#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AKAP4	8852	genome.wustl.edu	37	X	49958365	49958365	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chrX:49958365G>A	ENST00000376056.2	-	5	1122	c.972C>T	c.(970-972)ctC>ctT	p.L324L	AKAP4_ENST00000376064.3_Silent_p.L324L|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Silent_p.L333L					A kinase (PRKA) anchor protein 4									p.L333L(2)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CATAAACCATGAGCCCCTTGC	0.458																																						dbGAP											2	Substitution - coding silent(2)	cervix(1)|breast(1)											55.0	48.0	50.0					X																	49958365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.972C>T	X.37:g.49958365G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.L333	ENST00000376056.2	37	c.999	CCDS14330.1	X																																																																																			AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.458	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	126	0.00	0	G	NM_003886		49958365	49958365	-1	no_errors	ENST00000358526	ensembl	human	known	69_37n	silent	213	13.41	33	SNP	0.470	A
ALDH3B1	221	genome.wustl.edu	37	11	67787235	67787235	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:67787235G>C	ENST00000539229.1	+	7	645	c.529G>C	c.(529-531)Gag>Cag	p.E177Q	ALDH3B1_ENST00000007633.8_Missense_Mutation_p.E177Q|ALDH3B1_ENST00000434449.1_3'UTR|ALDH3B1_ENST00000316367.6_Missense_Mutation_p.E177Q|ALDH3B1_ENST00000342456.6_Missense_Mutation_p.E141Q	NM_001161473.1	NP_001154945.1	P43353	AL3B1_HUMAN	aldehyde dehydrogenase 3 family, member B1	178					alcohol metabolic process (GO:0006066)|aldehyde catabolic process (GO:0046185)|cellular response to oxidative stress (GO:0034599)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)										GCAGCTGCTAGAGCACAGGTT	0.652																																						dbGAP											0													98.0	112.0	107.0					11																	67787235		2200	4294	6494	-	-	-	SO:0001583	missense	0			U10868	CCDS73335.1, CCDS73336.1	11q13	2010-04-27			ENSG00000006534	ENSG00000006534	1.2.1.5	"""Aldehyde dehydrogenases"""	410	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 7"", ""aldehyde dehydrogenase 3B1"""	600466		ALDH7		9161417, 7828891	Standard	NM_000694		Approved		uc001ona.3	P43353	OTTHUMG00000154910	ENST00000539229.1:c.529G>C	11.37:g.67787235G>C	ENSP00000474034:p.Glu177Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A3FMP9|Q53XL5|Q8N515|Q96CK8	RNA	SNP	-	NULL	ENST00000539229.1	37	NULL		11																																																																																			ALDH3B1	-	-	ENSG00000006534		0.652	ALDH3B1-204	KNOWN	basic|appris_principal	protein_coding	ALDH3B1	HGNC	protein_coding		32	0.00	0	G	NM_000694		67787235	67787235	+1	no_errors	ENST00000007633	ensembl	human	known	69_37n	rna	25	19.35	6	SNP	0.997	C
AMY2B	280	genome.wustl.edu	37	1	104112739	104112739	+	Intron	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:104112739C>T	ENST00000361355.4	+	3	570				AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)						carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		CCAACTACCTCATGAAGATCC	0.552																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.-46-1440C>T	1.37:g.104112739C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTI1|B3KXB7|D3DT76|Q9UBH3	RNA	SNP	-	NULL	ENST00000361355.4	37	NULL	CCDS782.1	1																																																																																			AMY2B	-	-	ENSG00000240038		0.552	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	53	0.00	0	C	NM_020978		104112739	104112739	+1	no_errors	ENST00000491397	ensembl	human	known	69_37n	rna	54	11.29	7	SNP	1.000	T
ANGPTL6	83854	genome.wustl.edu	37	19	10204185	10204186	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:10204185_10204186insC	ENST00000253109.4	-	5	1299_1300	c.1061_1062insG	c.(1060-1062)ggcfs	p.G354fs	ANGPTL6_ENST00000592641.1_Frame_Shift_Ins_p.G354fs|ANGPTL6_ENST00000589181.1_Frame_Shift_Ins_p.G314fs	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	354	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			GTGCTCCACGGCCCCCCCAGTC	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.1062dupG	19.37:g.10204192_10204192dupC	ENSP00000253109:p.Gly354fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV7|Q9BZZ0	Frame_Shift_Ins	INS	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.R355fs	ENST00000253109.4	37	c.1062_1061	CCDS12224.1	19																																																																																			ANGPTL6	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000130812		0.639	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL6	HGNC	protein_coding	OTTHUMT00000451142.1	57	0.00	0	-	NM_031917		10204185	10204186	-1	no_errors	ENST00000253109	ensembl	human	known	69_37n	frame_shift_ins	31	11.43	4	INS	0.996:1.000	C
ARHGAP21	57584	genome.wustl.edu	37	10	24874831	24874831	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:24874831C>T	ENST00000396432.2	-	26	4873	c.4387G>A	c.(4387-4389)Gag>Aag	p.E1463K		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1462					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.E1462K(2)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CCCAGTGTCTCACTTTCTTTT	0.388																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											174.0	168.0	170.0					10																	24874831		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.4387G>A	10.37:g.24874831C>T	ENSP00000379709:p.Glu1463Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.E1463K	ENST00000396432.2	37	c.4387	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429465	0.43122	.	.	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.10573	2.86	5.17	4.25	0.50352	.	0.284573	0.38111	N	0.001817	T	0.12263	0.0298	L	0.59436	1.845	0.24145	N	0.995711	B	0.10296	0.003	B	0.08055	0.003	T	0.09015	-1.0694	10	0.52906	T	0.07	.	10.405	0.44252	0.0:0.8484:0.0:0.1516	.	1462	Q5T5U3	RHG21_HUMAN	K	1463;912	ENSP00000379709:E1463K	ENSP00000379709:E1463K	E	-	1	0	ARHGAP21	24914837	0.193000	0.23313	0.160000	0.22671	0.091000	0.18340	2.889000	0.48601	2.380000	0.81148	0.655000	0.94253	GAG	ARHGAP21	-	NULL	ENSG00000107863		0.388	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	376	0.00	0	C	NM_020824		24874831	24874831	-1	no_errors	ENST00000396432	ensembl	human	known	69_37n	missense	471	29.34	196	SNP	0.005	T
ARID4B	51742	genome.wustl.edu	37	1	235357486	235357486	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:235357486G>C	ENST00000264183.3	-	19	2464	c.1967C>G	c.(1966-1968)tCt>tGt	p.S656C	ARID4B_ENST00000349213.3_Missense_Mutation_p.S570C|ARID4B_ENST00000366603.2_Missense_Mutation_p.S656C	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	656					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S656C(1)		NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			GTTTTTTGGAGAGTATTTTTC	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	89.0	92.0					1																	235357486		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.1967C>G	1.37:g.235357486G>C	ENSP00000264183:p.Ser656Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S656C	ENST00000264183.3	37	c.1967	CCDS31061.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.245912|4.245912	0.80024|0.80024	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|T;T;T	.|0.48836	.|0.8;0.8;0.8	5.22|5.22	5.22|5.22	0.72569|0.72569	.|Chromo domain-like (1);	.|0.154031	.|0.47455	.|D	.|0.000239	T|T	0.55353|0.55353	0.1915|0.1915	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.999;0.999	.|D;D;D;D	.|0.85130	.|0.997;0.994;0.994;0.987	T|T	0.53173|0.53173	-0.8476|-0.8476	5|9	.|.	.|.	.|.	-11.8855|-11.8855	19.1448|19.1448	0.93461|0.93461	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|337;656;570;656	.|Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39	.|.;.;.;ARI4B_HUMAN	V|C	56|656;570;656;656	.|ENSP00000264184:S570C;ENSP00000355562:S656C;ENSP00000264183:S656C	.|.	L|S	-|-	1|2	0|0	ARID4B|ARID4B	233424109|233424109	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.981000|0.981000	0.71138|0.71138	5.729000|5.729000	0.68538|0.68538	2.596000|2.596000	0.87737|0.87737	0.555000|0.555000	0.69702|0.69702	CTC|TCT	ARID4B	-	superfamily_Chromodomain-like	ENSG00000054267		0.333	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	99	0.00	0	G	NM_016374		235357486	235357486	-1	no_errors	ENST00000264183	ensembl	human	known	69_37n	missense	274	13.02	41	SNP	1.000	C
