	ARNT	149068254	0.997000	0.39634	0.999000	0.59377	0.952000	0.60782	2.649000	0.46656	0.277000	0.22141	0.529000	0.55759	ATT	ARNT	-	pfam_PAS_fold,smart_PAS,pfscan_PAS,prints_Nuc_translocat,tigrfam_PAS	ENSG00000143437		0.463	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARNT	HGNC	protein_coding	OTTHUMT00000084741.2	145	0.00	0	A			150801630	150801630	-1	no_errors	ENST00000358595	ensembl	human	known	69_37n	missense	166	21.33	45	SNP	0.998	G
ANGEL2	90806	genome.wustl.edu	37	1	213168400	213168400	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:213168400A>C	ENST00000366962.3	-	9	1772	c.1618T>G	c.(1618-1620)Ttc>Gtc	p.F540V	ANGEL2_ENST00000473303.1_5'UTR|ANGEL2_ENST00000535388.1_3'UTR|ANGEL2_ENST00000544555.1_Missense_Mutation_p.F371V|ANGEL2_ENST00000540642.1_Missense_Mutation_p.F414V|ANGEL2_ENST00000360506.2_Missense_Mutation_p.F371V	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	540										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TCAAGTCTGAACTTTGCCAAT	0.343																																						dbGAP											0													109.0	107.0	108.0					1																	213168400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.1618T>G	1.37:g.213168400A>C	ENSP00000355929:p.Phe540Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.F540V	ENST00000366962.3	37	c.1618	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.835003	0.91117	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642	D;T;T;D	0.96334	-3.98;0.35;0.35;-3.98	5.89	5.89	0.94794	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.97879	0.9303	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.984	D	0.98735	1.0714	10	0.87932	D	0	-19.7496	16.3083	0.82859	1.0:0.0:0.0:0.0	.	414;540	F5H476;Q5VTE6	.;ANGE2_HUMAN	V	540;371;371;414	ENSP00000355929:F540V;ENSP00000353696:F371V;ENSP00000443193:F371V;ENSP00000446124:F414V	ENSP00000353696:F371V	F	-	1	0	ANGEL2	211235023	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.984000	0.88150	2.250000	0.74265	0.455000	0.32223	TTC	ANGEL2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000174606		0.343	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	104	0.00	0	A	NM_144567		213168400	213168400	-1	no_errors	ENST00000366962	ensembl	human	known	69_37n	missense	123	22.64	36	SNP	1.000	C
B4GALNT1	2583	genome.wustl.edu	37	12	58023681	58023682	+	Intron	INS	-	-	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:58023681_58023682insC	ENST00000341156.4	-	6	1297				B4GALNT1_ENST00000418555.2_Intron|B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000449184.3_Intron|B4GALNT1_ENST00000552350.1_Frame_Shift_Ins_p.G322fs|B4GALNT1_ENST00000550764.1_Frame_Shift_Ins_p.G322fs	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1						carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TCTTCCTGGGGCCCCCCACAGT	0.545																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.712+252->G	12.37:g.58023687_58023687dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE26|Q8N636	Frame_Shift_Ins	INS	NULL	p.R324fs	ENST00000341156.4	37	c.966_965	CCDS8950.1	12																																																																																			B4GALNT1	-	NULL	ENSG00000135454		0.545	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	22	0.00	0	-	NM_001478		58023681	58023682	-1	no_errors	ENST00000550764	ensembl	human	putative	69_37n	frame_shift_ins	8	20.00	2	INS	0.051:0.035	C
BMP6	654	genome.wustl.edu	37	6	7845400	7845400	+	Missense_Mutation	SNP	G	G	A	rs566660170		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr6:7845400G>A	ENST00000283147.6	+	2	851	c.692G>A	c.(691-693)cGt>cAt	p.R231H		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	231					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.R231H(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					TTCTCCCCTCGTCAGCGACAC	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19565	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	large_intestine(1)											129.0	126.0	127.0					6																	7845400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.692G>A	6.37:g.7845400G>A	ENSP00000283147:p.Arg231His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCP3	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.R231H	ENST00000283147.6	37	c.692	CCDS4503.1	6	.	.	.	.	.	.	.	.	.	.	G	13.30	2.197499	0.38806	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.66099	-0.19	5.41	2.67	0.31697	Transforming growth factor-beta, N-terminal (1);	0.253249	0.42294	N	0.000739	T	0.17662	0.0424	N	0.12961	0.28	0.25820	N	0.984296	B	0.13145	0.007	B	0.13407	0.009	T	0.15065	-1.0450	10	0.27082	T	0.32	.	4.5659	0.12186	0.3124:0.0:0.5362:0.1514	.	231	P22004	BMP6_HUMAN	H	153;231;194	ENSP00000283147:R231H	ENSP00000283147:R231H	R	+	2	0	BMP6	7790399	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.586000	0.46119	0.659000	0.30945	0.557000	0.71058	CGT	BMP6	-	pfam_TGF-b_N	ENSG00000153162		0.468	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP6	HGNC	protein_coding	OTTHUMT00000039794.1	145	0.00	0	G	NM_001718		7845400	7845400	+1	no_errors	ENST00000283147	ensembl	human	known	69_37n	missense	207	16.19	40	SNP	0.992	A
CCNB1	891	genome.wustl.edu	37	5	68467280	68467283	+	Splice_Site	DEL	GTAA	GTAA	-			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	GTAA	GTAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr5:68467280_68467283delGTAA	ENST00000256442.5	+	4	799		c.e4+1			NM_031966.3	NP_114172.1	P14635	CCNB1_HUMAN	cyclin B1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to iron(III) ion (GO:0071283)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle checkpoint (GO:0071174)|mitotic spindle stabilization (GO:0043148)|negative regulation of gene expression (GO:0010629)|negative regulation of protein phosphorylation (GO:0001933)|oocyte maturation (GO:0001556)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of chromosome condensation (GO:0060623)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to DDT (GO:0046680)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|spermatogenesis (GO:0007283)|tissue regeneration (GO:0042246)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase activity (GO:0016301)|patched binding (GO:0005113)|protein kinase binding (GO:0019901)			large_intestine(2)|lung(5)|skin(1)	8		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		ACAACTTGAGGTAAGTATTATCAT	0.328																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			U22364	CCDS3997.1	5q12	2008-07-18			ENSG00000134057	ENSG00000134057			1579	protein-coding gene	gene with protein product	"""G2/mitotic-specific cyclin B1"""	123836		CCNB		1386342	Standard	NM_031966		Approved		uc003jvm.3	P14635	OTTHUMG00000097817	ENST00000256442.5:c.546+1GTAA>-	5.37:g.68467280_68467283delGTAA		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K066|Q5TZP9	Splice_Site	DEL	-	e4+1	ENST00000256442.5	37	c.546+1_546+1	CCDS3997.1	5																																																																																			CCNB1	-	-	ENSG00000134057		0.328	CCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB1	HGNC	protein_coding	OTTHUMT00000215084.1	109	0.00	0	GTAA	NM_031966	Intron	68467280	68467283	+1	no_errors	ENST00000256442	ensembl	human	known	69_37n	splice_site_del	112	16.30	22	DEL	1.000:1.000:0.985:0.992	-
CD69	969	genome.wustl.edu	37	12	9907797	9907797	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:9907797G>C	ENST00000228434.3	-	3	328	c.248C>G	c.(247-249)tCt>tGt	p.S83C	CD69_ENST00000536709.1_Missense_Mutation_p.S83C	NM_001781.2	NP_001772.1	Q07108	CD69_HUMAN	CD69 molecule	83					cellular response to drug (GO:0035690)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10						AGAGCATGAAGAAACATGGCT	0.418																																						dbGAP											0													121.0	129.0	126.0					12																	9907797		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z22576	CCDS8604.1	12p13	2011-08-30	2006-03-28		ENSG00000110848	ENSG00000110848		"""C-type lectin domain containing"", ""CD molecules"""	1694	protein-coding gene	gene with protein product		107273	"""CD69 antigen (p60, early T-cell activation antigen)"""			1612643	Standard	NM_001781		Approved	CLEC2C	uc001qwk.3	Q07108	OTTHUMG00000168481	ENST00000228434.3:c.248C>G	12.37:g.9907797G>C	ENSP00000228434:p.Ser83Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S83C	ENST00000228434.3	37	c.248	CCDS8604.1	12	.	.	.	.	.	.	.	.	.	.	G	10.95	1.497028	0.26861	.	.	ENSG00000110848	ENST00000228434;ENST00000536709	T;T	0.64260	-0.09;-0.09	5.22	4.33	0.51752	C-type lectin-like (1);	0.509447	0.19347	N	0.116482	T	0.71854	0.3389	M	0.63843	1.955	0.09310	N	1	D;D	0.76494	0.999;0.993	D;P	0.64042	0.921;0.626	T	0.62263	-0.6891	9	.	.	.	-6.1223	9.6216	0.39725	0.0937:0.0:0.9063:0.0	.	83;83	B4E0H7;Q07108	.;CD69_HUMAN	C	83	ENSP00000228434:S83C;ENSP00000442597:S83C	.	S	-	2	0	CD69	9799064	0.025000	0.19082	0.016000	0.15963	0.037000	0.13140	1.206000	0.32321	1.442000	0.47568	0.591000	0.81541	TCT	CD69	-	pfam_Herpes_UL45-like	ENSG00000110848		0.418	CD69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD69	HGNC	protein_coding	OTTHUMT00000399876.1	187	0.00	0	G			9907797	9907797	-1	no_errors	ENST00000228434	ensembl	human	known	69_37n	missense	35	81.87	158	SNP	0.091	C
CDK16	5127	genome.wustl.edu	37	X	47086098	47086098	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chrX:47086098A>C	ENST00000357227.4	+	10	1457	c.1033A>C	c.(1033-1035)Atg>Ctg	p.M345L	CDK16_ENST00000518022.1_Missense_Mutation_p.M345L|CDK16_ENST00000276052.6_Missense_Mutation_p.M419L|CDK16_ENST00000457458.2_Missense_Mutation_p.M351L	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	345	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						TCAGATTGACATGTGGTAAGG	0.557																																						dbGAP											0													79.0	64.0	69.0					X																	47086098		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.1033A>C	X.37:g.47086098A>C	ENSP00000349762:p.Met345Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K280|B7Z7C8|J3KN74|J3KQP7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.M419L	ENST00000357227.4	37	c.1255	CCDS14276.1	X	.	.	.	.	.	.	.	.	.	.	A	22.3	4.271624	0.80469	.	.	ENSG00000102225	ENST00000457458;ENST00000357227;ENST00000540877;ENST00000540311;ENST00000517426;ENST00000518022;ENST00000276052;ENST00000523344	T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	5.48	5.48	0.80851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65249	0.2673	N	0.17278	0.47	0.80722	D	1	D;P;D	0.61697	0.99;0.639;0.98	D;B;D	0.71870	0.975;0.392;0.925	T	0.70737	-0.4790	10	0.72032	D	0.01	-17.475	13.5688	0.61834	1.0:0.0:0.0:0.0	.	419;443;345	B7Z7C8;B7Z8T0;Q00536	.;.;CDK16_HUMAN	L	351;345;443;297;345;345;419;102	ENSP00000405798:M351L;ENSP00000349762:M345L;ENSP00000429985:M345L;ENSP00000429751:M345L;ENSP00000276052:M419L;ENSP00000428349:M102L	ENSP00000276052:M419L	M	+	1	0	CDK16	46971042	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.229000	0.95273	1.847000	0.53656	0.430000	0.28490	ATG	CDK16	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000102225		0.557	CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK16	HGNC	protein_coding	OTTHUMT00000056406.2	101	0.00	0	A	NM_006201		47086098	47086098	+1	no_errors	ENST00000276052	ensembl	human	known	69_37n	missense	20	55.56	25	SNP	1.000	C
CDKN1B	1027	genome.wustl.edu	37	12	12871175	12871175	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:12871175delG	ENST00000228872.4	+	1	1118	c.402delG	c.(400-402)aagfs	p.K134fs	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Frame_Shift_Del_p.K134fs	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	134					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)			breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		TGGACCCAAAGACTGATCCGT	0.602																																						dbGAP											0													34.0	35.0	35.0					12																	12871175		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.402delG	12.37:g.12871175delG	ENSP00000228872:p.Lys134fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16307|Q5U0H2|Q9BUS6	Frame_Shift_Del	DEL	pfam_CDI	p.T135fs	ENST00000228872.4	37	c.402	CCDS8653.1	12																																																																																			CDKN1B	-	NULL	ENSG00000111276		0.602	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1B	HGNC	protein_coding	OTTHUMT00000313878.2	34	0.00	0	G	NM_004064		12871175	12871175	+1	no_errors	ENST00000228872	ensembl	human	known	69_37n	frame_shift_del	4	61.54	8	DEL	1.000	-
CNTNAP4	85445	genome.wustl.edu	37	16	76572193	76572193	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr16:76572193G>A	ENST00000476707.1	+	18	3324	c.3185G>A	c.(3184-3186)aGc>aAc	p.S1062N	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S1010N|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S1058N|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S986N			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1059	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CTTTTTGTGAGCTCCTTTTAC	0.373																																						dbGAP											0													113.0	108.0	110.0					16																	76572193		1833	4104	5937	-	-	-	SO:0001583	missense	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3185G>A	16.37:g.76572193G>A	ENSP00000417628:p.Ser1062Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S1058N	ENST00000476707.1	37	c.3173		16	.	.	.	.	.	.	.	.	.	.	G	8.532	0.871300	0.17322	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.35	3.36	0.38483	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.134638	0.34200	N	0.004166	T	0.34019	0.0883	.	.	.	0.31634	N	0.648667	B;B;B	0.21071	0.004;0.008;0.051	B;B;B	0.28991	0.029;0.029;0.097	T	0.33471	-0.9867	9	0.25751	T	0.34	.	8.3769	0.32449	0.1401:0.1289:0.731:0.0	.	986;1062;1059	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	N	1058;1010;986;1062	ENSP00000306893:S1058N;ENSP00000439733:S1010N;ENSP00000418741:S986N;ENSP00000417628:S1062N	ENSP00000306893:S1058N	S	+	2	0	CNTNAP4	75129694	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	1.753000	0.38359	0.790000	0.33803	0.655000	0.94253	AGC	CNTNAP4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000152910		0.373	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	130	0.00	0	G	NM_033401		76572193	76572193	+1	no_errors	ENST00000307431	ensembl	human	known	69_37n	missense	26	67.90	55	SNP	1.000	A
CSNK1A1P1	161635	genome.wustl.edu	37	15	37109994	37109994	+	RNA	SNP	C	C	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:37109994C>A	ENST00000430593.3	-	0	666					NR_027320.1				casein kinase 1, alpha 1 pseudogene 1																		ATCATCTGGTCAGCTAATATA	0.378																																						dbGAP											0																																										-	-	-			0			BC028192		15q13.3	2010-09-21	2010-07-20	2010-07-20		ENSG00000223518			30446	pseudogene	pseudogene			"""casein kinase 1, alpha 1 pseudogene"""	CSNK1A1P			Standard	NR_027320		Approved		uc001zjg.4				15.37:g.37109994C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430593.3	37	NULL		15																																																																																			CSNK1A1P1	-	-	ENSG00000223518		0.378	CSNK1A1P1-002	KNOWN	basic	processed_transcript	CSNK1A1P1	HGNC	pseudogene	OTTHUMT00000419759.1	76	0.00	0	C	NR_027320		37109994	37109994	-1	no_errors	ENST00000430593	ensembl	human	known	69_37n	rna	34	35.85	19	SNP	1.000	A
RTP5	285093	genome.wustl.edu	37	2	242814374	242814375	+	Frame_Shift_Ins	INS	-	-	C	rs35989328		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr2:242814374_242814375insC	ENST00000343216.3	+	2	695_696	c.667_668insC	c.(667-669)gccfs	p.A223fs		NM_173821.2	NP_776182.2																					TGAGGGCCCTGCCCCCCCTGCG	0.658																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														ENST00000343216.3:c.674dupC	2.37:g.242814381_242814381dupC	ENSP00000345374:p.Ala223fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	NULL	p.A226fs	ENST00000343216.3	37	c.667_668	CCDS42843.1	2																																																																																			CXXC11	-	NULL	ENSG00000188011		0.658	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC11	HGNC	protein_coding	OTTHUMT00000322310.1	19	0.00	0	-			242814374	242814375	+1	no_errors	ENST00000343216	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.000:0.000	C
