#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA3	21	genome.wustl.edu	37	16	2345608	2345608	+	Silent	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr16:2345608G>C	ENST00000301732.5	-	18	3097	c.2397C>G	c.(2395-2397)ccC>ccG	p.P799P	ABCA3_ENST00000382381.3_Silent_p.P741P	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	799					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TGCTCTCTCTGGGAAGGATGA	0.627																																						dbGAP											0													147.0	149.0	148.0					16																	2345608		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2397C>G	16.37:g.2345608G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P799	ENST00000301732.5	37	c.2397	CCDS10466.1	16																																																																																			ABCA3	-	NULL	ENSG00000167972		0.627	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	34	0.00	0	G	NM_001089		2345608	2345608	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	silent	49	10.91	6	SNP	0.998	C
ADAMTS10	81794	genome.wustl.edu	37	19	8651509	8651509	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:8651509C>T	ENST00000597188.1	-	20	2606	c.2336G>A	c.(2335-2337)cGa>cAa	p.R779Q	ADAMTS10_ENST00000595838.1_Missense_Mutation_p.R266Q|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.R779Q	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	779	Spacer.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						TGGCCCCTGTCGCAGTTGAAA	0.637											OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													63.0	67.0	66.0					19																	8651509		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.2336G>A	19.37:g.8651509C>T	ENSP00000471851:p.Arg779Gln	Somatic	81	WXS	Illumina GAIIx	Phase_IV	M0QZE4	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R779Q	ENST00000597188.1	37	c.2336	CCDS12206.1	19	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138208	0.56936	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.51071	0.72	4.92	3.66	0.41972	ADAM-TS Spacer 1 (1);	0.070235	0.53938	U	0.000052	T	0.36468	0.0968	L	0.38175	1.15	0.58432	D	0.999998	B;P;D	0.61080	0.185;0.657;0.989	B;B;P	0.48627	0.021;0.297;0.584	T	0.11131	-1.0600	10	0.11794	T	0.64	.	6.3732	0.21493	0.0:0.7362:0.0:0.2638	.	533;779;266	Q59FE5;Q9H324;E9PCI6	.;ATS10_HUMAN;.	Q	779;533	ENSP00000270328:R779Q	ENSP00000270328:R779Q	R	-	2	0	ADAMTS10	8557509	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	2.317000	0.43770	2.276000	0.75962	0.655000	0.94253	CGA	ADAMTS10	-	pfam_ADAM_spacer1	ENSG00000142303		0.637	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS10	HGNC	protein_coding	OTTHUMT00000460085.3	33	0.00	0	C	NM_030957		8651509	8651509	-1	no_errors	ENST00000270328	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.999	T
ADAMTS19	171019	genome.wustl.edu	37	5	129001204	129001204	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr5:129001204T>A	ENST00000274487.4	+	16	2565	c.2420T>A	c.(2419-2421)gTg>gAg	p.V807E	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	807	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TATGTAGAAGTGCTGGTGATA	0.383																																						dbGAP											0													102.0	95.0	97.0					5																	129001204		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2420T>A	5.37:g.129001204T>A	ENSP00000274487:p.Val807Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V807E	ENST00000274487.4	37	c.2420	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	T	16.79	3.221243	0.58560	.	.	ENSG00000145808	ENST00000274487	T	0.61742	0.08	4.58	4.58	0.56647	ADAM-TS Spacer 1 (1);	0.128035	0.34700	N	0.003759	T	0.51295	0.1666	M	0.73598	2.24	0.46774	D	0.999191	P	0.38677	0.642	B	0.36808	0.233	T	0.55829	-0.8079	9	.	.	.	.	4.5327	0.12013	0.0:0.2259:0.0:0.774	.	807	Q8TE59	ATS19_HUMAN	E	807	ENSP00000274487:V807E	.	V	+	2	0	ADAMTS19	129029103	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.575000	0.60908	2.281000	0.76405	0.533000	0.62120	GTG	ADAMTS19	-	pfam_ADAM_spacer1	ENSG00000145808		0.383	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	55	0.00	0	T	NM_133638		129001204	129001204	+1	no_errors	ENST00000274487	ensembl	human	known	69_37n	missense	43	45.57	36	SNP	0.999	A
AGAP6	414189	genome.wustl.edu	37	10	51769464	51769464	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr10:51769464G>A	ENST00000374056.4	+	7	1908	c.1510G>A	c.(1510-1512)Gag>Aag	p.E504K	AGAP6_ENST00000412531.3_Missense_Mutation_p.E527K			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	504	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						CTGGCCAGTTGAGCTCAGGAA	0.537																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.1510G>A	10.37:g.51769464G>A	ENSP00000363168:p.Glu504Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.E527K	ENST00000374056.4	37	c.1579		10	.	.	.	.	.	.	.	.	.	.	.	16.48	3.136496	0.56936	.	.	ENSG00000204149	ENST00000374056;ENST00000412531	.	.	.	0.0465	0.0465	0.14256	.	0.000000	0.85682	D	0.000000	T	0.68449	0.3002	M	0.81802	2.56	0.48236	D	0.999618	D	0.67145	0.996	D	0.64877	0.93	T	0.66388	-0.5936	9	0.66056	D	0.02	.	5.9248	0.19104	7.0E-4:0.0:0.9993:0.0	.	527	C9IYN2	.	K	527;504	.	ENSP00000363168:E527K	E	+	1	0	AGAP6	51439470	1.000000	0.71417	0.079000	0.20413	0.080000	0.17528	6.453000	0.73488	0.132000	0.18615	0.134000	0.15878	GAG	AGAP6	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	ENSG00000204149		0.537	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	AGAP6	HGNC	protein_coding		239	0.00	0	G	NM_001077665		51769464	51769464	+1	no_errors	ENST00000374056	ensembl	human	known	69_37n	missense	107	52.23	117	SNP	1.000	A
AKAP11	11215	genome.wustl.edu	37	13	42876457	42876457	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr13:42876457C>G	ENST00000025301.2	+	8	3750	c.3575C>G	c.(3574-3576)tCa>tGa	p.S1192*		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1192					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)	p.S1192*(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TCGGAGCACTCAGGGAAGAAG	0.413																																						dbGAP											1	Substitution - Nonsense(1)	cervix(1)											59.0	63.0	62.0					13																	42876457		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3575C>G	13.37:g.42876457C>G	ENSP00000025301:p.Ser1192*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75124|Q9NUK7	Nonsense_Mutation	SNP	NULL	p.S1192*	ENST00000025301.2	37	c.3575	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	C	42	9.548442	0.99202	.	.	ENSG00000023516	ENST00000025301	.	.	.	5.8	4.96	0.65561	.	1.232610	0.05724	N	0.598210	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	15.1742	0.72899	0.0:0.9318:0.0:0.0682	.	.	.	.	X	1192	.	ENSP00000025301:S1192X	S	+	2	0	AKAP11	41774457	0.031000	0.19500	0.597000	0.28824	0.936000	0.57629	1.272000	0.33109	1.434000	0.47414	0.655000	0.94253	TCA	AKAP11	-	NULL	ENSG00000023516		0.413	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	156	0.00	0	C	NM_016248		42876457	42876457	+1	no_errors	ENST00000025301	ensembl	human	known	69_37n	nonsense	113	30.67	50	SNP	0.997	G
AMMECR1L	83607	genome.wustl.edu	37	2	128628473	128628474	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:128628473_128628474insG	ENST00000272647.5	-	5	807_808	c.547_548insC	c.(547-549)ctgfs	p.L183fs	AMMECR1L_ENST00000393001.1_Frame_Shift_Ins_p.L183fs	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like	183	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		CTCTCGGGTCAGGGGGGGAAAT	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535	ENST00000272647.5:c.548dupC	2.37:g.128628480_128628480dupG	ENSP00000272647:p.Leu183fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E276	Frame_Shift_Ins	INS	pfam_AMMECR1_domain,pfscan_AMMECR1_domain,tigrfam_AMMECR1	p.L183fs	ENST00000272647.5	37	c.548_547	CCDS2152.1	2																																																																																			AMMECR1L	-	pfam_AMMECR1_domain,pfscan_AMMECR1_domain,tigrfam_AMMECR1	ENSG00000144233		0.540	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMMECR1L	HGNC	protein_coding	OTTHUMT00000254392.1	30	0.00	0	-	NM_031445		128628473	128628474	-1	no_errors	ENST00000272647	ensembl	human	known	69_37n	frame_shift_ins	36	10.00	4	INS	1.000:1.000	G
ARG2	384	genome.wustl.edu	37	14	68087661	68087661	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr14:68087661G>A	ENST00000261783.3	+	2	342	c.162G>A	c.(160-162)ttG>ttA	p.L54L	ARG2_ENST00000556491.1_3'UTR	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	54					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	AAGCTGGCTTGATGAAAAGGC	0.428																																						dbGAP											0													176.0	163.0	167.0					14																	68087661		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.162G>A	14.37:g.68087661G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R690|Q6FHY8	Silent	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase	p.L54	ENST00000261783.3	37	c.162	CCDS9785.1	14																																																																																			ARG2	-	pfam_Ureohydrolase,tigrfam_Arginase	ENSG00000081181		0.428	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARG2	HGNC	protein_coding	OTTHUMT00000415190.2	141	0.00	0	G	NM_001172		68087661	68087661	+1	no_errors	ENST00000261783	ensembl	human	known	69_37n	silent	125	24.24	40	SNP	0.998	A
ASB1	51665	genome.wustl.edu	37	2	239353148	239353148	+	Silent	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:239353148C>T	ENST00000264607.4	+	4	907	c.660C>T	c.(658-660)ttC>ttT	p.F220F	ASB1_ENST00000409297.1_Silent_p.F119F	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	220					intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		ACCCTGACTTCAACTGCAATG	0.612																																						dbGAP											0													74.0	64.0	67.0					2																	239353148		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.660C>T	2.37:g.239353148C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL50|Q4ZG29|Q9ULS4	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.F220	ENST00000264607.4	37	c.660	CCDS33416.1	2																																																																																			ASB1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000065802		0.612	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB1	HGNC	protein_coding	OTTHUMT00000328294.1	41	0.00	0	C	NM_001040445		239353148	239353148	+1	no_errors	ENST00000264607	ensembl	human	known	69_37n	silent	17	72.58	45	SNP	1.000	T
ASH2L	9070	genome.wustl.edu	37	8	37967942	37967942	+	Silent	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr8:37967942C>T	ENST00000343823.6	+	4	756	c.447C>T	c.(445-447)gtC>gtT	p.V149V	ASH2L_ENST00000428278.2_Silent_p.V55V|ASH2L_ENST00000545394.1_Silent_p.V10V|ASH2L_ENST00000521652.1_Silent_p.V55V|ASH2L_ENST00000250635.7_Silent_p.V55V	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	149	DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				ATTGCAACGTCTGCCATCACA	0.408																																						dbGAP											0													140.0	122.0	128.0					8																	37967942		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.447C>T	8.37:g.37967942C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Silent	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	p.V149	ENST00000343823.6	37	c.447	CCDS6101.1	8																																																																																			ASH2L	-	NULL	ENSG00000129691		0.408	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASH2L	HGNC	protein_coding	OTTHUMT00000376749.4	70	0.00	0	C	NM_004674		37967942	37967942	+1	no_errors	ENST00000343823	ensembl	human	known	69_37n	silent	51	38.55	32	SNP	0.434	T
MYRF	745	genome.wustl.edu	37	11	61539012	61539013	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr11:61539012_61539013insC	ENST00000278836.5	+	6	877_878	c.781_782insC	c.(781-783)tccfs	p.S261fs	TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000327797.1_5'Flank|MYRF_ENST00000265460.5_Frame_Shift_Ins_p.S252fs	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	261	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S255fs*74(1)									GCACTCTGAATCCCCCCCCAGC	0.634																																						dbGAP											1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.789dupC	11.37:g.61539020_61539020dupC	ENSP00000278836:p.Ser261fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O43582|Q9P1Q6	Frame_Shift_Ins	INS	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	p.S264fs	ENST00000278836.5	37	c.781_782	CCDS44622.1	11																																																																																			C11orf9	-	NULL	ENSG00000124920		0.634	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf9	HGNC	protein_coding	OTTHUMT00000398519.2	44	0.00	0	-	NM_013279		61539012	61539013	+1	no_errors	ENST00000278836	ensembl	human	known	69_37n	frame_shift_ins	22	12.00	3	INS	1.000:1.000	C
C4orf19	55286	genome.wustl.edu	37	4	37591780	37591780	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr4:37591780G>A	ENST00000284437.6	+	3	281	c.103G>A	c.(103-105)Gaa>Aaa	p.E35K	C4orf19_ENST00000508175.1_Intron|C4orf19_ENST00000381980.4_Missense_Mutation_p.E35K|RP11-36B15.1_ENST00000503034.1_RNA	NM_018302.2	NP_060772.2	Q8IY42	CD019_HUMAN	chromosome 4 open reading frame 19	35										large_intestine(1)|lung(3)|skin(3)|stomach(1)|urinary_tract(1)	9						CAAGCTAGATGAAGACGACAC	0.458																																						dbGAP											0													241.0	253.0	249.0					4																	37591780		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037906	CCDS3442.1	4p14	2008-02-05			ENSG00000154274	ENSG00000154274			25618	protein-coding gene	gene with protein product						12477932	Standard	NM_001104629		Approved	FLJ11017	uc003gsw.4	Q8IY42	OTTHUMG00000128580	ENST00000284437.6:c.103G>A	4.37:g.37591780G>A	ENSP00000284437:p.Glu35Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NV03	Missense_Mutation	SNP	NULL	p.E35K	ENST00000284437.6	37	c.103	CCDS3442.1	4	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637739	0.87760	.	.	ENSG00000154274	ENST00000381980;ENST00000284437	T;T	0.35048	1.33;1.33	5.54	5.54	0.83059	.	0.107041	0.41938	D	0.000797	T	0.58878	0.2153	M	0.63843	1.955	0.41309	D	0.987096	D	0.89917	1.0	D	0.74674	0.984	T	0.59710	-0.7403	10	0.87932	D	0	-21.3716	17.8477	0.88736	0.0:0.0:1.0:0.0	.	35	Q8IY42	CD019_HUMAN	K	35	ENSP00000371408:E35K;ENSP00000284437:E35K	ENSP00000284437:E35K	E	+	1	0	C4orf19	37268175	1.000000	0.71417	0.800000	0.32199	0.709000	0.40893	4.128000	0.57951	2.884000	0.98904	0.655000	0.94253	GAA	C4orf19	-	NULL	ENSG00000154274		0.458	C4orf19-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C4orf19	HGNC	protein_coding	OTTHUMT00000250432.1	207	0.00	0	G	NM_018302		37591780	37591780	+1	no_errors	ENST00000284437	ensembl	human	known	69_37n	missense	245	17.51	52	SNP	0.972	A
CABP5	56344	genome.wustl.edu	37	19	48537515	48537515	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:48537515G>A	ENST00000293255.2	-	5	583	c.453C>T	c.(451-453)gtC>gtT	p.V151V		NM_019855.4	NP_062829.1	Q9NP86	CABP5_HUMAN	calcium binding protein 5	151	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	11		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)		CAGCCTCCCGGACAACCTCAG	0.617																																						dbGAP											0													47.0	41.0	43.0					19																	48537515		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF169159	CCDS12709.1	19q13.33	2014-08-12			ENSG00000105507	ENSG00000105507		"""EF-hand domain containing"""	13714	protein-coding gene	gene with protein product		607315	"""calcium binding protein 3"""	CABP3		10625670	Standard	NM_019855		Approved	CaBP3	uc002phu.2	Q9NP86	OTTHUMG00000183139	ENST00000293255.2:c.453C>T	19.37:g.48537515G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUY4	Silent	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.V151	ENST00000293255.2	37	c.453	CCDS12709.1	19																																																																																			CABP5	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000105507		0.617	CABP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABP5	HGNC	protein_coding	OTTHUMT00000465212.1	36	0.00	0	G	NM_019855		48537515	48537515	-1	no_errors	ENST00000293255	ensembl	human	known	69_37n	silent	29	52.94	36	SNP	1.000	A
CD163L1	283316	genome.wustl.edu	37	12	7522120	7522120	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr12:7522120G>A	ENST00000313599.3	-	15	3929	c.3872C>T	c.(3871-3873)tCt>tTt	p.S1291F	CD163L1_ENST00000396630.1_Missense_Mutation_p.S1291F|CD163L1_ENST00000416109.2_Missense_Mutation_p.S1301F			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1291	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						AGCCAGAGCAGAGCCACAGCC	0.592																																						dbGAP											0													104.0	99.0	101.0					12																	7522120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3872C>T	12.37:g.7522120G>A	ENSP00000315945:p.Ser1291Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.S1291F	ENST00000313599.3	37	c.3872	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947633	0.34377	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.36340	1.26;1.26;1.26	2.67	-2.2	0.06994	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.331667	0.21062	U	0.080819	T	0.48624	0.1510	M	0.79926	2.475	0.09310	N	1	D;D	0.67145	0.984;0.996	D;D	0.68621	0.932;0.959	T	0.40403	-0.9565	10	0.56958	D	0.05	.	1.9136	0.03292	0.1178:0.1626:0.2274:0.4922	.	1301;1291	E7EVK4;Q9NR16	.;C163B_HUMAN	F	1291;1301;1291	ENSP00000315945:S1291F;ENSP00000393474:S1301F;ENSP00000379871:S1291F	ENSP00000315945:S1291F	S	-	2	0	CD163L1	7413387	0.000000	0.05858	0.004000	0.12327	0.163000	0.22366	-0.910000	0.04054	-0.541000	0.06257	-0.302000	0.09304	TCT	CD163L1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000177675		0.592	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	321	0.00	0	G	NM_174941		7522120	7522120	-1	no_errors	ENST00000313599	ensembl	human	known	69_37n	missense	101	54.91	123	SNP	0.001	A
COL10A1	1300	genome.wustl.edu	37	6	116442021	116442021	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr6:116442021G>A	ENST00000327673.4	-	2	1665	c.1258C>T	c.(1258-1260)Ctc>Ttc	p.L420F	NT5DC1_ENST00000319550.4_Intron|AL121963.1_ENST00000430695.1_5'Flank|COL10A1_ENST00000243222.4_Missense_Mutation_p.L420F			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	420	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		GGGCCTGGGAGACCAGGAGGT	0.592																																						dbGAP											0													49.0	50.0	49.0					6																	116442021		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.1258C>T	6.37:g.116442021G>A	ENSP00000327368:p.Leu420Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4P2	Missense_Mutation	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.L420F	ENST00000327673.4	37	c.1258	CCDS5105.1	6	.	.	.	.	.	.	.	.	.	.	G	3.950	-0.012524	0.07727	.	.	ENSG00000123500	ENST00000243222;ENST00000327673	D;D	0.93659	-3.26;-3.26	4.69	1.81	0.25067	.	0.399014	0.25738	N	0.028629	T	0.79173	0.4401	L	0.46670	1.46	0.39422	D	0.966937	P	0.39216	0.664	B	0.27500	0.08	T	0.74609	-0.3608	10	0.51188	T	0.08	.	5.5351	0.17007	0.0703:0.1224:0.5549:0.2525	.	420	Q03692	COAA1_HUMAN	F	420	ENSP00000243222:L420F;ENSP00000327368:L420F	ENSP00000243222:L420F	L	-	1	0	COL10A1	116548714	0.499000	0.26083	0.988000	0.46212	0.918000	0.54935	0.877000	0.28106	0.245000	0.21373	0.555000	0.69702	CTC	COL10A1	-	NULL	ENSG00000123500		0.592	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL10A1	HGNC	protein_coding	OTTHUMT00000041926.1	79	0.00	0	G			116442021	116442021	-1	no_errors	ENST00000243222	ensembl	human	known	69_37n	missense	39	26.42	14	SNP	0.950	A