ASPA	443	genome.wustl.edu	37	17	3392582	3392582	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr17:3392582C>T	ENST00000263080.2	+	4	738	c.580C>T	c.(580-582)Caa>Taa	p.Q194*	ASPA_ENST00000456349.2_Nonsense_Mutation_p.Q194*|SPATA22_ENST00000541913.1_Intron	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	194					aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)	p.Q194*(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	TATCTTGGATCAAATGAGAAA	0.333																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											119.0	125.0	123.0					17																	3392582		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.580C>T	17.37:g.3392582C>T	ENSP00000263080:p.Gln194*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Aste_AspA,pirsf_Aspartoacylase	p.Q194*	ENST00000263080.2	37	c.580	CCDS11028.1	17	.	.	.	.	.	.	.	.	.	.	c	28.0	4.885136	0.91814	.	.	ENSG00000108381	ENST00000456349;ENST00000263080	.	.	.	5.75	5.75	0.90469	.	0.404826	0.29239	N	0.012729	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-15.1306	12.8741	0.57980	0.2526:0.7474:0.0:0.0	.	.	.	.	X	194	.	ENSP00000263080:Q194X	Q	+	1	0	ASPA	3339332	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.455000	0.44988	2.894000	0.99253	0.655000	0.94253	CAA	ASPA	-	pfam_Aste_AspA,pirsf_Aspartoacylase	ENSG00000108381		0.333	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPA	HGNC	protein_coding	OTTHUMT00000207315.1	171	0.00	0	C	NM_000049		3392582	3392582	+1	no_errors	ENST00000263080	ensembl	human	known	69_37n	nonsense	370	26.88	136	SNP	1.000	T
ATP6V1B1	525	genome.wustl.edu	37	2	71170756	71170756	+	Intron	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr2:71170756G>A	ENST00000234396.4	+	2	191				ATP6V1B1_ENST00000412314.1_Intron|AC007040.7_ENST00000447639.1_RNA|AC007040.11_ENST00000606025.1_Intron|AC007040.7_ENST00000422761.1_RNA	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1						ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						TGTTTGGGGTGAGACCCCTAC	0.632																																						dbGAP											0													56.0	55.0	56.0					2																	71170756		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.119-32G>A	2.37:g.71170756G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FY0|Q6P4H6	Silent	SNP	pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,superfamily_ATPase_F1/A1-cplx_a/bsu_N	p.V46	ENST00000234396.4	37	c.138	CCDS1912.1	2																																																																																			ATP6V1B1	-	NULL	ENSG00000116039		0.632	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1B1	HGNC	protein_coding	OTTHUMT00000251920.2	24	0.00	0	G	NM_001692		71170756	71170756	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000454446	ensembl	human	novel	69_37n	silent	27	20.59	7	SNP	0.945	A
C14orf182	283551	genome.wustl.edu	37	14	50459793	50459793	+	Intron	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr14:50459793C>T	ENST00000399206.1	-	2	1927				C14orf182_ENST00000529902.1_Intron	NM_001012706.1	NP_001012724.1	A1A4T8	CN182_HUMAN	chromosome 14 open reading frame 182											large_intestine(2)|urinary_tract(1)	3						AGCAGAGAGTCACGGTGGCTG	0.532																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK090420	CCDS41949.1	14q22.1	2009-02-24			ENSG00000214900	ENSG00000214900			27503	protein-coding gene	gene with protein product							Standard	NM_001012706		Approved		uc001wxi.1	A1A4T8		ENST00000399206.1:c.207-202G>A	14.37:g.50459793C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYX4	RNA	SNP	-	NULL	ENST00000399206.1	37	NULL	CCDS41949.1	14																																																																																			C14orf182	-	-	ENSG00000214900		0.532	C14orf182-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C14orf182	HGNC	protein_coding	OTTHUMT00000395717.1	11	0.00	0	C	NM_001012706		50459793	50459793	-1	no_errors	ENST00000533506	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.004	T
CA12	771	genome.wustl.edu	37	15	63638802	63638802	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr15:63638802G>A	ENST00000178638.3	-	3	653	c.213C>T	c.(211-213)ctC>ctT	p.L71L	CA12_ENST00000344366.3_Silent_p.L71L|CA12_ENST00000422263.2_Intron	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	71					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.L71L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	CGAGGGGCGTGAGGCTGGCGT	0.572																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											162.0	140.0	147.0					15																	63638802		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.213C>T	15.37:g.63638802G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE24|Q53YE5|Q9BWG2	Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.L71	ENST00000178638.3	37	c.213	CCDS10185.1	15																																																																																			CA12	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000074410		0.572	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CA12	HGNC	protein_coding	OTTHUMT00000256370.1	58	0.00	0	G	NM_001218		63638802	63638802	-1	no_errors	ENST00000178638	ensembl	human	known	69_37n	silent	77	27.36	29	SNP	0.000	A
CALD1	800	genome.wustl.edu	37	7	134625906	134625906	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr7:134625906C>G	ENST00000361675.2	+	7	1679	c.1450C>G	c.(1450-1452)Cga>Gga	p.R484G	CALD1_ENST00000495522.1_Missense_Mutation_p.R249G|CALD1_ENST00000361388.2_Missense_Mutation_p.R255G|CALD1_ENST00000424922.1_Missense_Mutation_p.R223G|CALD1_ENST00000422748.1_Missense_Mutation_p.R255G|CALD1_ENST00000543443.1_Missense_Mutation_p.R234G|CALD1_ENST00000417172.1_Missense_Mutation_p.R229G|CALD1_ENST00000393118.2_Missense_Mutation_p.R249G|CALD1_ENST00000361901.2_Missense_Mutation_p.R229G			Q05682	CALD1_HUMAN	caldesmon 1	484					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)	p.R484G(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						CTTCATGGATCGAAAGAAGGG	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	75.0	77.0					7																	134625906		2203	4300	6503	-	-	-	SO:0001583	missense	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1450C>G	7.37:g.134625906C>G	ENSP00000354826:p.Arg484Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.R255G	ENST00000361675.2	37	c.763	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849840	0.32699	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000361675;ENST00000361901;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.77	0.587	0.17439	.	0.498560	0.16684	N	0.203806	T	0.40247	0.1109	L	0.55743	1.74	0.33415	D	0.579072	B;B;B;B;B;B;B;B;B;B	0.11235	0.001;0.0;0.0;0.004;0.0;0.0;0.0;0.0;0.002;0.0	B;B;B;B;B;B;B;B;B;B	0.09377	0.0;0.0;0.0;0.004;0.0;0.0;0.0;0.0;0.001;0.0	T	0.41305	-0.9516	10	0.48119	T	0.1	-2.7095	9.9403	0.41576	0.3818:0.4791:0.1391:0.0	.	178;234;255;249;223;249;229;255;484;229	B4DPW5;F5H1Z9;A8K0X1;E7EX44;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;.;.;CALD1_HUMAN;.	G	229;229;255;255;484;229;249;223;249;234	ENSP00000398826:R229G;ENSP00000411476:R229G;ENSP00000355000:R255G;ENSP00000395710:R255G;ENSP00000354826:R484G;ENSP00000354513:R229G;ENSP00000376826:R249G;ENSP00000393621:R223G;ENSP00000419673:R249G;ENSP00000445641:R234G	ENSP00000355000:R255G	R	+	1	2	CALD1	134276446	1.000000	0.71417	0.910000	0.35882	0.991000	0.79684	1.280000	0.33202	-0.179000	0.10654	-0.127000	0.14921	CGA	CALD1	-	pfam_Caldesmon_LSP	ENSG00000122786		0.358	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	151	0.00	0	C	NM_033138		134625906	134625906	+1	no_errors	ENST00000361388	ensembl	human	known	69_37n	missense	166	36.88	97	SNP	0.997	G
CASC5	57082	genome.wustl.edu	37	15	40917571	40917571	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr15:40917571G>A	ENST00000346991.5	+	11	5577	c.5187G>A	c.(5185-5187)ctG>ctA	p.L1729L	CASC5_ENST00000399668.2_Silent_p.L1703L			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1729					acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.L1729L(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		CAGGTAAACTGAACCTAAGTC	0.383																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											79.0	76.0	77.0					15																	40917571		1831	4082	5913	-	-	-	SO:0001819	synonymous_variant	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.5187G>A	15.37:g.40917571G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.E748K	ENST00000346991.5	37	c.2242	CCDS42023.1	15																																																																																			CASC5	-	NULL	ENSG00000137812		0.383	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	139	0.00	0	G	NM_144508		40917571	40917571	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000526913	ensembl	human	known	69_37n	missense	248	10.14	28	SNP	0.043	A