CYBB	1536	genome.wustl.edu	37	X	37665784	37665784	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chrX:37665784C>T	ENST00000378588.4	+	11	1526	c.1459C>T	c.(1459-1461)Cag>Tag	p.Q487*	CYBB_ENST00000545017.1_Nonsense_Mutation_p.Q455*|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000536160.1_Nonsense_Mutation_p.Q220*	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	487					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	GGATGAGTCTCAGGTAAGGAC	0.493																																						dbGAP											0													68.0	51.0	57.0					X																	37665784		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.1459C>T	X.37:g.37665784C>T	ENSP00000367851:p.Gln487*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K138|Q2PP16	Nonsense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.Q487*	ENST00000378588.4	37	c.1459	CCDS14242.1	X	.	.	.	.	.	.	.	.	.	.	C	39	7.642501	0.98406	.	.	ENSG00000165168	ENST00000378588;ENST00000545017;ENST00000536160	.	.	.	5.61	5.61	0.85477	.	0.169852	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	16.7521	0.85488	0.0:1.0:0.0:0.0	.	.	.	.	X	487;455;220	.	ENSP00000367851:Q487X	Q	+	1	0	CYBB	37550728	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	2.848000	0.48278	2.332000	0.79248	0.544000	0.68410	CAG	CYBB	-	pfam_Fe_red_NAD-bd_6	ENSG00000165168		0.493	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	HGNC	protein_coding	OTTHUMT00000080881.1	111	0.00	0	C			37665784	37665784	+1	no_errors	ENST00000378588	ensembl	human	known	69_37n	nonsense	89	26.45	32	SNP	1.000	T
CYP26A1	1592	genome.wustl.edu	37	10	94836315	94836315	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr10:94836315G>C	ENST00000224356.4	+	6	1059	c.1014G>C	c.(1012-1014)aaG>aaC	p.K338N	CYP26A1_ENST00000394139.1_Missense_Mutation_p.K269N|CYP26A1_ENST00000371531.1_Missense_Mutation_p.K269N	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	338					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	TACTTTGCAAGAGCAATCAAG	0.418																																						dbGAP											0													105.0	104.0	104.0					10																	94836315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.1014G>C	10.37:g.94836315G>C	ENSP00000224356:p.Lys338Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.K338N	ENST00000224356.4	37	c.1014	CCDS7426.1	10	.	.	.	.	.	.	.	.	.	.	G	4.416	0.076865	0.08485	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.68624	-0.34;-0.34;-0.34	5.26	2.23	0.28157	.	0.523926	0.19723	N	0.107547	T	0.46833	0.1413	L	0.42487	1.325	0.26752	N	0.970174	P;B	0.38335	0.627;0.002	B;B	0.33121	0.158;0.012	T	0.24368	-1.0162	10	0.19590	T	0.45	-22.1877	3.1792	0.06578	0.4024:0.0:0.4015:0.1961	.	269;338	B3KNI4;O43174	.;CP26A_HUMAN	N	269;338;269	ENSP00000360586:K269N;ENSP00000224356:K338N;ENSP00000377695:K269N	ENSP00000224356:K338N	K	+	3	2	CYP26A1	94826305	0.945000	0.32115	1.000000	0.80357	0.998000	0.95712	0.140000	0.16056	0.803000	0.34113	0.650000	0.86243	AAG	CYP26A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000095596		0.418	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP26A1	HGNC	protein_coding	OTTHUMT00000049408.3	118	0.00	0	G			94836315	94836315	+1	no_errors	ENST00000224356	ensembl	human	known	69_37n	missense	58	41.41	41	SNP	0.996	C
DGKK	139189	genome.wustl.edu	37	X	50111995	50111995	+	RNA	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chrX:50111995G>A	ENST00000376025.2	-	0	3818							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					TCATCTTCACGATGTCTGCGG	0.423																																						dbGAP											0													142.0	116.0	124.0					X																	50111995		1909	4124	6033	-	-	-			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50111995G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.423	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	117	0.85	1	G	NM_001013742		50111995	50111995	-1	no_errors	ENST00000376025	ensembl	human	known	69_37n	rna	41	60.58	63	SNP	0.000	A
DICER1	23405	genome.wustl.edu	37	14	95560349	95560349	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr14:95560349G>A	ENST00000526495.1	-	26	5531	c.5240C>T	c.(5239-5241)tCg>tTg	p.S1747L	DICER1_ENST00000527414.1_Missense_Mutation_p.S1747L|DICER1_ENST00000343455.3_Missense_Mutation_p.S1747L|DICER1_ENST00000393063.1_Missense_Mutation_p.S1747L|DICER1_ENST00000556045.1_Missense_Mutation_p.S645L|DICER1_ENST00000527416.2_5'Flank|DICER1_ENST00000541352.1_Missense_Mutation_p.S1747L			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1747	RNase III 2. {ECO:0000255|PROSITE- ProRule:PRU00177}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)	p.S1747L(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TACAGCCAGCGATGCAAAGAT	0.507			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													dbGAP	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	1	Substitution - Missense(1)	breast(1)											124.0	120.0	121.0					14																	95560349		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5240C>T	14.37:g.95560349G>A	ENSP00000437256:p.Ser1747Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ,pfam_Dicer_dsRNA_binding_fold,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_PAZ,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_PAZ,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.S1747L	ENST00000526495.1	37	c.5240	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.161919	0.94727	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	T;T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01;-1.01	5.29	5.29	0.74685	Ribonuclease III (5);	0.000000	0.85682	D	0.000000	D	0.83649	0.5300	L	0.48260	1.515	0.80722	D	1	D;D	0.89917	0.99;1.0	P;D	0.87578	0.806;0.998	T	0.78175	-0.2306	10	0.11485	T	0.65	-11.4359	18.951	0.92641	0.0:0.0:1.0:0.0	.	645;1747	B3KRG4;Q9UPY3	.;DICER_HUMAN	L	1747;1747;1747;1747;645;1747	ENSP00000343745:S1747L;ENSP00000437256:S1747L;ENSP00000376783:S1747L;ENSP00000435681:S1747L;ENSP00000451041:S645L;ENSP00000444719:S1747L	ENSP00000343745:S1747L	S	-	2	0	DICER1	94630102	1.000000	0.71417	0.227000	0.23927	0.873000	0.50193	9.389000	0.97243	2.468000	0.83385	0.655000	0.94253	TCG	DICER1	-	pfam_RNase_III_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,pfscan_RNase_III_dom	ENSG00000100697		0.507	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1	137	0.00	0	G			95560349	95560349	-1	no_errors	ENST00000343455	ensembl	human	known	69_37n	missense	125	22.36	36	SNP	1.000	A
DMD	1756	genome.wustl.edu	37	X	32382795	32382795	+	Silent	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chrX:32382795C>T	ENST00000357033.4	-	36	5264	c.5058G>A	c.(5056-5058)caG>caA	p.Q1686Q	DMD_ENST00000378677.2_Silent_p.Q1682Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1686	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGTCCACATTCTGGTCAAAAG	0.373																																						dbGAP											0													209.0	162.0	178.0					X																	32382795		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5058G>A	X.37:g.32382795C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q1686	ENST00000357033.4	37	c.5058	CCDS14233.1	X																																																																																			DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	201	0.00	0	C	NM_004006		32382795	32382795	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	silent	168	25.55	58	SNP	1.000	T
DMXL1	1657	genome.wustl.edu	37	5	118525430	118525430	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr5:118525430A>G	ENST00000311085.8	+	29	7243	c.7163A>G	c.(7162-7164)aAa>aGa	p.K2388R	DMXL1_ENST00000539542.1_Missense_Mutation_p.K2388R	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2388										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GAAGGAGAAAAACAGAACAAA	0.388																																						dbGAP											0													81.0	83.0	82.0					5																	118525430		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.7163A>G	5.37:g.118525430A>G	ENSP00000309690:p.Lys2388Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K2388R	ENST00000311085.8	37	c.7163	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	A	14.21	2.466942	0.43839	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.10668	2.85;2.86	6.05	4.88	0.63580	.	0.218818	0.52532	D	0.000073	T	0.10380	0.0254	L	0.36672	1.1	0.36954	D	0.893014	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.09058	-1.0692	10	0.33940	T	0.23	-22.9044	13.587	0.61937	0.8704:0.1296:0.0:0.0	.	2388;2388	F5H269;Q9Y485	.;DMXL1_HUMAN	R	2388	ENSP00000309690:K2388R;ENSP00000439479:K2388R	ENSP00000309690:K2388R	K	+	2	0	DMXL1	118553329	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	4.577000	0.60922	1.090000	0.41315	0.528000	0.53228	AAA	DMXL1	-	NULL	ENSG00000172869		0.388	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	369	0.00	0	A	NM_005509		118525430	118525430	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	227	47.34	205	SNP	1.000	G
DNAH11	8701	genome.wustl.edu	37	7	21730485	21730485	+	Silent	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr7:21730485C>T	ENST00000409508.3	+	35	6058	c.6027C>T	c.(6025-6027)ctC>ctT	p.L2009L	DNAH11_ENST00000328843.6_Silent_p.L2016L	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2016	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CGGAAAATCTCAAAGCTCTTT	0.418									Kartagener syndrome																													dbGAP											0													138.0	135.0	136.0					7																	21730485		1868	4103	5971	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6027C>T	7.37:g.21730485C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L2016	ENST00000409508.3	37	c.6048		7																																																																																			DNAH11	-	smart_AAA+_ATPase	ENSG00000105877		0.418	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	327	0.00	0	C	NM_003777		21730485	21730485	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	silent	146	53.77	171	SNP	1.000	T
DZIP1L	199221	genome.wustl.edu	37	3	137822634	137822635	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr3:137822634_137822635insC	ENST00000327532.2	-	2	541_542	c.179_180insG	c.(178-180)gctfs	p.A60fs	DZIP1L_ENST00000469243.1_Frame_Shift_Ins_p.A60fs	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	60					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						AGGTGATGCCAGCAATATTCTC	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.179_180insG	3.37:g.137822634_137822635insC	ENSP00000332148:p.Ala60fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JUG5|Q96M38	Frame_Shift_Ins	INS	pfscan_Znf_C2H2	p.G61fs	ENST00000327532.2	37	c.180_179	CCDS3096.1	3																																																																																			DZIP1L	-	NULL	ENSG00000158163		0.619	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP1L	HGNC	protein_coding	OTTHUMT00000357548.1	45	0.00	0	-	NM_173543		137822634	137822635	-1	no_errors	ENST00000327532	ensembl	human	known	69_37n	frame_shift_ins	44	10.20	5	INS	0.000:0.000	C
EVI5	7813	genome.wustl.edu	37	1	93168985	93168985	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:93168985G>C	ENST00000370331.1	-	4	672	c.663C>G	c.(661-663)agC>agG	p.S221R	EVI5_ENST00000543509.1_Missense_Mutation_p.S221R|EVI5_ENST00000540033.1_Missense_Mutation_p.S221R|RNU4-59P_ENST00000364447.1_RNA	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	221	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CCTGTCCAAGGCTATCTTTTT	0.323																																						dbGAP											0													72.0	72.0	72.0					1																	93168985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.663C>G	1.37:g.93168985G>C	ENSP00000359356:p.Ser221Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S221R	ENST00000370331.1	37	c.663	CCDS30774.1	1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399503	0.62177	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509	T;T;T	0.04551	3.6;3.6;3.6	5.61	3.75	0.43078	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.08537	0.0212	L	0.48986	1.54	0.54753	D	0.999981	D;D	0.71674	0.998;0.998	D;D	0.72625	0.962;0.978	T	0.02313	-1.1178	10	0.87932	D	0	-12.4555	12.5581	0.56265	0.1355:0.0:0.8645:0.0	.	221;221	F5H4R0;O60447	.;EVI5_HUMAN	R	221	ENSP00000359356:S221R;ENSP00000440826:S221R;ENSP00000445019:S221R	ENSP00000359356:S221R	S	-	3	2	EVI5	92941573	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.752000	0.38349	0.849000	0.35215	0.650000	0.86243	AGC	EVI5	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000067208		0.323	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVI5	HGNC	protein_coding	OTTHUMT00000030047.1	144	0.00	0	G	NM_005665		93168985	93168985	-1	no_errors	ENST00000543509	ensembl	human	known	69_37n	missense	35	62.37	58	SNP	1.000	C
FAH	2184	genome.wustl.edu	37	15	80454614	80454614	+	Missense_Mutation	SNP	C	C	T	rs147946196	byFrequency	TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:80454614C>T	ENST00000407106.1	+	6	546	c.391C>T	c.(391-393)Cgg>Tgg	p.R131W	FAH_ENST00000558627.1_3'UTR|FAH_ENST00000561421.1_Missense_Mutation_p.R131W|FAH_ENST00000261755.5_Missense_Mutation_p.R131W|FAH_ENST00000539156.1_Missense_Mutation_p.R61W			P16930	FAAA_HUMAN	fumarylacetoacetate hydrolase (fumarylacetoacetase)	131					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	fumarylacetoacetase activity (GO:0004334)|metal ion binding (GO:0046872)	p.R131R(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTATTCCTCTCGGCAGCATGC	0.488									Tyrosinemia, type 1				C|||	3	0.000599042	0.0	0.0	5008	,	,		21755	0.003		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	lung(1)											168.0	152.0	157.0					15																	80454614		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Fumarylacetoacetase Deficiency, Hepatorenal Tyrosinemia, Hereditary Tyrosinemia 1, HT1	M55150	CCDS10314.1	15q25.1	2012-08-30			ENSG00000103876	ENSG00000103876	3.7.1.2		3579	protein-coding gene	gene with protein product		613871				1998338, 2336361	Standard	NM_000137		Approved		uc002bfm.2	P16930	OTTHUMG00000144187	ENST00000407106.1:c.391C>T	15.37:g.80454614C>T	ENSP00000385080:p.Arg131Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9X1|D3DW95|Q53XA7	Missense_Mutation	SNP	pfam_Fumarylacetoacetase_C,pfam_Fumarylacetoacetase_N,superfamily_Fumarylacetoacetase_C-rel,superfamily_Fumarylacetoacetase_N,tigrfam_Fumarylacetoacetase	p.R131W	ENST00000407106.1	37	c.391	CCDS10314.1	15	3|3	0.0013736263736263737|0.0013736263736263737	0|0	0.0|0.0	0|0	0.0|0.0	3|3	0.005244755244755245|0.005244755244755245	0|0	0.0|0.0	C|C	11.49|11.49	1.653557|1.653557	0.29425|0.29425	.|.	.|.	ENSG00000103876|ENSG00000103876	ENST00000407106;ENST00000261755;ENST00000539156|ENST00000537726	D;D;D|.	0.95272|.	-3.66;-3.66;-3.66|.	4.81|4.81	2.92|2.92	0.33932|0.33932	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);|.	0.198730|.	0.41823|.	N|.	0.000820|.	T|T	0.54532|0.54532	0.1864|0.1864	M|M	0.86740|0.86740	2.835|2.835	0.44918|0.44918	D|D	0.997931|0.997931	P;B|B	0.34562|0.09022	0.457;0.113|0.002	B;B|B	0.15052|0.04013	0.006;0.012|0.001	T|T	0.60037|0.60037	-0.7341|-0.7341	10|8	0.66056|0.87932	D|D	0.02|0	-15.5724|-15.5724	5.6491|5.6491	0.17606|0.17606	0.1561:0.6745:0.0:0.1693|0.1561:0.6745:0.0:0.1693	.|.	61;131|152	Q53XA7;P16930|B7Z4W2	.;FAAA_HUMAN|.	W|L	131;131;61|152	ENSP00000385080:R131W;ENSP00000261755:R131W;ENSP00000454271:R61W|.	ENSP00000261755:R131W|ENSP00000443621:S152L	R|S	+|+	1|2	2|0	FAH|FAH	78241669|78241669	0.480000|0.480000	0.25933|0.25933	0.516000|0.516000	0.27786|0.27786	0.518000|0.518000	0.34316|0.34316	1.133000|1.133000	0.31430|0.31430	0.560000|0.560000	0.29169|0.29169	0.650000|0.650000	0.86243|0.86243	CGG|TCG	FAH	-	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel,tigrfam_Fumarylacetoacetase	ENSG00000103876		0.488	FAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAH	HGNC	protein_coding	OTTHUMT00000291392.2	216	0.00	0	C			80454614	80454614	+1	no_errors	ENST00000261755	ensembl	human	known	69_37n	missense	63	36.36	36	SNP	0.801	T