COL28A1	340267	genome.wustl.edu	37	7	7412809	7412809	+	Missense_Mutation	SNP	G	G	A	rs201662547	byFrequency	TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr7:7412809G>A	ENST00000399429.3	-	32	2868	c.2728C>T	c.(2728-2730)Cgt>Tgt	p.R910C		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	910	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TCTTTATCACGAGAATCTGTC	0.458													G|||	2	0.000399361	0.0	0.0	5008	,	,		21148	0.001		0.0	False		,,,				2504	0.001					dbGAP											0													95.0	90.0	91.0					7																	7412809		1936	4131	6067	-	-	-	SO:0001583	missense	0			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.2728C>T	7.37:g.7412809G>A	ENSP00000382356:p.Arg910Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.R910C	ENST00000399429.3	37	c.2728	CCDS43553.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	15.11	2.737024	0.49045	.	.	ENSG00000215018	ENST00000399429	T	0.78481	-1.18	4.09	4.09	0.47781	von Willebrand factor, type A (3);	0.095709	0.40302	U	0.001130	D	0.89619	0.6767	M	0.90425	3.115	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	D	0.90310	0.4336	10	0.38643	T	0.18	-4.4705	16.8665	0.86030	0.0:0.0:1.0:0.0	.	910	Q2UY09	COSA1_HUMAN	C	910	ENSP00000382356:R910C	ENSP00000382356:R910C	R	-	1	0	COL28A1	7379334	0.177000	0.23109	0.425000	0.26659	0.565000	0.35776	1.429000	0.34903	2.284000	0.76573	0.655000	0.94253	CGT	COL28A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000215018		0.458	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	147	0.00	0	G	NM_001037763		7412809	7412809	-1	no_errors	ENST00000399429	ensembl	human	known	69_37n	missense	101	24.06	32	SNP	0.927	A
CPAMD8	27151	genome.wustl.edu	37	19	17108122	17108122	+	Silent	SNP	G	G	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:17108122G>T	ENST00000443236.1	-	11	1066	c.1035C>A	c.(1033-1035)atC>atA	p.I345I	CPAMD8_ENST00000388925.4_Silent_p.I298I	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	298						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCCTCACGCAGATGTCGAAGT	0.612																																						dbGAP											0													13.0	15.0	14.0					19																	17108122		1999	4164	6163	-	-	-	SO:0001819	synonymous_variant	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1035C>A	19.37:g.17108122G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.S356Y	ENST00000443236.1	37	c.1067	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	g	8.717	0.913525	0.17907	.	.	ENSG00000160111	ENST00000443236	.	.	.	3.0	-1.86	0.07760	.	.	.	.	.	T	0.50222	0.1603	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44143	-0.9347	4	.	.	.	.	6.0228	0.19638	0.2536:0.2703:0.4761:0.0	.	.	.	.	Y	356	.	.	S	-	2	0	CPAMD8	16969122	0.995000	0.38212	0.964000	0.40570	0.805000	0.45488	0.042000	0.13949	0.011000	0.14865	-0.263000	0.10527	TCT	CPAMD8	-	NULL	ENSG00000160111		0.612	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	10	0.00	0	G	NM_015692		17108122	17108122	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443236	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	1.000	T
DDHD2	23259	genome.wustl.edu	37	8	38117635	38117635	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr8:38117635A>G	ENST00000397166.2	+	17	2657	c.2132A>G	c.(2131-2133)cAg>cGg	p.Q711R	DDHD2_ENST00000520272.2_Missense_Mutation_p.Q711R|DDHD2_ENST00000517385.1_Missense_Mutation_p.Q330R|DDHD2_ENST00000529845.1_Missense_Mutation_p.Q162R	NM_015214.2	NP_056029.2	O94830	DDHD2_HUMAN	DDHD domain containing 2	711					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)|urinary_tract(2)	28	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			CAGCCTTTACAGTAAAAATGA	0.333																																						dbGAP											0													120.0	116.0	117.0					8																	38117635		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056525	CCDS34883.1	8p11.23	2014-03-03	2004-04-05	2004-04-07				"""Sterile alpha motif (SAM) domain containing"""	29106	protein-coding gene	gene with protein product		615003	"""SAM, WWE and DDHD domain containing 1"""	SAMWD1		9872452, 11788596, 19632984, 20932832	Standard	NM_015214		Approved	KIAA0725, SPG54	uc003xlc.3	O94830		ENST00000397166.2:c.2132A>G	8.37:g.38117635A>G	ENSP00000380352:p.Gln711Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWV2|B3KXB5|Q9H8X7	Missense_Mutation	SNP	pfam_DDHD,pfam_WWE-dom,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_DDHD,pfscan_WWE-dom	p.Q711R	ENST00000397166.2	37	c.2132	CCDS34883.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.99|18.99	3.739754|3.739754	0.69304|0.69304	.|.	.|.	ENSG00000085788|ENSG00000085788	ENST00000397166;ENST00000520272;ENST00000517385;ENST00000529845;ENST00000528613|ENST00000526144	T;T|.	0.31510|.	1.49;1.49|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.216999|.	0.38720|.	N|.	0.001582|.	T|T	0.41419|0.41419	0.1158|0.1158	L|L	0.36672|0.36672	1.1|1.1	0.32248|0.32248	N|N	0.57182|0.57182	D|.	0.57257|.	0.979|.	P|.	0.47528|.	0.549|.	T|T	0.52283|0.52283	-0.8596|-0.8596	10|5	0.51188|.	T|.	0.08|.	.|.	6.9297|6.9297	0.24434|0.24434	0.6966:0.1642:0.0:0.1392|0.6966:0.1642:0.0:0.1392	.|.	711|.	O94830|.	DDHD2_HUMAN|.	R|G	711;711;330;162;79|213	ENSP00000380352:Q711R;ENSP00000429932:Q711R|.	ENSP00000380352:Q711R|.	Q|S	+|+	2|1	0|0	DDHD2|DDHD2	38236792|38236792	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.904000|0.904000	0.53231|0.53231	3.656000|3.656000	0.54467|0.54467	2.141000|2.141000	0.66446|0.66446	0.533000|0.533000	0.62120|0.62120	CAG|AGT	DDHD2	-	NULL	ENSG00000085788		0.333	DDHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDHD2	HGNC	protein_coding	OTTHUMT00000377251.2	116	0.00	0	A	XM_291291		38117635	38117635	+1	no_errors	ENST00000397166	ensembl	human	known	69_37n	missense	158	20.20	40	SNP	0.972	G
DGUOK	1716	genome.wustl.edu	37	2	74154071	74154071	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:74154071C>T	ENST00000264093.4	+	1	119	c.34C>T	c.(34-36)Cga>Tga	p.R12*	DGUOK_ENST00000356837.6_Nonsense_Mutation_p.R12*|DGUOK_ENST00000348222.1_Nonsense_Mutation_p.R12*|DGUOK_ENST00000462685.1_3'UTR	NM_080916.2	NP_550438.1	Q16854	DGUOK_HUMAN	deoxyguanosine kinase	12					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|dGTP metabolic process (GO:0046070)|guanosine metabolic process (GO:0008617)|negative regulation of neuron projection development (GO:0010977)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein phosphorylation (GO:0006468)|purine deoxyribonucleoside metabolic process (GO:0046122)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxyguanosine kinase activity (GO:0004138)|nucleoside kinase activity (GO:0019206)			endometrium(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	8					Nelarabine(DB01280)	AAGTCGGCTTCGAGCACCCTT	0.652																																						dbGAP											0													48.0	45.0	46.0					2																	74154071		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U41668	CCDS1931.1, CCDS1932.1	2p13	2008-02-05			ENSG00000114956	ENSG00000114956	2.7.1.113		2858	protein-coding gene	gene with protein product		601465					Standard	NM_080916		Approved	dGK	uc002sjx.3	Q16854	OTTHUMG00000129819	ENST00000264093.4:c.34C>T	2.37:g.74154071C>T	ENSP00000264093:p.Arg12*	Somatic		WXS	Illumina GAIIx	Phase_IV	P78532|Q16759|Q4ZG09|Q7L1W9|Q96BC1	Nonsense_Mutation	SNP	pfam_Deoxynucleoside_kinase	p.R12*	ENST00000264093.4	37	c.34	CCDS1931.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.379600	0.95945	.	.	ENSG00000114956	ENST00000264093;ENST00000348222;ENST00000356837;ENST00000347161	.	.	.	4.19	4.19	0.49359	.	0.549745	0.18015	N	0.154439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.5185	12.3492	0.55139	0.0:1.0:0.0:0.0	.	.	.	.	X	12	.	ENSP00000264093:R12X	R	+	1	2	DGUOK	74007579	0.897000	0.30589	0.274000	0.24659	0.162000	0.22319	3.232000	0.51302	2.622000	0.88805	0.655000	0.94253	CGA	DGUOK	-	NULL	ENSG00000114956		0.652	DGUOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGUOK	HGNC	protein_coding	OTTHUMT00000252050.1	21	0.00	0	C			74154071	74154071	+1	no_errors	ENST00000264093	ensembl	human	known	69_37n	nonsense	22	21.43	6	SNP	0.302	T
DNAH2	146754	genome.wustl.edu	37	17	7690336	7690336	+	Silent	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr17:7690336C>T	ENST00000572933.1	+	42	8048	c.6588C>T	c.(6586-6588)atC>atT	p.I2196I	DNAH2_ENST00000389173.2_Silent_p.I2196I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2196	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCGAGCGCATCGCGATGCCCG	0.637																																						dbGAP											0													59.0	40.0	46.0					17																	7690336		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6588C>T	17.37:g.7690336C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.I2196	ENST00000572933.1	37	c.6588	CCDS32551.1	17																																																																																			DNAH2	-	pfam_ATPase_dyneun-rel_AAA	ENSG00000183914		0.637	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	22	0.00	0	C	NM_020877		7690336	7690336	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	silent	36	68.64	81	SNP	0.472	T
FAM120C	54954	genome.wustl.edu	37	X	54112178	54112178	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:54112178G>A	ENST00000375180.2	-	13	2865	c.2809C>T	c.(2809-2811)Ccc>Tcc	p.P937S	FAM120C_ENST00000328235.4_Intron	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	937							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CCTTGAGGGGGAAGTGGCATG	0.478																																						dbGAP											0													71.0	64.0	66.0					X																	54112178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.2809C>T	X.37:g.54112178G>A	ENSP00000364324:p.Pro937Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMT7	Missense_Mutation	SNP	NULL	p.P937S	ENST00000375180.2	37	c.2809	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	g	17.98	3.521319	0.64747	.	.	ENSG00000184083	ENST00000375180	T	0.27890	1.64	4.74	3.87	0.44632	.	0.066470	0.64402	N	0.000009	T	0.48259	0.1490	M	0.71581	2.175	0.80722	D	1	P	0.41188	0.741	P	0.54815	0.761	T	0.49244	-0.8960	10	0.87932	D	0	-1.8419	11.4576	0.50191	0.0933:0.0:0.9067:0.0	.	937	Q9NX05	F120C_HUMAN	S	937	ENSP00000364324:P937S	ENSP00000364324:P937S	P	-	1	0	FAM120C	54128903	1.000000	0.71417	0.990000	0.47175	0.657000	0.38888	6.544000	0.73878	0.930000	0.37217	-0.200000	0.12747	CCC	FAM120C	-	NULL	ENSG00000184083		0.478	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	83	0.00	0	G	NM_017848		54112178	54112178	-1	no_errors	ENST00000375180	ensembl	human	known	69_37n	missense	48	57.52	65	SNP	1.000	A
FASTKD2	22868	genome.wustl.edu	37	2	207639085	207639085	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:207639085C>T	ENST00000236980.6	+	7	1739	c.1391C>T	c.(1390-1392)tCt>tTt	p.S464F	FASTKD2_ENST00000403094.3_Missense_Mutation_p.S464F|FASTKD2_ENST00000402774.3_Missense_Mutation_p.S464F	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	464					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		CATACTTACTCTTCTCTCAAT	0.308																																						dbGAP											0													114.0	117.0	116.0					2																	207639085		2202	4298	6500	-	-	-	SO:0001583	missense	0			BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1391C>T	2.37:g.207639085C>T	ENSP00000236980:p.Ser464Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	pfam_FAST_Leu-rich,pfam_FAST_2,pfam_RAP,smart_RAP	p.S464F	ENST00000236980.6	37	c.1391	CCDS2371.1	2	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428433	0.62844	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.52295	0.67;0.67;0.67	5.99	5.99	0.97316	FAST kinase leucine-rich (1);	0.201402	0.45361	D	0.000369	T	0.70378	0.3217	M	0.74881	2.28	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79784	0.991;0.993	T	0.69183	-0.5212	10	0.51188	T	0.08	-33.983	19.2492	0.93917	0.0:1.0:0.0:0.0	.	464;464	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	F	464	ENSP00000236980:S464F;ENSP00000385990:S464F;ENSP00000384929:S464F	ENSP00000236980:S464F	S	+	2	0	FASTKD2	207347330	1.000000	0.71417	0.993000	0.49108	0.288000	0.27193	5.645000	0.67909	2.840000	0.97914	0.655000	0.94253	TCT	FASTKD2	-	pfam_FAST_Leu-rich	ENSG00000118246		0.308	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD2	HGNC	protein_coding	OTTHUMT00000256428.2	239	0.42	1	C	NM_014929		207639085	207639085	+1	no_errors	ENST00000236980	ensembl	human	known	69_37n	missense	86	54.01	101	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126370964	126370964	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr4:126370964G>C	ENST00000394329.3	+	9	8806	c.8793G>C	c.(8791-8793)caG>caC	p.Q2931H	FAT4_ENST00000335110.5_Missense_Mutation_p.Q1229H	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2931	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCAATAAACAGATCTTAAAAT	0.338																																						dbGAP											0													60.0	63.0	62.0					4																	126370964		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8793G>C	4.37:g.126370964G>C	ENSP00000377862:p.Gln2931His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.Q2931H	ENST00000394329.3	37	c.8793	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309212	0.40895	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01767	4.65;4.65	5.34	3.62	0.41486	Cadherin (4);Cadherin-like (1);	0.000000	0.33092	U	0.005284	T	0.06050	0.0157	L	0.48935	1.535	0.48901	D	0.999721	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.87578	0.994;0.998;0.997	T	0.32188	-0.9916	10	0.49607	T	0.09	.	10.1511	0.42794	0.2157:0.0:0.7843:0.0	.	1229;2931;2931	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	H	2931;1229	ENSP00000377862:Q2931H;ENSP00000335169:Q1229H	ENSP00000335169:Q1229H	Q	+	3	2	FAT4	126590414	1.000000	0.71417	0.990000	0.47175	0.942000	0.58702	2.161000	0.42358	0.751000	0.32900	-0.136000	0.14681	CAG	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.338	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	198	0.00	0	G	NM_024582		126370964	126370964	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	91	23.53	28	SNP	0.995	C
FOLR4	390243	genome.wustl.edu	37	11	94039800	94039800	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr11:94039800G>A	ENST00000440961.2	+	2	304	c.260G>A	c.(259-261)cGg>cAg	p.R87Q		NM_001199206.1	NP_001186135.1	A6ND01	JUNO_HUMAN	folate receptor 4, delta (putative)	87					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14						CCTGGCTGTCGGAAGCACTTC	0.582																																						dbGAP											0													135.0	134.0	134.0					11																	94039800		2088	4230	6318	-	-	-	SO:0001583	missense	0					11q14	2014-07-23	2012-12-07		ENSG00000183560	ENSG00000183560			32565	protein-coding gene	gene with protein product		615737	"""folate receptor 4 (delta) homolog (mouse)"""			11111049, 24739963	Standard	NM_001199206		Approved	Folbp3, JUNO	uc021qou.1	A6ND01		ENST00000440961.2:c.260G>A	11.37:g.94039800G>A	ENSP00000416935:p.Arg87Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Folate_rcpt-like	p.R87Q	ENST00000440961.2	37	c.260		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.45|10.45	1.353658|1.353658	0.24512|0.24512	.|.	.|.	ENSG00000183560|ENSG00000183560	ENST00000328458|ENST00000440961	.|T	.|0.76578	.|-1.03	4.75|4.75	-1.67|-1.67	0.08238|0.08238	.|.	.|0.530450	.|0.20293	.|N	.|0.095186	T|T	0.48169|0.48169	0.1485|0.1485	N|N	0.04090|0.04090	-0.28|-0.28	0.23298|0.23298	N|N	0.997956|0.997956	.|B	.|0.22346	.|0.068	.|B	.|0.11329	.|0.006	T|T	0.34576|0.34576	-0.9823|-0.9823	5|10	.|0.38643	.|T	.|0.18	-18.3954|-18.3954	4.9406|4.9406	0.13963|0.13963	0.5154:0.0:0.3457:0.1389|0.5154:0.0:0.3457:0.1389	.|.	.|87	.|A6ND01-2	.|.	R|Q	81|87	.|ENSP00000416935:R87Q	.|ENSP00000416935:R87Q	G|R	+|+	1|2	0|0	FOLR4|FOLR4	93679448|93679448	1.000000|1.000000	0.71417|0.71417	0.187000|0.187000	0.23214|0.23214	0.466000|0.466000	0.32739|0.32739	2.245000|2.245000	0.43133|0.43133	-0.159000|-0.159000	0.11021|0.11021	-1.130000|-1.130000	0.01982|0.01982	GGA|CGG	FOLR4	-	pfam_Folate_rcpt-like	ENSG00000183560		0.582	FOLR4-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	FOLR4	HGNC	protein_coding	OTTHUMT00000396420.1	279	0.00	0	G	NM_001080486		94039800	94039800	+1	no_errors	ENST00000440961	ensembl	human	novel	69_37n	missense	103	39.41	67	SNP	0.982	A
FREM2	341640	genome.wustl.edu	37	13	39425221	39425221	+	Missense_Mutation	SNP	A	A	G	rs374734549		TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr13:39425221A>G	ENST00000280481.7	+	10	6934	c.6718A>G	c.(6718-6720)Ata>Gta	p.I2240V		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2240	Calx-beta 5.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGAAACTCTCATAAGGATCCG	0.428																																						dbGAP											0													76.0	70.0	72.0					13																	39425221		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6718A>G	13.37:g.39425221A>G	ENSP00000280481:p.Ile2240Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.I2240V	ENST00000280481.7	37	c.6718	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	A	4.376	0.069327	0.08436	.	.	ENSG00000150893	ENST00000280481	T	0.24350	1.86	5.81	4.63	0.57726	Na-Ca exchanger/integrin-beta4 (2);	0.099859	0.64402	N	0.000005	T	0.14657	0.0354	N	0.16066	0.365	0.37214	D	0.904948	B;B	0.20780	0.048;0.012	B;B	0.19666	0.015;0.026	T	0.09552	-1.0669	10	0.09084	T	0.74	.	13.4672	0.61260	0.9328:0.0:0.0672:0.0	.	2240;2240	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	V	2240	ENSP00000280481:I2240V	ENSP00000280481:I2240V	I	+	1	0	FREM2	38323221	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	3.930000	0.56522	0.460000	0.27045	-1.139000	0.01908	ATA	FREM2	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000150893		0.428	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	200	0.00	0	A	NM_207361		39425221	39425221	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	missense	117	13.97	19	SNP	1.000	G
FZD9	8326	genome.wustl.edu	37	7	72849171	72849171	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr7:72849171G>A	ENST00000344575.3	+	1	1063	c.834G>A	c.(832-834)tcG>tcA	p.S278S		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	278					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				ACGTCTACTCGCTGGCCTTCC	0.652																																					Pancreas(144;909 1878 36867 38226 39554)	dbGAP											0													134.0	129.0	131.0					7																	72849171		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.834G>A	7.37:g.72849171G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.S278	ENST00000344575.3	37	c.834	CCDS5548.1	7																																																																																			FZD9	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000188763		0.652	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD9	HGNC	protein_coding	OTTHUMT00000252120.1	28	0.00	0	G			72849171	72849171	+1	no_errors	ENST00000344575	ensembl	human	known	69_37n	silent	8	42.86	6	SNP	0.954	A
GLT8D1	55830	genome.wustl.edu	37	3	52730613	52730613	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:52730613T>G	ENST00000407584.3	-	6	1242	c.392A>C	c.(391-393)aAa>aCa	p.K131T	GLT8D1_ENST00000478968.2_Missense_Mutation_p.K131T|GLT8D1_ENST00000394783.3_Missense_Mutation_p.K131T|GLT8D1_ENST00000266014.5_Missense_Mutation_p.K131T|GLT8D1_ENST00000463827.1_5'UTR|GLT8D1_ENST00000491606.1_Missense_Mutation_p.K131T	NM_001010983.1|NM_001278280.1	NP_001010983.1|NP_001265209.1	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1	131						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)	8				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TTCCAAAAGTTTAGGGTCAAA	0.388																																						dbGAP											0													76.0	76.0	76.0					3																	52730613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358579	CCDS2862.1	3p21.1	2013-02-22			ENSG00000016864	ENSG00000016864		"""Glycosyltransferase family 8 domain containing"""	24870	protein-coding gene	gene with protein product						12975309	Standard	NM_152932		Approved	AD-017, FLJ14611	uc003dfi.4	Q68CQ7	OTTHUMG00000158759	ENST00000407584.3:c.392A>C	3.37:g.52730613T>G	ENSP00000385730:p.Lys131Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z4D1|Q8N2J6|Q9P0I5	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.K131T	ENST00000407584.3	37	c.392	CCDS2862.1	3	.	.	.	.	.	.	.	.	.	.	T	6.447	0.450586	0.12223	.	.	ENSG00000016864	ENST00000478968;ENST00000394783;ENST00000407584;ENST00000266014;ENST00000491606;ENST00000479553	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	6.07	2.24	0.28232	.	0.784265	0.13013	N	0.420661	T	0.15132	0.0365	N	0.03608	-0.345	0.09310	N	0.999999	B;B	0.24317	0.048;0.101	B;B	0.25614	0.035;0.062	T	0.25676	-1.0125	10	0.11182	T	0.66	-5.4781	2.0368	0.03542	0.1241:0.1513:0.1461:0.5785	.	131;131	Q68CQ7-2;Q68CQ7	.;GL8D1_HUMAN	T	131	ENSP00000419612:K131T;ENSP00000378263:K131T;ENSP00000385730:K131T;ENSP00000266014:K131T;ENSP00000418853:K131T;ENSP00000417713:K131T	ENSP00000266014:K131T	K	-	2	0	GLT8D1	52705653	0.958000	0.32768	0.999000	0.59377	0.998000	0.95712	0.161000	0.16481	0.529000	0.28599	0.533000	0.62120	AAA	GLT8D1	-	pfam_Glyco_trans_8	ENSG00000016864		0.388	GLT8D1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D1	HGNC	protein_coding	OTTHUMT00000352065.3	61	0.00	0	T	NM_152932		52730613	52730613	-1	no_errors	ENST00000266014	ensembl	human	known	69_37n	missense	38	43.28	29	SNP	0.218	G