CCDC7	79741	genome.wustl.edu	37	10	32856783	32856783	+	Silent	SNP	A	A	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:32856783A>G	ENST00000362006.5	+	16	1926	c.1383A>G	c.(1381-1383)ggA>ggG	p.G461G	CCDC7_ENST00000277657.6_Silent_p.G461G|C10orf68_ENST00000375028.3_5'UTR|C10orf68_ENST00000572165.1_3'UTR|C10orf68_ENST00000375030.2_5'UTR	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	461								p.G461G(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				ATTCAGGTGGACAAAGGACAA	0.323																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											75.0	76.0	75.0					10																	32856783		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.1383A>G	10.37:g.32856783A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW55|Q8IVQ0|Q8NEQ0	Silent	SNP	NULL	p.G461	ENST00000362006.5	37	c.1383	CCDS7173.1	10																																																																																			CCDC7	-	NULL	ENSG00000216937		0.323	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CCDC7	HGNC	protein_coding	OTTHUMT00000047490.1	179	0.56	1	A	NM_145023		32856783	32856783	+1	no_errors	ENST00000277657	ensembl	human	known	69_37n	silent	311	13.37	48	SNP	0.248	G
CCDC88C	440193	genome.wustl.edu	37	14	91772201	91772201	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr14:91772201delT	ENST00000389857.6	-	19	3351	c.3265delA	c.(3265-3267)accfs	p.T1089fs		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1089					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CTGCTGAAGGTCACGTTCTGG	0.567																																						dbGAP											0													103.0	102.0	102.0					14																	91772201		2106	4240	6346	-	-	-	SO:0001589	frameshift_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3265delA	14.37:g.91772201delT	ENSP00000374507:p.Thr1089fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Frame_Shift_Del	DEL	pfam_HOOK,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.T1089fs	ENST00000389857.6	37	c.3265	CCDS45151.1	14																																																																																			CCDC88C	-	NULL	ENSG00000015133		0.567	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	17	0.00	0	T	XM_029353		91772201	91772201	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	frame_shift_del	33	56.10	46	DEL	0.710	-
CGNL1	84952	genome.wustl.edu	37	15	57746010	57746010	+	Silent	SNP	G	G	A	rs142690387		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr15:57746010G>A	ENST00000281282.5	+	7	2262	c.2184G>A	c.(2182-2184)ctG>ctA	p.L728L		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	728						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.L728L(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AGGGAGCTCTGATTGAGGTAA	0.547																																						dbGAP											2	Substitution - coding silent(2)	breast(1)|skin(1)											132.0	116.0	121.0					15																	57746010		2192	4292	6484	-	-	-	SO:0001819	synonymous_variant	0			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.2184G>A	15.37:g.57746010G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Silent	SNP	pfam_Myosin_tail,prints_Tropomyosin	p.L728	ENST00000281282.5	37	c.2184	CCDS10161.1	15																																																																																			CGNL1	-	NULL	ENSG00000128849		0.547	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGNL1	HGNC	protein_coding	OTTHUMT00000255482.2	49	0.00	0	G	NM_032866		57746010	57746010	+1	no_errors	ENST00000281282	ensembl	human	known	69_37n	silent	156	24.64	51	SNP	1.000	A
COL12A1	1303	genome.wustl.edu	37	6	75875459	75875459	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:75875459A>T	ENST00000322507.8	-	14	3056	c.2747T>A	c.(2746-2748)aTc>aAc	p.I916N	COL12A1_ENST00000416123.2_Missense_Mutation_p.I916N|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.I916N	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	916	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.I916N(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGTGTCAGTGATGTCTTTAGT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	87.0	90.0					6																	75875459		1850	4107	5957	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2747T>A	6.37:g.75875459A>T	ENSP00000325146:p.Ile916Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.I916N	ENST00000322507.8	37	c.2747	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	A	20.4	3.984026	0.74474	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.59224	0.28;0.28;0.28	5.3	5.3	0.74995	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000011	T	0.67401	0.2889	M	0.66939	2.045	0.49582	D	0.999801	D	0.76494	0.999	D	0.69142	0.962	T	0.72924	-0.4144	10	0.87932	D	0	.	15.2405	0.73465	1.0:0.0:0.0:0.0	.	916	Q99715	COCA1_HUMAN	N	916	ENSP00000325146:I916N;ENSP00000412864:I916N;ENSP00000421216:I916N	ENSP00000325146:I916N	I	-	2	0	COL12A1	75932179	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	8.690000	0.91272	1.997000	0.58415	0.460000	0.39030	ATC	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.363	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	258	0.00	0	A	NM_004370		75875459	75875459	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	336	29.65	142	SNP	1.000	T
CREB3L3	84699	genome.wustl.edu	37	19	4154928	4154928	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:4154928C>G	ENST00000078445.2	+	2	207	c.60C>G	c.(58-60)atC>atG	p.I20M	CREB3L3_ENST00000602147.1_Missense_Mutation_p.I20M|CREB3L3_ENST00000595923.1_Missense_Mutation_p.I20M|CREB3L3_ENST00000602257.1_Missense_Mutation_p.I20M|CREB3L3_ENST00000252587.3_Missense_Mutation_p.I11M	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	20					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.I20M(1)		breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGACCCCATCGACAGCTTTG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	87.0	93.0					19																	4154928		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.60C>G	19.37:g.4154928C>G	ENSP00000078445:p.Ile20Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.I20M	ENST00000078445.2	37	c.60	CCDS12121.1	19	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485026	0.63962	.	.	ENSG00000060566	ENST00000078445;ENST00000381943;ENST00000252587	T;T	0.80994	-1.44;-1.44	5.18	-10.4	0.00318	.	1.526340	0.03272	N	0.184883	T	0.70587	0.3241	L	0.60455	1.87	0.09310	N	1	B;B;B;B	0.30914	0.136;0.3;0.223;0.143	B;B;B;B	0.28232	0.016;0.026;0.087;0.04	T	0.62224	-0.6899	10	0.72032	D	0.01	-10.7879	5.8152	0.18488	0.0859:0.106:0.54:0.2681	.	20;20;20;20	Q68CJ9-3;B7ZL69;Q68CJ9-2;Q68CJ9	.;.;.;CR3L3_HUMAN	M	20;20;11	ENSP00000078445:I20M;ENSP00000252587:I11M	ENSP00000078445:I20M	I	+	3	3	CREB3L3	4105928	0.001000	0.12720	0.806000	0.32338	0.857000	0.48899	-1.707000	0.01893	-0.925000	0.03775	0.306000	0.20318	ATC	CREB3L3	-	NULL	ENSG00000060566		0.617	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB3L3	HGNC	protein_coding	OTTHUMT00000457922.1	43	0.00	0	C	NM_032607		4154928	4154928	+1	no_errors	ENST00000078445	ensembl	human	known	69_37n	missense	89	17.59	19	SNP	0.010	G