FAM179A	165186	genome.wustl.edu	37	2	29259479	29259479	+	Missense_Mutation	SNP	G	G	A	rs535137926		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr2:29259479G>A	ENST00000379558.4	+	18	2842	c.2491G>A	c.(2491-2493)Gcc>Acc	p.A831T	FAM179A_ENST00000403861.2_Missense_Mutation_p.A776T|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	831										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGAGTCCTTCGCCAAGATGAT	0.498													g|||	1	0.000199681	0.0	0.0014	5008	,	,		19733	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													125.0	105.0	111.0					2																	29259479		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2491G>A	2.37:g.29259479G>A	ENSP00000368876:p.Ala831Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZUF5	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.A831T	ENST00000379558.4	37	c.2491	CCDS1769.2	2	.	.	.	.	.	.	.	.	.	.	g	6.373	0.436969	0.12104	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.14144	2.53;2.53	6.04	1.22	0.21188	Armadillo-like helical (1);Armadillo-type fold (1);	0.266535	0.32802	N	0.005625	T	0.08044	0.0201	L	0.50333	1.59	0.09310	N	1	B;B;P	0.36249	0.179;0.034;0.545	B;B;B	0.22386	0.024;0.003;0.039	T	0.34403	-0.9830	10	0.13853	T	0.58	.	6.7617	0.23544	0.1701:0.0:0.6081:0.2218	.	776;831;129	F8W8E4;Q6ZUX3;Q6ZUX3-3	.;F179A_HUMAN;.	T	831;776	ENSP00000368876:A831T;ENSP00000384699:A776T	ENSP00000368876:A831T	A	+	1	0	FAM179A	29112983	0.000000	0.05858	0.439000	0.26833	0.203000	0.24098	0.488000	0.22371	0.461000	0.27071	-0.217000	0.12591	GCC	FAM179A	-	superfamily_ARM-type_fold	ENSG00000189350		0.498	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	181	0.00	0	G	NM_199280		29259479	29259479	+1	no_errors	ENST00000379558	ensembl	human	known	69_37n	missense	62	40.38	42	SNP	0.007	A
FBN1	2200	genome.wustl.edu	37	15	48818433	48818433	+	Silent	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:48818433G>A	ENST00000316623.5	-	9	1337	c.882C>T	c.(880-882)acC>acT	p.T294T		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	294	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTCCAGGAATGGTGCTGCATT	0.393																																						dbGAP											0													87.0	83.0	84.0					15																	48818433		2197	4296	6493	-	-	-	SO:0001819	synonymous_variant	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.882C>T	15.37:g.48818433G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.T294	ENST00000316623.5	37	c.882	CCDS32232.1	15																																																																																			FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.393	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	245	0.00	0	G			48818433	48818433	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	silent	101	33.11	50	SNP	0.822	A
FBXL13	222235	genome.wustl.edu	37	7	102603988	102603988	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr7:102603988C>T	ENST00000313221.4	-	8	1142	c.716G>A	c.(715-717)aGa>aAa	p.R239K	FBXL13_ENST00000456695.1_Missense_Mutation_p.R239K|FBXL13_ENST00000471074.1_5'UTR|FBXL13_ENST00000436908.1_Missense_Mutation_p.R239K|FBXL13_ENST00000379308.3_Missense_Mutation_p.R239K|FBXL13_ENST00000379306.3_Missense_Mutation_p.R239K|FBXL13_ENST00000393772.2_Missense_Mutation_p.R239K|FBXL13_ENST00000379305.3_Missense_Mutation_p.R239K|FBXL13_ENST00000455112.2_Missense_Mutation_p.R239K	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	239										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						ACTGACAGATCTGAAAGTTTT	0.338																																						dbGAP											0													78.0	80.0	80.0					7																	102603988		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.716G>A	7.37:g.102603988C>T	ENSP00000321927:p.Arg239Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Missense_Mutation	SNP	smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.R239K	ENST00000313221.4	37	c.716	CCDS5726.1	7	.	.	.	.	.	.	.	.	.	.	C	11.88	1.771677	0.31320	.	.	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000379306;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000456695;ENST00000455112	T;T;T;T;T;T;T;T	0.51574	2.35;2.35;2.35;2.35;0.7;0.7;2.35;2.35	5.83	-6.55	0.01854	.	0.468805	0.20565	N	0.089840	T	0.29620	0.0739	L	0.36672	1.1	0.09310	N	0.999996	B;B;B;B	0.27192	0.001;0.171;0.004;0.001	B;B;B;B	0.26094	0.002;0.066;0.009;0.003	T	0.37865	-0.9687	10	0.05436	T	0.98	.	18.2966	0.90148	0.0:0.1215:0.0:0.8785	.	239;239;239;239	Q8NEE6-3;Q8NEE6-4;Q8NEE6-2;Q8NEE6	.;.;.;FXL13_HUMAN	K	239;239;239;166;239;239;239;239;239	ENSP00000377367:R239K;ENSP00000368610:R239K;ENSP00000368608:R239K;ENSP00000368607:R239K;ENSP00000388608:R239K;ENSP00000321927:R239K;ENSP00000409716:R239K;ENSP00000391550:R239K	ENSP00000321927:R239K	R	-	2	0	FBXL13	102391224	0.188000	0.23250	0.079000	0.20413	0.862000	0.49288	-0.100000	0.10990	-1.223000	0.02584	-0.355000	0.07637	AGA	FBXL13	-	NULL	ENSG00000161040		0.338	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL13	HGNC	protein_coding	OTTHUMT00000348001.1	175	0.00	0	C	NM_145032		102603988	102603988	-1	no_errors	ENST00000313221	ensembl	human	known	69_37n	missense	110	22.54	32	SNP	0.021	T
FHL1	2273	genome.wustl.edu	37	X	135291482	135291482	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chrX:135291482C>T	ENST00000345434.3	+	6	850	c.769C>T	c.(769-771)Ctc>Ttc	p.L257F	FHL1_ENST00000394153.2_Intron|FHL1_ENST00000370683.1_Intron|FHL1_ENST00000539015.1_Intron|FHL1_ENST00000394155.2_Missense_Mutation_p.L257F|FHL1_ENST00000370690.3_Intron|FHL1_ENST00000370676.3_Intron|FHL1_ENST00000543669.1_Intron|FHL1_ENST00000535737.1_Intron			Q13642	FHL1_HUMAN	four and a half LIM domains 1	257					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					ACGCTTGCCTCTCACCCTGTT	0.552											OREG0019943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													59.0	53.0	55.0					X																	135291482		1568	3582	5150	-	-	-	SO:0001583	missense	0			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.769C>T	X.37:g.135291482C>T	ENSP00000071281:p.Leu257Phe	Somatic	1617	WXS	Illumina GAIIx	Phase_IV	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.L257F	ENST00000345434.3	37	c.769	CCDS55507.1	X	.	.	.	.	.	.	.	.	.	.	c	15.19	2.759516	0.49468	.	.	ENSG00000022267	ENST00000394155;ENST00000345434	T;T	0.69175	-0.38;-0.38	3.85	3.85	0.44370	.	0.200419	0.44483	D	0.000458	T	0.56790	0.2009	N	0.08118	0	0.27561	N	0.950178	D	0.52996	0.957	P	0.55222	0.771	T	0.53989	-0.8360	10	0.66056	D	0.02	.	10.3036	0.43667	0.0:1.0:0.0:0.0	.	257	Q13642	FHL1_HUMAN	F	257	ENSP00000377710:L257F;ENSP00000071281:L257F	ENSP00000071281:L257F	L	+	1	0	FHL1	135119148	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.012000	0.49575	2.187000	0.69744	0.421000	0.28195	CTC	FHL1	-	NULL	ENSG00000022267		0.552	FHL1-002	KNOWN	basic|CCDS	protein_coding	FHL1	HGNC	protein_coding	OTTHUMT00000058461.1	115	0.00	0	C	NM_001449		135291482	135291482	+1	no_errors	ENST00000345434	ensembl	human	known	69_37n	missense	66	35.29	36	SNP	1.000	T
FNBP1	23048	genome.wustl.edu	37	9	132689621	132689621	+	Splice_Site	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr9:132689621C>T	ENST00000446176.2	-	8	829		c.e8-1		FNBP1_ENST00000420781.1_Splice_Site|FNBP1_ENST00000478129.1_5'Flank|FNBP1_ENST00000355681.3_Splice_Site	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1						endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		CTTGTATTTTCTGCAACATTA	0.383			T	MLL	AML																																	dbGAP		Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	0													239.0	238.0	238.0					9																	132689621		1849	4102	5951	-	-	-	SO:0001630	splice_region_variant	0			AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.643-1G>A	9.37:g.132689621C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Splice_Site	SNP	-	e8-1	ENST00000446176.2	37	c.643-1	CCDS48040.1	9	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808737	0.70797	.	.	ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000449089;ENST00000355681	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5634	0.95382	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FNBP1	131729442	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	7.294000	0.78760	2.868000	0.98415	0.557000	0.71058	.	FNBP1	-	-	ENSG00000187239		0.383	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP1	HGNC	protein_coding	OTTHUMT00000054630.2	200	0.00	0	C		Intron	132689621	132689621	-1	no_errors	ENST00000372416	ensembl	human	known	69_37n	splice_site	177	19.18	42	SNP	1.000	T
FRMPD2	143162	genome.wustl.edu	37	10	49383976	49383976	+	Missense_Mutation	SNP	T	T	C	rs200957845		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr10:49383976T>C	ENST00000374201.3	-	23	3204	c.2902A>G	c.(2902-2904)Att>Gtt	p.I968V	FRMPD2_ENST00000305531.3_Missense_Mutation_p.I943V|FRMPD2_ENST00000463706.1_5'UTR|FRMPD2_ENST00000474573.1_5'UTR|FRMPD2_ENST00000407470.4_Missense_Mutation_p.I936V	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	968	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTGGTGTTAATGCCACCCTGA	0.532																																						dbGAP											0													3.0	1.0	1.0					10																	49383976		81	163	244	-	-	-	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2902A>G	10.37:g.49383976T>C	ENSP00000363317:p.Ile968Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.I968V	ENST00000374201.3	37	c.2902	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.452426	0.01080	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.26810	1.71;1.71;1.71	4.81	-0.335	0.12662	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.10723	0.0262	N	0.03891	-0.335	0.09310	N	1	B;B;B	0.18863	0.006;0.031;0.016	B;B;B	0.23419	0.016;0.046;0.024	T	0.39165	-0.9627	9	0.21540	T	0.41	.	9.0019	0.36088	0.0:0.3679:0.0:0.6321	.	943;968;936	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	V	968;943;936	ENSP00000363317:I968V;ENSP00000307079:I943V;ENSP00000384339:I936V	ENSP00000307079:I943V	I	-	1	0	FRMPD2	49053982	0.623000	0.27094	0.520000	0.27837	0.722000	0.41435	0.524000	0.22940	-0.339000	0.08401	0.528000	0.53228	ATT	FRMPD2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000170324		0.532	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	25	0.00	0	T	NM_152428		49383976	49383976	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.060	C
GATAD2A	54815	genome.wustl.edu	37	19	19612063	19612063	+	Silent	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr19:19612063G>A	ENST00000360315.3	+	9	1650	c.1338G>A	c.(1336-1338)caG>caA	p.Q446Q	GATAD2A_ENST00000358713.3_Silent_p.Q446Q|GATAD2A_ENST00000429563.2_Silent_p.Q274Q|GATAD2A_ENST00000252577.5_Silent_p.Q446Q|GATAD2A_ENST00000537887.1_Silent_p.Q75Q|GATAD2A_ENST00000404158.1_Silent_p.Q447Q	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	446	CR2; histone tail-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						CAACCAACCAGAAGAAGGCGC	0.607																																						dbGAP											0													48.0	38.0	42.0					19																	19612063		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1338G>A	19.37:g.19612063G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	pfam_Znf_GATA,pfscan_Znf_GATA	p.R95K	ENST00000360315.3	37	c.284	CCDS12402.2	19	.	.	.	.	.	.	.	.	.	.	G	10.24	1.295445	0.23564	.	.	ENSG00000167491	ENST00000418032	.	.	.	5.45	3.32	0.38043	.	.	.	.	.	T	0.57961	0.2089	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52533	-0.8563	4	.	.	.	-20.9693	8.108	0.30898	0.2533:0.0:0.7467:0.0	.	.	.	.	K	73	.	.	E	+	1	0	GATAD2A	19473063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.479000	0.53165	0.776000	0.33473	0.645000	0.84053	GAA	GATAD2A	-	pfam_Znf_GATA	ENSG00000167491		0.607	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATAD2A	HGNC	protein_coding	OTTHUMT00000326671.4	13	0.00	0	G	NM_017660		19612063	19612063	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418032	ensembl	human	novel	69_37n	missense	2	66.67	4	SNP	1.000	A
GLE1	2733	genome.wustl.edu	37	9	131277847	131277847	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr9:131277847C>T	ENST00000309971.4	+	3	467	c.361C>T	c.(361-363)Cag>Tag	p.Q121*	GLE1_ENST00000372770.4_Nonsense_Mutation_p.Q121*|GLE1_ENST00000539582.1_5'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	121					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						TATGGTACTTCAGTCCTCACG	0.413																																						dbGAP											0													68.0	58.0	61.0					9																	131277847		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.361C>T	9.37:g.131277847C>T	ENSP00000308622:p.Gln121*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Nonsense_Mutation	SNP	pfam_GLE1	p.Q121*	ENST00000309971.4	37	c.361	CCDS35154.1	9	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816903	0.90790	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	.	.	.	5.29	5.29	0.74685	.	0.688144	0.13734	N	0.366480	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-8.9508	15.6597	0.77174	0.0:1.0:0.0:0.0	.	.	.	.	X	121	.	ENSP00000308622:Q121X	Q	+	1	0	GLE1	130317668	0.898000	0.30612	0.933000	0.37362	0.728000	0.41692	1.996000	0.40776	2.481000	0.83766	0.462000	0.41574	CAG	GLE1	-	NULL	ENSG00000119392		0.413	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLE1	HGNC	protein_coding	OTTHUMT00000054456.1	47	0.00	0	C	NM_001003722		131277847	131277847	+1	no_errors	ENST00000309971	ensembl	human	known	69_37n	nonsense	31	58.67	44	SNP	0.471	T
GOLGA3	2802	genome.wustl.edu	37	12	133381492	133381492	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:133381492C>A	ENST00000450791.2	-	6	1590	c.1407G>T	c.(1405-1407)gaG>gaT	p.E469D	GOLGA3_ENST00000204726.3_Missense_Mutation_p.E469D|GOLGA3_ENST00000545875.1_Missense_Mutation_p.E469D|GOLGA3_ENST00000456883.2_Missense_Mutation_p.E469D|GOLGA3_ENST00000537452.1_Missense_Mutation_p.E469D			Q08378	GOGA3_HUMAN	golgin A3	469					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGGTGTCCACCTCCGAGCTCA	0.642																																						dbGAP											0													63.0	58.0	60.0					12																	133381492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.1407G>T	12.37:g.133381492C>A	ENSP00000410378:p.Glu469Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E469D	ENST00000450791.2	37	c.1407	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866029	0.51588	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16	5.45	-1.85	0.07784	.	0.044512	0.85682	D	0.000000	T	0.66366	0.2782	L	0.29908	0.895	0.80722	D	1	P;P;D	0.54397	0.787;0.787;0.966	B;B;P	0.46275	0.443;0.326;0.51	T	0.63910	-0.6530	10	0.40728	T	0.16	.	11.8539	0.52427	0.0:0.4305:0.0:0.5695	.	469;469;469	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	D	469	ENSP00000204726:E469D;ENSP00000410378:E469D;ENSP00000409303:E469D;ENSP00000442143:E469D;ENSP00000442603:E469D	ENSP00000204726:E469D	E	-	3	2	GOLGA3	131891565	0.976000	0.34144	0.889000	0.34880	0.599000	0.36880	0.158000	0.16422	-0.264000	0.09365	0.561000	0.74099	GAG	GOLGA3	-	NULL	ENSG00000090615		0.642	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	36	0.00	0	C	NM_005895		133381492	133381492	-1	no_errors	ENST00000204726	ensembl	human	known	69_37n	missense	33	47.62	30	SNP	0.990	A
GOLGA8DP	100132979	genome.wustl.edu	37	15	22709084	22709084	+	RNA	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:22709084G>A	ENST00000314246.8	-	0	1312				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											TCCTGCTCCCGAAGCCTCTCC	0.597																																						dbGAP											0																																										-	-	-			0					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709084G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000314246.8	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	0.750	-0.773012	0.02951	.	.	ENSG00000185182	ENST00000341390;ENST00000314246;ENST00000317692	.	.	.	0.887	-1.77	0.07982	.	.	.	.	.	T	0.44138	0.1279	.	.	.	0.24573	N	0.993916	D	0.76494	0.999	P	0.53861	0.736	T	0.48115	-0.9063	6	0.46703	T	0.11	.	4.8521	0.13542	0.0:0.2201:0.558:0.2219	.	139	F8WBT8	.	W	139;139;357	.	ENSP00000327024:R139W	R	-	1	2	AC116165.1	20260448	0.300000	0.24435	0.004000	0.12327	0.017000	0.09413	0.155000	0.16362	-1.397000	0.02068	-1.565000	0.00878	CGG	GOLGA8DP	-	-	ENSG00000185182		0.597	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	HGNC	pseudogene	OTTHUMT00000415613.1	47	0.00	0	G	NR_027407		22709084	22709084	-1	no_errors	ENST00000314246	ensembl	human	known	69_37n	rna	24	31.43	11	SNP	0.891	A