GPD2	2820	genome.wustl.edu	37	2	157439307	157439307	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:157439307G>A	ENST00000310454.6	+	17	2433	c.2061G>A	c.(2059-2061)ctG>ctA	p.L687L	GPD2_ENST00000438166.2_Silent_p.L687L|GPD2_ENST00000496190.1_3'UTR|GPD2_ENST00000409125.4_Silent_p.L460L|GPD2_ENST00000540309.1_3'UTR|GPD2_ENST00000409674.1_Silent_p.L687L	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	687	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						TCTTTAAGCTGATGAGTGCTA	0.418																																						dbGAP											0													129.0	124.0	125.0					2																	157439307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.2061G>A	2.37:g.157439307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,smart_EF_hand_Ca-bd,prints_G3P_DH_FAD-dep,pfscan_EF_HAND_2	p.L687	ENST00000310454.6	37	c.2061	CCDS2202.1	2																																																																																			GPD2	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000115159		0.418	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	HGNC	protein_coding	OTTHUMT00000254910.3	212	0.00	0	G			157439307	157439307	+1	no_errors	ENST00000310454	ensembl	human	known	69_37n	silent	53	53.51	61	SNP	1.000	A
GPR126	57211	genome.wustl.edu	37	6	142721681	142721681	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr6:142721681G>A	ENST00000230173.6	+	11	2103	c.1627G>A	c.(1627-1629)Gaa>Aaa	p.E543K	GPR126_ENST00000367609.3_Missense_Mutation_p.E543K|GPR126_ENST00000367608.2_Missense_Mutation_p.E515K|GPR126_ENST00000296932.8_Missense_Mutation_p.E515K	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	543					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CCAACCTTCTGAATACGTTCT	0.428																																						dbGAP											0													110.0	99.0	103.0					6																	142721681		1885	4113	5998	-	-	-	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.1627G>A	6.37:g.142721681G>A	ENSP00000230173:p.Glu543Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Pentaxin,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.E543K	ENST00000230173.6	37	c.1627	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	G	3.217	-0.160313	0.06502	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.06	2.3	0.28687	.	1.778420	0.02585	N	0.099278	T	0.19604	0.0471	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.28636	0.052;0.052;0.218;0.139	B;B;B;B	0.26094	0.047;0.047;0.066;0.04	T	0.18398	-1.0338	10	0.52906	T	0.07	.	7.0695	0.25171	0.0902:0.3346:0.5752:0.0	.	515;543;515;543	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	K	543;515;515;543	ENSP00000230173:E543K;ENSP00000356580:E515K;ENSP00000296932:E515K;ENSP00000356581:E543K	ENSP00000230173:E543K	E	+	1	0	GPR126	142763374	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.132000	0.15891	0.304000	0.22809	-0.165000	0.13383	GAA	GPR126	-	NULL	ENSG00000112414		0.428	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	54	0.00	0	G			142721681	142721681	+1	no_errors	ENST00000367609	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.006	A
HEG1	57493	genome.wustl.edu	37	3	124746131	124746131	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:124746131C>G	ENST00000311127.4	-	3	898	c.831G>C	c.(829-831)aaG>aaC	p.K277N		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	277					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						AGGAATTTCTCTTCCTAGAAG	0.532																																						dbGAP											0													55.0	60.0	59.0					3																	124746131		1973	4132	6105	-	-	-	SO:0001583	missense	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.831G>C	3.37:g.124746131C>G	ENSP00000311502:p.Lys277Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.K277N	ENST00000311127.4	37	c.831	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765978	0.31228	.	.	ENSG00000173706	ENST00000311127	T	0.44083	0.93	4.63	2.83	0.33086	.	.	.	.	.	T	0.36744	0.0978	L	0.47716	1.5	0.09310	N	1	B;B	0.32160	0.358;0.244	B;B	0.35971	0.215;0.107	T	0.31364	-0.9946	9	0.59425	D	0.04	.	7.3213	0.26529	0.0:0.8138:0.0:0.1862	.	277;277	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	N	277	ENSP00000311502:K277N	ENSP00000311502:K277N	K	-	3	2	HEG1	126228821	0.053000	0.20554	0.037000	0.18230	0.062000	0.15995	1.155000	0.31700	0.679000	0.31345	0.650000	0.86243	AAG	HEG1	-	NULL	ENSG00000173706		0.532	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	73	0.00	0	C	XM_087386		124746131	124746131	-1	no_errors	ENST00000311127	ensembl	human	known	69_37n	missense	58	46.36	51	SNP	0.104	G
HYDIN	54768	genome.wustl.edu	37	16	71052229	71052230	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr16:71052229_71052230insA	ENST00000393567.2	-	23	3596_3597	c.3446_3447insT	c.(3445-3447)gaafs	p.E1149fs	HYDIN_ENST00000448089.2_Frame_Shift_Ins_p.E1101fs	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1149					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TCTGAGGGTGTTCCACATACTT	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.3446_3447insT	16.37:g.71052229_71052230insA	ENSP00000377197:p.Glu1149fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Frame_Shift_Ins	INS	superfamily_PapD-like	p.E1149fs	ENST00000393567.2	37	c.3447_3446	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.455	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	36	0.00	0	-			71052229	71052230	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	frame_shift_ins	18	18.18	4	INS	1.000:1.000	A
IKZF4	64375	genome.wustl.edu	37	12	56428780	56428780	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr12:56428780C>T	ENST00000262032.5	+	12	1790	c.1423C>T	c.(1423-1425)Cag>Tag	p.Q475*	IKZF4_ENST00000547791.1_Nonsense_Mutation_p.Q430*|RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000547167.1_Nonsense_Mutation_p.Q475*|IKZF4_ENST00000431367.2_Nonsense_Mutation_p.Q373*			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	475					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			ATCCCTCCCTCAGGGTCCCCC	0.647																																						dbGAP											0													17.0	19.0	18.0					12																	56428780		1861	4092	5953	-	-	-	SO:0001587	stop_gained	0			AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.1423C>T	12.37:g.56428780C>T	ENSP00000262032:p.Gln475*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JP3	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q475*	ENST00000262032.5	37	c.1423	CCDS44917.1	12	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854749	0.71719	.	.	ENSG00000123411	ENST00000262032;ENST00000431367;ENST00000547167;ENST00000547791	.	.	.	4.29	4.29	0.51040	.	0.000000	0.45867	D	0.000327	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-17.1817	12.4127	0.55476	0.0:1.0:0.0:0.0	.	.	.	.	X	475;373;475;430	.	ENSP00000262032:Q475X	Q	+	1	0	IKZF4	54715047	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.230000	0.42999	2.379000	0.81126	0.313000	0.20887	CAG	IKZF4	-	NULL	ENSG00000123411		0.647	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF4	HGNC	protein_coding	OTTHUMT00000407590.1	43	0.00	0	C	NM_022465		56428780	56428780	+1	no_errors	ENST00000262032	ensembl	human	known	69_37n	nonsense	50	32.89	25	SNP	1.000	T
IMPG2	50939	genome.wustl.edu	37	3	100976551	100976551	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:100976551G>A	ENST00000193391.7	-	10	1162	c.975C>T	c.(973-975)ctC>ctT	p.L325L		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	325	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	GAAGGCTAATGAGGTCCCAGG	0.433																																						dbGAP											0													142.0	133.0	136.0					3																	100976551		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.975C>T	3.37:g.100976551G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWT5|Q9UKD4|Q9UKK5	Silent	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.L325	ENST00000193391.7	37	c.975	CCDS2940.1	3																																																																																			IMPG2	-	pfam_SEA,smart_SEA	ENSG00000081148		0.433	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	260	0.00	0	G			100976551	100976551	-1	no_errors	ENST00000193391	ensembl	human	known	69_37n	silent	156	42.44	115	SNP	0.996	A
ITGB3	3690	genome.wustl.edu	37	17	45361815	45361815	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr17:45361815C>T	ENST00000559488.1	+	4	384	c.368C>T	c.(367-369)tCg>tTg	p.S123L	ITGB3_ENST00000435993.2_Missense_Mutation_p.S76L|ITGB3_ENST00000571680.1_Missense_Mutation_p.S123L|ITGB3_ENST00000560629.1_Silent_p.F111F	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	123					activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CCAGATGATTCGAAGAATTTC	0.428																																						dbGAP											0													80.0	70.0	73.0					17																	45361815		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.368C>T	17.37:g.45361815C>T	ENSP00000452786:p.Ser123Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.S123L	ENST00000559488.1	37	c.368	CCDS11511.1	17	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193705	0.78902	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.92647	-3.08	5.76	5.76	0.90799	Integrin beta subunit, N-terminal (2);	0.172055	0.52532	D	0.000069	D	0.92136	0.7507	L	0.59436	1.845	0.58432	D	0.999997	D;D	0.71674	0.986;0.998	P;P	0.47162	0.54;0.449	D	0.92570	0.6065	10	0.59425	D	0.04	.	17.4368	0.87554	0.0:1.0:0.0:0.0	.	123;123	P05106;Q2YFE1	ITB3_HUMAN;.	L	123;76	ENSP00000407801:S76L	ENSP00000262017:S123L	S	+	2	0	C17orf57	42716814	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	5.854000	0.69503	2.716000	0.92895	0.655000	0.94253	TCG	ITGB3	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000259207		0.428	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB3	HGNC	protein_coding	OTTHUMT00000416111.3	146	0.00	0	C	NM_000212		45361815	45361815	+1	no_errors	ENST00000262017	ensembl	human	known	69_37n	missense	188	24.19	60	SNP	0.999	T
KAT6A	7994	genome.wustl.edu	37	8	41792232	41792232	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr8:41792232C>T	ENST00000396930.3	-	18	4049	c.3506G>A	c.(3505-3507)cGa>cAa	p.R1169Q	KAT6A_ENST00000406337.1_Missense_Mutation_p.R1169Q|KAT6A_ENST00000265713.2_Missense_Mutation_p.R1169Q	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1169					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCCTGGTTTTCGACCAGGTCT	0.468																																						dbGAP											0													147.0	151.0	150.0					8																	41792232		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3506G>A	8.37:g.41792232C>T	ENSP00000380136:p.Arg1169Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R1169Q	ENST00000396930.3	37	c.3506	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738433	0.49045	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.69685	-0.42;-0.42;-0.42	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000002	T	0.81356	0.4805	M	0.64404	1.975	0.51767	D	0.999936	D	0.89917	1.0	D	0.79108	0.992	T	0.80786	-0.1227	10	0.62326	D	0.03	-18.2747	20.3854	0.98941	0.0:1.0:0.0:0.0	.	1169	Q92794	KAT6A_HUMAN	Q	1169	ENSP00000265713:R1169Q;ENSP00000385888:R1169Q;ENSP00000380136:R1169Q	ENSP00000265713:R1169Q	R	-	2	0	KAT6A	41911389	0.999000	0.42202	0.965000	0.40720	0.497000	0.33675	2.849000	0.48286	2.825000	0.97269	0.655000	0.94253	CGA	KAT6A	-	NULL	ENSG00000083168		0.468	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	227	0.00	0	C	NM_006766		41792232	41792232	-1	no_errors	ENST00000265713	ensembl	human	known	69_37n	missense	256	21.95	72	SNP	0.998	T
KCNJ8	3764	genome.wustl.edu	37	12	21919223	21919223	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr12:21919223C>T	ENST00000240662.2	-	3	1054	c.709G>A	c.(709-711)Gaa>Aaa	p.E237K	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	237					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)	p.E237Q(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	ACCTCCCCTTCAGGTGTAGTT	0.488																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											121.0	110.0	114.0					12																	21919223		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.709G>A	12.37:g.21919223C>T	ENSP00000240662:p.Glu237Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00657	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir6.1	p.E237K	ENST00000240662.2	37	c.709	CCDS8692.1	12	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658445	0.88154	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	D	0.96651	-4.08	5.11	5.11	0.69529	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98661	0.9551	M	0.93462	3.42	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99544	1.0964	10	0.87932	D	0	.	18.7389	0.91767	0.0:1.0:0.0:0.0	.	237	Q15842	IRK8_HUMAN	K	237	ENSP00000240662:E237K	ENSP00000240662:E237K	E	-	1	0	KCNJ8	21810490	1.000000	0.71417	0.309000	0.25155	0.790000	0.44656	7.638000	0.83328	2.667000	0.90743	0.563000	0.77884	GAA	KCNJ8	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000121361		0.488	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ8	HGNC	protein_coding	OTTHUMT00000402226.1	246	0.00	0	C	NM_004982		21919223	21919223	-1	no_errors	ENST00000240662	ensembl	human	known	69_37n	missense	67	60.82	104	SNP	1.000	T
KCNT1	57582	genome.wustl.edu	37	9	138646986	138646986	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr9:138646986G>A	ENST00000263604.3	+	6	454	c.454G>A	c.(454-456)Gag>Aag	p.E152K	KCNT1_ENST00000488444.2_Missense_Mutation_p.E152K|KCNT1_ENST00000486577.2_Missense_Mutation_p.E132K|KCNT1_ENST00000298480.5_Missense_Mutation_p.E171K|KCNT1_ENST00000371757.2_Missense_Mutation_p.E171K|KCNT1_ENST00000490355.2_Missense_Mutation_p.E152K|KCNT1_ENST00000487664.1_Missense_Mutation_p.E123K|KCNT1_ENST00000491806.2_Missense_Mutation_p.E138K			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	152					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		TCTGTGGGTGGAGAGAAAGAT	0.617																																						dbGAP											0													116.0	92.0	100.0					9																	138646986		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.454G>A	9.37:g.138646986G>A	ENSP00000263604:p.Glu152Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.E171K	ENST00000263604.3	37	c.511		9	.	.	.	.	.	.	.	.	.	.	.	11.12	1.546399	0.27652	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T;T	0.42900	1.96;1.95;1.95;0.96;1.95	3.11	3.11	0.35812	.	0.325101	0.28748	U	0.014263	T	0.33556	0.0867	L	0.43152	1.355	0.38014	D	0.934627	B;B	0.28783	0.142;0.222	B;B	0.26614	0.071;0.062	T	0.30149	-0.9988	10	0.28530	T	0.3	-4.6855	13.1028	0.59231	0.0:0.0:1.0:0.0	.	171;123	B9EGP2;G5E9V0	.;.	K	123;171;171;118;132;138;152;152;152	ENSP00000417851:E123K;ENSP00000298480:E171K;ENSP00000360822:E171K;ENSP00000420764:E118K;ENSP00000263604:E152K	ENSP00000263604:E152K	E	+	1	0	KCNT1	137786807	1.000000	0.71417	1.000000	0.80357	0.419000	0.31324	3.754000	0.55189	1.456000	0.47831	0.313000	0.20887	GAG	KCNT1	-	NULL	ENSG00000107147		0.617	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		15	0.00	0	G	NM_020822		138646986	138646986	+1	no_errors	ENST00000298480	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	1.000	A
C2CD5	9847	genome.wustl.edu	37	12	22671004	22671004	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr12:22671004G>C	ENST00000333957.4	-	8	1123	c.868C>G	c.(868-870)Caa>Gaa	p.Q290E	C2CD5_ENST00000545552.1_Intron|C2CD5_ENST00000540703.1_5'Flank|C2CD5_ENST00000544930.1_Intron|C2CD5_ENST00000446597.1_Missense_Mutation_p.Q290E|C2CD5_ENST00000536386.1_Intron|C2CD5_ENST00000396028.2_Intron|C2CD5_ENST00000542676.1_Missense_Mutation_p.Q290E	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	290					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										GAATAAGTTTGGTTTTTCAGA	0.443																																						dbGAP											0													241.0	231.0	234.0					12																	22671004		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.868C>G	12.37:g.22671004G>C	ENSP00000334229:p.Gln290Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.Q290E	ENST00000333957.4	37	c.868	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	G	10.58	1.390108	0.25118	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000542676	T;T;T	0.44083	0.93;0.93;0.93	6.04	6.04	0.98038	.	.	.	.	.	T	0.36303	0.0962	L	0.44542	1.39	0.80722	D	1	B;B	0.15473	0.013;0.01	B;B	0.15052	0.012;0.005	T	0.35051	-0.9804	9	0.02654	T	1	-6.42	20.5792	0.99380	0.0:0.0:1.0:0.0	.	290;290	B4DRN7;Q86YS7	.;K0528_HUMAN	E	290	ENSP00000334229:Q290E;ENSP00000388756:Q290E;ENSP00000441951:Q290E	ENSP00000334229:Q290E	Q	-	1	0	KIAA0528	22562271	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.564000	0.98151	2.873000	0.98535	0.561000	0.74099	CAA	KIAA0528	-	NULL	ENSG00000111731		0.443	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0528	HGNC	protein_coding	OTTHUMT00000402257.1	191	0.00	0	G	NM_014802		22671004	22671004	-1	no_errors	ENST00000333957	ensembl	human	known	69_37n	missense	141	22.95	42	SNP	1.000	C
KTI12	112970	genome.wustl.edu	37	1	52499148	52499148	+	Missense_Mutation	SNP	G	G	A	rs201065316		TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:52499148G>A	ENST00000371614.1	-	1	340	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W	RP11-91A18.4_ENST00000425802.1_RNA|TXNDC12_ENST00000371626.4_Intron	NM_138417.2	NP_612426.1	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated (S. cerevisiae)	96							ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)|urinary_tract(1)	12						CGCGCCGCCCGTGCCAGGCAG	0.677																																						dbGAP											0													60.0	67.0	64.0					1																	52499148		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS562.1	1p32.3	2008-02-05			ENSG00000198841	ENSG00000198841			25160	protein-coding gene	gene with protein product						11929532	Standard	NM_138417		Approved	TOT4, MGC20419, SBBI81	uc001ctj.1	Q96EK9	OTTHUMG00000008630	ENST00000371614.1:c.286C>T	1.37:g.52499148G>A	ENSP00000360676:p.Arg96Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Chromatin_KTI12	p.R96W	ENST00000371614.1	37	c.286	CCDS562.1	1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452010	0.84209	.	.	ENSG00000198841	ENST00000371614	T	0.37915	1.17	4.83	4.83	0.62350	.	0.081227	0.47093	U	0.000248	T	0.64832	0.2634	M	0.86651	2.83	0.37926	D	0.93186	D	0.89917	1.0	D	0.97110	1.0	T	0.74618	-0.3605	10	0.87932	D	0	.	14.7652	0.69634	0.0:0.0:1.0:0.0	.	96	Q96EK9	KTI12_HUMAN	W	96	ENSP00000360676:R96W	ENSP00000360676:R96W	R	-	1	2	KTI12	52271736	0.772000	0.28567	1.000000	0.80357	0.752000	0.42762	1.837000	0.39201	2.494000	0.84150	0.655000	0.94253	CGG	KTI12	-	pfam_Chromatin_KTI12	ENSG00000198841		0.677	KTI12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KTI12	HGNC	protein_coding	OTTHUMT00000023821.1	22	0.00	0	G	NM_138417		52499148	52499148	-1	no_errors	ENST00000371614	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.999	A
LAMP2	3920	genome.wustl.edu	37	X	119589362	119589362	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:119589362G>A	ENST00000200639.4	-	3	383	c.247C>T	c.(247-249)Cag>Tag	p.Q83*	LAMP2_ENST00000371335.4_Nonsense_Mutation_p.Q83*|LAMP2_ENST00000434600.2_Nonsense_Mutation_p.Q83*|LAMP2_ENST00000538785.1_Intron|LAMP2_ENST00000540603.1_Nonsense_Mutation_p.Q36*			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	83	First lumenal domain.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						GGACCATTCTGATCATCCCCA	0.408																																						dbGAP											0													158.0	135.0	143.0					X																	119589362		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.247C>T	X.37:g.119589362G>A	ENSP00000200639:p.Gln83*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Nonsense_Mutation	SNP	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.Q83*	ENST00000200639.4	37	c.247	CCDS14599.1	X	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829237	0.90955	.	.	ENSG00000005893	ENST00000434600;ENST00000200639;ENST00000371335;ENST00000540603	.	.	.	5.44	1.11	0.20524	.	1.422580	0.03904	N	0.280706	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	7.2626	8.3841	0.32491	0.0:0.3564:0.4084:0.2352	.	.	.	.	X	83;83;83;36	.	ENSP00000200639:Q83X	Q	-	1	0	LAMP2	119473390	0.000000	0.05858	0.000000	0.03702	0.796000	0.44982	-0.143000	0.10296	0.104000	0.17725	-0.226000	0.12346	CAG	LAMP2	-	NULL	ENSG00000005893		0.408	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LAMP2	HGNC	protein_coding	OTTHUMT00000058099.1	273	0.00	0	G			119589362	119589362	-1	no_errors	ENST00000434600	ensembl	human	known	69_37n	nonsense	184	29.50	77	SNP	0.000	A