CTH	1491	genome.wustl.edu	37	1	70890019	70890019	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:70890019G>T	ENST00000370938.3	+	5	652	c.508G>T	c.(508-510)Gaa>Taa	p.E170*	CTH_ENST00000346806.2_Intron|CTH_ENST00000464926.1_3'UTR|CTH_ENST00000411986.2_Nonsense_Mutation_p.E138*	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0	Ig-like C2-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.E170*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						GATTGACATTGAAGGCTGTGC	0.343																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											173.0	156.0	162.0					1																	70890019		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.508G>T	1.37:g.70890019G>T	ENSP00000359976:p.Glu170*	Somatic		WXS	Illumina GAIIx	Phase_IV	O95791|Q9NX42	Nonsense_Mutation	SNP	pfam_Cys/Met-Metab_PyrdxlP-dep_enz,pfam_Aminotransferase_I/II,pfam_Aminotrans_V/Cys_dSase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cys/Met-Metab_PyrdxlP-dep_enz	p.E170*	ENST00000370938.3	37	c.508	CCDS650.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.234609	0.95207	.	.	ENSG00000116761	ENST00000411986;ENST00000370938	.	.	.	5.73	2.8	0.32819	.	0.334578	0.35067	N	0.003480	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-7.3366	5.5256	0.16957	0.2988:0.1343:0.5669:0.0	.	.	.	.	X	138;170	.	ENSP00000359976:E170X	E	+	1	0	CTH	70662607	0.574000	0.26684	0.971000	0.41717	0.699000	0.40488	1.094000	0.30951	0.754000	0.32968	0.650000	0.86243	GAA	CTH	-	pfam_Cys/Met-Metab_PyrdxlP-dep_enz,pfam_Aminotransferase_I/II,pfam_Aminotrans_V/Cys_dSase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cys/Met-Metab_PyrdxlP-dep_enz	ENSG00000116761		0.343	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTH	HGNC	protein_coding	OTTHUMT00000025918.1	295	0.00	0	G	NM_001902		70890019	70890019	+1	no_errors	ENST00000370938	ensembl	human	known	69_37n	nonsense	458	27.83	177	SNP	0.795	T
DAK	26007	genome.wustl.edu	37	11	61106623	61106623	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:61106623C>T	ENST00000394900.3	+	4	508	c.279C>T	c.(277-279)atC>atT	p.I93I		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	93	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)	p.I93I(1)		NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						TGGCAGCCATCAGGGCCGTGG	0.667																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											32.0	33.0	33.0					11																	61106623		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.279C>T	11.37:g.61106623C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Silent	SNP	pfam_Dak1,pfam_Dak2,superfamily_Dak2,tigrfam_DhaK_ATP	p.I93	ENST00000394900.3	37	c.279	CCDS8003.1	11																																																																																			DAK	-	pfam_Dak1,tigrfam_DhaK_ATP	ENSG00000149476		0.667	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAK	HGNC	protein_coding	OTTHUMT00000394425.4	8	0.00	0	C	NM_015533		61106623	61106623	+1	no_errors	ENST00000394900	ensembl	human	known	69_37n	silent	18	43.75	14	SNP	0.996	T
DNAJC11	55735	genome.wustl.edu	37	1	6727814	6727814	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:6727814C>G	ENST00000377577.5	-	4	456	c.333G>C	c.(331-333)caG>caC	p.Q111H	DNAJC11_ENST00000349363.6_Missense_Mutation_p.Q73H|DNAJC11_ENST00000542246.1_Missense_Mutation_p.Q73H|DNAJC11_ENST00000377573.5_Missense_Mutation_p.Q21H|DNAJC11_ENST00000294401.7_Missense_Mutation_p.Q111H	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	111						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)		p.Q111H(2)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTCTCTCTCTGCAGCCGCT	0.512																																						dbGAP											2	Substitution - Missense(2)	breast(2)											62.0	59.0	60.0					1																	6727814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.333G>C	1.37:g.6727814C>G	ENSP00000366800:p.Gln111His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	pfam_DnaJ-like_C11_C,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.Q111H	ENST00000377577.5	37	c.333	CCDS87.1	1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417527	0.62622	.	.	ENSG00000007923	ENST00000377577;ENST00000451196;ENST00000349363;ENST00000294401;ENST00000542246;ENST00000377573;ENST00000426784	T;T;T;T;T;T;T	0.34072	2.38;1.76;1.38;2.38;2.17;1.85;2.38	5.63	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.55321	0.1913	M	0.76002	2.32	0.58432	D	0.999998	D;D;D;D	0.69078	0.997;0.989;0.994;0.995	D;P;D;D	0.68765	0.942;0.885;0.96;0.922	T	0.56159	-0.8025	10	0.45353	T	0.12	-18.3277	9.5926	0.39554	0.0:0.8436:0.0:0.1564	.	21;87;111;111	B4DGD5;Q5TH61;Q9NVH1-3;Q9NVH1	.;.;.;DJC11_HUMAN	H	111;87;73;111;73;21;111	ENSP00000366800:Q111H;ENSP00000415871:Q87H;ENSP00000326304:Q73H;ENSP00000294401:Q111H;ENSP00000444020:Q73H;ENSP00000366796:Q21H;ENSP00000410194:Q111H	ENSP00000294401:Q111H	Q	-	3	2	DNAJC11	6650401	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.347000	0.33975	1.376000	0.46267	0.591000	0.81541	CAG	DNAJC11	-	NULL	ENSG00000007923		0.512	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	HGNC	protein_coding	OTTHUMT00000004216.3	21	0.00	0	C	NM_018198		6727814	6727814	-1	no_errors	ENST00000377577	ensembl	human	known	69_37n	missense	70	30.00	30	SNP	1.000	G
DPY19L3	147991	genome.wustl.edu	37	19	32923705	32923705	+	Silent	SNP	C	C	T	rs557500437		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:32923705C>T	ENST00000342179.5	+	4	536	c.321C>T	c.(319-321)ctC>ctT	p.L107L	DPY19L3_ENST00000586987.1_Silent_p.L107L|DPY19L3_ENST00000392250.2_Silent_p.L107L	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	107						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.L107L(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					CTCCAACCCTCGTGCAAGGTA	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		16468	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	81.0	85.0					19																	32923705		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.321C>T	19.37:g.32923705C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DC7|Q6ZTB7|Q6ZTS2	Silent	SNP	pfam_Dpy-19	p.L107	ENST00000342179.5	37	c.321	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	C	3.768	-0.048296	0.07407	.	.	ENSG00000178904	ENST00000392248	.	.	.	5.84	2.57	0.30868	.	.	.	.	.	T	0.54598	0.1868	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47947	-0.9077	4	.	.	.	-7.8656	6.4855	0.22087	0.121:0.621:0.0:0.2579	.	.	.	.	L	107	.	.	S	+	2	0	DPY19L3	37615545	0.008000	0.16893	0.771000	0.31576	0.515000	0.34225	-0.008000	0.12788	0.819000	0.34492	-0.194000	0.12790	TCG	DPY19L3	-	pfam_Dpy-19	ENSG00000178904		0.408	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	76	0.00	0	C	NM_207325		32923705	32923705	+1	no_errors	ENST00000342179	ensembl	human	known	69_37n	silent	122	27.38	46	SNP	0.427	T
DST	667	genome.wustl.edu	37	6	56485062	56485062	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:56485062T>C	ENST00000370765.6	-	23	3877	c.3770A>G	c.(3769-3771)aAa>aGa	p.K1257R	DST_ENST00000446842.2_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000421834.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	0					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.K1257R(2)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATCTTTTCTTTTAAGATGATC	0.383																																						dbGAP											2	Substitution - Missense(2)	breast(2)											66.0	70.0	69.0					6																	56485062		2203	4300	6503	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.3770A>G	6.37:g.56485062T>C	ENSP00000359801:p.Lys1257Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.K1257R	ENST00000370765.6	37	c.3770	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	T	9.063	0.995040	0.19043	.	.	ENSG00000151914	ENST00000370765	T	0.30981	1.51	4.46	2.04	0.26737	.	.	.	.	.	T	0.04634	0.0126	.	.	.	0.19300	N	0.999974	B	0.02656	0.0	B	0.06405	0.002	T	0.41538	-0.9503	7	0.14656	T	0.56	.	3.9684	0.09443	0.0:0.246:0.1838:0.5701	.	1257	Q03001-3	.	R	1257	ENSP00000359801:K1257R	ENSP00000359801:K1257R	K	-	2	0	DST	56593021	0.979000	0.34478	0.053000	0.19242	0.682000	0.39822	1.603000	0.36794	0.253000	0.21552	0.455000	0.32223	AAA	DST	-	NULL	ENSG00000151914		0.383	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	165	0.00	0	T	NM_001723		56485062	56485062	-1	no_errors	ENST00000370765	ensembl	human	known	69_37n	missense	263	30.05	113	SNP	0.639	C