HIST1H2BK	85236	genome.wustl.edu	37	6	27114440	27114440	+	Silent	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr6:27114440C>T	ENST00000356950.1	-	1	137	c.138G>A	c.(136-138)ctG>ctA	p.L46L	HIST1H2BK_ENST00000396891.4_Silent_p.L46L|HIST1H2AH_ENST00000377459.1_5'Flank|MIR3143_ENST00000584253.1_RNA			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	46					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						GGACCTGCTTCAGCACCTTGT	0.577																																						dbGAP											0													124.0	106.0	112.0					6																	27114440		2202	4280	6482	-	-	-	SO:0001819	synonymous_variant	0			AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.138G>A	6.37:g.27114440C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P7|Q2VPI7	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.L46	ENST00000356950.1	37	c.138	CCDS4621.1	6																																																																																			HIST1H2BK	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000197903		0.577	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BK	HGNC	protein_coding	OTTHUMT00000040141.1	174	0.00	0	C	NM_080593		27114440	27114440	-1	no_errors	ENST00000356950	ensembl	human	known	69_37n	silent	223	14.89	39	SNP	1.000	T
HSD17B13	345275	genome.wustl.edu	37	4	88239546	88239546	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr4:88239546C>T	ENST00000328546.4	-	2	317	c.253G>A	c.(253-255)Gtc>Atc	p.V85I	RP11-529H2.2_ENST00000508163.1_RNA|HSD17B13_ENST00000302219.6_Intron	NM_178135.3	NP_835236.2	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	85						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		TGCGCAGTGACGCCTAGTTTT	0.453																																						dbGAP											0													133.0	115.0	121.0					4																	88239546		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3618.1, CCDS47097.1	4q22.1	2011-09-20			ENSG00000170509	ENSG00000170509	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18685	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 3"""	612127				19027726	Standard	NM_178135		Approved	SCDR9, SDR16C3	uc003hqo.2	Q7Z5P4	OTTHUMG00000130602	ENST00000328546.4:c.253G>A	4.37:g.88239546C>T	ENSP00000333300:p.Val85Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9R9|Q2M1L5|Q86W22|Q86W23	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.V85I	ENST00000328546.4	37	c.253	CCDS3618.1	4	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677441	0.29783	.	.	ENSG00000170509	ENST00000328546	D	0.88046	-2.33	4.94	4.1	0.47936	NAD(P)-binding domain (1);	0.283433	0.29126	N	0.013065	D	0.82930	0.5144	L	0.42008	1.315	0.20638	N	0.999878	P	0.35192	0.489	B	0.37239	0.244	T	0.74598	-0.3612	10	0.41790	T	0.15	.	13.0244	0.58806	0.0:0.9216:0.0:0.0784	.	85	Q7Z5P4	DHB13_HUMAN	I	85	ENSP00000333300:V85I	ENSP00000333300:V85I	V	-	1	0	HSD17B13	88458570	0.215000	0.23574	0.193000	0.23327	0.061000	0.15899	1.892000	0.39748	1.297000	0.44761	0.591000	0.81541	GTC	HSD17B13	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000170509		0.453	HSD17B13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B13	HGNC	protein_coding	OTTHUMT00000253052.1	96	0.00	0	C	NM_178135		88239546	88239546	-1	no_errors	ENST00000328546	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	0.886	T
ING4	51147	genome.wustl.edu	37	12	6762144	6762144	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:6762144C>T	ENST00000396807.4	-	4	387	c.349G>A	c.(349-351)Gag>Aag	p.E117K	ING4_ENST00000341550.4_Missense_Mutation_p.E117K|ING4_ENST00000446105.2_Missense_Mutation_p.E117K|ING4_ENST00000444704.2_Missense_Mutation_p.E93K|ING4_ENST00000423703.2_Missense_Mutation_p.E117K|ING4_ENST00000486287.1_5'UTR|ING4_ENST00000412586.2_Missense_Mutation_p.E117K	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	117					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						TCACTTGACTCAATCTGTTTC	0.542																																						dbGAP											0													74.0	75.0	75.0					12																	6762144		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.349G>A	12.37:g.6762144C>T	ENSP00000380024:p.Glu117Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E117K	ENST00000396807.4	37	c.349	CCDS44813.1	12	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059861	0.55325	.	.	ENSG00000111653	ENST00000341550;ENST00000396807;ENST00000446105;ENST00000444704;ENST00000423703;ENST00000412586	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.63129	0.2485	M	0.72894	2.215	0.58432	D	0.999998	P;P;D;B;P;D	0.67145	0.894;0.893;0.996;0.321;0.599;0.993	P;B;D;B;B;D	0.76071	0.734;0.4;0.987;0.138;0.284;0.971	T	0.60156	-0.7318	10	0.27785	T	0.31	-11.9405	17.8485	0.88738	0.0:1.0:0.0:0.0	.	93;117;117;117;117;117	Q9UNL4-3;A4KYM6;Q9UNL4-4;Q9UNL4-5;Q9UNL4;Q4VBQ6	.;.;.;.;ING4_HUMAN;.	K	117;117;117;93;117;117	ENSP00000343396:E117K;ENSP00000380024:E117K;ENSP00000415903:E117K;ENSP00000397343:E93K;ENSP00000412705:E117K	ENSP00000343396:E117K	E	-	1	0	ING4	6632405	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	7.294000	0.78760	2.435000	0.82474	0.655000	0.94253	GAG	ING4	-	NULL	ENSG00000111653		0.542	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ING4	HGNC	protein_coding	OTTHUMT00000280467.2	104	0.00	0	C	NM_198287		6762144	6762144	-1	no_errors	ENST00000396807	ensembl	human	known	69_37n	missense	77	18.09	17	SNP	1.000	T
INHBA	3624	genome.wustl.edu	37	7	41729911	41729911	+	Silent	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr7:41729911G>C	ENST00000242208.4	-	3	864	c.618C>G	c.(616-618)ctC>ctG	p.L206L	INHBA_ENST00000442711.1_Silent_p.L206L|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	206					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTTTTTCAGAGAGCAACAGTT	0.597										TSP Lung(11;0.080)																												dbGAP											0													77.0	70.0	72.0					7																	41729911		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.618C>G	7.37:g.41729911G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14599	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaA,prints_Inhibin_asu	p.L206	ENST00000242208.4	37	c.618	CCDS5464.1	7																																																																																			INHBA	-	pfam_TGF-b_N	ENSG00000122641		0.597	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	HGNC	protein_coding	OTTHUMT00000250793.1	57	0.00	0	G			41729911	41729911	-1	no_errors	ENST00000242208	ensembl	human	known	69_37n	silent	44	27.87	17	SNP	0.078	C
KCNG4	93107	genome.wustl.edu	37	16	84271018	84271019	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr16:84271018_84271019delTG	ENST00000308251.4	-	2	141_142	c.73_74delCA	c.(73-75)cagfs	p.Q25fs	KCNG4_ENST00000568181.1_Frame_Shift_Del_p.Q25fs	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	25					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						GGACAGGAGCTGACTCCAAGGG	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.73_74delCA	16.37:g.84271018_84271019delTG	ENSP00000312129:p.Gln25fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H24	Frame_Shift_Del	DEL	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.Q25fs	ENST00000308251.4	37	c.74_73	CCDS10945.1	16																																																																																			KCNG4	-	NULL	ENSG00000168418		0.629	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	HGNC	protein_coding	OTTHUMT00000269079.2	45	0.00	0	TG	NM_172347		84271018	84271019	-1	no_errors	ENST00000308251	ensembl	human	known	69_37n	frame_shift_del	22	38.89	14	DEL	0.000:0.006	-
KRT86	3892	genome.wustl.edu	37	12	52699981	52699981	+	Missense_Mutation	SNP	G	G	T	rs375789021		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:52699981G>T	ENST00000423955.2	+	9	1342	c.1164G>T	c.(1162-1164)gaG>gaT	p.E388D	RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000544024.1_Missense_Mutation_p.E388D|KRT86_ENST00000293525.5_Missense_Mutation_p.E388D			O43790	KRT86_HUMAN	keratin 86	388	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGATCAGGGAGTACCAGGAGG	0.647											OREG0021845	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													74.0	73.0	73.0					12																	52699981		2203	4296	6499	-	-	-	SO:0001583	missense	0			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.1164G>T	12.37:g.52699981G>T	ENSP00000444533:p.Glu388Asp	Somatic	987	WXS	Illumina GAIIx	Phase_IV	P78387	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.E388D	ENST00000423955.2	37	c.1164	CCDS41785.1	12	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253078	0.80135	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	D;D;D	0.92805	-3.11;-3.11;-3.11	5.35	4.45	0.53987	Filament (1);	0.000000	0.42172	U	0.000741	D	0.93119	0.7809	M	0.73598	2.24	0.38091	D	0.936964	B	0.27823	0.19	B	0.42851	0.4	D	0.92680	0.6157	10	0.59425	D	0.04	.	9.9757	0.41781	0.1582:0.0:0.8418:0.0	.	388	O43790	KRT86_HUMAN	D	388	ENSP00000443169:E388D;ENSP00000444533:E388D;ENSP00000293525:E388D	ENSP00000293525:E388D	E	+	3	2	AC021066.1;KRT86	50986248	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.953000	0.40352	1.220000	0.43490	0.555000	0.69702	GAG	AC021066.1	-	pfam_F	ENSG00000170442		0.647	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT86	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000404911.1	152	0.00	0	G	NM_002284		52699981	52699981	+1	no_errors	ENST00000293525	ensembl	human	known	69_37n	missense	262	22.71	77	SNP	1.000	T
LCOR	84458	genome.wustl.edu	37	10	98714962	98714962	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr10:98714962G>C	ENST00000371097.4	+	8	1131	c.585G>C	c.(583-585)tgG>tgC	p.W195C	LCOR_ENST00000540664.1_Missense_Mutation_p.W195C|LCOR_ENST00000356016.3_Missense_Mutation_p.W195C|LCOR_ENST00000498444.1_Intron|LCOR_ENST00000371103.3_Missense_Mutation_p.W195C			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	195					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		AAGCCTCTTGGGCAAAACCAC	0.463																																						dbGAP											0													68.0	65.0	66.0					10																	98714962		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.585G>C	10.37:g.98714962G>C	ENSP00000360138:p.Trp195Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	p.W195C	ENST00000371097.4	37	c.585	CCDS7451.1	10	.	.	.	.	.	.	.	.	.	.	G	16.15	3.043076	0.55003	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.54	5.54	0.83059	.	0.155279	0.53938	D	0.000043	T	0.63189	0.2490	L	0.29908	0.895	0.80722	D	1	D;D	0.63880	0.993;0.989	P;P	0.56042	0.621;0.79	T	0.66208	-0.5981	9	0.87932	D	0	-1.2107	19.8472	0.96713	0.0:0.0:1.0:0.0	.	195;195	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	C	195	.	ENSP00000348298:W195C	W	+	3	0	LCOR	98704952	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.354000	0.79424	2.768000	0.95171	0.650000	0.86243	TGG	LCOR	-	NULL	ENSG00000196233		0.463	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	LCOR	HGNC	protein_coding	OTTHUMT00000049628.2	84	0.00	0	G			98714962	98714962	+1	no_errors	ENST00000356016	ensembl	human	known	69_37n	missense	102	20.93	27	SNP	1.000	C
LCP2	3937	genome.wustl.edu	37	5	169720329	169720329	+	Silent	SNP	A	A	G			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr5:169720329A>G	ENST00000046794.5	-	2	741	c.126T>C	c.(124-126)gaT>gaC	p.D42D		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	42	SAM.				blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		AGCGAGCCCCATCGATGTGGT	0.517																																						dbGAP											0													125.0	127.0	126.0					5																	169720329		2011	4178	6189	-	-	-	SO:0001819	synonymous_variant	0				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.126T>C	5.37:g.169720329A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA25|Q53XV4	Silent	SNP	pfam_SH2,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,smart_SH2,pfscan_SH2	p.D42	ENST00000046794.5	37	c.126	CCDS47339.1	5																																																																																			LCP2	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	ENSG00000043462		0.517	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP2	HGNC	protein_coding	OTTHUMT00000371727.1	40	0.00	0	A	NM_005565		169720329	169720329	-1	no_errors	ENST00000046794	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.018	G
LELP1	149018	genome.wustl.edu	37	1	153177188	153177188	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:153177188C>T	ENST00000368747.1	+	2	115	c.5C>T	c.(4-6)tCg>tTg	p.S2L		NM_001010857.1	NP_001010857.1	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	2										NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|pancreas(1)|prostate(1)	19	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAAACAATGTCGAGTGATGAT	0.433																																						dbGAP											0													119.0	120.0	119.0					1																	153177188		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30869.1	1q21.3	2008-02-05			ENSG00000203784	ENSG00000203784			32046	protein-coding gene	gene with protein product		611042					Standard	NM_001010857		Approved		uc001fbl.4	Q5T871	OTTHUMG00000013935	ENST00000368747.1:c.5C>T	1.37:g.153177188C>T	ENSP00000357736:p.Ser2Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4E1	Missense_Mutation	SNP	NULL	p.S2L	ENST00000368747.1	37	c.5	CCDS30869.1	1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365133	0.41902	.	.	ENSG00000203784	ENST00000368747	.	.	.	5.32	5.32	0.75619	.	0.000000	0.30911	N	0.008627	T	0.74906	0.3778	.	.	.	0.37156	D	0.902376	D	0.89917	1.0	D	0.83275	0.996	T	0.78476	-0.2189	8	0.87932	D	0	-5.6737	14.3568	0.66742	0.0:1.0:0.0:0.0	.	2	Q5T871	LELP1_HUMAN	L	2	.	ENSP00000357736:S2L	S	+	2	0	LELP1	151443812	0.987000	0.35691	0.996000	0.52242	0.358000	0.29455	3.347000	0.52200	2.769000	0.95229	0.561000	0.74099	TCG	LELP1	-	NULL	ENSG00000203784		0.433	LELP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LELP1	HGNC	protein_coding	OTTHUMT00000039104.1	308	0.00	0	C	NM_001010857		153177188	153177188	+1	no_errors	ENST00000368747	ensembl	human	known	69_37n	missense	527	11.67	70	SNP	0.999	T
LRRK1	79705	genome.wustl.edu	37	15	101566209	101566209	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:101566209C>T	ENST00000388948.3	+	17	2631	c.2272C>T	c.(2272-2274)Cac>Tac	p.H758Y	LRRK1_ENST00000284395.5_Missense_Mutation_p.H755Y	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGTCGGGACGCACCTGGATTT	0.602																																						dbGAP											0													99.0	113.0	108.0					15																	101566209		2099	4206	6305	-	-	-	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.2272C>T	15.37:g.101566209C>T	ENSP00000373600:p.His758Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.H758Y	ENST00000388948.3	37	c.2272	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957750	0.92726	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.80304	-1.36;-1.36	4.95	4.95	0.65309	ROC GTPase (1);Mitochondrial Rho-like (1);	0.114981	0.64402	D	0.000014	D	0.91442	0.7299	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93202	0.6592	10	0.87932	D	0	.	18.2273	0.89921	0.0:1.0:0.0:0.0	.	758	Q38SD2	LRRK1_HUMAN	Y	758;755	ENSP00000373600:H758Y;ENSP00000284395:H755Y	ENSP00000284395:H755Y	H	+	1	0	LRRK1	99383732	1.000000	0.71417	0.996000	0.52242	0.921000	0.55340	7.371000	0.79600	2.289000	0.77006	0.561000	0.74099	CAC	LRRK1	-	pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase	ENSG00000154237		0.602	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	77	0.00	0	C	NM_024652		101566209	101566209	+1	no_errors	ENST00000388948	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	1.000	T