LILRA4	23547	genome.wustl.edu	37	19	54849301	54849301	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:54849301G>C	ENST00000291759.4	-	4	617	c.561C>G	c.(559-561)ttC>ttG	p.F187L	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	187	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CCCTGTTGCTGAAGGTCAGGG	0.562																																						dbGAP											0													90.0	77.0	81.0					19																	54849301		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.561C>G	19.37:g.54849301G>C	ENSP00000291759:p.Phe187Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MC4	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.F187L	ENST00000291759.4	37	c.561	CCDS12890.1	19	.	.	.	.	.	.	.	.	.	.	.	10.04	1.240505	0.22711	.	.	ENSG00000239961	ENST00000291759	T	0.02837	4.14	2.76	0.356	0.16074	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.995005	0.08150	N	0.990171	T	0.01489	0.0048	N	0.02158	-0.66	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.47129	-0.9141	10	0.87932	D	0	.	7.0092	0.24853	0.0:0.0:0.5082:0.4918	.	187	P59901	LIRA4_HUMAN	L	187	ENSP00000291759:F187L	ENSP00000291759:F187L	F	-	3	2	LILRA4	59541113	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.392000	0.07314	0.173000	0.19788	0.563000	0.77884	TTC	LILRA4	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	ENSG00000239961		0.562	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA4	HGNC	protein_coding	OTTHUMT00000140229.2	15	0.00	0	G	NM_012276		54849301	54849301	-1	no_errors	ENST00000291759	ensembl	human	known	69_37n	missense	17	56.41	22	SNP	0.000	C
LRRC71	149499	genome.wustl.edu	37	1	156897417	156897417	+	Silent	SNP	C	C	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:156897417C>A	ENST00000337428.7	+	7	946	c.792C>A	c.(790-792)atC>atA	p.I264I	LRRC71_ENST00000490146.1_3'UTR	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71	264										endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						TCAACCACATCGGTGACGAGG	0.701											OREG0013892	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													16.0	19.0	18.0					1																	156897417		2066	4186	6252	-	-	-	SO:0001819	synonymous_variant	0			BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.792C>A	1.37:g.156897417C>A		Somatic	1782	WXS	Illumina GAIIx	Phase_IV	Q96M24	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.I264	ENST00000337428.7	37	c.792	CCDS44249.1	1																																																																																			LRRC71	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000160838		0.701	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC71	HGNC	protein_coding	OTTHUMT00000098961.1	18	0.00	0	C	NM_144702		156897417	156897417	+1	no_errors	ENST00000337428	ensembl	human	known	69_37n	silent	15	44.44	12	SNP	1.000	A
MAGEC3	139081	genome.wustl.edu	37	X	140969422	140969422	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:140969422A>G	ENST00000298296.1	+	4	749	c.749A>G	c.(748-750)tAt>tGt	p.Y250C	MAGEC3_ENST00000448920.1_Intron|MAGEC3_ENST00000536088.1_Intron|MAGEC3_ENST00000443323.2_Intron	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	250	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GACCATTTCTATGTCTTTGTA	0.478																																						dbGAP											0													142.0	131.0	135.0					X																	140969422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.749A>G	X.37:g.140969422A>G	ENSP00000298296:p.Tyr250Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.Y250C	ENST00000298296.1	37	c.749	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	A	9.037	0.988671	0.18966	.	.	ENSG00000165509	ENST00000298296	T	0.14516	2.5	2.26	-0.432	0.12291	.	.	.	.	.	T	0.14485	0.0350	M	0.83852	2.665	0.09310	N	1	B	0.32467	0.372	B	0.26693	0.072	T	0.23190	-1.0195	9	0.51188	T	0.08	.	2.4717	0.04566	0.5252:0.2904:0.1844:0.0	.	250	Q8TD91	MAGC3_HUMAN	C	250	ENSP00000298296:Y250C	ENSP00000298296:Y250C	Y	+	2	0	MAGEC3	140797088	0.005000	0.15991	0.002000	0.10522	0.001000	0.01503	0.235000	0.17948	-0.170000	0.10816	-1.411000	0.01122	TAT	MAGEC3	-	pfam_MAGE,pfscan_MAGE	ENSG00000165509		0.478	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	368	0.00	0	A	NM_138702		140969422	140969422	+1	no_errors	ENST00000298296	ensembl	human	known	69_37n	missense	219	24.74	72	SNP	0.002	G
MAK	4117	genome.wustl.edu	37	6	10791936	10791936	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr6:10791936delC	ENST00000313243.2	-	10	1670	c.1288delG	c.(1288-1290)gaafs	p.E430fs	MAK_ENST00000354489.2_Frame_Shift_Del_p.E430fs|RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron|MAK_ENST00000538030.1_Frame_Shift_Del_p.E430fs|MAK_ENST00000474039.1_Frame_Shift_Del_p.E430fs			P20794	MAK_HUMAN	male germ cell-associated kinase	430					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				TTCCTTTTTTCTTTAAAAACA	0.358																																						dbGAP											0													56.0	59.0	58.0					6																	10791936		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.1288delG	6.37:g.10791936delC	ENSP00000313021:p.Glu430fs	Somatic		WXS	Illumina GAIIx	Phase_IV	F1T0K6|G1FL29|Q547D0|Q9NUH7	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E430fs	ENST00000313243.2	37	c.1288	CCDS4516.1	6																																																																																			MAK	-	NULL	ENSG00000111837		0.358	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK	HGNC	protein_coding	OTTHUMT00000039841.1	79	0.00	0	C	NM_005906		10791936	10791936	-1	no_errors	ENST00000313243	ensembl	human	known	69_37n	frame_shift_del	50	37.11	36	DEL	0.996	-
MAP2K4	6416	genome.wustl.edu	37	17	12028614	12028614	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr17:12028614G>A	ENST00000353533.5	+	8	880	c.817G>A	c.(817-819)Gaa>Aaa	p.E273K	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Missense_Mutation_p.E284K	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	273	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(3)|p.E273*(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		GTTCCAGCCTGAAAGAATAGA	0.433			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																	dbGAP		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	14	Whole gene deletion(10)|Unknown(3)|Substitution - Nonsense(1)	breast(4)|ovary(4)|large_intestine(2)|lung(2)|biliary_tract(1)|pancreas(1)											196.0	157.0	170.0					17																	12028614		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.817G>A	17.37:g.12028614G>A	ENSP00000262445:p.Glu273Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E284K	ENST00000353533.5	37	c.850	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322545	0.60634	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	T;T	0.62105	0.05;0.05	5.1	5.1	0.69264	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87249	0.6130	H	0.97940	4.11	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.97110	1.0;0.991;0.995	D	0.91599	0.5293	10	0.87932	D	0	.	17.8064	0.88602	0.0:0.0:1.0:0.0	.	145;284;273	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	K	273;284;250;145	ENSP00000262445:E273K;ENSP00000410402:E284K	ENSP00000262445:E273K	E	+	1	0	MAP2K4	11969339	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.561000	0.98142	2.814000	0.96858	0.563000	0.77884	GAA	MAP2K4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065559		0.433	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1	128	0.00	0	G			12028614	12028614	+1	no_errors	ENST00000415385	ensembl	human	known	69_37n	missense	14	79.71	55	SNP	1.000	A
MAP3K13	9175	genome.wustl.edu	37	3	185181413	185181413	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:185181413G>A	ENST00000265026.3	+	8	1688	c.1354G>A	c.(1354-1356)Gaa>Aaa	p.E452K	MAP3K13_ENST00000446828.1_Missense_Mutation_p.E245K|MAP3K13_ENST00000424227.1_Missense_Mutation_p.E452K|MAP3K13_ENST00000443863.1_Missense_Mutation_p.E308K|MAP3K13_ENST00000535426.1_Missense_Mutation_p.E308K	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CCGGTTAGATGAAGAACTGAT	0.453																																						dbGAP											0													129.0	118.0	121.0					3																	185181413		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.1354G>A	3.37:g.185181413G>A	ENSP00000265026:p.Glu452Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E452K	ENST00000265026.3	37	c.1354	CCDS3270.1	3	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623374	0.87460	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026;ENST00000420577	T;T;T;T;T;T	0.79141	-1.24;-1.19;-1.1;-1.1;-1.19;-0.95	5.82	5.82	0.92795	Protein kinase-like domain (1);	0.053484	0.64402	D	0.000001	D	0.86707	0.5997	M	0.63843	1.955	0.80722	D	1	D;D;D	0.58970	0.984;0.984;0.972	P;D;P	0.64144	0.895;0.922;0.709	D	0.86970	0.2097	10	0.87932	D	0	.	20.1092	0.97906	0.0:0.0:1.0:0.0	.	308;245;452	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	K	245;452;308;308;452;197	ENSP00000411483:E245K;ENSP00000399910:E452K;ENSP00000409325:E308K;ENSP00000439257:E308K;ENSP00000265026:E452K;ENSP00000415712:E197K	ENSP00000265026:E452K	E	+	1	0	MAP3K13	186664107	1.000000	0.71417	0.999000	0.59377	0.455000	0.32408	9.830000	0.99415	2.745000	0.94114	0.655000	0.94253	GAA	MAP3K13	-	pirsf_MAP3K12_MAP3K13,superfamily_Kinase-like_dom	ENSG00000073803		0.453	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K13	HGNC	protein_coding	OTTHUMT00000345268.1	137	0.00	0	G	NM_004721		185181413	185181413	+1	no_errors	ENST00000265026	ensembl	human	known	69_37n	missense	84	50.30	85	SNP	1.000	A
MAT1A	4143	genome.wustl.edu	37	10	82034286	82034286	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr10:82034286C>T	ENST00000372213.3	-	8	1335	c.1075G>A	c.(1075-1077)Gtc>Atc	p.V359I	MAT1A_ENST00000485270.1_5'UTR	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	359					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CTGACAATGACGCCCGGCCGG	0.552																																						dbGAP											0													150.0	142.0	144.0					10																	82034286		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.1075G>A	10.37:g.82034286C>T	ENSP00000361287:p.Val359Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWD5|Q5QP09	Missense_Mutation	SNP	pfam_S-AdoMet_synt_C,pfam_S-AdoMet_synt_central,pfam_S-AdoMet_synt_N,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	p.V359I	ENST00000372213.3	37	c.1075	CCDS7365.1	10	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077653	0.36662	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.97791	-4.54	4.95	4.05	0.47172	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.94555	0.8246	L	0.39397	1.21	0.80722	D	1	B	0.11235	0.004	B	0.16289	0.015	D	0.91255	0.5032	10	0.21540	T	0.41	-32.9736	11.4945	0.50400	0.0:0.9112:0.0:0.0888	.	359	Q00266	METK1_HUMAN	I	359	ENSP00000361287:V359I	ENSP00000361280:V359I	V	-	1	0	MAT1A	82024266	1.000000	0.71417	0.373000	0.26003	0.348000	0.29142	5.779000	0.68948	1.216000	0.43427	0.561000	0.74099	GTC	MAT1A	-	pfam_S-AdoMet_synt_C,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	ENSG00000151224		0.552	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT1A	HGNC	protein_coding	OTTHUMT00000049070.1	72	0.00	0	C	NM_000429		82034286	82034286	-1	no_errors	ENST00000372206	ensembl	human	known	69_37n	missense	31	59.21	45	SNP	0.997	T
SMC4	10051	genome.wustl.edu	37	3	160122611	160122611	+	Intron	SNP	G	G	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:160122611G>T	ENST00000357388.3	+	5	1138				SMC4_ENST00000470240.1_Intron|SMC4_ENST00000360111.2_Intron|RP11-432B6.3_ENST00000483754.1_Intron|MIR16-2_ENST00000362117.1_RNA|SMC4_ENST00000469762.1_Intron|MIR15B_ENST00000385045.1_RNA|SMC4_ENST00000462787.1_Intron|SMC4_ENST00000344722.5_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4						kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GCTTTAGTGTGACAGGGATAC	0.308																																						dbGAP											0													63.0	58.0	59.0					3																	160122611		1567	3579	5146	-	-	-	SO:0001627	intron_variant	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.687+319G>T	3.37:g.160122611G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	RNA	SNP	-	NULL	ENST00000357388.3	37	NULL	CCDS3189.1	3																																																																																			MIR16-2	-	-	ENSG00000198987		0.308	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR16-2	HGNC	protein_coding	OTTHUMT00000352862.1	16	0.00	0	G			160122611	160122611	+1	no_errors	ENST00000362117	ensembl	human	known	69_37n	rna	11	35.29	6	SNP	1.000	T
MRPL9	65005	genome.wustl.edu	37	1	151735572	151735573	+	Frame_Shift_Ins	INS	-	-	C	rs571400775		TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:151735572_151735573insC	ENST00000368830.3	-	2	287_288	c.203_204insG	c.(202-204)ggcfs	p.G68fs	OAZ3_ENST00000453029.2_5'Flank|MRPL9_ENST00000467306.1_5'UTR|RP11-98D18.3_ENST00000512280.1_RNA|OAZ3_ENST00000479764.1_5'Flank|MRPL9_ENST00000368829.3_Frame_Shift_Ins_p.G68fs|OAZ3_ENST00000321531.5_5'UTR|OAZ3_ENST00000315067.8_5'UTR|RP11-98D18.2_ENST00000420382.1_RNA	NM_031420.2	NP_113608.1	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9	68					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCGGCTTCCGGCCCTCCCCGGC	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK026363	CCDS1003.1, CCDS72916.1	1q21	2012-09-13			ENSG00000143436	ENSG00000143436		"""Mitochondrial ribosomal proteins / large subunits"""	14277	protein-coding gene	gene with protein product		611824					Standard	XM_005245455		Approved		uc001eyv.3	Q9BYD2	OTTHUMG00000013063	ENST00000368830.3:c.204dupG	1.37:g.151735575_151735575dupC	ENSP00000357823:p.Gly68fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD99|Q5SZR2|Q9BSW8	Frame_Shift_Ins	INS	pfam_Ribosomal_L9_N,superfamily_Ribosomal_L9/RNase_H1_N	p.R69fs	ENST00000368830.3	37	c.204_203	CCDS1003.1	1																																																																																			MRPL9	-	NULL	ENSG00000143436		0.639	MRPL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL9	HGNC	protein_coding	OTTHUMT00000036653.2	32	0.00	0	-	NM_031420		151735572	151735573	-1	no_errors	ENST00000368830	ensembl	human	known	69_37n	frame_shift_ins	60	10.45	7	INS	1.000:1.000	C
MUC16	94025	genome.wustl.edu	37	19	9073597	9073597	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:9073597C>T	ENST00000397910.4	-	3	14052	c.13849G>A	c.(13849-13851)Gag>Aag	p.E4617K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4619	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGTTTGACTCTGTAGTTGAG	0.488																																						dbGAP											0													105.0	100.0	102.0					19																	9073597		1970	4160	6130	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13849G>A	19.37:g.9073597C>T	ENSP00000381008:p.Glu4617Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.E4617K	ENST00000397910.4	37	c.13849	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	8.520	0.868570	0.17322	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	1.56	1.56	0.23342	.	.	.	.	.	T	0.05044	0.0135	L	0.55481	1.735	.	.	.	D	0.58620	0.983	P	0.48598	0.583	T	0.24297	-1.0164	8	0.87932	D	0	.	6.5548	0.22454	0.0:1.0:0.0:0.0	.	4617	B5ME49	.	K	4617	ENSP00000381008:E4617K	ENSP00000381008:E4617K	E	-	1	0	MUC16	8934597	0.000000	0.05858	0.003000	0.11579	0.230000	0.25150	-0.329000	0.07935	1.151000	0.42436	0.205000	0.17691	GAG	MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	166	0.00	0	C	NM_024690		9073597	9073597	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	148	36.48	85	SNP	0.004	T
MUSK	4593	genome.wustl.edu	37	9	113547808	113547808	+	Splice_Site	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr9:113547808G>A	ENST00000374448.4	+	13	1722	c.1588G>A	c.(1588-1590)Gaa>Aaa	p.E530K	MUSK_ENST00000374438.1_Splice_Site_p.E46K|MUSK_ENST00000416899.2_Splice_Site_p.E522K|MUSK_ENST00000189978.5_Splice_Site_p.E530K	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	530					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						TGCCTGCAGAGAATCAGCAGC	0.458																																						dbGAP											0													200.0	194.0	196.0					9																	113547808		2017	4171	6188	-	-	-	SO:0001630	splice_region_variant	0			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.1587-1G>A	9.37:g.113547808G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Frizzled_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E536K	ENST00000374448.4	37	c.1606	CCDS48005.1	9	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836589	0.71373	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000374441;ENST00000416899;ENST00000374438	T;T	0.81415	-0.8;-1.49	5.86	5.86	0.93980	.	0.170971	0.52532	D	0.000070	T	0.81351	0.4804	L	0.56769	1.78	0.80722	D	1	P	0.47910	0.902	P	0.45428	0.48	T	0.78526	-0.2170	10	0.27082	T	0.32	.	19.1684	0.93567	0.0:0.0:1.0:0.0	.	530	O15146	MUSK_HUMAN	K	536;530;530;444;444;46;528;46	ENSP00000363571:E530K;ENSP00000363561:E46K	ENSP00000189978:E536K	E	+	1	0	MUSK	112587629	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.319000	0.96338	2.777000	0.95525	0.655000	0.94253	GAA	MUSK	-	NULL	ENSG00000030304		0.458	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUSK	HGNC	protein_coding		272	0.00	0	G		Missense_Mutation	113547808	113547808	+1	no_errors	ENST00000189978	ensembl	human	known	69_37n	missense	188	39.16	121	SNP	1.000	A
NCOR1	9611	genome.wustl.edu	37	17	15989751	15989751	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr17:15989751G>A	ENST00000268712.3	-	23	3279	c.3022C>T	c.(3022-3024)Cag>Tag	p.Q1008*	NCOR1_ENST00000395851.1_Nonsense_Mutation_p.Q1024*	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1008	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGAGCAGGCTGAAGGACTTTT	0.433																																						dbGAP											0													63.0	64.0	64.0					17																	15989751		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.3022C>T	17.37:g.15989751G>A	ENSP00000268712:p.Gln1008*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Nonsense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q1008*	ENST00000268712.3	37	c.3022	CCDS11175.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.224910|7.224910	0.98146|0.98146	.|.	.|.	ENSG00000141027|ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849|ENST00000436068	.|.	.|.	.|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.048089|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75406	.|0.3845	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72600	.|-0.4244	.|4	0.02654|.	T|.	1|.	-8.7515|-8.7515	19.1272|19.1272	0.93390|0.93390	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1008;1024;915|79	.|.	ENSP00000268712:Q1008X|.	Q|S	-|-	1|2	0|0	NCOR1|NCOR1	15930476|15930476	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.790000|0.790000	0.44656|0.44656	7.611000|7.611000	0.82962|0.82962	2.769000|2.769000	0.95229|0.95229	0.580000|0.580000	0.79431|0.79431	CAG|TCA	NCOR1	-	NULL	ENSG00000141027		0.433	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	107	0.00	0	G	NM_006311		15989751	15989751	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	nonsense	20	70.59	48	SNP	1.000	A