DUXA	503835	genome.wustl.edu	37	19	57672085	57672085	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:57672085G>C	ENST00000554048.2	-	2	105	c.106C>G	c.(106-108)Caa>Gaa	p.Q36E		NM_001012729.1	NP_001012747.1	A6NLW8	DUXA_HUMAN	double homeobox A	36					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q36E(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		TAAGGCTTTTGATTGAAGGTA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											164.0	159.0	161.0					19																	57672085		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33126.1	19q13.43	2012-10-04			ENSG00000258873	ENSG00000258873		"""Homeoboxes / PRD class"""	32179	protein-coding gene	gene with protein product		611168					Standard	NM_001012729		Approved		uc002qoa.1	A6NLW8	OTTHUMG00000170714	ENST00000554048.2:c.106C>G	19.37:g.57672085G>C	ENSP00000452398:p.Gln36Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif	p.Q36E	ENST00000554048.2	37	c.106	CCDS33126.1	19	.	.	.	.	.	.	.	.	.	.	G	4.599	0.111293	0.08831	.	.	ENSG00000258873	ENST00000554048	D	0.95918	-3.85	2.96	-0.71	0.11234	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	1.022020	0.07883	N	0.969789	D	0.89818	0.6825	N	0.01874	-0.695	0.09310	N	1	P	0.42757	0.789	P	0.51866	0.682	T	0.83186	-0.0086	10	0.44086	T	0.13	-0.3715	8.62	0.33855	0.0:0.0:0.397:0.603	.	36	A6NLW8	DUXA_HUMAN	E	36	ENSP00000452398:Q36E	ENSP00000365415:Q36E	Q	-	1	0	DUXA	62363897	0.108000	0.22018	0.004000	0.12327	0.729000	0.41735	0.079000	0.14782	-0.032000	0.13758	0.561000	0.74099	CAA	DUXA	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000258873		0.368	DUXA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	DUXA	HGNC	protein_coding	OTTHUMT00000410075.3	117	0.00	0	G	NM_001012729		57672085	57672085	-1	no_errors	ENST00000554048	ensembl	human	known	69_37n	missense	177	27.94	69	SNP	0.007	C
EIF4ENIF1	56478	genome.wustl.edu	37	22	31839047	31839047	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr22:31839047G>A	ENST00000397525.1	-	16	2330	c.2107C>T	c.(2107-2109)Cgt>Tgt	p.R703C	EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.R358C|EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.R529C|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.R679C|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.R703C	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	703						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.R703C(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TACATCTTACGAATCACTGAG	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	92.0	96.0					22																	31839047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2107C>T	22.37:g.31839047G>A	ENSP00000380659:p.Arg703Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	pfam_eIF4E_transporter	p.R703C	ENST00000397525.1	37	c.2107	CCDS13898.1	22	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558480	0.86231	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180	.	.	.	5.77	5.77	0.91146	.	0.050213	0.85682	D	0.000000	T	0.78534	0.4298	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.994;0.993	T	0.78605	-0.2139	9	0.72032	D	0.01	-12.5527	19.335	0.94312	0.0:0.0:1.0:0.0	.	529;703;528;679	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	C	529;703;703;679;358	.	ENSP00000328103:R703C	R	-	1	0	EIF4ENIF1	30169047	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.625000	0.74248	2.884000	0.98904	0.655000	0.94253	CGT	EIF4ENIF1	-	pfam_eIF4E_transporter	ENSG00000184708		0.453	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	HGNC	protein_coding	OTTHUMT00000127926.1	128	0.00	0	G	NM_019843		31839047	31839047	-1	no_errors	ENST00000330125	ensembl	human	known	69_37n	missense	259	10.07	29	SNP	1.000	A
FAM188A	80013	genome.wustl.edu	37	10	15828635	15828635	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:15828635C>T	ENST00000277632.3	-	13	1261	c.1041G>A	c.(1039-1041)atG>atA	p.M347I	FAM188A_ENST00000477891.1_5'UTR|FAM188A_ENST00000378036.1_Missense_Mutation_p.M52I	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	347					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.M347I(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						ATTTATTCTTCATGAGATTTA	0.323																																					Pancreas(159;946 1953 2111 4475 22008)	dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	73.0	70.0					10																	15828635		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.1041G>A	10.37:g.15828635C>T	ENSP00000277632:p.Met347Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Missense_Mutation	SNP	NULL	p.M347I	ENST00000277632.3	37	c.1041	CCDS7110.1	10	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252948	0.59212	.	.	ENSG00000148481	ENST00000277632;ENST00000378036;ENST00000378033	T	0.31769	1.48	5.52	5.52	0.82312	EF-hand-like domain (1);	0.036984	0.85682	D	0.000000	T	0.33440	0.0863	L	0.52266	1.64	0.80722	D	1	B	0.25667	0.131	B	0.21546	0.035	T	0.06197	-1.0840	10	0.48119	T	0.1	-15.8973	19.7913	0.96458	0.0:1.0:0.0:0.0	.	347	Q9H8M7	F188A_HUMAN	I	347;52;52	ENSP00000277632:M347I	ENSP00000277632:M347I	M	-	3	0	FAM188A	15868641	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.992000	0.56980	2.739000	0.93911	0.655000	0.94253	ATG	FAM188A	-	NULL	ENSG00000148481		0.323	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188A	HGNC	protein_coding	OTTHUMT00000046990.2	120	0.00	0	C	NM_024948		15828635	15828635	-1	no_errors	ENST00000277632	ensembl	human	known	69_37n	missense	146	29.81	62	SNP	1.000	T
FAM72C	554282	genome.wustl.edu	37	1	149459467	149459467	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:149459467G>A	ENST00000369175.3	-	1	82	c.83C>T	c.(82-84)tCa>tTa	p.S28L	FAM72C_ENST00000492131.1_5'UTR			H0Y354	FA72C_HUMAN	family with sequence similarity 72, member C	0																	GCCTGGCTGTGAAACATCCAG	0.368																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL109948	CCDS72850.1	1q21.2	2013-03-15			ENSG00000203817	ENSG00000263513			30602	protein-coding gene	gene with protein product							Standard	NM_001287385		Approved	RP5-998N21.9		H0Y354	OTTHUMG00000041029	ENST00000369175.3:c.83C>T	1.37:g.149459467G>A	ENSP00000358174:p.Ser28Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S28L	ENST00000369175.3	37	c.83		1	.	.	.	.	.	.	.	.	.	.	.	5.853	0.341510	0.11069	.	.	ENSG00000203817	ENST00000369175	.	.	.	1.7	1.7	0.24286	.	.	.	.	.	T	0.33294	0.0858	.	.	.	.	.	.	.	.	.	.	.	.	T	0.12116	-1.0560	3	.	.	.	.	9.4009	0.38431	0.0:0.0:1.0:0.0	.	.	.	.	L	28	.	.	S	-	2	0	FAM72C	147726091	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	4.941000	0.63540	1.256000	0.44068	0.184000	0.17185	TCA	FAM72C	-	NULL	ENSG00000203817		0.368	FAM72C-001	NOVEL	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	FAM72C	HGNC	protein_coding	OTTHUMT00000098432.1	208	0.00	0	G			149459467	149459467	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000369175	ensembl	human	known	69_37n	missense	596	17.08	123	SNP	1.000	A
FBXL19	54620	genome.wustl.edu	37	16	30941589	30941589	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr16:30941589G>A	ENST00000380310.2	+	7	1203	c.1045G>A	c.(1045-1047)Gag>Aag	p.E349K	FBXL19_ENST00000565690.1_Missense_Mutation_p.E213K|FBXL19_ENST00000471231.2_Missense_Mutation_p.E37K|FBXL19_ENST00000562319.1_Missense_Mutation_p.E329K|FBXL19_ENST00000338343.4_Missense_Mutation_p.E329K	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	349					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E179K(1)|p.E349K(1)		breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						AGCCCCCGGCGAGGCCCGGAA	0.706																																						dbGAP											2	Substitution - Missense(2)	breast(2)											20.0	21.0	21.0					16																	30941589		1853	3994	5847	-	-	-	SO:0001583	missense	0			AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.1045G>A	16.37:g.30941589G>A	ENSP00000369666:p.Glu349Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.E349K	ENST00000380310.2	37	c.1045	CCDS45465.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.07|13.07	2.127918|2.127918	0.37533|0.37533	.|.	.|.	ENSG00000099364|ENSG00000099364	ENST00000338343;ENST00000380310|ENST00000427128	T;T|.	0.23552|.	1.9;2.22|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.689340|.	0.13632|.	N|.	0.373666|.	T|T	0.27169|0.27169	0.0666|0.0666	N|N	0.03608|0.03608	-0.345|-0.345	0.33371|0.33371	D|D	0.573566|0.573566	P;P|.	0.42692|.	0.682;0.787|.	B;B|.	0.26614|.	0.048;0.071|.	T|T	0.38178|0.38178	-0.9673|-0.9673	10|5	0.06365|.	T|.	0.9|.	-10.4009|-10.4009	11.9234|11.9234	0.52806|0.52806	0.0841:0.0:0.9159:0.0|0.0841:0.0:0.9159:0.0	.|.	349;306|.	Q6PCT2;Q6PCT2-2|.	FXL19_HUMAN;.|.	K|Q	329;349|240	ENSP00000339712:E329K;ENSP00000369666:E349K|.	ENSP00000339712:E329K|.	E|R	+|+	1|2	0|0	FBXL19|FBXL19	30849090|30849090	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.932000|0.932000	0.56968|0.56968	1.804000|1.804000	0.38873|0.38873	2.490000|2.490000	0.84030|0.84030	0.655000|0.655000	0.94253|0.94253	GAG|CGA	FBXL19	-	NULL	ENSG00000099364		0.706	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL19	HGNC	protein_coding		23	0.00	0	G	NM_019085		30941589	30941589	+1	no_errors	ENST00000380310	ensembl	human	known	69_37n	missense	22	54.17	26	SNP	0.982	A