MDC1	9656	genome.wustl.edu	37	6	30673675	30673675	+	Silent	SNP	G	G	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr6:30673675G>T	ENST00000376406.3	-	10	3932	c.3285C>A	c.(3283-3285)tcC>tcA	p.S1095S	MDC1_ENST00000376405.2_Silent_p.S831S|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1095	Pro-rich.			Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CCAGCTCTGAGGACAAGGGAG	0.552								Other conserved DNA damage response genes																														dbGAP											0													164.0	177.0	173.0					6																	30673675		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.3285C>A	6.37:g.30673675G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	NULL	p.L156I	ENST00000376406.3	37	c.466	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	G	11.82	1.754181	0.31046	.	.	ENSG00000137337	ENST00000417033	.	.	.	4.23	2.42	0.29668	.	.	.	.	.	T	0.40222	0.1108	.	.	.	0.49130	D	0.999752	.	.	.	.	.	.	T	0.26710	-1.0095	4	.	.	.	-6.5219	6.6711	0.23068	0.2219:0.0:0.7781:0.0	.	.	.	.	I	156	.	.	L	-	1	0	MDC1	30781654	0.979000	0.34478	0.971000	0.41717	0.687000	0.40016	0.523000	0.22925	0.549000	0.28973	0.478000	0.44815	CTC	MDC1	-	NULL	ENSG00000137337		0.552	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	497	0.00	0	G	NM_014641		30673675	30673675	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000417033	ensembl	human	known	69_37n	missense	653	25.60	225	SNP	0.777	T
TAF1D	79101	genome.wustl.edu	37	11	93466920	93466921	+	IGR	INS	-	-	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr11:93466920_93466921insT	ENST00000448108.2	-	0	2082				TAF1D_ENST00000546088.1_Intron|MIR1304_ENST00000408243.1_RNA|SNORA18_ENST00000384416.1_RNA|SNORD6_ENST00000365444.1_RNA|SNORA1_ENST00000384107.1_RNA|SNORA32_ENST00000384072.1_RNA|SNORA40_ENST00000388090.1_RNA|SNORD5_ENST00000459342.1_RNA|SNORA8_ENST00000384574.1_RNA	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa						gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						aaccgctgggctcaagtgtttc	0.485																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451		11.37:g.93466921_93466921dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6I9Y6	RNA	INS	-	NULL	ENST00000448108.2	37	NULL	CCDS8293.1	11																																																																																			MIR1304	-	-	ENSG00000221170		0.485	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1304	HGNC	protein_coding	OTTHUMT00000394662.2	40	0.00	0	-	NM_024116		93466920	93466921	-1	no_errors	ENST00000408243	ensembl	human	known	69_37n	rna	14	12.50	2	INS	0.011:0.009	T
MTIF2	4528	genome.wustl.edu	37	2	55463838	55463840	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr2:55463838_55463840delAAC	ENST00000263629.4	-	16	2443_2445	c.2128_2130delGTT	c.(2128-2130)gttdel	p.V710del	MTIF2_ENST00000403721.1_In_Frame_Del_p.V710del|MTIF2_ENST00000394600.3_In_Frame_Del_p.V710del	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	710					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CTTCATAACAAACAATTCTGTCT	0.33																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.2128_2130delGTT	2.37:g.55463838_55463840delAAC	ENSP00000263629:p.Val710del	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5D0	In_Frame_Del	DEL	pfam_ProtSyn_GTP-bd,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,pfam_GTP_binding_domain,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_TIF_IF2_dom3,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Small_GTP-bd_dom	p.V710in_frame_del	ENST00000263629.4	37	c.2130_2128	CCDS1853.1	2																																																																																			MTIF2	-	superfamily_Transl_elong_init/rib_B-barrel	ENSG00000085760		0.330	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	92	0.00	0	AAC	NM_002453		55463838	55463840	-1	no_errors	ENST00000263629	ensembl	human	known	69_37n	in_frame_del	62	29.55	26	DEL	0.995:0.997:0.854	-
MUC16	94025	genome.wustl.edu	37	19	9058646	9058646	+	Silent	SNP	T	T	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr19:9058646T>C	ENST00000397910.4	-	3	29003	c.28800A>G	c.(28798-28800)acA>acG	p.T9600T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9602	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGACAGTGCTTGTCTCTGTGG	0.527																																						dbGAP											0													108.0	99.0	102.0					19																	9058646		2021	4184	6205	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28800A>G	19.37:g.9058646T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T9600	ENST00000397910.4	37	c.28800	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	85	0.00	0	T	NM_024690		9058646	9058646	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	31	70.19	73	SNP	0.000	C
MUC16	94025	genome.wustl.edu	37	19	9059401	9059401	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr19:9059401T>C	ENST00000397910.4	-	3	28248	c.28045A>G	c.(28045-28047)Acc>Gcc	p.T9349A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9351	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTAGTGATGGTTTCCATGGAG	0.512																																						dbGAP											0													154.0	154.0	154.0					19																	9059401		1962	4144	6106	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28045A>G	19.37:g.9059401T>C	ENSP00000381008:p.Thr9349Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T9349A	ENST00000397910.4	37	c.28045	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	4.389	0.071884	0.08436	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	2.23	1.19	0.21007	.	.	.	.	.	T	0.01627	0.0052	N	0.19112	0.55	.	.	.	B	0.29671	0.254	B	0.25506	0.061	T	0.40365	-0.9567	8	0.87932	D	0	.	4.039	0.09743	0.0:0.1818:0.0:0.8182	.	9349	B5ME49	.	A	9349	ENSP00000381008:T9349A	ENSP00000381008:T9349A	T	-	1	0	MUC16	8920401	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.172000	0.09868	0.299000	0.22661	0.378000	0.23410	ACC	MUC16	-	NULL	ENSG00000181143		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	223	0.00	0	T	NM_024690		9059401	9059401	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	90	66.17	176	SNP	0.000	C
MYO3A	53904	genome.wustl.edu	37	10	26462851	26462851	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr10:26462851G>T	ENST00000265944.5	+	30	3824	c.3658G>T	c.(3658-3660)Gac>Tac	p.D1220Y	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1220					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GTCTGTCAAAGACCTGGAAGA	0.418																																						dbGAP											0													99.0	103.0	101.0					10																	26462851		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3658G>T	10.37:g.26462851G>T	ENSP00000265944:p.Asp1220Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.D1220Y	ENST00000265944.5	37	c.3658	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412353	0.42817	.	.	ENSG00000095777	ENST00000265944	T	0.80214	-1.35	5.18	3.23	0.37069	.	0.307172	0.39759	N	0.001261	T	0.64483	0.2602	N	0.14661	0.345	0.09310	N	0.999991	P	0.51653	0.947	P	0.44561	0.453	T	0.59236	-0.7492	10	0.59425	D	0.04	.	5.3703	0.16136	0.0779:0.279:0.5142:0.1289	.	1220	Q8NEV4	MYO3A_HUMAN	Y	1220	ENSP00000265944:D1220Y	ENSP00000265944:D1220Y	D	+	1	0	MYO3A	26502857	0.242000	0.23868	0.459000	0.27081	0.033000	0.12548	2.608000	0.46308	1.252000	0.44001	0.655000	0.94253	GAC	MYO3A	-	NULL	ENSG00000095777		0.418	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	199	0.00	0	G	NM_017433		26462851	26462851	+1	no_errors	ENST00000265944	ensembl	human	known	69_37n	missense	109	43.52	84	SNP	0.017	T
NBPF14	25832	genome.wustl.edu	37	1	148005450	148005451	+	In_Frame_Ins	INS	-	-	CTC			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:148005450_148005451insCTC	ENST00000369219.1	-	21	2490_2491	c.2474_2475insGAG	c.(2473-2475)aga>agGAGa	p.825_825R>RR				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	825	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					ttcttccccttcttctttcctt	0.426																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2474_2475insGAG	1.37:g.148005450_148005451insCTC	ENSP00000358221:p.Arg826dup	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TI23|Q8IX76|Q9UJI9	In_Frame_Ins	INS	pfam_NBPF_dom	p.827in_frame_insR	ENST00000369219.1	37	c.2475_2474		1																																																																																			NBPF14	-	NULL	ENSG00000122497		0.426	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	NBPF14	HGNC	protein_coding		29	0.00	0	-	NM_015383		148005450	148005451	-1	no_errors	ENST00000369219	ensembl	human	known	69_37n	in_frame_ins	20	13.04	3	INS	0.028:0.027	CTC
OR51A4	401666	genome.wustl.edu	37	11	4967817	4967817	+	Nonsense_Mutation	SNP	T	T	A	rs533373608		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr11:4967817T>A	ENST00000380373.2	-	1	539	c.514A>T	c.(514-516)Aag>Tag	p.K172*	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGTTTTTCTTGCAATATCTC	0.413																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.514A>T	11.37:g.4967817T>A	ENSP00000369731:p.Lys172*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K172*	ENST00000380373.2	37	c.514	CCDS31367.1	11	.	.	.	.	.	.	.	.	.	.	T	13.85	2.360283	0.41801	.	.	ENSG00000205497	ENST00000380373	.	.	.	3.44	-0.597	0.11653	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	7.3683	0.26787	0.0:0.3153:0.0:0.6847	.	.	.	.	X	172	.	ENSP00000369731:K172X	K	-	1	0	OR51A4	4924393	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-0.683000	0.05179	-0.218000	0.10018	-0.553000	0.04205	AAG	OR51A4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205497		0.413	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A4	HGNC	protein_coding	OTTHUMT00000142821.1	520	0.00	0	T	NM_001005329		4967817	4967817	-1	no_errors	ENST00000380373	ensembl	human	known	69_37n	nonsense	429	21.86	120	SNP	0.000	A
PARP1	142	genome.wustl.edu	37	1	226561965	226561965	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:226561965C>G	ENST00000366794.5	-	14	2175	c.2032G>C	c.(2032-2034)Gat>Cat	p.D678H		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	678	PARP alpha-helical. {ECO:0000255|PROSITE- ProRule:PRU00398}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CTTTCCACATCAAAGATCATC	0.438								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														dbGAP											0													176.0	156.0	163.0					1																	226561965		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2032G>C	1.37:g.226561965C>G	ENSP00000355759:p.Asp678His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_Znf_PARP,pfam_PADR1,pfam_WGR_domain,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_WGR_domain,pirsf_NAD_ADPRT,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.D678H	ENST00000366794.5	37	c.2032	CCDS1554.1	1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992541	0.93167	.	.	ENSG00000143799	ENST00000366794	T	0.15372	2.43	5.5	5.5	0.81552	Poly(ADP-ribose) polymerase, regulatory domain (4);	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70876	-0.4753	10	0.87932	D	0	.	19.7574	0.96299	0.0:1.0:0.0:0.0	.	678	P09874	PARP1_HUMAN	H	678	ENSP00000355759:D678H	ENSP00000355759:D678H	D	-	1	0	PARP1	224628588	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.484000	0.81180	2.743000	0.94032	0.650000	0.86243	GAT	PARP1	-	pfam_Poly(ADP-ribose)pol_reg_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,pirsf_NAD_ADPRT,pfscan_Poly(ADP-ribose)pol_reg_dom	ENSG00000143799		0.438	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	115	0.00	0	C	NM_001618		226561965	226561965	-1	no_errors	ENST00000366794	ensembl	human	known	69_37n	missense	220	12.70	32	SNP	1.000	G
PCOLCE	5118	genome.wustl.edu	37	7	100205413	100205414	+	Frame_Shift_Ins	INS	-	-	C	rs538448756		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr7:100205413_100205414insC	ENST00000223061.5	+	8	1446_1447	c.1166_1167insC	c.(1165-1170)tgccccfs	p.CP389fs		NM_002593.3	NP_002584.2	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	389	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				multicellular organismal development (GO:0007275)|positive regulation of peptidase activity (GO:0010952)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.M392fs*>59(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TGCAAGCAGTGCCCCCCCATGA	0.51																																						dbGAP											2	Insertion - Frameshift(2)	ovary(1)|large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			L33799	CCDS5700.1	7q22	2008-07-18			ENSG00000106333	ENSG00000106333			8738	protein-coding gene	gene with protein product	"""procollagen, type 1, COOH-terminal proteinase enhancer"", ""procollagen C-proteinase enhancer 1"""	600270				8824813, 9799793	Standard	NM_002593		Approved	PCPE, PCPE1	uc003uvo.3	Q15113	OTTHUMG00000156675	ENST00000223061.5:c.1173dupC	7.37:g.100205420_100205420dupC	ENSP00000223061:p.Cys389fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9E1|O14550	Frame_Shift_Ins	INS	pfam_CUB,pfam_Netrin_module_non-TIMP,superfamily_CUB,superfamily_TIMP-like_OB-fold,smart_CUB,smart_Netrin_module_non-TIMP,pfscan_CUB,pfscan_Netrin_domain	p.M392fs	ENST00000223061.5	37	c.1166_1167	CCDS5700.1	7																																																																																			PCOLCE	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain	ENSG00000106333		0.510	PCOLCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE	HGNC	protein_coding	OTTHUMT00000345285.1	120	0.83	1	-	NM_002593		100205413	100205414	+1	no_errors	ENST00000223061	ensembl	human	known	69_37n	frame_shift_ins	39	13.33	6	INS	0.992:0.880	C
PDK4	5166	genome.wustl.edu	37	7	95216806	95216806	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr7:95216806A>C	ENST00000005178.5	-	9	1102	c.905T>G	c.(904-906)aTt>aGt	p.I302S		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	302	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			GCGGTCAATAATTCTCAGGGG	0.378																																						dbGAP											0													82.0	84.0	83.0					7																	95216806		2203	4300	6503	-	-	-	SO:0001583	missense	0			U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.905T>G	7.37:g.95216806A>C	ENSP00000005178:p.Ile302Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.I302S	ENST00000005178.5	37	c.905	CCDS5643.1	7	.	.	.	.	.	.	.	.	.	.	A	14.23	2.472486	0.43942	.	.	ENSG00000004799	ENST00000005178;ENST00000542888	T	0.53206	0.63	5.61	5.61	0.85477	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.135536	0.64402	D	0.000006	T	0.35885	0.0947	L	0.40543	1.245	0.45528	D	0.998481	B	0.16802	0.019	B	0.24006	0.05	T	0.16600	-1.0397	10	0.10636	T	0.68	.	9.6907	0.40127	0.7427:0.0:0.0:0.2573	.	302	Q16654	PDK4_HUMAN	S	302;266	ENSP00000005178:I302S	ENSP00000005178:I302S	I	-	2	0	PDK4	95054742	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	5.549000	0.67261	2.270000	0.75569	0.482000	0.46254	ATT	PDK4	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	ENSG00000004799		0.378	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK4	HGNC	protein_coding	OTTHUMT00000333298.1	109	0.91	1	A	NM_002612		95216806	95216806	-1	no_errors	ENST00000005178	ensembl	human	known	69_37n	missense	57	31.33	26	SNP	1.000	C
PID1	55022	genome.wustl.edu	37	2	230020681	230020681	+	Splice_Site	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr2:230020681C>T	ENST00000354069.6	-	2	160		c.e2-1		PID1_ENST00000409462.1_Intron|PID1_ENST00000392054.3_Splice_Site|PID1_ENST00000392055.3_Splice_Site|PID1_ENST00000482518.2_Splice_Site			Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1						cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		TCTGAAAGTGCTGAAAAGCAG	0.408																																						dbGAP											0													66.0	66.0	66.0					2																	230020681		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000354069.6:c.130-1G>A	2.37:g.230020681C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Splice_Site	SNP	-	e2-1	ENST00000354069.6	37	c.130-1		2	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651794	0.88056	.	.	ENSG00000153823	ENST00000392054;ENST00000392055;ENST00000542363;ENST00000354069	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.248	0.93909	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PID1	229728925	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.353000	0.79414	2.861000	0.98227	0.655000	0.94253	.	PID1	-	-	ENSG00000153823		0.408	PID1-005	KNOWN	basic	protein_coding	PID1	HGNC	protein_coding	OTTHUMT00000331810.2	201	0.00	0	C	NM_017933	Intron	230020681	230020681	-1	no_errors	ENST00000354069	ensembl	human	known	69_37n	splice_site	82	36.92	48	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	154	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	36	83.02	176	SNP	1.000	G