NDUFA13	51079	genome.wustl.edu	37	19	19626972	19626972	+	5'UTR	SNP	T	T	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:19626972T>A	ENST00000507754.4	+	0	409				TSSK6_ENST00000585580.3_5'Flank|CTC-260F20.3_ENST00000555938.1_5'Flank|YJEFN3_ENST00000608404.1_5'Flank|NDUFA13_ENST00000252576.5_Missense_Mutation_p.S58R|NDUFA13_ENST00000503283.1_5'Flank|NDUFA13_ENST00000512771.3_5'Flank|TSSK6_ENST00000360913.3_5'Flank|NDUFA13_ENST00000428459.2_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						CCATCTCAAGTGCTTCCGCCA	0.622																																						dbGAP											0													46.0	46.0	46.0					19																	19626972		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211	ENST00000507754.4:c.-76T>A	19.37:g.19626972T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	pfam_GRIM-19	p.S58R	ENST00000507754.4	37	c.174	CCDS12404.2	19	.	.	.	.	.	.	.	.	.	.	T	14.72	2.619722	0.46736	.	.	ENSG00000186010	ENST00000252576	T	0.81078	-1.45	4.82	-3.17	0.05202	.	.	.	.	.	T	0.72867	0.3514	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.64753	-0.6333	6	0.52906	T	0.07	.	5.2827	0.15684	0.2518:0.4097:0.0:0.3384	.	.	.	.	R	58	ENSP00000252576:S58R	ENSP00000252576:S58R	S	+	3	2	NDUFA13	19487972	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-4.333000	0.00251	-0.682000	0.05197	0.529000	0.55759	AGT	NDUFA13	-	NULL	ENSG00000186010		0.622	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	NDUFA13	HGNC	protein_coding	OTTHUMT00000367916.6	19	0.00	0	T	NM_015965		19626972	19626972	+1	no_errors	ENST00000252576	ensembl	human	known	69_37n	missense	9	60.87	14	SNP	0.000	A
NLGN3	54413	genome.wustl.edu	37	X	70367894	70367894	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:70367894G>A	ENST00000358741.3	+	2	598	c.295G>A	c.(295-297)Gcc>Acc	p.A99T	NLGN3_ENST00000374051.3_Missense_Mutation_p.A99T|NLGN3_ENST00000536169.1_Missense_Mutation_p.A99T	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	99					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CATCCGGAACGCCACACACTT	0.617																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0													80.0	55.0	63.0					X																	70367894		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.295G>A	X.37:g.70367894G>A	ENSP00000351591:p.Ala99Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.A99T	ENST00000358741.3	37	c.295	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964558	0.74131	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000395855;ENST00000358741	T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87	4.41	4.41	0.53225	.	0.312041	0.34002	N	0.004350	T	0.72358	0.3450	M	0.74258	2.255	0.80722	D	1	B;P;B	0.41366	0.153;0.747;0.075	B;B;B	0.34180	0.15;0.177;0.025	T	0.78198	-0.2297	10	0.52906	T	0.07	.	16.4169	0.83745	0.0:0.0:1.0:0.0	.	99;99;99	D3DVV1;B7Z5Y1;Q9NZ94-2	.;.;.	T	99	ENSP00000445298:A99T;ENSP00000363163:A99T;ENSP00000379196:A99T;ENSP00000351591:A99T	ENSP00000351591:A99T	A	+	1	0	NLGN3	70284619	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.406000	0.80017	2.044000	0.60594	0.436000	0.28706	GCC	NLGN3	-	pfam_CarbesteraseB	ENSG00000196338		0.617	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	30	0.00	0	G	NM_018977		70367894	70367894	+1	no_errors	ENST00000358741	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	1.000	A
NOL6	65083	genome.wustl.edu	37	9	33466347	33466347	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr9:33466347C>T	ENST00000379471.2	-	17	2255	c.2168G>A	c.(2167-2169)cGg>cAg	p.R723Q	NOL6_ENST00000455041.2_Missense_Mutation_p.R671Q|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	723			R -> W (in dbSNP:rs35135082).		rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CTTATCGAGCCGGGGCAGCAG	0.617											OREG0019137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													81.0	83.0	82.0					9																	33466347		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.2168G>A	9.37:g.33466347C>T	ENSP00000368784:p.Arg723Gln	Somatic	840	WXS	Illumina GAIIx	Phase_IV	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	pfam_Nrap	p.R723Q	ENST00000379471.2	37	c.2168		9	.	.	.	.	.	.	.	.	.	.	C	13.96	2.394253	0.42410	.	.	ENSG00000165271	ENST00000297990;ENST00000379471;ENST00000541373;ENST00000325914;ENST00000455041	T;T;T	0.29917	1.55;1.55;1.55	5.0	5.0	0.66597	.	0.293370	0.36101	N	0.002799	T	0.27524	0.0676	L	0.46157	1.445	0.34802	D	0.736832	D;D;P;D	0.57257	0.979;0.974;0.945;0.979	P;B;B;P	0.47044	0.535;0.4;0.321;0.535	T	0.20672	-1.0268	10	0.16896	T	0.51	.	7.2815	0.26314	0.0:0.7245:0.1862:0.0893	.	671;720;723;723	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4	.;.;.;NOL6_HUMAN	Q	723;723;279;723;671	ENSP00000297990:R723Q;ENSP00000368784:R723Q;ENSP00000395915:R671Q	ENSP00000297990:R723Q	R	-	2	0	NOL6	33456347	0.659000	0.27411	0.998000	0.56505	0.207000	0.24258	1.701000	0.37825	2.595000	0.87683	0.655000	0.94253	CGG	NOL6	-	pfam_Nrap	ENSG00000165271		0.617	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	NOL6	HGNC	protein_coding	OTTHUMT00000001019.2	40	0.00	0	C	NM_022917		33466347	33466347	-1	no_errors	ENST00000297990	ensembl	human	known	69_37n	missense	25	40.91	18	SNP	0.960	T
NRK	203447	genome.wustl.edu	37	X	105139453	105139453	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:105139453G>A	ENST00000243300.9	+	7	820	c.517G>A	c.(517-519)Gta>Ata	p.V173I	NRK_ENST00000428173.2_Missense_Mutation_p.V173I	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	173	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CGCACACCGAGTAATTCACCG	0.348										HNSCC(51;0.14)																												dbGAP											0													78.0	75.0	76.0					X																	105139453		1907	4110	6017	-	-	-	SO:0001583	missense	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.517G>A	X.37:g.105139453G>A	ENSP00000434830:p.Val173Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.V173I	ENST00000243300.9	37	c.517		X	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181034	0.78677	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.61392	0.11;0.11	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41712	D	0.000822	T	0.63010	0.2475	N	0.17379	0.485	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.67577	-0.5635	10	0.56958	D	0.05	.	15.968	0.79987	0.0:0.0:1.0:0.0	.	173	Q7Z2Y5	NRK_HUMAN	I	173	ENSP00000434830:V173I;ENSP00000438378:V173I	ENSP00000434830:V173I	V	+	1	0	NRK	105026109	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.523000	0.98034	2.372000	0.80975	0.600000	0.82982	GTA	NRK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000123572		0.348	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	247	0.00	0	G	NM_198465		105139453	105139453	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	missense	189	21.58	52	SNP	1.000	A
NSF	4905	genome.wustl.edu	37	17	44791323	44791323	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr17:44791323G>A	ENST00000398238.4	+	15	1839	c.1732G>A	c.(1732-1734)Gaa>Aaa	p.E578K	NSF_ENST00000575068.1_Missense_Mutation_p.E573K|NSF_ENST00000225282.8_Missense_Mutation_p.E484K	NM_006178.3	NP_006169.2	P46459	NSF_HUMAN	N-ethylmaleimide-sensitive factor	578					exocytosis (GO:0006887)|plasma membrane fusion (GO:0045026)|positive regulation of receptor recycling (GO:0001921)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|syntaxin-1 binding (GO:0017075)			kidney(2)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		TGGCTTTTCTGAAACAGCCAA	0.383																																					Ovarian(25;472 742 1472 36813 50223)	dbGAP											0													81.0	75.0	77.0					17																	44791323		1849	4090	5939	-	-	-	SO:0001583	missense	0				CCDS42354.1	17q21	2010-04-21			ENSG00000073969	ENSG00000073969		"""ATPases / AAA-type"""	8016	protein-coding gene	gene with protein product	"""N-ethylmaleimide-sensitive factor-like protein"""	601633				1315316, 8875895	Standard	NM_006178		Approved	SKD2	uc002iku.3	P46459	OTTHUMG00000134315	ENST00000398238.4:c.1732G>A	17.37:g.44791323G>A	ENSP00000381293:p.Glu578Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2D9|B4DFA2|Q8N6D7|Q9UKZ2	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Cdc48_dom2,pfam_CDC4_N-term_subdom,pfam_ATPase_AAA-2,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.E578K	ENST00000398238.4	37	c.1732	CCDS42354.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.206424	0.95033	.	.	ENSG00000073969	ENST00000398238;ENST00000225282	D;D	0.92805	-3.11;-3.11	5.26	5.26	0.73747	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98046	0.9356	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.99585	1.0974	10	0.87932	D	0	-17.0076	19.2285	0.93827	0.0:0.0:1.0:0.0	.	578	P46459	NSF_HUMAN	K	578;484	ENSP00000381293:E578K;ENSP00000225282:E484K	ENSP00000225282:E484K	E	+	1	0	NSF	42146506	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.615000	0.88500	0.591000	0.81541	GAA	NSF	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000073969		0.383	NSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSF	HGNC	protein_coding	OTTHUMT00000259348.2	78	0.00	0	G	NM_006178		44791323	44791323	+1	no_errors	ENST00000398238	ensembl	human	known	69_37n	missense	77	46.53	67	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	123654414	123654414	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:123654414T>G	ENST00000371130.3	-	18	3317	c.3254A>C	c.(3253-3255)aAg>aCg	p.K1085T	TENM1_ENST00000422452.2_Missense_Mutation_p.K1085T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1085					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GATGTCGGTCTTGTTCCAAGC	0.443																																						dbGAP											0													131.0	114.0	120.0					X																	123654414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3254A>C	X.37:g.123654414T>G	ENSP00000360171:p.Lys1085Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.K1085T	ENST00000371130.3	37	c.3254	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	T	26.3	4.723346	0.89298	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.88741	-2.42;-2.39	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.94282	0.8163	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	0.999;0.985;1.0	D;P;D	0.78314	0.991;0.787;0.991	D	0.94948	0.8097	10	0.87932	D	0	.	14.4999	0.67714	0.0:0.0:0.0:1.0	.	1084;1085;1085	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	1085	ENSP00000360171:K1085T;ENSP00000403954:K1085T	ENSP00000360171:K1085T	K	-	2	0	ODZ1	123482095	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.289000	0.72696	1.804000	0.52760	0.486000	0.48141	AAG	ODZ1	-	NULL	ENSG00000009694		0.443	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	450	0.00	0	T	NM_014253		123654414	123654414	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	232	28.17	91	SNP	1.000	G
OCRL	4952	genome.wustl.edu	37	X	128701282	128701282	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:128701282G>A	ENST00000371113.4	+	14	1573	c.1408G>A	c.(1408-1410)Gaa>Aaa	p.E470K	OCRL_ENST00000357121.5_Missense_Mutation_p.E470K	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	470	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						CAATGAAGGGGAAATCAAGTT	0.373																																						dbGAP											0													100.0	85.0	90.0					X																	128701282		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.1408G>A	X.37:g.128701282G>A	ENSP00000360154:p.Glu470Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E470K	ENST00000371113.4	37	c.1408	CCDS35393.1	X	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140625	0.77775	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.95103	-3.61;-3.61	5.86	4.98	0.66077	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.145069	0.64402	D	0.000008	D	0.91503	0.7317	L	0.42581	1.335	0.58432	D	0.999998	B;B	0.33964	0.434;0.001	B;B	0.39503	0.301;0.052	D	0.88220	0.2896	10	0.35671	T	0.21	.	8.5582	0.33494	0.081:0.1506:0.7683:0.0	.	470;470	Q01968-2;Q01968	.;OCRL_HUMAN	K	470	ENSP00000360154:E470K;ENSP00000349635:E470K	ENSP00000349635:E470K	E	+	1	0	OCRL	128528963	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	6.442000	0.73443	1.194000	0.43101	0.600000	0.82982	GAA	OCRL	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000122126		0.373	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	OCRL	HGNC	protein_coding	OTTHUMT00000058917.1	164	0.00	0	G	NM_000276		128701282	128701282	+1	no_errors	ENST00000371113	ensembl	human	known	69_37n	missense	126	20.25	32	SNP	0.969	A
OSCP1	127700	genome.wustl.edu	37	1	36894016	36894016	+	Intron	SNP	C	C	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:36894016C>A	ENST00000356637.5	-	5	610				OSCP1_ENST00000235532.5_Intron|OSCP1_ENST00000315643.9_Intron|OSCP1_ENST00000354267.3_Nonsense_Mutation_p.G193*|OSCP1_ENST00000433045.2_Intron			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1						transport (GO:0006810)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						TTCCCCACTCCTGGAAGGCAA	0.393																																						dbGAP											0													126.0	120.0	122.0					1																	36894016		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.546+3386G>T	1.37:g.36894016C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Nonsense_Mutation	SNP	pfam_OSCP1	p.G193*	ENST00000356637.5	37	c.577		1	.	.	.	.	.	.	.	.	.	.	C	10.11	1.261687	0.23051	.	.	ENSG00000116885	ENST00000354267	.	.	.	3.47	1.59	0.23543	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	5.5698	0.17190	0.0:0.7471:0.0:0.2529	.	.	.	.	X	193	.	ENSP00000346216:G193X	G	-	1	0	OSCP1	36666603	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	0.607000	0.24209	0.459000	0.27016	-0.253000	0.11424	GGA	OSCP1	-	NULL	ENSG00000116885		0.393	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	OSCP1	HGNC	protein_coding	OTTHUMT00000389759.1	107	0.00	0	C	NM_145047		36894016	36894016	-1	no_errors	ENST00000354267	ensembl	human	known	69_37n	nonsense	70	47.37	63	SNP	0.001	A
OR14C36	127066	genome.wustl.edu	37	1	248512379	248512379	+	Silent	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:248512379C>T	ENST00000317861.1	+	1	303	c.303C>T	c.(301-303)ctC>ctT	p.L101L		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						AGGTCTTCCTCGTGGTTTTTT	0.483																																						dbGAP											0													78.0	68.0	71.0					1																	248512379		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.303C>T	1.37:g.248512379C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEZ6	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L101	ENST00000317861.1	37	c.303	CCDS31112.1	1																																																																																			OR14C36	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000177174		0.483	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14C36	HGNC	protein_coding	OTTHUMT00000097359.1	201	0.00	0	C	NM_001001918		248512379	248512379	+1	no_errors	ENST00000317861	ensembl	human	known	69_37n	silent	198	13.42	31	SNP	0.000	T
PCDHB7	56129	genome.wustl.edu	37	5	140553379	140553379	+	Silent	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr5:140553379C>G	ENST00000231137.3	+	1	1137	c.963C>G	c.(961-963)gcC>gcG	p.A321A		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	321	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTATTCAGGCCAAAGACGGCG	0.428																																						dbGAP											0													62.0	66.0	64.0					5																	140553379		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.963C>G	5.37:g.140553379C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3Y8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A321	ENST00000231137.3	37	c.963	CCDS4249.1	5																																																																																			PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000113212		0.428	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	82	0.00	0	C	NM_018940		140553379	140553379	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	silent	41	34.92	22	SNP	0.393	G
PCDHB14	56122	genome.wustl.edu	37	5	140604697	140604697	+	Silent	SNP	G	G	A	rs147849897	byFrequency	TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr5:140604697G>A	ENST00000239449.4	+	1	1620	c.1620G>A	c.(1618-1620)gcG>gcA	p.A540A	PCDHB14_ENST00000515856.2_Silent_p.A387A	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	540	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A540A(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTCCCCGGCGTTGAGCAGCG	0.682																																					Ovarian(141;50 1831 27899 33809 37648)	dbGAP											1	Substitution - coding silent(1)	endometrium(1)											48.0	54.0	52.0					5																	140604697		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1620G>A	5.37:g.140604697G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A540	ENST00000239449.4	37	c.1620	CCDS4256.1	5																																																																																			PCDHB14	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120327		0.682	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	47	0.00	0	G	NM_018934		140604697	140604697	+1	no_errors	ENST00000239449	ensembl	human	known	69_37n	silent	23	47.73	21	SNP	0.631	A
PHC3	80012	genome.wustl.edu	37	3	169846805	169846805	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:169846805G>A	ENST00000494943.1	-	8	1487	c.1419C>T	c.(1417-1419)gcC>gcT	p.A473A	PHC3_ENST00000467570.1_Silent_p.A432A|PHC3_ENST00000495893.2_Silent_p.A485A			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	473	Gln-rich.|Pro-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GGGATACCAAGGCAGACTGCT	0.512																																						dbGAP											0													72.0	73.0	73.0					3																	169846805		2062	4197	6259	-	-	-	SO:0001819	synonymous_variant	0				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.1419C>T	3.37:g.169846805G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.A485	ENST00000494943.1	37	c.1455		3																																																																																			PHC3	-	NULL	ENSG00000173889		0.512	PHC3-004	KNOWN	basic	protein_coding	PHC3	HGNC	protein_coding	OTTHUMT00000352182.3	76	0.00	0	G	NM_024947		169846805	169846805	-1	no_errors	ENST00000495893	ensembl	human	known	69_37n	silent	57	35.96	32	SNP	0.048	A
PIK3CA	5290	genome.wustl.edu	37	3	178936094	178936094	+	Missense_Mutation	SNP	C	C	A	rs121913286		TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:178936094C>A	ENST00000263967.3	+	10	1793	c.1636C>A	c.(1636-1638)Cag>Aag	p.Q546K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	546	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		Q -> E (in BC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> K (in OC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> P (found in an anaplastic astrocytoma sample; unknown pathological significance). {ECO:0000269|PubMed:15289301}.|Q -> R (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.Q546K(89)|p.Q546E(12)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATCACTGAGCAGGAGAAAGA	0.358		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	101	Substitution - Missense(101)	large_intestine(55)|breast(17)|endometrium(15)|central_nervous_system(3)|lung(3)|ovary(3)|skin(2)|cervix(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)											61.0	61.0	61.0					3																	178936094		1814	4072	5886	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1636C>A	3.37:g.178936094C>A	ENSP00000263967:p.Gln546Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q546K	ENST00000263967.3	37	c.1636	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838482	0.91117	.	.	ENSG00000121879	ENST00000263967	T	0.62232	0.04	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75191	0.3816	M	0.64404	1.975	0.80722	D	1	D	0.58970	0.984	P	0.58660	0.843	T	0.73833	-0.3858	10	0.46703	T	0.11	-14.2064	20.0024	0.97423	0.0:1.0:0.0:0.0	.	546	P42336	PK3CA_HUMAN	K	546	ENSP00000263967:Q546K	ENSP00000263967:Q546K	Q	+	1	0	PIK3CA	180418788	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.487000	0.81328	2.722000	0.93159	0.467000	0.42956	CAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.358	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	87	0.00	0	C			178936094	178936094	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	72	36.84	42	SNP	1.000	A