FCGBP	8857	genome.wustl.edu	37	19	40392482	40392482	+	Silent	SNP	A	A	G	rs62108883		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:40392482A>G	ENST00000221347.6	-	16	8029	c.8022T>C	c.(8020-8022)tcT>tcC	p.S2674S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2674	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCTTGTGGCAAGAGGACAGTG	0.572																																						dbGAP											0													39.0	40.0	40.0					19																	40392482		2187	4280	6467	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.8022T>C	19.37:g.40392482A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.S2674	ENST00000221347.6	37	c.8022	CCDS12546.1	19																																																																																			FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000090920		0.572	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	34	0.00	0	A	NM_003890		40392482	40392482	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	69	11.54	9	SNP	0.739	G
FCGBP	8857	genome.wustl.edu	37	19	40424194	40424194	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:40424194C>T	ENST00000221347.6	-	4	2016	c.2009G>A	c.(2008-2010)gGc>gAc	p.G670D		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	670	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.G670D(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GAGTCGGTCGCCCTCATAGTG	0.607																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	194.0	194.0					19																	40424194		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2009G>A	19.37:g.40424194C>T	ENSP00000221347:p.Gly670Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.G670D	ENST00000221347.6	37	c.2009	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	8.323	0.824837	0.16678	.	.	ENSG00000090920	ENST00000221347	T	0.76316	-1.01	5.34	0.647	0.17796	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.439732	0.21028	N	0.081387	T	0.76271	0.3964	M	0.67569	2.06	0.09310	N	1	P	0.39022	0.655	P	0.47015	0.534	T	0.66476	-0.5914	10	0.49607	T	0.09	.	5.5056	0.16852	0.0:0.5256:0.1364:0.338	.	670	Q9Y6R7	FCGBP_HUMAN	D	670	ENSP00000221347:G670D	ENSP00000221347:G670D	G	-	2	0	FCGBP	45116034	0.000000	0.05858	0.004000	0.12327	0.369000	0.29798	-0.529000	0.06186	0.193000	0.20303	0.650000	0.86243	GGC	FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000090920		0.607	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	55	0.00	0	C	NM_003890		40424194	40424194	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	62	28.74	25	SNP	0.000	T
FCRL4	83417	genome.wustl.edu	37	1	157557674	157557674	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:157557674G>A	ENST00000271532.1	-	4	678	c.543C>T	c.(541-543)ttC>ttT	p.F181F	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	181	Ig-like C2-type 2.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F181F(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TAATTATTTTGAAATTTGATC	0.333																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											38.0	38.0	38.0					1																	157557674		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.543C>T	1.37:g.157557674G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PJ3|Q96RE0	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.F181	ENST00000271532.1	37	c.543	CCDS1166.1	1																																																																																			FCRL4	-	smart_Ig_sub	ENSG00000163518		0.333	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	HGNC	protein_coding	OTTHUMT00000086180.1	70	0.00	0	G	NM_031282		157557674	157557674	-1	no_errors	ENST00000271532	ensembl	human	known	69_37n	silent	195	19.09	46	SNP	0.000	A
GLT1D1	144423	genome.wustl.edu	37	12	129383811	129383811	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr12:129383811G>A	ENST00000442111.2	+	4	442	c.354G>A	c.(352-354)aaG>aaA	p.K118K	GLT1D1_ENST00000537468.1_Silent_p.K107K|GLT1D1_ENST00000542193.1_Silent_p.K19K|GLT1D1_ENST00000281703.6_Silent_p.K118K			Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	118					biosynthetic process (GO:0009058)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	transferase activity, transferring glycosyl groups (GO:0016757)	p.K118K(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		AGTCAATGAAGGAAATGGCAC	0.378																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											323.0	286.0	298.0					12																	129383811		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9265.1	12q24.32	2013-02-22			ENSG00000151948	ENSG00000151948		"""Glycosyltransferase group 1 domain containing"""	26483	protein-coding gene	gene with protein product							Standard	NM_144669		Approved	FLJ31978	uc001uhx.1	Q96MS3	OTTHUMG00000168437	ENST00000442111.2:c.354G>A	12.37:g.129383811G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XG8	Silent	SNP	pfam_Glyco_trans_1	p.K118	ENST00000442111.2	37	c.354		12																																																																																			GLT1D1	-	NULL	ENSG00000151948		0.378	GLT1D1-002	KNOWN	basic|appris_principal	protein_coding	GLT1D1	HGNC	protein_coding	OTTHUMT00000399740.1	170	0.00	0	G	NM_144669		129383811	129383811	+1	no_errors	ENST00000442111	ensembl	human	known	69_37n	silent	302	21.35	82	SNP	1.000	A
GPBP1L1	60313	genome.wustl.edu	37	1	46108107	46108107	+	Missense_Mutation	SNP	C	C	G	rs540229680		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:46108107C>G	ENST00000290795.3	-	6	1763	c.542G>C	c.(541-543)gGa>gCa	p.G181A	GPBP1L1_ENST00000355105.3_Missense_Mutation_p.G181A			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	181					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G181A(1)	GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					ACCCCATACTCCAGAAGGTGT	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											139.0	142.0	141.0					1																	46108107		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.542G>C	1.37:g.46108107C>G	ENSP00000290795:p.Gly181Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ10|Q9H751	Missense_Mutation	SNP	NULL	p.G181A	ENST00000290795.3	37	c.542	CCDS528.1	1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546135	0.86022	.	.	ENSG00000159592	ENST00000290795;ENST00000355105	T;T	0.48201	0.82;0.82	5.86	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.62221	0.2410	M	0.73962	2.25	0.45172	D	0.998189	D	0.65815	0.995	P	0.59643	0.861	T	0.65772	-0.6087	10	0.54805	T	0.06	-6.8693	11.5784	0.50877	0.1237:0.811:0.0:0.0653	.	181	Q9HC44	GPBL1_HUMAN	A	181	ENSP00000290795:G181A;ENSP00000347224:G181A	ENSP00000290795:G181A	G	-	2	0	GPBP1L1	45880694	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.070000	0.57548	1.474000	0.48178	0.591000	0.81541	GGA	GPBP1L1	-	NULL	ENSG00000159592		0.408	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	HGNC	protein_coding	OTTHUMT00000098375.1	299	0.00	0	C	NM_021639		46108107	46108107	-1	no_errors	ENST00000290795	ensembl	human	known	69_37n	missense	591	24.52	192	SNP	1.000	G
GPD1	2819	genome.wustl.edu	37	12	50503243	50503243	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr12:50503243G>A	ENST00000301149.3	+	8	1223	c.991G>A	c.(991-993)Gag>Aag	p.E331K	COX14_ENST00000548985.1_5'Flank|RP4-605O3.4_ENST00000552815.1_RNA|GPD1_ENST00000548814.1_Missense_Mutation_p.E308K|COX14_ENST00000317943.2_5'Flank|COX14_ENST00000550487.1_5'Flank|COX14_ENST00000550654.1_5'Flank	NM_001257199.1|NM_005276.3	NP_001244128.1|NP_005267.2	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	331					cellular lipid metabolic process (GO:0044255)|cellular response to cAMP (GO:0071320)|cellular response to tumor necrosis factor (GO:0071356)|gluconeogenesis (GO:0006094)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophosphate shuttle (GO:0006127)|glycerophospholipid biosynthetic process (GO:0046474)|NADH oxidation (GO:0006116)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrion (GO:0005739)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|NAD binding (GO:0051287)	p.E331K(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						GGTGTGCTACGAGGGCCAGCC	0.572																																					NSCLC(141;1402 1905 9497 13391 44868)	dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	104.0	114.0					12																	50503243		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8799.1, CCDS58229.1	12q13.12	2013-09-20			ENSG00000167588	ENSG00000167588	1.1.1.8		4455	protein-coding gene	gene with protein product		138420					Standard	NM_005276		Approved		uc001rvz.4	P21695	OTTHUMG00000169813	ENST00000301149.3:c.991G>A	12.37:g.50503243G>A	ENSP00000301149:p.Glu331Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W1L5|Q8N1B0	Missense_Mutation	SNP	pfam_G3P_DH_NAD-dep_N,pfam_G3P_DH_NAD-dep_C,superfamily_6-PGluconate_DH_C-like,pirsf_G3P_DH_NAD-dep,prints_G3P_DH_NAD-dep,tigrfam_G3P_DH_NAD-dep_euk	p.E331K	ENST00000301149.3	37	c.991	CCDS8799.1	12	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372226	0.42003	.	