PIWIL1	9271	genome.wustl.edu	37	12	130847321	130847321	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:130847321C>T	ENST00000245255.3	+	17	2253	c.1981C>T	c.(1981-1983)Cgc>Tgc	p.R661C		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	661	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.|RNA-binding. {ECO:0000250}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTGGTTCTCACGCTGCATATT	0.403																																						dbGAP											0													111.0	106.0	107.0					12																	130847321		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1981C>T	12.37:g.130847321C>T	ENSP00000245255:p.Arg661Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R661C	ENST00000245255.3	37	c.1981	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636295	0.47049	.	.	ENSG00000125207	ENST00000245255	T	0.14766	2.48	5.49	5.49	0.81192	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.103881	0.64402	D	0.000005	T	0.24431	0.0592	M	0.76727	2.345	0.80722	D	1	B;P	0.46395	0.124;0.877	B;B	0.43783	0.046;0.431	T	0.01781	-1.1275	10	0.45353	T	0.12	-0.7152	18.3615	0.90376	0.0:1.0:0.0:0.0	.	661;661	Q96J94;Q96J94-2	PIWL1_HUMAN;.	C	661	ENSP00000245255:R661C	ENSP00000245255:R661C	R	+	1	0	PIWIL1	129413274	0.997000	0.39634	0.985000	0.45067	0.710000	0.40934	3.670000	0.54569	2.578000	0.87016	0.467000	0.42956	CGC	PIWIL1	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000125207		0.403	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	108	0.00	0	C			130847321	130847321	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	missense	111	13.28	17	SNP	0.984	T
PREP	5550	genome.wustl.edu	37	6	105730425	105730425	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr6:105730425C>T	ENST00000369110.3	-	13	1774	c.1582G>A	c.(1582-1584)Gat>Aat	p.D528N	RP3-355L5.4_ENST00000452363.1_RNA	NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	528					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	TGAAAGTCATCAAAGCAGTTT	0.393																																						dbGAP											0													151.0	143.0	146.0					6																	105730425		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.1582G>A	6.37:g.105730425C>T	ENSP00000358106:p.Asp528Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6D4	Missense_Mutation	SNP	pfam_Peptidase_S9A_B_C_N,pfam_Peptidase_S9,superfamily_Peptidase_S9A_B_C_N,prints_Peptidase_S9A	p.D528N	ENST00000369110.3	37	c.1582	CCDS5053.1	6	.	.	.	.	.	.	.	.	.	.	C	23.6	4.435630	0.83885	.	.	ENSG00000085377	ENST00000369110	T	0.32753	1.44	6.17	6.17	0.99709	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.091884	0.85682	D	0.000000	T	0.35219	0.0924	M	0.83953	2.67	0.46774	D	0.999191	P	0.43578	0.811	P	0.45099	0.469	T	0.22173	-1.0224	10	0.52906	T	0.07	-30.8064	14.9567	0.71120	0.0:0.9326:0.0:0.0674	.	528	P48147	PPCE_HUMAN	N	528	ENSP00000358106:D528N	ENSP00000358106:D528N	D	-	1	0	PREP	105837118	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.473000	0.53122	2.941000	0.99782	0.655000	0.94253	GAT	PREP	-	pfam_Peptidase_S9,prints_Peptidase_S9A	ENSG00000085377		0.393	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREP	HGNC	protein_coding	OTTHUMT00000041658.1	252	0.00	0	C			105730425	105730425	-1	no_errors	ENST00000369110	ensembl	human	known	69_37n	missense	96	52.48	106	SNP	1.000	T
PSG1	5669	genome.wustl.edu	37	19	43373185	43373185	+	Splice_Site	SNP	C	C	T	rs4030951		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr19:43373185C>T	ENST00000436291.2	-	4	827	c.711G>A	c.(709-711)ccG>ccA	p.P237P	PSG1_ENST00000312439.6_Splice_Site_p.P237P|PSG1_ENST00000244296.2_Splice_Site_p.P237P|PSG1_ENST00000403380.3_Splice_Site_p.P144P|PSG1_ENST00000595356.1_Splice_Site_p.P237P|PSG1_ENST00000595124.1_Splice_Site_p.P144P	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	237					female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.P237P(3)		breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TGGGCAGCTTCGCTGTGTGGA	0.473													.|||	1	0.000199681	0.0008	0.0	5008	,	,		20661	0.0		0.0	False		,,,				2504	0.0					dbGAP											3	Substitution - coding silent(3)	endometrium(3)											149.0	165.0	160.0					19																	43373185		1510	2707	4217	-	-	-	SO:0001630	splice_region_variant	0				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.710-1G>A	19.37:g.43373185C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P237	ENST00000436291.2	37	c.711	CCDS54275.1	19																																																																																			PSG1	-	NULL	ENSG00000231924		0.473	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	444	0.00	0	C		Silent	43373185	43373185	-1	no_errors	ENST00000312439	ensembl	human	known	69_37n	silent	412	16.60	82	SNP	0.431	T
RAB28	9364	genome.wustl.edu	37	4	13383134	13383134	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr4:13383134G>A	ENST00000330852.5	-	5	690	c.476C>T	c.(475-477)tCa>tTa	p.S159L	RAB28_ENST00000338176.4_Missense_Mutation_p.S159L|RAB28_ENST00000288723.4_Missense_Mutation_p.S159L	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	159					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						TGTCTTGGCTGAGACAAAGTG	0.338																																						dbGAP											0													75.0	79.0	78.0					4																	13383134		2203	4299	6502	-	-	-	SO:0001583	missense	0			X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.476C>T	4.37:g.13383134G>A	ENSP00000328551:p.Ser159Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	G8JLC5|Q8IYR8|Q8NI05	Nonsense_Mutation	SNP	NULL	p.Q29*	ENST00000330852.5	37	c.85	CCDS33961.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.064751|5.064751	0.93898|0.93898	.|.	.|.	ENSG00000157869|ENSG00000157869	ENST00000504644|ENST00000330852;ENST00000288723;ENST00000338176	.|D;D;D	.|0.89343	.|-2.5;-2.5;-2.5	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Small GTP-binding protein domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.97173	.|0.9076	H|H	0.98682|0.98682	4.3|4.3	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	.|D	.|0.98091	.|1.0409	.|10	.|0.87932	.|D	.|0	.|.	20.197|20.197	0.98244|0.98244	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|159;159	.|P51157;P51157-2	.|RAB28_HUMAN;.	X|L	29|159	.|ENSP00000328551:S159L;ENSP00000288723:S159L;ENSP00000340079:S159L	.|ENSP00000288723:S159L	Q|S	-|-	1|2	0|0	RAB28|RAB28	12992232|12992232	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.389000|9.389000	0.97243|0.97243	2.776000|2.776000	0.95493|0.95493	0.585000|0.585000	0.79938|0.79938	CAG|TCA	RAB28	-	NULL	ENSG00000157869		0.338	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB28	HGNC	protein_coding	OTTHUMT00000207068.2	254	0.00	0	G	NM_001017979		13383134	13383134	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000504644	ensembl	human	putative	69_37n	nonsense	53	75.45	166	SNP	1.000	A
RASGEF1C	255426	genome.wustl.edu	37	5	179545842	179545842	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr5:179545842G>A	ENST00000393371.2	-	8	1228	c.932C>T	c.(931-933)tCc>tTc	p.S311F	RASGEF1C_ENST00000519883.1_5'UTR|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.S311F|RASGEF1C_ENST00000522500.1_Missense_Mutation_p.S160F			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	311	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTCAGCCTGGAGACAGGGCT	0.632																																						dbGAP											0													83.0	87.0	86.0					5																	179545842		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.932C>T	5.37:g.179545842G>A	ENSP00000377037:p.Ser311Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S311F	ENST00000393371.2	37	c.932	CCDS4452.1	5	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909645	0.72868	.	.	ENSG00000146090	ENST00000361132;ENST00000393371;ENST00000522500	T;T;T	0.34072	1.38;1.38;1.38	4.16	4.16	0.48862	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.47948	0.1473	L	0.43646	1.37	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	T	0.31052	-0.9957	10	0.10902	T	0.67	.	15.43	0.75084	0.0:0.0:1.0:0.0	.	311	Q8N431	RGF1C_HUMAN	F	311;311;160	ENSP00000354963:S311F;ENSP00000377037:S311F;ENSP00000429114:S160F	ENSP00000354963:S311F	S	-	2	0	RASGEF1C	179478448	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	9.015000	0.93640	2.043000	0.60533	0.313000	0.20887	TCC	RASGEF1C	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000146090		0.632	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	HGNC	protein_coding	OTTHUMT00000253506.2	32	0.00	0	G	NM_175062		179545842	179545842	-1	no_errors	ENST00000361132	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	1.000	A
RBM25	58517	genome.wustl.edu	37	14	73572680	73572680	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr14:73572680G>A	ENST00000261973.7	+	11	1553	c.1268G>A	c.(1267-1269)cGa>cAa	p.R423Q	RBM25_ENST00000527432.1_Missense_Mutation_p.R423Q	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	423	Arg-rich.|Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		gaacgggagcgagaaagagaa	0.488																																						dbGAP											0													143.0	156.0	152.0					14																	73572680		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1268G>A	14.37:g.73572680G>A	ENSP00000261973:p.Arg423Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	pfam_PWI,pfam_RRM_dom,superfamily_PWI,smart_RRM_dom,smart_PWI,pfscan_RRM_dom	p.R423Q	ENST00000261973.7	37	c.1268	CCDS32113.1	14	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070182	0.76301	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.61627	0.09;0.09	5.61	5.61	0.85477	.	0.131577	0.50627	D	0.000106	T	0.45756	0.1358	L	0.50333	1.59	0.80722	D	1	P	0.49253	0.921	B	0.26614	0.071	T	0.50491	-0.8822	10	0.22109	T	0.4	.	19.2308	0.93839	0.0:0.0:1.0:0.0	.	423	P49756	RBM25_HUMAN	Q	423	ENSP00000261973:R423Q;ENSP00000431150:R423Q	ENSP00000261973:R423Q	R	+	2	0	RBM25	72642433	1.000000	0.71417	0.948000	0.38648	0.986000	0.74619	9.188000	0.94921	2.641000	0.89580	0.650000	0.86243	CGA	RBM25	-	NULL	ENSG00000119707		0.488	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	HGNC	protein_coding	OTTHUMT00000394966.1	309	0.00	0	G	XM_027330		73572680	73572680	+1	no_errors	ENST00000261973	ensembl	human	known	69_37n	missense	242	58.60	344	SNP	0.845	A
RYR3	6263	genome.wustl.edu	37	15	34130404	34130404	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:34130404G>A	ENST00000389232.4	+	89	12293	c.12223G>A	c.(12223-12225)Gaa>Aaa	p.E4075K	RYR3_ENST00000415757.3_Missense_Mutation_p.E4070K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4075					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGTTGTCAATGAAGGTGGGGA	0.453																																						dbGAP											0													115.0	116.0	115.0					15																	34130404		1940	4139	6079	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.12223G>A	15.37:g.34130404G>A	ENSP00000373884:p.Glu4075Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E4075K	ENST00000389232.4	37	c.12223	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010002	0.75046	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.98028	-4.67	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.98807	0.9598	M	0.85373	2.75	0.80722	D	1	D;D	0.69078	0.997;0.989	D;D	0.79108	0.992;0.913	D	0.99441	1.0938	10	0.62326	D	0.03	.	19.0911	0.93227	0.0:0.0:1.0:0.0	.	4070;4075	Q15413-2;Q15413	.;RYR3_HUMAN	K	4075;4071	ENSP00000373884:E4075K	ENSP00000354735:E4071K	E	+	1	0	RYR3	31917696	1.000000	0.71417	0.981000	0.43875	0.667000	0.39255	9.539000	0.98076	2.746000	0.94184	0.563000	0.77884	GAA	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.453	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	151	0.00	0	G			34130404	34130404	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	92	34.29	48	SNP	1.000	A
SATL1	340562	genome.wustl.edu	37	X	84349940	84349940	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chrX:84349940C>T	ENST00000395409.3	-	3	1755	c.1195G>A	c.(1195-1197)Gat>Aat	p.D399N	SATL1_ENST00000332921.5_Missense_Mutation_p.D399N|SATL1_ENST00000509231.1_Missense_Mutation_p.D586N			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	399	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TTTTGTTGATCGTTTACTTCT	0.348																																						dbGAP											0													114.0	98.0	103.0					X																	84349940		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.1195G>A	X.37:g.84349940C>T	ENSP00000378804:p.Asp399Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.D586N	ENST00000395409.3	37	c.1756		X	.	.	.	.	.	.	.	.	.	.	C	0.996	-0.692432	0.03303	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.41758	0.99;0.99;0.99	5.4	-2.2	0.06994	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	1.374530	0.05346	N	0.531060	T	0.17662	0.0424	N	0.10760	0.04	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.04013	0.001;0.001	T	0.12344	-1.0551	10	0.16420	T	0.52	-2.6316	1.4581	0.02390	0.1447:0.3263:0.1444:0.3847	.	399;586	Q86VE3;E9PB72	SATL1_HUMAN;.	N	399;399;586	ENSP00000378804:D399N;ENSP00000329115:D399N;ENSP00000425421:D586N	ENSP00000329115:D399N	D	-	1	0	SATL1	84236596	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.114000	0.15520	-0.379000	0.07906	-0.354000	0.07668	GAT	SATL1	-	superfamily_Acyl_CoA_acyltransferase	ENSG00000184788		0.348	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		26	0.00	0	C	XM_291339		84349940	84349940	-1	no_errors	ENST00000509231	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	0.000	T
SIGLEC5	8778	genome.wustl.edu	37	19	52132741	52132741	+	Silent	SNP	G	G	A	rs200210701	byFrequency	TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr19:52132741G>A	ENST00000534261.2	-	4	969	c.570C>T	c.(568-570)ccC>ccT	p.P190P	SIGLEC5_ENST00000429354.3_Silent_p.P190P|SIGLEC5_ENST00000222107.4_Silent_p.P190P|SIGLEC5_ENST00000599649.1_Silent_p.P190P|SIGLEC5_ENST00000570106.2_Silent_p.P190P			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	190	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GGGTGGTCTCGGGGTCCAGGG	0.652													G|||	61	0.0121805	0.0159	0.0014	5008	,	,		15292	0.0288		0.002	False		,,,				2504	0.0082					dbGAP											0													16.0	16.0	16.0					19																	52132741		2201	4290	6491	-	-	-	SO:0001819	synonymous_variant	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.570C>T	19.37:g.52132741G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P190	ENST00000534261.2	37	c.570	CCDS33088.1	19																																																																																			SIGLEC5	-	pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000105501		0.652	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	55	0.00	0	G	NM_003830		52132741	52132741	-1	no_errors	ENST00000222107	ensembl	human	known	69_37n	silent	44	13.73	7	SNP	0.000	A
SLC25A14	9016	genome.wustl.edu	37	X	129474326	129474326	+	Splice_Site	SNP	G	G	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chrX:129474326G>T	ENST00000218197.5	+	1	301	c.74G>T	c.(73-75)gGa>gTa	p.G25V	SLC25A14_ENST00000361980.5_Intron|SLC25A14_ENST00000543953.1_Intron|SLC25A14_ENST00000545805.1_Splice_Site_p.G25V|SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000339231.3_Intron	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	25					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						ATTGTAAGCGGAGTAAGCAAA	0.478																																						dbGAP											0													78.0	82.0	81.0					X																	129474326		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.75+1G>T	X.37:g.129474326G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling,prints_Mit_carrier	p.G25V	ENST00000218197.5	37	c.74	CCDS14623.1	X	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916349	0.33815	.	.	ENSG00000102078	ENST00000424447;ENST00000545805;ENST00000218197	T;T;T	0.80824	-1.17;-1.42;-1.38	4.31	4.31	0.51392	.	.	.	.	.	T	0.62648	0.2445	N	0.08118	0	0.80722	D	1	P	0.48694	0.914	B	0.41135	0.348	T	0.65516	-0.6149	9	0.38643	T	0.18	.	11.0968	0.48150	0.0:0.0:1.0:0.0	.	25	O95258	UCP5_HUMAN	V	25	ENSP00000402578:G25V;ENSP00000444642:G25V;ENSP00000218197:G25V	ENSP00000218197:G25V	G	+	2	0	SLC25A14	129302007	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.812000	0.55628	2.387000	0.81309	0.594000	0.82650	GGA	SLC25A14	-	NULL	ENSG00000102078		0.478	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A14	HGNC	protein_coding	OTTHUMT00000058253.1	123	0.00	0	G	NM_022810, NM_003951	Missense_Mutation	129474326	129474326	+1	no_errors	ENST00000218197	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	T