PIKFYVE	200576	genome.wustl.edu	37	2	209163498	209163498	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:209163498C>G	ENST00000264380.4	+	8	1203	c.1045C>G	c.(1045-1047)Ctt>Gtt	p.L349V	PIKFYVE_ENST00000407449.1_Missense_Mutation_p.L349V|PIKFYVE_ENST00000392202.3_Missense_Mutation_p.L252V|PIKFYVE_ENST00000308862.6_Missense_Mutation_p.L263V	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	349					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						ACGCAAAATTCTTCTGGTACT	0.423																																						dbGAP											0													136.0	109.0	119.0					2																	209163498		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.1045C>G	2.37:g.209163498C>G	ENSP00000264380:p.Leu349Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.L349V	ENST00000264380.4	37	c.1045	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468280	0.84533	.	.	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000407449;ENST00000308862;ENST00000452564	T;T;T	0.68765	1.4;-0.35;1.56	5.53	4.66	0.58398	.	0.075016	0.56097	D	0.000039	T	0.70395	0.3219	L	0.27053	0.805	0.58432	D	0.999995	D;D;D;P;D	0.69078	0.997;0.997;0.996;0.956;0.974	D;D;D;P;D	0.75484	0.978;0.978;0.986;0.899;0.969	T	0.67597	-0.5630	10	0.24483	T	0.36	-19.8689	14.9805	0.71309	0.0:0.931:0.0:0.069	.	349;349;263;349;252	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	V	252;349;349;263;349	ENSP00000264380:L349V;ENSP00000384356:L349V;ENSP00000405736:L349V	ENSP00000264380:L349V	L	+	1	0	PIKFYVE	208871743	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.378000	0.66190	1.472000	0.48140	-0.133000	0.14855	CTT	PIKFYVE	-	NULL	ENSG00000115020		0.423	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	150	0.00	0	C	NM_015040		209163498	209163498	+1	no_errors	ENST00000264380	ensembl	human	known	69_37n	missense	57	59.86	85	SNP	1.000	G
PLS3	5358	genome.wustl.edu	37	X	114844608	114844608	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chrX:114844608G>A	ENST00000420625.2	+	2	180	c.46G>A	c.(46-48)Gaa>Aaa	p.E16K	PLS3_ENST00000537301.1_5'UTR|PLS3_ENST00000355899.3_Missense_Mutation_p.E16K|PLS3_ENST00000539310.1_5'UTR|PLS3_ENST00000289290.3_5'UTR	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	16	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						TGAGCTTGATGAACTCAAAGA	0.303																																					Colon(160;1047 1864 8490 12969 29601)	dbGAP											0													90.0	86.0	88.0					X																	114844608		2203	4299	6502	-	-	-	SO:0001583	missense	0			L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.46G>A	X.37:g.114844608G>A	ENSP00000398945:p.Glu16Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.E16K	ENST00000420625.2	37	c.46	CCDS14568.1	X	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303307	0.40795	.	.	ENSG00000102024	ENST00000355899;ENST00000420625	T;T	0.72282	-0.64;-0.64	4.69	4.69	0.59074	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.75443	0.3850	M	0.80982	2.52	0.80722	D	1	D;B	0.56287	0.975;0.314	P;B	0.48488	0.579;0.271	T	0.78008	-0.2372	10	0.45353	T	0.12	-19.2731	11.7535	0.51862	0.0:0.0:1.0:0.0	.	16;16	B4DPW9;P13797	.;PLST_HUMAN	K	16	ENSP00000348163:E16K;ENSP00000398945:E16K	ENSP00000348163:E16K	E	+	1	0	PLS3	114750864	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.025000	0.64097	2.156000	0.67533	0.600000	0.82982	GAA	PLS3	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000102024		0.303	PLS3-201	KNOWN	basic|CCDS	protein_coding	PLS3	HGNC	protein_coding	OTTHUMT00000057976.2	144	0.00	0	G			114844608	114844608	+1	no_errors	ENST00000355899	ensembl	human	known	69_37n	missense	96	35.14	52	SNP	1.000	A
PMS2	5395	genome.wustl.edu	37	7	6013049	6013049	+	Missense_Mutation	SNP	C	C	G	rs1802683	byFrequency	TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr7:6013049C>G	ENST00000265849.7	-	15	2675	c.2570G>C	c.(2569-2571)gGt>gCt	p.G857A	PMS2_ENST00000382321.4_Missense_Mutation_p.G456A|RSPH10B_ENST00000404406.1_5'Flank|PMS2_ENST00000441476.2_Missense_Mutation_p.G751A|RSPH10B_ENST00000405415.1_5'Flank	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	857					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AGAAATGACACCCAGGTTGGC	0.453			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													11.0	13.0	12.0					7																	6013049		2006	4056	6062	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2570G>C	7.37:g.6013049C>G	ENSP00000265849:p.Gly857Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.G857A	ENST00000265849.7	37	c.2570	CCDS5343.1	7	378	0.17307692307692307	103	0.20934959349593496	73	0.20165745856353592	76	0.13286713286713286	126	0.1662269129287599	C	8.419	0.845863	0.16963	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000382321;ENST00000441476	D;D;T	0.86956	-1.86;-2.19;-1.26	5.2	2.84	0.33178	.	0.108239	0.64402	D	0.000012	T	0.00109	0.0003	N	0.04768	-0.165	0.37619	P	0.07877500000000004	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.03545	-1.1026	9	0.06891	T	0.86	-5.7653	6.6077	0.22734	0.0:0.0845:0.1704:0.7451	.	456;857;751	P54278-2;P54278;C9J167	.;PMS2_HUMAN;.	A	857;810;456;751	ENSP00000265849:G857A;ENSP00000371758:G456A;ENSP00000392843:G751A	ENSP00000265849:G857A	G	-	2	0	PMS2	5979575	1.000000	0.71417	0.826000	0.32828	0.555000	0.35460	5.160000	0.64929	0.325000	0.23359	-0.367000	0.07326	GGT	PMS2	-	NULL	ENSG00000122512		0.453	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3	20	0.00	0	C	NM_000535		6013049	6013049	-1	no_errors	ENST00000265849	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.999	G
PPP1R9A	55607	genome.wustl.edu	37	7	94919430	94919430	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr7:94919430C>T	ENST00000433881.1	+	16	3644	c.3112C>T	c.(3112-3114)Cga>Tga	p.R1038*	PPP1R9A_ENST00000433360.1_Nonsense_Mutation_p.R1314*|PPP1R9A_ENST00000424654.1_Nonsense_Mutation_p.R1193*|PPP1R9A_ENST00000289495.5_Nonsense_Mutation_p.R1236*|PPP1R9A_ENST00000340694.4_Nonsense_Mutation_p.R1038*|PPP1R9A_ENST00000456331.2_Nonsense_Mutation_p.R1193*			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	1038	Interacts with TGN38. {ECO:0000250}.|SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			ATCCCAGGACCGAGCAGTGGT	0.418										HNSCC(28;0.073)																												dbGAP											0													58.0	61.0	60.0					7																	94919430		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.3112C>T	7.37:g.94919430C>T	ENSP00000398870:p.Arg1038*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Nonsense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,superfamily_Smac_DIABLO-like,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.R1236*	ENST00000433881.1	37	c.3706	CCDS34683.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.197378	0.98129	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	.	.	.	4.87	3.97	0.46021	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.54753	D	0.999987	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7233	0.51696	0.4882:0.5118:0.0:0.0	.	.	.	.	X	1314;1038;1193;1038;1236;1193	.	ENSP00000289495:R1236X	R	+	1	2	PPP1R9A	94757366	1.000000	0.71417	0.966000	0.40874	0.010000	0.07245	2.936000	0.48971	1.391000	0.46566	0.655000	0.94253	CGA	PPP1R9A	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000158528		0.418	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	76	0.00	0	C	NM_001166160		94919430	94919430	+1	no_errors	ENST00000289495	ensembl	human	known	69_37n	nonsense	55	34.52	29	SNP	1.000	T
PRKAG3	53632	genome.wustl.edu	37	2	219694753	219694753	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:219694753T>G	ENST00000529249.1	-	4	896	c.581A>C	c.(580-582)tAc>tCc	p.Y194S	PRKAG3_ENST00000545803.1_Missense_Mutation_p.Y10S|PRKAG3_ENST00000439262.2_Missense_Mutation_p.Y169S|PRKAG3_ENST00000392098.3_Missense_Mutation_p.Y194S			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	194					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	CATGGCATCGTAGCAGGTGTG	0.602																																						dbGAP											0													86.0	75.0	79.0					2																	219694753		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.581A>C	2.37:g.219694753T>G	ENSP00000436068:p.Tyr194Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core	p.Y194S	ENST00000529249.1	37	c.581	CCDS2424.1	2	.	.	.	.	.	.	.	.	.	.	T	26.8	4.774140	0.90108	.	.	ENSG00000115592	ENST00000439262;ENST00000545803;ENST00000529249;ENST00000392098	D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.92224	0.7534	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	D	0.93169	0.6564	10	0.87932	D	0	-13.5037	14.0131	0.64509	0.0:0.0:0.0:1.0	.	194;169;194	B4DUK8;Q9UGI9-2;Q9UGI9	.;.;AAKG3_HUMAN	S	169;10;194;194	ENSP00000397133:Y169S;ENSP00000444536:Y10S;ENSP00000436068:Y194S;ENSP00000375947:Y194S	ENSP00000233944:Y194S	Y	-	2	0	PRKAG3	219402997	1.000000	0.71417	0.958000	0.39756	0.876000	0.50452	7.668000	0.83897	2.186000	0.69663	0.533000	0.62120	TAC	PRKAG3	-	NULL	ENSG00000115592		0.602	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRKAG3	HGNC	protein_coding	OTTHUMT00000385992.1	25	0.00	0	T			219694753	219694753	-1	no_errors	ENST00000233944	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	G
PRMT9	90826	genome.wustl.edu	37	4	148559724	148559724	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr4:148559724G>A	ENST00000322396.6	-	12	2739	c.2497C>T	c.(2497-2499)Cag>Tag	p.Q833*	PRMT10_ENST00000541232.1_Nonsense_Mutation_p.Q720*|TMEM184C_ENST00000508208.1_Intron	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		833	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						TTGTGATGCTGAATGCTGAGT	0.398																																						dbGAP											0													221.0	197.0	205.0					4																	148559724		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000322396.6:c.2497C>T	4.37:g.148559724G>A	ENSP00000314396:p.Gln833*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Nonsense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q833*	ENST00000322396.6	37	c.2497	CCDS3771.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.701046	0.98441	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	.	.	.	5.6	2.84	0.33178	.	0.250666	0.40818	N	0.001002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-18.959	16.7032	0.85364	0.0:0.3479:0.6521:0.0	.	.	.	.	X	833;720	.	ENSP00000314396:Q833X	Q	-	1	0	PRMT10	148779174	1.000000	0.71417	0.968000	0.41197	0.773000	0.43773	2.537000	0.45702	0.272000	0.22027	-0.502000	0.04539	CAG	PRMT10	-	NULL	ENSG00000164169		0.398	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT10	HGNC	protein_coding	OTTHUMT00000364650.1	270	0.00	0	G			148559724	148559724	-1	no_errors	ENST00000322396	ensembl	human	known	69_37n	nonsense	163	48.09	151	SNP	1.000	A
PSMF1	9491	genome.wustl.edu	37	20	1099509	1099509	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr20:1099509G>A	ENST00000335877.6	+	1	269	c.93G>A	c.(91-93)gtG>gtA	p.V31V	PSMF1_ENST00000381898.4_Intron|PSMF1_ENST00000438768.2_Silent_p.V31V|PSMF1_ENST00000333082.3_Silent_p.V31V|PSMF1_ENST00000246015.4_Silent_p.V31V	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	31	Important for homodimerization and interaction with FBXO7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						GGGAAGTGGTGACACACGGTT	0.642																																						dbGAP											0													88.0	79.0	82.0					20																	1099509		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.93G>A	20.37:g.1099509G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ9|D3DVW3|Q9H4I1	Silent	SNP	pfam_Inhibitor_PI31,pfam_PI31_Prot_Reg	p.V31	ENST00000335877.6	37	c.93	CCDS13010.1	20																																																																																			PSMF1	-	pfam_Inhibitor_PI31	ENSG00000125818		0.642	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMF1	HGNC	protein_coding	OTTHUMT00000077504.2	60	0.00	0	G	NM_178578		1099509	1099509	+1	no_errors	ENST00000333082	ensembl	human	known	69_37n	silent	73	37.07	43	SNP	1.000	A
PTK2B	2185	genome.wustl.edu	37	8	27288485	27288485	+	Silent	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr8:27288485C>T	ENST00000397501.1	+	13	1570	c.762C>T	c.(760-762)ctC>ctT	p.L254L	PTK2B_ENST00000346049.5_Silent_p.L254L|PTK2B_ENST00000397497.4_5'UTR|PTK2B_ENST00000544172.1_Silent_p.L254L|PTK2B_ENST00000517339.1_Silent_p.L254L|PTK2B_ENST00000338238.4_Silent_p.L254L|PTK2B_ENST00000420218.2_Silent_p.L254L	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	254	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	TCAACACTCTCGCCGGCTTCG	0.577																																						dbGAP											0													149.0	129.0	136.0					8																	27288485		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.762C>T	8.37:g.27288485C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	superfamily_FERM_central,pfscan_FERM_domain	p.R28C	ENST00000397501.1	37	c.82	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	C	5.895	0.349291	0.11182	.	.	ENSG00000120899	ENST00000519512	.	.	.	5.8	-11.6	0.00059	.	.	.	.	.	T	0.48150	0.1484	.	.	.	0.44117	D	0.996891	.	.	.	.	.	.	T	0.65981	-0.6036	4	.	.	.	.	10.6844	0.45835	0.0723:0.0775:0.5781:0.2721	.	.	.	.	C	28	.	.	R	+	1	0	PTK2B	27344402	0.000000	0.05858	0.001000	0.08648	0.532000	0.34746	-2.649000	0.00858	-3.550000	0.00142	-0.176000	0.13171	CGC	PTK2B	-	superfamily_FERM_central,pfscan_FERM_domain	ENSG00000120899		0.577	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	HGNC	protein_coding	OTTHUMT00000219916.1	70	0.00	0	C	NM_004103		27288485	27288485	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000519512	ensembl	human	putative	69_37n	missense	65	18.75	15	SNP	0.007	T
PTPN13	5783	genome.wustl.edu	37	4	87720273	87720273	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr4:87720273G>T	ENST00000411767.2	+	42	6484	c.6421G>T	c.(6421-6423)Gaa>Taa	p.E2141*	PTPN13_ENST00000436978.1_Nonsense_Mutation_p.E2146*|PTPN13_ENST00000427191.2_Nonsense_Mutation_p.E2122*|PTPN13_ENST00000316707.6_Nonsense_Mutation_p.E1950*|PTPN13_ENST00000511467.1_Nonsense_Mutation_p.E2146*			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2141					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GAAGCCACAAGAAAAGAAGAC	0.313																																						dbGAP											0													62.0	58.0	59.0					4																	87720273		1822	4077	5899	-	-	-	SO:0001587	stop_gained	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.6421G>T	4.37:g.87720273G>T	ENSP00000407249:p.Glu2141*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Nonsense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E2146*	ENST00000411767.2	37	c.6436	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	G	49	15.195406	0.99825	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	.	.	.	5.53	4.69	0.59074	.	0.656368	0.13358	N	0.393843	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	5.6366	0.17540	0.1629:0.0:0.6782:0.1588	.	.	.	.	X	2122;2146;1950;2141;2146;2090	.	ENSP00000322675:E1950X	E	+	1	0	PTPN13	87939297	0.029000	0.19370	0.726000	0.30738	0.787000	0.44495	1.059000	0.30517	1.477000	0.48234	0.491000	0.48974	GAA	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13	ENSG00000163629		0.313	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	41	0.00	0	G			87720273	87720273	+1	no_errors	ENST00000436978	ensembl	human	known	69_37n	nonsense	24	27.27	9	SNP	0.050	T
RAB20	55647	genome.wustl.edu	37	13	111176031	111176031	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr13:111176031C>G	ENST00000267328.3	-	2	899	c.686G>C	c.(685-687)aGa>aCa	p.R229T		NM_017817.1	NP_060287.1	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family	229					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)			endometrium(2)|large_intestine(2)|lung(3)	7	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			ACACCCAGATCTGGTCCTCTT	0.542																																						dbGAP											0													146.0	112.0	123.0					13																	111176031		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000436	CCDS9512.1	13q34	2008-07-18			ENSG00000139832	ENSG00000139832		"""RAB, member RAS oncogene"""	18260	protein-coding gene	gene with protein product						11697911	Standard	NM_017817		Approved	FLJ20429	uc001vqy.3	Q9NX57	OTTHUMG00000017343	ENST00000267328.3:c.686G>C	13.37:g.111176031C>G	ENSP00000267328:p.Arg229Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T9X5|Q9NX49	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R229T	ENST00000267328.3	37	c.686	CCDS9512.1	13	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389456	0.25118	.	.	ENSG00000139832	ENST00000267328	T	0.67698	-0.28	5.21	-0.686	0.11324	.	0.623507	0.16696	N	0.203330	T	0.53206	0.1782	L	0.51422	1.61	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.40365	-0.9567	10	0.39692	T	0.17	-14.4542	5.8669	0.18781	0.0:0.1825:0.1395:0.678	.	229	Q9NX57	RAB20_HUMAN	T	229	ENSP00000267328:R229T	ENSP00000267328:R229T	R	-	2	0	RAB20	109974032	0.281000	0.24258	0.000000	0.03702	0.450000	0.32258	0.233000	0.17911	-0.380000	0.07894	0.561000	0.74099	AGA	RAB20	-	NULL	ENSG00000139832		0.542	RAB20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB20	HGNC	protein_coding	OTTHUMT00000045760.2	39	0.00	0	C	NM_017817		111176031	111176031	-1	no_errors	ENST00000267328	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	0.000	G
RAP1GDS1	5910	genome.wustl.edu	37	4	99325751	99325751	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr4:99325751A>G	ENST00000408927.3	+	7	874	c.761A>G	c.(760-762)aAt>aGt	p.N254S	RAP1GDS1_ENST00000453712.2_Missense_Mutation_p.N255S|RAP1GDS1_ENST00000380158.4_Missense_Mutation_p.N206S|RAP1GDS1_ENST00000408900.3_Missense_Mutation_p.N205S|RAP1GDS1_ENST00000339360.5_Missense_Mutation_p.N255S|RAP1GDS1_ENST00000264572.7_Missense_Mutation_p.N163S	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	254					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		TTGGCAGAAAATGGTGAGAAA	0.313			T	NUP98	T-ALL																																	dbGAP		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	0													96.0	93.0	94.0					4																	99325751		1810	4068	5878	-	-	-	SO:0001583	missense	0				CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.761A>G	4.37:g.99325751A>G	ENSP00000386153:p.Asn254Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.N255S	ENST00000408927.3	37	c.764	CCDS43253.1	4	.	.	.	.	.	.	.	.	.	.	A	15.65	2.894979	0.52121	.	.	ENSG00000138698	ENST00000380158;ENST00000264572;ENST00000408927;ENST00000453712;ENST00000408900;ENST00000339360	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.47	5.47	0.80525	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.48040	0.1478	N	0.25647	0.755	0.80722	D	1	P;D;P;B;P;P	0.56035	0.547;0.974;0.956;0.05;0.918;0.532	B;D;D;B;B;B	0.70487	0.218;0.969;0.931;0.014;0.428;0.175	T	0.31696	-0.9934	10	0.10111	T	0.7	-17.5769	15.5537	0.76173	1.0:0.0:0.0:0.0	.	163;205;206;254;255;255	E9PH06;P52306-2;Q499L7;P52306;Q4QQI8;G5E9P9	.;.;.;GDS1_HUMAN;.;.	S	206;163;254;255;205;255	ENSP00000369503:N206S;ENSP00000264572:N163S;ENSP00000386153:N254S;ENSP00000407157:N255S;ENSP00000386223:N205S;ENSP00000340454:N255S	ENSP00000264572:N163S	N	+	2	0	RAP1GDS1	99544774	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	8.962000	0.93254	2.075000	0.62263	0.397000	0.26171	AAT	RAP1GDS1	-	superfamily_ARM-type_fold	ENSG00000138698		0.313	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GDS1	HGNC	protein_coding	OTTHUMT00000363273.2	208	0.00	0	A	NM_001100426		99325751	99325751	+1	no_errors	ENST00000339360	ensembl	human	known	69_37n	missense	179	22.51	52	SNP	1.000	G
RPRD2	23248	genome.wustl.edu	37	1	150444379	150444379	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:150444379G>A	ENST00000369068.4	+	11	2959	c.2955G>A	c.(2953-2955)acG>acA	p.T985T	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Silent_p.T959T|RPRD2_ENST00000539519.1_Missense_Mutation_p.G913R	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	985						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)		p.T985T(2)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CCGCTCCCACGGGTCACCCAC	0.547																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											230.0	237.0	235.0					1																	150444379		1994	4161	6155	-	-	-	SO:0001819	synonymous_variant	0			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2955G>A	1.37:g.150444379G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.G913R	ENST00000369068.4	37	c.2737	CCDS44216.1	1	.	.	.	.	.	.	.	.	.	.	G	5.322	0.244690	0.10077	.	.	ENSG00000163125	ENST00000539519	T	0.48522	0.81	4.9	1.87	0.25490	.	.	.	.	.	T	0.13798	0.0334	.	.	.	0.21967	N	0.999443	B	0.06786	0.001	B	0.04013	0.001	T	0.22312	-1.0220	8	0.62326	D	0.03	-0.3381	1.595	0.02662	0.3099:0.132:0.4225:0.1356	.	913	B4E2Q6	.	R	913	ENSP00000445482:G913R	ENSP00000445482:G913R	G	+	1	0	RPRD2	148711003	0.516000	0.26218	1.000000	0.80357	0.999000	0.98932	-0.291000	0.08343	0.624000	0.30286	0.650000	0.86243	GGG	RPRD2	-	NULL	ENSG00000163125		0.547	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	HGNC	protein_coding	OTTHUMT00000035844.1	352	0.00	0	G	NM_015203		150444379	150444379	+1	no_errors	ENST00000539519	ensembl	human	known	69_37n	missense	894	14.54	153	SNP	0.994	A