.	ENSG00000167588	ENST00000301149;ENST00000548814	T;T	0.65178	-0.14;-0.14	4.99	4.99	0.66335	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);Glycerol-3-phosphate dehydrogenase, NAD-dependent, C-terminal (1);	0.055715	0.64402	D	0.000001	T	0.51924	0.1703	L	0.52266	1.64	0.42940	D	0.994346	B;B	0.15473	0.001;0.013	B;B	0.18561	0.005;0.022	T	0.44817	-0.9303	10	0.13470	T	0.59	-27.5198	10.3519	0.43941	0.1285:0.0:0.8715:0.0	.	308;331	F8W1L5;P21695	.;GPDA_HUMAN	K	331;308	ENSP00000301149:E331K;ENSP00000446768:E308K	ENSP00000301149:E331K	E	+	1	0	GPD1	48789510	0.992000	0.36948	0.994000	0.49952	0.922000	0.55478	2.317000	0.43770	2.493000	0.84123	0.462000	0.41574	GAG	GPD1	-	pfam_G3P_DH_NAD-dep_C,superfamily_6-PGluconate_DH_C-like,pirsf_G3P_DH_NAD-dep,tigrfam_G3P_DH_NAD-dep_euk	ENSG00000167588		0.572	GPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD1	HGNC	protein_coding	OTTHUMT00000406018.1	70	0.00	0	G			50503243	50503243	+1	no_errors	ENST00000301149	ensembl	human	known	69_37n	missense	101	19.84	25	SNP	0.997	A
GPR1	2825	genome.wustl.edu	37	2	207041528	207041528	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr2:207041528A>T	ENST00000407325.2	-	3	806	c.444T>A	c.(442-444)caT>caA	p.H148Q	GPR1_ENST00000437420.1_Missense_Mutation_p.H148Q	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	148					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.H148Q(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		TGAGGGTTCGATGCCGATGAG	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	104.0	105.0					2																	207041528		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.444T>A	2.37:g.207041528A>T	ENSP00000384345:p.His148Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPR1_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Frt_met_rcpt,prints_ATII_rcpt	p.H148Q	ENST00000407325.2	37	c.444	CCDS2368.1	2	.	.	.	.	.	.	.	.	.	.	A	13.62	2.290884	0.40494	.	.	ENSG00000183671	ENST00000407325;ENST00000437420;ENST00000442134;ENST00000451790	T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6	5.84	3.88	0.44766	GPCR, rhodopsin-like superfamily (1);	0.323590	0.34291	N	0.004098	T	0.67211	0.2869	L	0.58583	1.82	0.35973	D	0.835444	P	0.35226	0.491	B	0.37198	0.243	T	0.72827	-0.4175	10	0.72032	D	0.01	.	11.2662	0.49112	0.1604:0.0:0.8396:0.0	.	148	P46091	GPR1_HUMAN	Q	148	ENSP00000384345:H148Q;ENSP00000397535:H148Q;ENSP00000414836:H148Q;ENSP00000391146:H148Q	ENSP00000384345:H148Q	H	-	3	2	GPR1	206749773	0.884000	0.30299	0.709000	0.30452	0.706000	0.40770	0.460000	0.21924	0.670000	0.31165	-0.417000	0.06048	CAT	GPR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPR1_rcpt,prints_Frt_met_rcpt	ENSG00000183671		0.468	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR1	HGNC	protein_coding	OTTHUMT00000256394.2	304	0.00	0	A	NM_001098199		207041528	207041528	-1	no_errors	ENST00000407325	ensembl	human	known	69_37n	missense	265	30.18	115	SNP	0.931	T
GTF2F1	2962	genome.wustl.edu	37	19	6380409	6380409	+	Silent	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:6380409G>C	ENST00000394456.5	-	13	1901	c.1437C>G	c.(1435-1437)acC>acG	p.T479T	GTF2F1_ENST00000429701.2_Silent_p.T394T|PSPN_ENST00000597721.1_5'Flank	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	479					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.T479T(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						CTGTCTTCTTGGTCTGGAACT	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											203.0	192.0	196.0					19																	6380409		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.1437C>G	19.37:g.6380409G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCS0|Q9BWN0	Silent	SNP	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	p.T479	ENST00000394456.5	37	c.1437	CCDS12165.1	19																																																																																			GTF2F1	-	pfam_TFIIF-alpha	ENSG00000125651		0.567	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F1	HGNC	protein_coding	OTTHUMT00000398033.1	175	0.00	0	G	NM_002096		6380409	6380409	-1	no_errors	ENST00000394456	ensembl	human	known	69_37n	silent	149	31.19	68	SNP	1.000	C
HECTD4	283450	genome.wustl.edu	37	12	112691858	112691858	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr12:112691858C>G	ENST00000430131.2	-	21	3285	c.2140G>C	c.(2140-2142)Gac>Cac	p.D714H	HECTD4_ENST00000377560.5_Missense_Mutation_p.D964H|RP3-521E19.2_ENST00000547401.1_RNA|HECTD4_ENST00000550722.1_Missense_Mutation_p.D1000H			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	714					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.D964H(1)|p.D714H(1)									TTCACCAAGTCTTTCGGCCAA	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											145.0	123.0	130.0					12																	112691858		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2140G>C	12.37:g.112691858C>G	ENSP00000404379:p.Asp714His	Somatic		WXS	Illumina GAIIx	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.D964H	ENST00000430131.2	37	c.2890		12	.	.	.	.	.	.	.	.	.	.	C	32	5.149097	0.94645	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.55052	0.54;0.55;0.78	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.62122	0.2402	N	0.19112	0.55	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.994;0.996	T	0.65639	-0.6119	10	0.87932	D	0	.	19.4638	0.94931	0.0:1.0:0.0:0.0	.	714;714;714	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	H	964;714;1000	ENSP00000366783:D964H;ENSP00000404379:D714H;ENSP00000449784:D1000H	ENSP00000366783:D964H	D	-	1	0	C12orf51	111176241	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.847000	0.97988	0.655000	0.94253	GAC	HECTD4	-	NULL	ENSG00000173064		0.448	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		80	0.00	0	C	NM_173813		112691858	112691858	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	missense	209	10.68	25	SNP	1.000	G
IGHV4-34	28395	genome.wustl.edu	37	14	106829998	106829998	+	RNA	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr14:106829998G>C	ENST00000390616.2	-	0	78									immunoglobulin heavy variable 4-34																		CTGCCACCAGGAGGAGGAAGA	0.502																																						dbGAP											0													77.0	71.0	73.0					14																	106829998		1918	4125	6043	-	-	-			0			X92278		14q32.33	2012-02-08			ENSG00000211956	ENSG00000211956		"""Immunoglobulins / IGH locus"""	5650	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152074		14.37:g.106829998G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L16	ENST00000390616.2	37	c.48		14																																																																																			IGHV4-34	-	NULL	ENSG00000211956		0.502	IGHV4-34-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV4-34	HGNC	IG_V_gene	OTTHUMT00000325168.1	87	0.00	0	G	NG_001019		106829998	106829998	-1	no_stop_codon	ENST00000390616	ensembl	human	known	69_37n	silent	127	36.18	72	SNP	0.095	C
IPMK	253430	genome.wustl.edu	37	10	59997544	59997544	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:59997544C>G	ENST00000373935.3	-	2	544	c.222G>C	c.(220-222)ttG>ttC	p.L74F	snoU13_ENST00000458829.1_RNA	NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	74					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)	p.L74F(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						GTAACTGTTTCAAAACTGTGC	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											127.0	121.0	123.0					10																	59997544		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.222G>C	10.37:g.59997544C>G	ENSP00000363046:p.Leu74Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IPK	p.L74F	ENST00000373935.3	37	c.222	CCDS7250.1	10	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577583	0.45902	.	.	ENSG00000151151	ENST00000373935	T	0.16073	2.37	5.71	1.71	0.24356	.	0.066146	0.64402	D	0.000013	T	0.19446	0.0467	L	0.49455	1.56	0.39779	D	0.972275	B	0.31680	0.335	B	0.43413	0.419	T	0.06917	-1.0800	9	.	.	.	-2.3266	6.6267	0.22833	0.0:0.6469:0.1296:0.2234	.	74	Q8NFU5	IPMK_HUMAN	F	74	ENSP00000363046:L74F	.	L	-	3	2	IPMK	59667550	0.997000	0.39634	0.998000	0.56505	0.993000	0.82548	0.261000	0.18442	0.065000	0.16485	-0.236000	0.12185	TTG	IPMK	-	NULL	ENSG00000151151		0.343	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPMK	HGNC	protein_coding	OTTHUMT00000048142.1	181	0.00	0	C	NM_152230		59997544	59997544	-1	no_errors	ENST00000373935	ensembl	human	known	69_37n	missense	241	27.19	90	SNP	1.000	G