SLC30A5	64924	genome.wustl.edu	37	5	68419204	68419204	+	Silent	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr5:68419204G>C	ENST00000396591.3	+	14	2560	c.1950G>C	c.(1948-1950)ctG>ctC	p.L650L	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	650					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTCTACTCCTGAGATTGCCAC	0.353																																						dbGAP											0													84.0	86.0	85.0					5																	68419204		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1950G>C	5.37:g.68419204G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Nonstop_Mutation	SNP	NULL	p.*12S	ENST00000396591.3	37	c.35	CCDS3996.1	5	.	.	.	.	.	.	.	.	.	.	G	7.859	0.725579	0.15439	.	.	ENSG00000145740	ENST00000511158	.	.	.	5.11	3.34	0.38264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0814	0.48062	0.1511:0.0:0.8489:0.0	.	.	.	.	S	12	.	.	X	+	2	2	SLC30A5	68454960	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	1.944000	0.40263	0.741000	0.32674	0.650000	0.86243	TGA	SLC30A5	-	NULL	ENSG00000145740		0.353	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	103	0.00	0	G			68419204	68419204	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000511158	ensembl	human	novel	69_37n	nonstop	125	32.43	60	SNP	1.000	C
SLC31A1	1317	genome.wustl.edu	37	9	116018517	116018517	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr9:116018517C>T	ENST00000374212.4	+	2	241	c.89C>T	c.(88-90)tCa>tTa	p.S30L	CDC26_ENST00000490408.1_Intron|SLC31A1_ENST00000374210.6_Missense_Mutation_p.S30L	NM_001859.3	NP_001850.1	O15431	COPT1_HUMAN	solute carrier family 31 (copper transporter), member 1	30					cellular copper ion homeostasis (GO:0006878)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)|copper uptake transmembrane transporter activity (GO:0015088)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7					Bortezomib(DB00188)|Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	ACTTCAGCCTCACACTCCCAT	0.498																																					Ovarian(135;1049 1799 4519 17564 28677)	dbGAP											0													132.0	98.0	110.0					9																	116018517		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83460	CCDS6789.1	9q32	2013-07-17	2013-07-17		ENSG00000136868	ENSG00000136868		"""Solute carriers"""	11016	protein-coding gene	gene with protein product	copper transport 1 homolog (S. cerevisiae)	603085		COPT1		9207117	Standard	NM_001859		Approved	hCTR1, CTR1	uc004bgu.3	O15431	OTTHUMG00000020519	ENST00000374212.4:c.89C>T	9.37:g.116018517C>T	ENSP00000363329:p.Ser30Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Z6|Q53GR5|Q5T1M4	Missense_Mutation	SNP	pfam_Cop_transporter	p.S30L	ENST00000374212.4	37	c.89	CCDS6789.1	9	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666591	0.47677	.	.	ENSG00000136868	ENST00000374212;ENST00000374210	T;T	0.66280	-0.15;-0.2	6.04	4.19	0.49359	.	0.846476	0.10618	N	0.653672	T	0.55593	0.1930	L	0.43152	1.355	0.22305	N	0.999212	P;B	0.43094	0.799;0.1	B;B	0.38562	0.276;0.036	T	0.43750	-0.9372	10	0.56958	D	0.05	-1.6832	12.1371	0.53977	0.3117:0.6883:0.0:0.0	.	30;30	Q5T1M3;O15431	.;COPT1_HUMAN	L	30	ENSP00000363329:S30L;ENSP00000363327:S30L	ENSP00000363327:S30L	S	+	2	0	SLC31A1	115058338	0.040000	0.19996	0.292000	0.24919	0.990000	0.78478	1.664000	0.37439	0.866000	0.35629	0.563000	0.77884	TCA	SLC31A1	-	NULL	ENSG00000136868		0.498	SLC31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC31A1	HGNC	protein_coding	OTTHUMT00000053715.1	118	0.00	0	C	NM_001859		116018517	116018517	+1	no_errors	ENST00000374212	ensembl	human	known	69_37n	missense	98	11.71	13	SNP	0.217	T
SLCO1C1	53919	genome.wustl.edu	37	12	20893300	20893300	+	Silent	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr12:20893300G>A	ENST00000266509.2	+	12	2099	c.1731G>A	c.(1729-1731)ctG>ctA	p.L577L	SLCO1C1_ENST00000540354.1_Silent_p.L528L|SLCO1C1_ENST00000381552.1_Silent_p.L577L|SLCO1C1_ENST00000545102.1_Silent_p.L459L|SLCO1C1_ENST00000545604.1_Silent_p.L577L	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	577					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TATTACTTCTGAGGTGAGTAC	0.358																																						dbGAP											0													141.0	138.0	139.0					12																	20893300		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1731G>A	12.37:g.20893300G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.L577	ENST00000266509.2	37	c.1731	CCDS8683.1	12																																																																																			SLCO1C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.358	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	297	0.00	0	G	NM_017435		20893300	20893300	+1	no_errors	ENST00000381552	ensembl	human	known	69_37n	silent	340	18.85	79	SNP	1.000	A
SORBS1	10580	genome.wustl.edu	37	10	97096417	97096417	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr10:97096417G>C	ENST00000361941.3	-	28	3526	c.3500C>G	c.(3499-3501)tCa>tGa	p.S1167*	SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000277982.5_Nonsense_Mutation_p.S1026*|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000371246.2_Nonsense_Mutation_p.S1026*|SORBS1_ENST00000371247.2_Nonsense_Mutation_p.S1167*|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371227.4_Nonsense_Mutation_p.S1121*|SORBS1_ENST00000393949.1_Intron	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GTTGAGATCTGAGAGTCTCTG	0.597																																						dbGAP											0													98.0	102.0	101.0					10																	97096417		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3500C>G	10.37:g.97096417G>C	ENSP00000355136:p.Ser1167*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.S1167*	ENST00000361941.3	37	c.3500	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	G	41	8.868372	0.98984	.	.	ENSG00000095637	ENST00000371247;ENST00000371227;ENST00000371246;ENST00000361941;ENST00000277982	.	.	.	5.58	4.62	0.57501	.	0.730444	0.11310	N	0.577254	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-0.0061	13.2561	0.60079	0.0:0.1735:0.8265:0.0	.	.	.	.	X	1167;1121;1026;1167;1026	.	ENSP00000277982:S1026X	S	-	2	0	SORBS1	97086407	0.927000	0.31430	1.000000	0.80357	0.996000	0.88848	1.796000	0.38794	2.641000	0.89580	0.561000	0.74099	TCA	SORBS1	-	NULL	ENSG00000095637		0.597	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	61	0.00	0	G			97096417	97096417	-1	no_errors	ENST00000361941	ensembl	human	known	69_37n	nonsense	48	39.24	31	SNP	0.983	C
SPPL2A	84888	genome.wustl.edu	37	15	51024842	51024842	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:51024842G>C	ENST00000261854.5	-	9	1246	c.972C>G	c.(970-972)ttC>ttG	p.F324L		NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	324					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		AATTCAGACAGAAAGCAATCC	0.289																																					Melanoma(50;790 1209 4069 22965 33125)	dbGAP											0													61.0	59.0	60.0					15																	51024842		2194	4294	6488	-	-	-	SO:0001583	missense	0				CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.972C>G	15.37:g.51024842G>C	ENSP00000261854:p.Phe324Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	pfam_Peptidase_A22B_SPP,pfam_Protease-assoc_domain,smart_Peptidase_A22	p.F324L	ENST00000261854.5	37	c.972	CCDS10138.1	15	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395520	0.62066	.	.	ENSG00000138600	ENST00000261854	T	0.12147	2.71	5.81	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.21962	0.0529	L	0.45744	1.44	0.49051	D	0.999745	D	0.56746	0.977	P	0.59357	0.856	T	0.05835	-1.0861	10	0.12430	T	0.62	-4.5411	10.8982	0.47036	0.1425:0.0:0.8575:0.0	.	324	Q8TCT8	PSL2_HUMAN	L	324	ENSP00000261854:F324L	ENSP00000261854:F324L	F	-	3	2	AC012100.1	48812134	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.117000	0.50407	1.485000	0.48380	0.644000	0.83932	TTC	SPPL2A	-	pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	ENSG00000138600		0.289	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2A	HGNC	protein_coding	OTTHUMT00000254543.3	64	0.00	0	G	NM_032802		51024842	51024842	-1	no_errors	ENST00000261854	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	1.000	C
SCNM1	79005	genome.wustl.edu	37	1	151143396	151143396	+	IGR	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:151143396C>T	ENST00000368905.4	+	0	2016				TMOD4_ENST00000416280.2_Splice_Site_p.Q221Q	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAATGCTGACCTGATTGTCTA	0.488																																						dbGAP											0													106.0	91.0	96.0					1																	151143396		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258		1.37:g.151143396C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWR1|Q5JR74	Missense_Mutation	SNP	NULL	p.R108K	ENST00000368905.4	37	c.323	CCDS987.1	1																																																																																			TMOD4	-	NULL	ENSG00000163157		0.488	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	TMOD4	HGNC	protein_coding	OTTHUMT00000034064.2	57	0.00	0	C	NM_024041		151143396	151143396	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000466891	ensembl	human	putative	69_37n	missense	123	11.51	16	SNP	1.000	T
SUSD4	55061	genome.wustl.edu	37	1	223408322	223408322	+	Intron	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr1:223408322G>A	ENST00000343846.3	-	5	1358				SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000478605.1_Intron|SUSD4_ENST00000494793.2_Intron|SUSD4_ENST00000366878.4_Intron|SUSD4_ENST00000344029.6_Missense_Mutation_p.S282L|SUSD4_ENST00000454695.2_Intron			Q5VX71	SUSD4_HUMAN	sushi domain containing 4							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GGTGCTAGTTGAGGAACAGGT	0.428																																						dbGAP											0													149.0	146.0	147.0					1																	223408322		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.725-5592C>T	1.37:g.223408322G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S282L	ENST00000343846.3	37	c.845	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	G	8.995	0.978565	0.18812	.	.	ENSG00000143502	ENST00000344029	T	0.35048	1.33	2.32	-0.0801	0.13708	.	.	.	.	.	T	0.20861	0.0502	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20538	-1.0272	8	0.33940	T	0.23	.	4.0601	0.09834	0.1604:0.3134:0.5262:0.0	.	282	Q5VX71-3	.	L	282	ENSP00000339926:S282L	ENSP00000339926:S282L	S	-	2	0	SUSD4	221474945	0.000000	0.05858	0.001000	0.08648	0.129000	0.20672	-1.556000	0.02168	-0.227000	0.09884	-0.463000	0.05309	TCA	SUSD4	-	NULL	ENSG00000143502		0.428	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	193	0.00	0	G	NM_017982		223408322	223408322	-1	no_errors	ENST00000344029	ensembl	human	known	69_37n	missense	266	25.91	93	SNP	0.003	A
TP53	7157	genome.wustl.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000420246.2_Missense_Mutation_p.C238Y|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000413465.2_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000445888.2_Missense_Mutation_p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	GRCh37	CM034930	TP53	M							132.0	103.0	113.0					17																	7577568		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	17.37:g.7577568C>T	ENSP00000269305:p.Cys238Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238Y	ENST00000269305.4	37	c.713	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	74	0.00	0	C	NM_000546		7577568	7577568	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	19	65.45	36	SNP	1.000	T
TPTE2	93492	genome.wustl.edu	37	13	20048120	20048120	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr13:20048120C>T	ENST00000400230.2	-	6	370	c.326G>A	c.(325-327)cGt>cAt	p.R109H	TPTE2_ENST00000382977.4_Missense_Mutation_p.R109H|TPTE2_ENST00000382978.1_Missense_Mutation_p.R109H|TPTE2_ENST00000400103.2_Intron|TPTE2_ENST00000390680.2_Missense_Mutation_p.R72H|TPTE2_ENST00000382975.4_Missense_Mutation_p.R109H|TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000255310.6_Missense_Mutation_p.R72H			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	109					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGAAATAGAACGATACTCCAA	0.343																																						dbGAP											0													53.0	61.0	58.0					13																	20048120		2201	4297	6498	-	-	-	SO:0001583	missense	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.326G>A	13.37:g.20048120C>T	ENSP00000383089:p.Arg109His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R109H	ENST00000400230.2	37	c.326	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	c	7.678	0.688357	0.14973	.	.	ENSG00000132958	ENST00000382978;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000343548	D;D;D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38;-4.38;-4.38	2.33	-0.47	0.12131	.	0.454593	0.22040	U	0.065463	D	0.93377	0.7888	L	0.57536	1.79	0.09310	N	1	B;B	0.19331	0.029;0.035	B;B	0.20767	0.008;0.031	D	0.84440	0.0582	9	.	.	.	-1.829	5.0232	0.14372	0.0:0.5096:0.0:0.4904	.	72;109	Q6XPS3-3;Q6XPS3	.;TPTE2_HUMAN	H	109;109;72;72;109;109;109	ENSP00000372438:R109H;ENSP00000383089:R109H;ENSP00000255310:R72H;ENSP00000375098:R72H;ENSP00000372437:R109H;ENSP00000372435:R109H	.	R	-	2	0	TPTE2	18946120	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.507000	0.06352	-0.170000	0.10816	-0.474000	0.04947	CGT	TPTE2	-	NULL	ENSG00000132958		0.343	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		151	0.00	0	C	NM_199254		20048120	20048120	-1	no_errors	ENST00000382977	ensembl	human	known	69_37n	missense	119	26.09	42	SNP	0.000	T
TRPM4	54795	genome.wustl.edu	37	19	49674925	49674925	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr19:49674925G>A	ENST00000252826.5	+	8	1075	c.949G>A	c.(949-951)Gac>Aac	p.D317N	TRPM4_ENST00000601347.1_3'UTR|TRPM4_ENST00000427978.2_Missense_Mutation_p.D317N|TRPM4_ENST00000355712.5_Missense_Mutation_p.D34N	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	317					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GACCCTGGAAGACACTCTGGC	0.632																																						dbGAP											0													36.0	40.0	39.0					19																	49674925		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.949G>A	19.37:g.49674925G>A	ENSP00000252826:p.Asp317Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.D317N	ENST00000252826.5	37	c.949	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	G	18.21	3.572998	0.65765	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.58940	1.52;1.52;0.3	4.99	4.99	0.66335	.	0.201602	0.41194	D	0.000936	T	0.57373	0.2049	L	0.34521	1.04	0.30809	N	0.739097	D;D;P;B	0.58268	0.969;0.982;0.728;0.013	P;P;P;B	0.54210	0.561;0.745;0.447;0.011	T	0.53927	-0.8369	10	0.12766	T	0.61	-36.3338	17.3952	0.87443	0.0:0.0:1.0:0.0	.	34;143;317;317	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	N	317;317;34	ENSP00000252826:D317N;ENSP00000407492:D317N;ENSP00000347944:D34N	ENSP00000252826:D317N	D	+	1	0	TRPM4	54366737	1.000000	0.71417	0.999000	0.59377	0.594000	0.36715	5.008000	0.63991	2.493000	0.84123	0.591000	0.81541	GAC	TRPM4	-	NULL	ENSG00000130529		0.632	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	HGNC	protein_coding	OTTHUMT00000465543.2	44	0.00	0	G	NM_017636		49674925	49674925	+1	no_errors	ENST00000252826	ensembl	human	known	69_37n	missense	22	50.00	22	SNP	1.000	A