RGS7	6000	genome.wustl.edu	37	1	241094034	241094034	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:241094034G>A	ENST00000407727.1	-	5	367	c.368C>T	c.(367-369)cCg>cTg	p.P123L	RGS7_ENST00000366562.4_Missense_Mutation_p.P123L|RGS7_ENST00000366564.1_Missense_Mutation_p.P123L|RGS7_ENST00000401882.1_Intron|RGS7_ENST00000331110.7_Missense_Mutation_p.P97L|RGS7_ENST00000366565.1_Missense_Mutation_p.P123L|RGS7_ENST00000366563.1_Missense_Mutation_p.P123L|RGS7_ENST00000446183.2_Missense_Mutation_p.P39L|RGS7_ENST00000348120.2_Intron			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	123					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TGTGTTTTCCGGCTCCCAACA	0.388																																						dbGAP											0													126.0	139.0	135.0					1																	241094034		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.368C>T	1.37:g.241094034G>A	ENSP00000384428:p.Pro123Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.P123L	ENST00000407727.1	37	c.368		1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.867783	0.91587	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000446183;ENST00000366562;ENST00000407727	T;T;T;T;T;T;T	0.35973	1.31;1.28;1.31;1.29;1.31;1.31;1.29	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.62146	0.2404	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.998;0.991	D;D;D;D;P	0.91635	0.975;0.999;0.995;0.97;0.761	T	0.63310	-0.6666	10	0.66056	D	0.02	-13.8552	17.2744	0.87111	0.0:0.0:1.0:0.0	.	39;97;123;123;123	B7Z223;B7Z257;P49802-2;P49802-5;P49802-3	.;.;.;.;.	L	97;123;123;123;39;123;123	ENSP00000331485:P97L;ENSP00000355523:P123L;ENSP00000355522:P123L;ENSP00000355521:P123L;ENSP00000390138:P39L;ENSP00000355520:P123L;ENSP00000384428:P123L	ENSP00000331485:P97L	P	-	2	0	RGS7	239160657	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.000000	0.93564	2.769000	0.95229	0.655000	0.94253	CCG	RGS7	-	NULL	ENSG00000182901		0.388	RGS7-204	KNOWN	basic	protein_coding	RGS7	HGNC	protein_coding		419	0.24	1	G	NM_002924		241094034	241094034	-1	no_errors	ENST00000407727	ensembl	human	known	69_37n	missense	304	51.44	322	SNP	1.000	A
SAMD9L	219285	genome.wustl.edu	37	7	92764927	92764927	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr7:92764927C>G	ENST00000318238.4	-	5	1574	c.358G>C	c.(358-360)Gat>Cat	p.D120H	SAMD9L_ENST00000437805.1_Missense_Mutation_p.D120H|SAMD9L_ENST00000411955.1_Missense_Mutation_p.D120H	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	120					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GGATCATAATCAATATTAGAT	0.318																																						dbGAP											0													107.0	117.0	114.0					7																	92764927		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.358G>C	7.37:g.92764927C>G	ENSP00000326247:p.Asp120His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,pfscan_SAM	p.D120H	ENST00000318238.4	37	c.358	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599669	0.46318	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472	T;T;T	0.13420	2.59;2.59;2.59	4.71	0.714	0.18180	.	0.334157	0.23727	N	0.045171	T	0.19208	0.0461	L	0.51422	1.61	0.09310	N	1	D;P	0.61697	0.99;0.91	P;P	0.60012	0.867;0.464	T	0.08534	-1.0717	10	0.25106	T	0.35	-10.5918	5.3857	0.16216	0.1435:0.6082:0.0:0.2483	.	120;120	Q8IVG5-2;Q8IVG5	.;SAM9L_HUMAN	H	120	ENSP00000326247:D120H;ENSP00000405760:D120H;ENSP00000408796:D120H	ENSP00000326247:D120H	D	-	1	0	SAMD9L	92602863	0.000000	0.05858	0.001000	0.08648	0.045000	0.14185	-0.104000	0.10923	0.610000	0.30035	0.460000	0.39030	GAT	SAMD9L	-	NULL	ENSG00000177409		0.318	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	590	0.00	0	C	NM_152703		92764927	92764927	-1	no_errors	ENST00000318238	ensembl	human	known	69_37n	missense	234	45.48	196	SNP	0.000	G
SERINC1	57515	genome.wustl.edu	37	6	122774991	122774993	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr6:122774991_122774993delAAG	ENST00000339697.4	-	5	595_597	c.511_513delCTT	c.(511-513)cttdel	p.L171del		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	171					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		CAAAATCAATAAGTAAGACTAGT	0.394																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.511_513delCTT	6.37:g.122774991_122774993delAAG	ENSP00000342962:p.Leu171del	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	In_Frame_Del	DEL	pfam_TMS_TDE	p.L171in_frame_del	ENST00000339697.4	37	c.513_511	CCDS5125.1	6																																																																																			SERINC1	-	pfam_TMS_TDE	ENSG00000111897		0.394	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC1	HGNC	protein_coding	OTTHUMT00000042031.2	134	0.00	0	AAG	NM_020755		122774991	122774993	-1	no_errors	ENST00000339697	ensembl	human	known	69_37n	in_frame_del	90	21.49	26	DEL	1.000:1.000:1.000	-
SLC24A3	57419	genome.wustl.edu	37	20	19677522	19677522	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr20:19677522G>A	ENST00000328041.6	+	14	1770	c.1573G>A	c.(1573-1575)Gac>Aac	p.D525N	RP4-718D20.3_ENST00000600889.1_RNA|RP4-718D20.3_ENST00000609610.1_RNA|RP4-718D20.3_ENST00000608476.1_RNA|RP4-718D20.3_ENST00000598694.1_RNA|RP4-718D20.3_ENST00000435992.2_RNA|RP4-718D20.3_ENST00000593770.1_RNA|RP4-718D20.3_ENST00000609846.1_RNA	NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	525					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CAGCGTGCCTGACTGCATGGC	0.592																																						dbGAP											0													92.0	76.0	81.0					20																	19677522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1573G>A	20.37:g.19677522G>A	ENSP00000333519:p.Asp525Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.D525N	ENST00000328041.6	37	c.1573	CCDS13140.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.556683	0.96514	.	.	ENSG00000185052	ENST00000328041	T	0.71461	-0.57	5.7	5.7	0.88788	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.86665	0.5987	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87509	0.2438	9	.	.	.	.	18.6103	0.91283	0.0:0.0:1.0:0.0	.	525	Q9HC58	NCKX3_HUMAN	N	525	ENSP00000333519:D525N	.	D	+	1	0	SLC24A3	19625522	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	9.830000	0.99415	2.695000	0.91970	0.561000	0.74099	GAC	SLC24A3	-	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	ENSG00000185052		0.592	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A3	HGNC	protein_coding	OTTHUMT00000078207.4	46	0.00	0	G	NM_020689		19677522	19677522	+1	no_errors	ENST00000328041	ensembl	human	known	69_37n	missense	20	41.18	14	SNP	1.000	A
SLC25A13	10165	genome.wustl.edu	37	7	95820474	95820474	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr7:95820474C>G	ENST00000265631.5	-	7	837	c.701G>C	c.(700-702)aGa>aCa	p.R234T	SLC25A13_ENST00000542654.1_Missense_Mutation_p.R126T|SLC25A13_ENST00000416240.2_Missense_Mutation_p.R234T			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	234					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	ATAGATCTTTCTAATGAGTTC	0.393																																						dbGAP											0													180.0	178.0	179.0					7																	95820474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.701G>C	7.37:g.95820474C>G	ENSP00000265631:p.Arg234Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_EF_HAND_2,pfscan_Mitochondrial_sb/sol_carrier	p.R234T	ENST00000265631.5	37	c.701	CCDS5645.1	7	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285848	0.59867	.	.	ENSG00000004864	ENST00000265631;ENST00000416240;ENST00000542654	T;T;T	0.80909	-1.43;-1.43;-1.43	5.18	5.18	0.71444	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83889	0.5352	M	0.75447	2.3	0.58432	D	0.999993	P;P;P	0.40794	0.696;0.729;0.729	B;B;B	0.43838	0.433;0.334;0.334	D	0.84303	0.0506	10	0.46703	T	0.11	-22.589	19.2746	0.94026	0.0:1.0:0.0:0.0	.	126;234;234	F5GX33;Q546F9;Q9UJS0	.;.;CMC2_HUMAN	T	234;234;126	ENSP00000265631:R234T;ENSP00000400101:R234T;ENSP00000440484:R126T	ENSP00000265631:R234T	R	-	2	0	SLC25A13	95658410	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.932000	0.70121	2.868000	0.98415	0.557000	0.71058	AGA	SLC25A13	-	NULL	ENSG00000004864		0.393	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A13	HGNC	protein_coding	OTTHUMT00000059395.2	302	0.66	2	C	NM_014251		95820474	95820474	-1	no_errors	ENST00000416240	ensembl	human	known	69_37n	missense	188	43.03	142	SNP	1.000	G
SMAD2	4087	genome.wustl.edu	37	18	45368278	45368278	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr18:45368278G>C	ENST00000402690.2	-	11	1718	c.1324C>G	c.(1324-1326)Ctg>Gtg	p.L442V	SMAD2_ENST00000356825.4_Missense_Mutation_p.L412V|SMAD2_ENST00000586040.1_Missense_Mutation_p.L412V|SMAD2_ENST00000262160.6_Missense_Mutation_p.L442V	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	442	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						GGTCCATTCAGATGAAGTTCA	0.423																																						dbGAP											0													168.0	144.0	152.0					18																	45368278		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1324C>G	18.37:g.45368278G>C	ENSP00000384449:p.Leu442Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.L442V	ENST00000402690.2	37	c.1324	CCDS11934.1	18	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403258	0.62288	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.99369	-5.78;-5.78;-5.78	5.65	3.85	0.44370	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99533	0.9833	H	0.95328	3.655	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.97110	0.964;1.0	D	0.98229	1.0482	10	0.87932	D	0	.	12.1175	0.53873	0.1389:0.0:0.8611:0.0	.	412;442	Q15796-2;Q15796	.;SMAD2_HUMAN	V	442;412;442	ENSP00000262160:L442V;ENSP00000349282:L412V;ENSP00000384449:L442V	ENSP00000262160:L442V	L	-	1	2	SMAD2	43622276	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.762000	0.47597	1.530000	0.49136	0.655000	0.94253	CTG	SMAD2	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000175387		0.423	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD2	HGNC	protein_coding	OTTHUMT00000450571.1	67	0.00	0	G	NM_005901		45368278	45368278	-1	no_errors	ENST00000262160	ensembl	human	known	69_37n	missense	47	50.53	48	SNP	1.000	C
SMARCA5	8467	genome.wustl.edu	37	4	144468591	144468591	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr4:144468591C>T	ENST00000283131.3	+	21	3169	c.2707C>T	c.(2707-2709)Cag>Tag	p.Q903*		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	903					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GATTATGGCTCAGATTGAAAG	0.348																																						dbGAP											0													92.0	91.0	92.0					4																	144468591		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.2707C>T	4.37:g.144468591C>T	ENSP00000283131:p.Gln903*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ATPase_nucl-remodel_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Homeodomain-like,superfamily_ATPase_nucl-remodel_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q903*	ENST00000283131.3	37	c.2707	CCDS3761.1	4	.	.	.	.	.	.	.	.	.	.	C	47	13.024941	0.99714	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-9.0739	19.6978	0.96034	0.0:1.0:0.0:0.0	.	.	.	.	X	903;846;846	.	ENSP00000283131:Q903X	Q	+	1	0	SMARCA5	144688041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.775000	0.85489	2.649000	0.89929	0.650000	0.86243	CAG	SMARCA5	-	pfam_SLIDE,superfamily_Homeodomain-like	ENSG00000153147		0.348	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCA5	HGNC	protein_coding	OTTHUMT00000365077.3	244	0.00	0	C			144468591	144468591	+1	no_errors	ENST00000283131	ensembl	human	known	69_37n	nonsense	170	27.23	64	SNP	1.000	T
SORBS1	10580	genome.wustl.edu	37	10	97106171	97106171	+	Silent	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr10:97106171C>T	ENST00000361941.3	-	24	2447	c.2421G>A	c.(2419-2421)caG>caA	p.Q807Q	SORBS1_ENST00000354106.3_Silent_p.Q777Q|SORBS1_ENST00000474353.2_5'UTR|SORBS1_ENST00000371245.3_Silent_p.Q658Q|SORBS1_ENST00000277982.5_Silent_p.Q829Q|SORBS1_ENST00000607232.1_Silent_p.Q1067Q|SORBS1_ENST00000393949.1_Silent_p.Q777Q|SORBS1_ENST00000371241.1_Silent_p.Q457Q|SORBS1_ENST00000306402.6_Silent_p.Q554Q|SORBS1_ENST00000347291.4_Silent_p.Q619Q|SORBS1_ENST00000371247.2_Silent_p.Q807Q|SORBS1_ENST00000371249.2_Silent_p.Q589Q|SORBS1_ENST00000353505.5_Silent_p.Q658Q|SORBS1_ENST00000371246.2_Silent_p.Q829Q|SORBS1_ENST00000371239.1_Silent_p.Q584Q|SORBS1_ENST00000371227.4_Silent_p.Q761Q	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ACTTTAGTGTCTGAGCTTTAA	0.343																																						dbGAP											0													86.0	85.0	85.0					10																	97106171		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.2421G>A	10.37:g.97106171C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.Q807	ENST00000361941.3	37	c.2421	CCDS31255.1	10																																																																																			SORBS1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000095637		0.343	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	123	0.00	0	C			97106171	97106171	-1	no_errors	ENST00000361941	ensembl	human	known	69_37n	silent	63	47.93	58	SNP	1.000	T
SOX30	11063	genome.wustl.edu	37	5	157078243	157078243	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr5:157078243C>T	ENST00000265007.6	-	1	1185	c.844G>A	c.(844-846)Gag>Aag	p.E282K	SOX30_ENST00000311371.5_Missense_Mutation_p.E282K|SOX30_ENST00000519442.1_Intron	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	282					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTTATCAGCTCTGAAGGCGGA	0.562																																					Esophageal Squamous(31;525 799 19355 21125 41744)	dbGAP											0													72.0	81.0	78.0					5																	157078243		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.844G>A	5.37:g.157078243C>T	ENSP00000265007:p.Glu282Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94995|Q8IYX6	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E282K	ENST00000265007.6	37	c.844	CCDS4339.1	5	.	.	.	.	.	.	.	.	.	.	C	9.099	1.003772	0.19199	.	.	ENSG00000039600	ENST00000311371;ENST00000265007	D;D	0.98313	-4.86;-4.43	4.66	4.66	0.58398	.	0.328071	0.26180	N	0.025877	D	0.93903	0.8049	N	0.19112	0.55	0.80722	D	1	B;B	0.23937	0.094;0.031	B;B	0.19946	0.027;0.014	D	0.90432	0.4425	10	0.31617	T	0.26	.	8.085	0.30767	0.0:0.7515:0.1616:0.0869	.	282;282	O94993-2;O94993	.;SOX30_HUMAN	K	282	ENSP00000309343:E282K;ENSP00000265007:E282K	ENSP00000265007:E282K	E	-	1	0	SOX30	157010821	0.991000	0.36638	1.000000	0.80357	0.051000	0.14879	2.592000	0.46171	2.420000	0.82092	0.460000	0.39030	GAG	SOX30	-	NULL	ENSG00000039600		0.562	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SOX30	HGNC	protein_coding	OTTHUMT00000252571.2	67	0.00	0	C	NM_007017		157078243	157078243	-1	no_errors	ENST00000265007	ensembl	human	known	69_37n	missense	20	44.44	16	SNP	0.999	T
SPTA1	6708	genome.wustl.edu	37	1	158615008	158615008	+	Silent	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:158615008C>T	ENST00000368147.4	-	29	4344	c.4164G>A	c.(4162-4164)aaG>aaA	p.K1388K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1388					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTAGGATCTTCTTGCGTTTTT	0.433																																						dbGAP											0													188.0	169.0	175.0					1																	158615008		1911	4129	6040	-	-	-	SO:0001819	synonymous_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4164G>A	1.37:g.158615008C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.K1388	ENST00000368147.4	37	c.4164	CCDS41423.1	1																																																																																			SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.433	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	251	0.00	0	C	NM_003126		158615008	158615008	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	silent	349	25.74	121	SNP	0.993	T
STRN3	29966	genome.wustl.edu	37	14	31374670	31374672	+	In_Frame_Del	DEL	TAA	TAA	-			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	TAA	TAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr14:31374670_31374672delTAA	ENST00000357479.5	-	15	2177_2179	c.1981_1983delTTA	c.(1981-1983)ttadel	p.L661del	STRN3_ENST00000355683.5_In_Frame_Del_p.L577del	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	661					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		GTGATGTTTCTAAATCATAAATT	0.36																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1981_1983delTTA	14.37:g.31374670_31374672delTAA	ENSP00000350071:p.Leu661del	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX7|A6NHZ7|Q9NRA5	In_Frame_Del	DEL	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L661in_frame_del	ENST00000357479.5	37	c.1983_1981	CCDS41938.1	14																																																																																			STRN3	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000196792		0.360	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	STRN3	HGNC	protein_coding	OTTHUMT00000409713.1	170	0.00	0	TAA	NM_014574		31374670	31374672	-1	no_errors	ENST00000357479	ensembl	human	known	69_37n	in_frame_del	100	42.70	79	DEL	1.000:1.000:0.999	-
TARBP1	6894	genome.wustl.edu	37	1	234556558	234556558	+	Splice_Site	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:234556558C>T	ENST00000040877.1	-	21	3444	c.3445G>A	c.(3445-3447)Gat>Aat	p.D1149N		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1149					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			ACTAATTCATCCTGGAAAGGA	0.373																																						dbGAP											0													102.0	108.0	106.0					1																	234556558		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3445-1G>A	1.37:g.234556558C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H581	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.D1149N	ENST00000040877.1	37	c.3445	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329846	0.81690	.	.	ENSG00000059588	ENST00000040877	T	0.06218	3.33	5.74	5.74	0.90152	Armadillo-type fold (1);	0.155822	0.56097	D	0.000040	T	0.19366	0.0465	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	P	0.57425	0.82	T	0.00312	-1.1826	10	0.30078	T	0.28	-23.0705	19.5152	0.95160	0.0:1.0:0.0:0.0	.	1149	Q13395	TARB1_HUMAN	N	1149	ENSP00000040877:D1149N	ENSP00000040877:D1149N	D	-	1	0	TARBP1	232623181	1.000000	0.71417	0.998000	0.56505	0.641000	0.38312	6.705000	0.74644	2.708000	0.92522	0.650000	0.86243	GAT	TARBP1	-	superfamily_ARM-type_fold	ENSG00000059588		0.373	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	241	0.41	1	C	NM_005646	Missense_Mutation	234556558	234556558	-1	no_errors	ENST00000040877	ensembl	human	known	69_37n	missense	395	12.97	59	SNP	1.000	T
TECTA	7007	genome.wustl.edu	37	11	120989316	120989316	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr11:120989316G>A	ENST00000392793.1	+	7	1363	c.1092G>A	c.(1090-1092)gaG>gaA	p.E364E	TECTA_ENST00000264037.2_Silent_p.E364E			O75443	TECTA_HUMAN	tectorin alpha	364	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCAGTGTGGAGGCCAAGAATG	0.537																																						dbGAP											0													110.0	104.0	106.0					11																	120989316		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1092G>A	11.37:g.120989316G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.E364	ENST00000392793.1	37	c.1092	CCDS8434.1	11																																																																																			TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.537	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	53	0.00	0	G	NM_005422		120989316	120989316	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	silent	42	19.23	10	SNP	1.000	A