UBE2J1	51465	genome.wustl.edu	37	6	90039635	90039636	+	Frame_Shift_Ins	INS	-	-	G	rs367896104		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr6:90039635_90039636insG	ENST00000435041.2	-	8	997_998	c.719_720insC	c.(718-720)cctfs	p.P240fs		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	240					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		CAGGTTGGGTAGGTTGATGAAA	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.720dupC	6.37:g.90039637_90039637dupG	ENSP00000451261:p.Pro240fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Frame_Shift_Ins	INS	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.T241fs	ENST00000435041.2	37	c.720_719	CCDS5021.1	6																																																																																			UBE2J1	-	NULL	ENSG00000198833		0.455	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2J1	HGNC	protein_coding	OTTHUMT00000043742.2	138	0.00	0	-	NM_016021		90039635	90039636	-1	no_errors	ENST00000435041	ensembl	human	known	69_37n	frame_shift_ins	102	46.03	87	INS	0.004:0.007	G
UBR1	197131	genome.wustl.edu	37	15	43282235	43282235	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr15:43282235C>T	ENST00000290650.4	-	34	3919	c.3841G>A	c.(3841-3843)Gag>Aag	p.E1281K	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1281					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TACGAAGACTCAACGCCAAAA	0.328																																						dbGAP											0													43.0	39.0	41.0					15																	43282235		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3841G>A	15.37:g.43282235C>T	ENSP00000290650:p.Glu1281Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E1281K	ENST00000290650.4	37	c.3841	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736520	0.30774	.	.	ENSG00000159459	ENST00000290650	T	0.44881	0.91	4.85	3.94	0.45596	.	0.450772	0.23487	N	0.047657	T	0.19087	0.0458	N	0.03608	-0.345	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.11941	-1.0567	10	0.05833	T	0.94	-28.5474	15.4637	0.75381	0.0:0.1393:0.8607:0.0	.	1281	Q8IWV7	UBR1_HUMAN	K	1281	ENSP00000290650:E1281K	ENSP00000290650:E1281K	E	-	1	0	UBR1	41069527	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	3.576000	0.53878	1.261000	0.44149	-0.234000	0.12200	GAG	UBR1	-	NULL	ENSG00000159459		0.328	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	54	0.00	0	C	NM_174916		43282235	43282235	-1	no_errors	ENST00000290650	ensembl	human	known	69_37n	missense	29	36.96	17	SNP	1.000	T
UQCR10	29796	genome.wustl.edu	37	22	30163499	30163499	+	Nonsense_Mutation	SNP	C	C	T	rs377432442		TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr22:30163499C>T	ENST00000330029.6	+	1	142	c.112C>T	c.(112-114)Caa>Taa	p.Q38*	ZMAT5_ENST00000344318.3_5'Flank|ZMAT5_ENST00000397781.3_5'Flank|UQCR10_ENST00000401406.3_Nonsense_Mutation_p.Q38*	NM_001003684.1|NM_013387.3	NP_001003684.1|NP_037519.2	Q9UDW1	QCR9_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit X	38					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	5						CGCCTTCGATCAAGGCGCGGA	0.602																																						dbGAP											0													41.0	47.0	45.0					22																	30163499		2010	4167	6177	-	-	-	SO:0001587	stop_gained	0			AB028598	CCDS46680.1, CCDS46681.1	22q12.2	2011-07-04			ENSG00000184076	ENSG00000184076		"""Mitochondrial respiratory chain complex / Complex III"""	30863	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa"", ""complex III subunit 9"""	610843				11042152	Standard	NM_013387		Approved	HSPC051, UCRC, QCR9, UCCR7.2	uc003agq.1	Q9UDW1	OTTHUMG00000151283	ENST00000330029.6:c.112C>T	22.37:g.30163499C>T	ENSP00000332887:p.Gln38*	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCM5|Q9T2V6	Nonsense_Mutation	SNP	pfam_Ubiquinol_cyt_c_Rdtase_QCR9,superfamily_Ubiquinol_cyt_c_Rdtase_QCR9	p.Q38*	ENST00000330029.6	37	c.112	CCDS46680.1	22	.	.	.	.	.	.	.	.	.	.	C	36	5.758193	0.96898	.	.	ENSG00000184076	ENST00000330029;ENST00000401406;ENST00000406782	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	1.1857	15.4576	0.75327	0.0:1.0:0.0:0.0	.	.	.	.	X	38	.	ENSP00000332887:Q38X	Q	+	1	0	UQCR10	28493499	1.000000	0.71417	0.991000	0.47740	0.874000	0.50279	6.063000	0.71162	2.720000	0.93068	0.558000	0.71614	CAA	UQCR10	-	pfam_Ubiquinol_cyt_c_Rdtase_QCR9,superfamily_Ubiquinol_cyt_c_Rdtase_QCR9	ENSG00000184076		0.602	UQCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCR10	HGNC	protein_coding	OTTHUMT00000322081.1	22	0.00	0	C	NM_013387		30163499	30163499	+1	no_errors	ENST00000330029	ensembl	human	known	69_37n	nonsense	13	27.78	5	SNP	0.997	T
WDR11	55717	genome.wustl.edu	37	10	122649430	122649430	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr10:122649430G>C	ENST00000263461.6	+	18	2498	c.2252G>C	c.(2251-2253)tGg>tCg	p.W751S	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						CACCGAAGTTGGGTGAGGAAG	0.408																																						dbGAP											0													124.0	115.0	118.0					10																	122649430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.2252G>C	10.37:g.122649430G>C	ENSP00000263461:p.Trp751Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.W751S	ENST00000263461.6	37	c.2252	CCDS7619.1	10	.	.	.	.	.	.	.	.	.	.	g	12.61	1.990321	0.35131	.	.	ENSG00000120008	ENST00000263461	D	0.90324	-2.65	5.61	5.61	0.85477	WD40/YVTN repeat-like-containing domain (1);	0.114030	0.64402	D	0.000004	T	0.80899	0.4712	N	0.12182	0.205	0.80722	D	1	B;B;B;B	0.32467	0.361;0.361;0.372;0.156	B;B;B;B	0.27796	0.054;0.054;0.083;0.026	T	0.78966	-0.1995	10	0.06365	T	0.9	-4.2272	20.0018	0.97417	0.0:0.0:1.0:0.0	.	751;751;42;280	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	S	751	ENSP00000263461:W751S	ENSP00000263461:W751S	W	+	2	0	WDR11	122639420	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.236000	0.95360	2.793000	0.96121	0.655000	0.94253	TGG	WDR11	-	pfam_WD40_repeat,smart_WD40_repeat	ENSG00000120008		0.408	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	72	0.00	0	G			122649430	122649430	+1	no_errors	ENST00000263461	ensembl	human	known	69_37n	missense	101	11.40	13	SNP	1.000	C
WDR82	80335	genome.wustl.edu	37	3	52293228	52293228	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr3:52293228G>A	ENST00000296490.3	-	7	1035	c.754C>T	c.(754-756)Cag>Tag	p.Q252*		NM_025222.3	NP_079498.2	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	252					histone H3-K4 methylation (GO:0051568)	chromatin (GO:0000785)|histone methyltransferase complex (GO:0035097)|PTW/PP1 phosphatase complex (GO:0072357)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)								BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		ATAATAAACTGAGAGTCTGGA	0.363																																						dbGAP											0													124.0	120.0	121.0					3																	52293228		1858	4087	5945	-	-	-	SO:0001587	stop_gained	0			AF132207	CCDS2851.2	3p21.2	2013-01-10	2007-07-04	2007-07-04	ENSG00000164091	ENSG00000164091		"""WD repeat domain containing"""	28826	protein-coding gene	gene with protein product		611059	"""transmembrane protein 113"""	TMEM113		17355966	Standard	NM_025222		Approved	PRO2730, MST107, MSTP107, PRO34047, WDR82A, SWD2	uc003ddl.2	Q6UXN9	OTTHUMG00000150391	ENST00000296490.3:c.754C>T	3.37:g.52293228G>A	ENSP00000296490:p.Gln252*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5R5|Q8TEB2	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Q252*	ENST00000296490.3	37	c.754	CCDS2851.2	3	.	.	.	.	.	.	.	.	.	.	G	38	6.924680	0.97940	.	.	ENSG00000164091	ENST00000296490	.	.	.	5.95	5.95	0.96441	.	0.049276	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-15.2269	18.5451	0.91043	0.0:0.0:1.0:0.0	.	.	.	.	X	252	.	ENSP00000296490:Q252X	Q	-	1	0	WDR82	52268268	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.312000	0.78968	2.821000	0.97095	0.561000	0.74099	CAG	WDR82	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000164091		0.363	WDR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR82	HGNC	protein_coding	OTTHUMT00000317919.1	207	0.00	0	G	NM_025222		52293228	52293228	-1	no_errors	ENST00000296490	ensembl	human	known	69_37n	nonsense	113	50.87	117	SNP	1.000	A
ZEB2	9839	genome.wustl.edu	37	2	145147374	145147374	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr2:145147374C>T	ENST00000558170.2	-	10	4473	c.3289G>A	c.(3289-3291)Gag>Aag	p.E1097K	ZEB2_ENST00000303660.4_Missense_Mutation_p.E1097K|ZEB2_ENST00000539609.3_Missense_Mutation_p.E1073K|ZEB2_ENST00000409487.3_Missense_Mutation_p.E1097K	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1097	Glu-rich (acidic).				cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TGCCCTTTCTCGCGCGCCTCG	0.607																																					Melanoma(33;1235 1264 5755 16332)	dbGAP											0													53.0	54.0	54.0					2																	145147374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3289G>A	2.37:g.145147374C>T	ENSP00000454157:p.Glu1097Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.E1097K	ENST00000558170.2	37	c.3289	CCDS2186.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.675427	0.96764	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.13778	2.57;2.56;2.56	5.51	5.51	0.81932	.	0.141139	0.64402	D	0.000005	T	0.33498	0.0865	L	0.50333	1.59	0.80722	D	1	P;D;D	0.76494	0.924;0.999;0.999	B;D;D	0.71184	0.191;0.972;0.972	T	0.00377	-1.1778	10	0.42905	T	0.14	-6.4202	19.7945	0.96474	0.0:1.0:0.0:0.0	.	1073;1096;1097	F5H814;A0JP08;O60315	.;.;ZEB2_HUMAN	K	1073;1097;1097	ENSP00000443792:E1073K;ENSP00000302501:E1097K;ENSP00000386854:E1097K	ENSP00000302501:E1097K	E	-	1	0	ZEB2	144863844	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.746000	0.94184	0.591000	0.81541	GAG	ZEB2	-	NULL	ENSG00000169554		0.607	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	110	0.00	0	C	NM_014795		145147374	145147374	-1	no_errors	ENST00000303660	ensembl	human	known	69_37n	missense	42	41.67	30	SNP	1.000	T
ZHX2	22882	genome.wustl.edu	37	8	123963911	123963911	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr8:123963911C>G	ENST00000314393.4	+	3	996	c.161C>G	c.(160-162)tCt>tGt	p.S54C		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	54					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S54F(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CTTGAAAACTCTTCCAAAGAA	0.498																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	64.0	66.0					8																	123963911		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.161C>G	8.37:g.123963911C>G	ENSP00000314709:p.Ser54Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S54C	ENST00000314393.4	37	c.161	CCDS6336.1	8	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237464	0.39498	.	.	ENSG00000178764	ENST00000314393	T	0.54279	0.58	4.86	4.86	0.63082	.	0.789057	0.11965	N	0.512338	T	0.55369	0.1916	L	0.55481	1.735	0.46416	D	0.99903	P	0.36990	0.577	B	0.38954	0.286	T	0.57323	-0.7831	10	0.48119	T	0.1	-0.4651	18.172	0.89749	0.0:1.0:0.0:0.0	.	54	Q9Y6X8	ZHX2_HUMAN	C	54	ENSP00000314709:S54C	ENSP00000314709:S54C	S	+	2	0	ZHX2	124033092	1.000000	0.71417	0.942000	0.38095	0.985000	0.73830	4.938000	0.63519	2.531000	0.85337	0.455000	0.32223	TCT	ZHX2	-	NULL	ENSG00000178764		0.498	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZHX2	HGNC	protein_coding	OTTHUMT00000381709.1	79	0.00	0	C	NM_014943		123963911	123963911	+1	no_errors	ENST00000314393	ensembl	human	known	69_37n	missense	332	13.77	53	SNP	0.998	G
ZHX2	22882	genome.wustl.edu	37	8	123964167	123964167	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr8:123964167C>G	ENST00000314393.4	+	3	1252	c.417C>G	c.(415-417)ttC>ttG	p.F139L		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	139					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AGGCCAACTTCAAGCTGAAGT	0.488																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)	dbGAP											0													90.0	86.0	87.0					8																	123964167		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.417C>G	8.37:g.123964167C>G	ENSP00000314709:p.Phe139Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.F139L	ENST00000314393.4	37	c.417	CCDS6336.1	8	.	.	.	.	.	.	.	.	.	.	C	18.97	3.734941	0.69189	.	.	ENSG00000178764	ENST00000314393	T	0.52057	0.68	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.63943	0.2554	L	0.59436	1.845	0.54753	D	0.999989	D	0.76494	0.999	D	0.80764	0.994	T	0.64875	-0.6304	10	0.62326	D	0.03	-20.1808	13.2524	0.60060	0.0:0.9179:0.0:0.0821	.	139	Q9Y6X8	ZHX2_HUMAN	L	139	ENSP00000314709:F139L	ENSP00000314709:F139L	F	+	3	2	ZHX2	124033348	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.649000	0.54417	2.637000	0.89404	0.455000	0.32223	TTC	ZHX2	-	NULL	ENSG00000178764		0.488	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZHX2	HGNC	protein_coding	OTTHUMT00000381709.1	150	0.00	0	C	NM_014943		123964167	123964167	+1	no_errors	ENST00000314393	ensembl	human	known	69_37n	missense	581	12.76	85	SNP	1.000	G
ZNF142	7701	genome.wustl.edu	37	2	219503518	219503519	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr2:219503518_219503519insC	ENST00000449707.1	-	10	5028_5029	c.4607_4608insG	c.(4606-4608)tacfs	p.Y1536fs	ZNF142_ENST00000411696.2_Frame_Shift_Ins_p.Y1536fs	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1536					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CGGGACACTGGTATGGCTTCAG	0.535																																					Colon(170;867 1942 8995 15834 18053)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.4607_4608insG	2.37:g.219503518_219503519insC	ENSP00000408643:p.Tyr1536fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92510	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y1536fs	ENST00000449707.1	37	c.4608_4607	CCDS42817.1	2																																																																																			ZNF142	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000115568		0.535	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1	17	0.00	0	-	NM_005081		219503518	219503519	-1	no_errors	ENST00000411696	ensembl	human	known	69_37n	frame_shift_ins	15	21.05	4	INS	1.000:1.000	C
ZNF682	91120	genome.wustl.edu	37	19	20117297	20117297	+	Silent	SNP	C	C	T			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr19:20117297C>T	ENST00000397165.2	-	4	1174	c.1014G>A	c.(1012-1014)gaG>gaA	p.E338E	ZNF682_ENST00000596019.1_Intron|ZNF682_ENST00000597972.1_Silent_p.E344E|ZNF682_ENST00000358523.5_Silent_p.E306E|ZNF682_ENST00000397162.1_Silent_p.E306E|ZNF682_ENST00000595736.1_Silent_p.E262E	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E338E(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						TATAGGGTTTCTCTCCCGTAT	0.383																																						dbGAP											1	Substitution - coding silent(1)	urinary_tract(1)											60.0	64.0	63.0					19																	20117297		2139	4259	6398	-	-	-	SO:0001819	synonymous_variant	0			AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.1014G>A	19.37:g.20117297C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU64|E9PFJ5|Q96JV9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E338	ENST00000397165.2	37	c.1014	CCDS42533.1	19																																																																																			ZNF682	-	pfscan_Znf_C2H2	ENSG00000197124		0.383	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF682	HGNC	protein_coding	OTTHUMT00000462888.1	211	0.00	0	C	NM_033196		20117297	20117297	-1	no_errors	ENST00000397165	ensembl	human	known	69_37n	silent	168	24.32	54	SNP	1.000	T
ZNF705E	100131539	genome.wustl.edu	37	11	71528103	71528103	+	RNA	SNP	C	C	G			TCGA-A8-A092-01A-11W-A019-09	TCGA-A8-A092-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	732dd0ab-c869-4d35-973f-9db064680fb1	40550f2e-0413-4ddf-85e3-edce4f47f62e	g.chr11:71528103C>G	ENST00000525199.1	-	0	429							A8MWA4	Z705E_HUMAN	zinc finger protein 705E						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TCTCCCGAATCATTACATTCA	0.373																																						dbGAP											0																																										-	-	-			0					11q13.4	2013-04-03			ENSG00000214534	ENSG00000214534			33203	other	unknown							Standard	NM_001278713		Approved			A8MWA4	OTTHUMG00000167482		11.37:g.71528103C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000525199.1	37	NULL		11																																																																																			ZNF705E	-	-	ENSG00000214534		0.373	ZNF705E-002	KNOWN	basic	processed_transcript	ZNF705E	HGNC	pseudogene	OTTHUMT00000394768.1	293	0.00	0	C			71528103	71528103	-1	no_errors	ENST00000525199	ensembl	human	known	69_37n	rna	339	25.98	119	SNP	0.003	G