TSSK3	81629	genome.wustl.edu	37	1	32829406	32829406	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr1:32829406T>C	ENST00000373534.3	+	2	861	c.356T>C	c.(355-357)gTt>gCt	p.V119A	FAM229A_ENST00000415596.1_Intron|FAM229A_ENST00000432622.1_5'Flank	NM_052841.3	NP_443073.1	Q96PN8	TSSK3_HUMAN	testis-specific serine kinase 3	119	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|large_intestine(6)|lung(5)|skin(2)|stomach(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)				CGTCAGATGGTTGAGGCCATC	0.597																																						dbGAP											0													68.0	64.0	65.0					1																	32829406		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF296450	CCDS362.1	1p35-p34	2008-02-05	2005-03-10	2005-03-12	ENSG00000162526	ENSG00000162526			15473	protein-coding gene	gene with protein product		607660	"""serine/threonine kinase 22C (spermiogenesis associated)"""	STK22C		11597141	Standard	NM_052841		Approved	SPOGA3	uc001bvf.3	Q96PN8	OTTHUMG00000007585	ENST00000373534.3:c.356T>C	1.37:g.32829406T>C	ENSP00000362634:p.Val119Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TEE5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V119A	ENST00000373534.3	37	c.356	CCDS362.1	1	.	.	.	.	.	.	.	.	.	.	T	10.82	1.457651	0.26161	.	.	ENSG00000162526	ENST00000373534	T	0.20881	2.04	5.42	4.29	0.51040	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000016	T	0.15739	0.0379	N	0.20401	0.57	0.80722	D	1	B	0.18741	0.03	B	0.31101	0.124	T	0.06373	-1.0830	10	0.66056	D	0.02	.	9.978	0.41795	0.0:0.0806:0.0:0.9194	.	119	Q96PN8	TSSK3_HUMAN	A	119	ENSP00000362634:V119A	ENSP00000362634:V119A	V	+	2	0	TSSK3	32601993	0.963000	0.33076	0.943000	0.38184	0.991000	0.79684	1.671000	0.37513	2.197000	0.70478	0.533000	0.62120	GTT	TSSK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162526		0.597	TSSK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK3	HGNC	protein_coding	OTTHUMT00000020049.1	79	0.00	0	T			32829406	32829406	+1	no_errors	ENST00000373534	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.976	C
TTC7A	57217	genome.wustl.edu	37	2	47202165	47202165	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr2:47202165G>A	ENST00000319190.5	+	4	939	c.571G>A	c.(571-573)Gag>Aag	p.E191K	TTC7A_ENST00000263737.6_5'UTR|TTC7A_ENST00000394850.2_Missense_Mutation_p.E191K|TTC7A_ENST00000461601.1_3'UTR|TTC7A_ENST00000409245.1_Missense_Mutation_p.E157K	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	191					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			CCGCCTGACAGAGAGGGAGGA	0.607																																						dbGAP											0													101.0	93.0	95.0					2																	47202165		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.571G>A	2.37:g.47202165G>A	ENSP00000316699:p.Glu191Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIX4|Q8ND67|Q9BUS3	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E191K	ENST00000319190.5	37	c.571	CCDS33193.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.217535|5.217535	0.95104|0.95104	.|.	.|.	ENSG00000068724|ENSG00000068724	ENST00000434093|ENST00000409245;ENST00000319190;ENST00000394850	.|T;T;T	.|0.34859	.|1.78;1.78;1.34	5.9|5.9	5.9|5.9	0.94986|0.94986	.|Tetratricopeptide-like helical (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.59197	.|0.2176	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	.|D;P;D;P	.|0.89917	.|0.997;0.855;1.0;0.911	.|D;P;D;P	.|0.85130	.|0.985;0.574;0.997;0.674	.|T	.|0.48352	.|-0.9043	.|10	.|0.22706	.|T	.|0.39	.|-28.2708	19.0502|19.0502	0.93039|0.93039	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|191;157;191;157	.|Q2T9J9;B3KPK7;Q9ULT0;G5E9G4	.|.;.;TTC7A_HUMAN;.	.|K	-1|157;191;191	.|ENSP00000386307:E157K;ENSP00000316699:E191K;ENSP00000378320:E191K	.|ENSP00000316699:E191K	.|E	+|+	.|1	.|0	TTC7A|TTC7A	47055669|47055669	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.908000|0.908000	0.53690|0.53690	5.940000|5.940000	0.70187|0.70187	2.798000|2.798000	0.96311|0.96311	0.650000|0.650000	0.86243|0.86243	.|GAG	TTC7A	-	NULL	ENSG00000068724		0.607	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC7A	HGNC	protein_coding	OTTHUMT00000329667.2	79	0.00	0	G	XM_372927		47202165	47202165	+1	no_errors	ENST00000319190	ensembl	human	known	69_37n	missense	82	25.23	28	SNP	0.996	A
USO1	8615	genome.wustl.edu	37	4	76695834	76695834	+	Silent	SNP	C	C	G			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr4:76695834C>G	ENST00000538159.1	+	8	567	c.567C>G	c.(565-567)gtC>gtG	p.V189V	USO1_ENST00000514213.2_Silent_p.V172V			O60763	USO1_HUMAN	USO1 vesicle transport factor	187	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TATAGGGCGTCTTACTACTGC	0.358																																						dbGAP											0													80.0	71.0	74.0					4																	76695834		1845	4080	5925	-	-	-	SO:0001819	synonymous_variant	0			AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.567C>G	4.37:g.76695834C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Silent	SNP	pfam_Vesicle_Uso1_P115_head,pfam_Uso1_p115_C,superfamily_ARM-type_fold,superfamily_t-SNARE	p.V189	ENST00000538159.1	37	c.567		4																																																																																			USO1	-	superfamily_ARM-type_fold	ENSG00000138768		0.358	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	USO1	HGNC	protein_coding		90	0.00	0	C	NM_003715		76695834	76695834	+1	no_errors	ENST00000538159	ensembl	human	known	69_37n	silent	72	20.00	18	SNP	0.991	G
VWF	7450	genome.wustl.edu	37	12	6091094	6091094	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr12:6091094G>T	ENST00000261405.5	-	42	7399	c.7145C>A	c.(7144-7146)aCc>aAc	p.T2382N		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2382					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CTTCCGAAGGGTGGGCAAACG	0.607																																						dbGAP											0													95.0	80.0	85.0					12																	6091094		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7145C>A	12.37:g.6091094G>T	ENSP00000261405:p.Thr2382Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T2382N	ENST00000261405.5	37	c.7145	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	G	15.68	2.903727	0.52333	.	.	ENSG00000110799	ENST00000261405	T	0.37235	1.21	4.98	2.17	0.27698	.	0.367266	0.19826	N	0.105190	T	0.30039	0.0752	L	0.48642	1.525	0.23773	N	0.996889	B	0.18166	0.026	B	0.22880	0.042	T	0.20371	-1.0277	10	0.37606	T	0.19	.	9.6886	0.40114	0.227:0.0:0.773:0.0	.	2382	P04275	VWF_HUMAN	N	2382	ENSP00000261405:T2382N	ENSP00000261405:T2382N	T	-	2	0	VWF	5961355	0.946000	0.32159	0.001000	0.08648	0.640000	0.38277	4.446000	0.60014	0.287000	0.22375	0.555000	0.69702	ACC	VWF	-	pirsf_VWF	ENSG00000110799		0.607	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	56	0.00	0	G	NM_000552		6091094	6091094	-1	no_errors	ENST00000261405	ensembl	human	known	69_37n	missense	47	36.49	27	SNP	0.003	T
WISP1	8840	genome.wustl.edu	37	8	134225361	134225361	+	Silent	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr8:134225361G>C	ENST00000250160.6	+	2	430	c.324G>C	c.(322-324)ccG>ccC	p.P108P	WISP1_ENST00000220856.6_Silent_p.P108P|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000517423.1_Silent_p.P108P	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	108	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GGGACCGCCCGAGGTACGCAA	0.622																																						dbGAP											0													62.0	62.0	62.0					8																	134225361		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.324G>C	8.37:g.134225361G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Silent	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Cys_knot,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.P108	ENST00000250160.6	37	c.324	CCDS6371.1	8																																																																																			WISP1	-	smart_IGFBP-like,pirsf_IGFBP_CNN	ENSG00000104415		0.622	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP1	HGNC	protein_coding	OTTHUMT00000378794.2	70	0.00	0	G	NM_003882		134225361	134225361	+1	no_errors	ENST00000250160	ensembl	human	known	69_37n	silent	44	41.33	31	SNP	1.000	C
WNT7A	7476	genome.wustl.edu	37	3	13860791	13860791	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr3:13860791C>T	ENST00000285018.4	-	4	1004	c.700G>A	c.(700-702)Gag>Aag	p.E234K		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	234					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						TGAACGGCCTCGTTGTACTTG	0.607																																						dbGAP											0													110.0	102.0	105.0					3																	13860791		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.700G>A	3.37:g.13860791C>T	ENSP00000285018:p.Glu234Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H90|Q9Y560	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt7	p.E234K	ENST00000285018.4	37	c.700	CCDS2616.1	3	.	.	.	.	.	.	.	.	.	.	c	12.79	2.043548	0.36085	.	.	ENSG00000154764	ENST00000285018	T	0.75154	-0.91	4.18	4.18	0.49190	.	0.281036	0.39407	N	0.001372	T	0.54078	0.1836	N	0.03084	-0.415	0.46564	D	0.999102	B	0.06786	0.001	B	0.06405	0.002	T	0.52555	-0.8560	10	0.41790	T	0.15	.	16.889	0.86082	0.0:1.0:0.0:0.0	.	234	O00755	WNT7A_HUMAN	K	234	ENSP00000285018:E234K	ENSP00000285018:E234K	E	-	1	0	WNT7A	13835792	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.208000	0.58486	2.048000	0.60808	0.558000	0.71614	GAG	WNT7A	-	pfam_Wnt,smart_Wnt	ENSG00000154764		0.607	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7A	HGNC	protein_coding	OTTHUMT00000252031.2	57	0.00	0	C	NM_004625		13860791	13860791	-1	no_errors	ENST00000285018	ensembl	human	known	69_37n	missense	42	39.13	27	SNP	1.000	T
WWP1	11059	genome.wustl.edu	37	8	87460386	87460386	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr8:87460386C>T	ENST00000517970.1	+	19	2315	c.2008C>T	c.(2008-2010)Cat>Tat	p.H670Y	WWP1_ENST00000341922.2_Missense_Mutation_p.H540Y|WWP1_ENST00000349423.2_Missense_Mutation_p.H452Y|WWP1_ENST00000265428.4_Missense_Mutation_p.H670Y	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	670	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GGCACTATTTCATGGAAAGTT	0.264																																						dbGAP											0													38.0	40.0	39.0					8																	87460386		2195	4271	6466	-	-	-	SO:0001583	missense	0			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.2008C>T	8.37:g.87460386C>T	ENSP00000427793:p.His670Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.H670Y	ENST00000517970.1	37	c.2008	CCDS6242.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.721512|4.721512	0.89298|0.89298	.|.	.|.	ENSG00000123124|ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423|ENST00000520453	T;T;T;T|.	0.44482|.	0.92;0.92;0.92;0.92|.	5.05|5.05	5.05|5.05	0.67936|0.67936	HECT (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86900|0.86900	0.6044|0.6044	M|M	0.93854|0.93854	3.465|3.465	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.78314|.	0.983;0.991|.	D|D	0.90382|0.90382	0.4389|0.4389	10|5	0.87932|.	D|.	0|.	.|.	18.7714|18.7714	0.91893|0.91893	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	452;670|.	Q9H0M0-6;Q9H0M0|.	.;WWP1_HUMAN|.	Y|L	670;670;540;452|170	ENSP00000427793:H670Y;ENSP00000265428:H670Y;ENSP00000340564:H540Y;ENSP00000342665:H452Y|.	ENSP00000265428:H670Y|.	H|S	+|+	1|2	0|0	WWP1|WWP1	87529502|87529502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.776000|7.776000	0.85560|0.85560	2.510000|2.510000	0.84645|0.84645	0.655000|0.655000	0.94253|0.94253	CAT|TCA	WWP1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000123124		0.264	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP1	HGNC	protein_coding	OTTHUMT00000374755.1	141	0.00	0	C	NM_007013		87460386	87460386	+1	no_errors	ENST00000265428	ensembl	human	known	69_37n	missense	193	21.54	53	SNP	1.000	T
ZNF441	126068	genome.wustl.edu	37	19	11892414	11892414	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:11892414G>C	ENST00000357901.4	+	4	1877	c.1775G>C	c.(1774-1776)tGt>tCt	p.C592S	ZNF441_ENST00000454339.2_Missense_Mutation_p.C525S	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	592					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGTAAGATATGTGGGAAAGGC	0.403																																						dbGAP											0													68.0	63.0	64.0					19																	11892414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.1775G>C	19.37:g.11892414G>C	ENSP00000350576:p.Cys592Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C592S	ENST00000357901.4	37	c.1775	CCDS12266.2	19	.	.	.	.	.	.	.	.	.	.	-	18.27	3.587734	0.66105	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	D;D	0.85861	-2.04;-2.04	1.22	1.22	0.21188	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.91161	0.7216	H	0.97186	3.955	0.44677	D	0.99766	P	0.52463	0.953	P	0.49637	0.617	D	0.92136	0.5716	9	0.87932	D	0	.	9.9894	0.41860	0.0:0.0:1.0:0.0	.	592	Q8N8Z8	ZN441_HUMAN	S	548;592;525	ENSP00000350576:C592S;ENSP00000403738:C525S	ENSP00000350576:C592S	C	+	2	0	ZNF441	11753414	0.998000	0.40836	0.003000	0.11579	0.963000	0.63663	4.589000	0.61006	0.968000	0.38212	0.305000	0.20034	TGT	ZNF441	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197044		0.403	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF441	HGNC	protein_coding	OTTHUMT00000335273.3	100	0.00	0	G	NM_152355		11892414	11892414	+1	no_errors	ENST00000357901	ensembl	human	known	69_37n	missense	111	36.57	64	SNP	1.000	C
ZNF44	51710	genome.wustl.edu	37	19	12358544	12358544	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:12358544G>A	ENST00000426973.1	-	4	1170	c.1171C>T	c.(1171-1173)Caa>Taa	p.Q391*				P15621	ZNF44_HUMAN	zinc finger protein 44	485					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		TCATGTCTTTGAGCTGAGTAG	0.393																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000426973.1:c.1171C>T	19.37:g.12358544G>A	ENSP00000395745:p.Gln391*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q391*	ENST00000426973.1	37	c.1171		19	.	.	.	.	.	.	.	.	.	.	G	8.511	0.866618	0.17250	.	.	ENSG00000197857	ENST00000426973	.	.	.	0.951	-0.303	0.12792	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	4.5048	0.11881	0.0:0.2398:0.5187:0.2415	.	.	.	.	X	391	.	ENSP00000395745:Q391X	Q	-	1	0	ZNF44	12219544	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.381000	0.07417	-0.037000	0.13646	-0.532000	0.04303	CAA	ZNF44	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197857		0.393	ZNF44-201	KNOWN	basic	protein_coding	ZNF44	HGNC	protein_coding		43	0.00	0	G	NM_016264		12358544	12358544	-1	no_errors	ENST00000426973	ensembl	human	known	69_37n	nonsense	32	36.00	18	SNP	0.000	A
ZNF540	163255	genome.wustl.edu	37	19	38103583	38103583	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:38103583G>A	ENST00000592533.1	+	5	1734	c.1402G>A	c.(1402-1404)Gaa>Aaa	p.E468K	ZNF540_ENST00000343599.5_Missense_Mutation_p.E468K|ZNF540_ENST00000316433.4_Missense_Mutation_p.E468K|ZNF540_ENST00000589117.1_Missense_Mutation_p.E436K	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	468					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAGCCCTACGAATGTAAGGA	0.413																																						dbGAP											0													90.0	86.0	87.0					19																	38103583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1402G>A	19.37:g.38103583G>A	ENSP00000466274:p.Glu468Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E468K	ENST00000592533.1	37	c.1402	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013445	0.54468	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T;T	0.24350	2.16;1.86	2.13	2.13	0.27403	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06371	0.0164	N	0.01109	-1.01	0.09310	N	1	B;B	0.30179	0.229;0.271	B;B	0.24155	0.03;0.051	T	0.24657	-1.0154	9	0.21540	T	0.41	.	2.8364	0.05516	0.1649:0.0:0.557:0.2781	.	436;468	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	K	468;436	ENSP00000324598:E468K;ENSP00000343768:E436K	ENSP00000324598:E468K	E	+	1	0	ZNF540	42795423	0.000000	0.05858	0.909000	0.35828	0.471000	0.32888	-0.224000	0.09164	1.171000	0.42768	0.305000	0.20034	GAA	ZNF540	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171817		0.413	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	152	0.00	0	G	NM_152606		38103583	38103583	+1	no_errors	ENST00000316433	ensembl	human	known	69_37n	missense	121	39.20	78	SNP	0.003	A
ZNF180	7733	genome.wustl.edu	37	19	44981989	44981989	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:44981989G>A	ENST00000221327.4	-	5	990	c.709C>T	c.(709-711)Cag>Tag	p.Q237*	ZNF180_ENST00000592529.1_Nonsense_Mutation_p.Q210*|ZNF180_ENST00000391956.4_Nonsense_Mutation_p.Q212*|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				TTAATCTTCTGATGACTGTTT	0.338																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)	dbGAP											0													84.0	84.0	84.0					19																	44981989		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.709C>T	19.37:g.44981989G>A	ENSP00000221327:p.Gln237*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q237*	ENST00000221327.4	37	c.709	CCDS12639.1	19	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980060	0.74474	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	.	.	.	4.72	1.13	0.20643	.	0.000000	0.37857	N	0.001912	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-8.9355	13.9692	0.64228	0.0:0.4332:0.5668:0.0	.	.	.	.	X	237;212	.	ENSP00000221327:Q237X	Q	-	1	0	ZNF180	49673829	0.015000	0.18098	0.318000	0.25279	0.554000	0.35429	0.181000	0.16880	0.572000	0.29383	0.655000	0.94253	CAG	ZNF180	-	NULL	ENSG00000167384		0.338	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF180	HGNC	protein_coding	OTTHUMT00000451601.1	416	0.00	0	G	NM_013256		44981989	44981989	-1	no_errors	ENST00000221327	ensembl	human	known	69_37n	nonsense	273	35.92	153	SNP	0.196	A
ZNF548	147694	genome.wustl.edu	37	19	57911242	57911242	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:57911242G>C	ENST00000366197.5	+	3	1837	c.1587G>C	c.(1585-1587)gaG>gaC	p.E529D	AC003002.6_ENST00000596400.1_Intron|AC003002.6_ENST00000600421.1_Intron|ZNF548_ENST00000336128.7_Missense_Mutation_p.E541D|AC004076.7_ENST00000597410.1_Intron	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCACAATGGAGaaagtttacc	0.348																																						dbGAP											0													23.0	23.0	23.0					19																	57911242		1881	4117	5998	-	-	-	SO:0001583	missense	0			AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.1587G>C	19.37:g.57911242G>C	ENSP00000379482:p.Glu529Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96M05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E541D	ENST00000366197.5	37	c.1623	CCDS46209.1	19	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256448	0.39896	.	.	ENSG00000188785	ENST00000336128;ENST00000366197	T;T	0.05447	3.44;3.46	2.59	2.59	0.31030	.	.	.	.	.	T	0.07098	0.0180	L	0.43152	1.355	0.09310	N	1	P;P	0.37781	0.557;0.608	B;B	0.33750	0.169;0.109	T	0.25257	-1.0137	9	0.62326	D	0.03	.	12.9994	0.58666	0.0:0.0:1.0:0.0	.	541;529	Q8NEK5-2;Q8NEK5	.;ZN548_HUMAN	D	541;529	ENSP00000337555:E541D;ENSP00000379482:E529D	ENSP00000337555:E541D	E	+	3	2	ZNF548	62603054	0.002000	0.14202	0.029000	0.17559	0.581000	0.36288	0.496000	0.22499	1.781000	0.52344	0.655000	0.94253	GAG	ZNF548	-	NULL	ENSG00000188785		0.348	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF548	HGNC	protein_coding	OTTHUMT00000465937.1	142	0.00	0	G	NM_152909		57911242	57911242	+1	no_errors	ENST00000336128	ensembl	human	known	69_37n	missense	156	44.48	125	SNP	0.173	C
ZNF671	79891	genome.wustl.edu	37	19	58231990	58231990	+	Silent	SNP	G	G	A			TCGA-A8-A093-01A-11W-A019-09	TCGA-A8-A093-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8f64ba22-0958-4fdb-8161-f83cfe57c95d	4f97de65-e2ea-444d-b824-70905e5059c2	g.chr19:58231990G>A	ENST00000317398.6	-	4	1559	c.1464C>T	c.(1462-1464)ttC>ttT	p.F488F	ZNF671_ENST00000594803.1_5'Flank|ZNF671_ENST00000335820.3_Silent_p.F390F|AC003006.7_ENST00000594684.1_Intron|AC003006.7_ENST00000599221.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GTCTTTGAGTGAAGGCTTTCC	0.493																																						dbGAP											0													147.0	135.0	139.0					19																	58231990		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.1464C>T	19.37:g.58231990G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF07|Q9H5E9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F488	ENST00000317398.6	37	c.1464	CCDS12961.1	19																																																																																			ZNF671	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000083814		0.493	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	HGNC	protein_coding	OTTHUMT00000466817.1	203	0.00	0	G	NM_024833		58231990	58231990	-1	no_errors	ENST00000317398	ensembl	human	known	69_37n	silent	196	45.86	166	SNP	0.010	A