JAK1	3716	genome.wustl.edu	37	1	65313316	65313316	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:65313316C>A	ENST00000342505.4	-	13	2046	c.1798G>T	c.(1798-1800)Ggg>Tgg	p.G600W	JAK1_ENST00000465376.1_5'UTR	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	600	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.G600W(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	ATCAGGGTCCCAGAATAGATG	0.512			Mis		ALL																																	dbGAP		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	1	Substitution - Missense(1)	breast(1)											165.0	167.0	166.0					1																	65313316		1956	4127	6083	-	-	-	SO:0001583	missense	0			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1798G>T	1.37:g.65313316C>A	ENSP00000343204:p.Gly600Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GQ2|Q9UD26	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.G600W	ENST00000342505.4	37	c.1798	CCDS41346.1	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689221	0.88735	.	.	ENSG00000162434	ENST00000342505	D	0.87029	-2.2	5.01	5.01	0.66863	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.96228	0.8770	H	0.98155	4.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97350	0.9963	9	0.87932	D	0	-7.6648	18.8858	0.92376	0.0:1.0:0.0:0.0	.	600	P23458	JAK1_HUMAN	W	600	ENSP00000343204:G600W	ENSP00000343204:G600W	G	-	1	0	JAK1	65085904	1.000000	0.71417	0.940000	0.37924	0.967000	0.64934	7.156000	0.77453	2.775000	0.95449	0.655000	0.94253	GGG	JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000162434		0.512	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	71	0.00	0	C	NM_002227		65313316	65313316	-1	no_errors	ENST00000342505	ensembl	human	known	69_37n	missense	99	25.00	33	SNP	1.000	A
KAL1	3730	genome.wustl.edu	37	X	8553429	8553429	+	Silent	SNP	G	G	A	rs188939998		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chrX:8553429G>A	ENST00000262648.3	-	6	884	c.735C>T	c.(733-735)gaC>gaT	p.D245D		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	245	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.D245D(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						GAACTCGCTCGTCTGTGGTCT	0.488													G|||	2	0.000529801	0.0	0.0014	3775	,	,		14329	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	breast(1)											186.0	130.0	149.0					X																	8553429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.735C>T	X.37:g.8553429G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPF8	Silent	SNP	pfam_Fibronectin_type3,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Fibronectin_type3,pfscan_Fibronectin_type3,prints_4-disulphide_core	p.D245	ENST00000262648.3	37	c.735	CCDS14130.1	X																																																																																			KAL1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000011201		0.488	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAL1	HGNC	protein_coding	OTTHUMT00000055692.1	140	0.00	0	G	NM_000216		8553429	8553429	-1	no_errors	ENST00000262648	ensembl	human	known	69_37n	silent	126	25.29	43	SNP	0.873	A
KCNU1	157855	genome.wustl.edu	37	8	36780034	36780034	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr8:36780034G>A	ENST00000399881.3	+	24	2660	c.2623G>A	c.(2623-2625)Gaa>Aaa	p.E875K		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	875					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.E875K(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TCACTTTATTGAACAGCTTGG	0.458																																						dbGAP											2	Substitution - Missense(2)	breast(2)											133.0	131.0	132.0					8																	36780034		1928	4133	6061	-	-	-	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2623G>A	8.37:g.36780034G>A	ENSP00000382770:p.Glu875Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2,prints_K_chnl_Ca-activ_BK_asu	p.E875K	ENST00000399881.3	37	c.2623	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	G	15.81	2.942163	0.53079	.	.	ENSG00000215262	ENST00000399881	T	0.44083	0.93	5.32	4.44	0.53790	.	0.194217	0.30285	U	0.009963	T	0.35740	0.0942	M	0.63428	1.95	0.80722	D	1	B	0.33266	0.404	B	0.24269	0.052	T	0.31696	-0.9934	10	0.87932	D	0	-2.0756	8.2503	0.31712	0.1815:0.0:0.8185:0.0	.	875	A8MYU2	KCNU1_HUMAN	K	875	ENSP00000382770:E875K	ENSP00000382770:E875K	E	+	1	0	KCNU1	36899192	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	2.006000	0.40874	1.233000	0.43693	0.655000	0.94253	GAA	KCNU1	-	NULL	ENSG00000215262		0.458	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	145	0.00	0	G	NM_001031836		36780034	36780034	+1	no_errors	ENST00000399881	ensembl	human	known	69_37n	missense	189	11.27	24	SNP	0.996	A
KDR	3791	genome.wustl.edu	37	4	55953837	55953837	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr4:55953837G>T	ENST00000263923.4	-	27	3894	c.3599C>A	c.(3598-3600)tCc>tAc	p.S1200Y	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1200					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.S1200Y(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCCATACAGGAAACAGGTGA	0.473			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																												dbGAP		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	1	Substitution - Missense(1)	breast(1)											148.0	129.0	136.0					4																	55953837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3599C>A	4.37:g.55953837G>T	ENSP00000263923:p.Ser1200Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR2_rcpt,prints_Tyr_kinase_VEGFR_rcpt_N	p.S1200Y	ENST00000263923.4	37	c.3599	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511009	0.85389	.	.	ENSG00000128052	ENST00000263923	T	0.77620	-1.11	5.61	5.61	0.85477	.	0.231504	0.46145	D	0.000315	D	0.85894	0.5803	L	0.50333	1.59	0.53688	D	0.999971	D	0.89917	1.0	D	0.72982	0.979	D	0.86419	0.1753	10	0.72032	D	0.01	.	19.6231	0.95667	0.0:0.0:1.0:0.0	.	1200	P35968	VGFR2_HUMAN	Y	1200	ENSP00000263923:S1200Y	ENSP00000263923:S1200Y	S	-	2	0	KDR	55648594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.092000	0.71414	2.659000	0.90383	0.561000	0.74099	TCC	KDR	-	prints_Tyr_kinase_VEGFR2_rcpt	ENSG00000128052		0.473	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	158	0.00	0	G			55953837	55953837	-1	no_errors	ENST00000263923	ensembl	human	known	69_37n	missense	197	11.66	26	SNP	1.000	T
ZSWIM8	23053	genome.wustl.edu	37	10	75549754	75549754	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:75549754C>G	ENST00000605216.1	+	6	996	c.779C>G	c.(778-780)tCt>tGt	p.S260C	ZSWIM8_ENST00000603114.1_Missense_Mutation_p.S260C|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.S260C|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.S260C|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.S260C	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	260							zinc ion binding (GO:0008270)	p.S260C(2)									GAACTCCTGTCTTCCCAGTCA	0.567																																						dbGAP											2	Substitution - Missense(2)	breast(2)											67.0	67.0	67.0					10																	75549754		2057	4211	6268	-	-	-	SO:0001583	missense	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.779C>G	10.37:g.75549754C>G	ENSP00000474748:p.Ser260Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.S260C	ENST00000605216.1	37	c.779		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.7|23.7	4.452644|4.452644	0.84209|0.84209	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000451629|ENST00000398706	.|T	.|0.52526	.|0.66	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	.|.	.|.	.|.	.|.	T|T	0.70325|0.70325	0.3211|0.3211	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.81914	.|0.993;0.995;0.993	T|T	0.72554|0.72554	-0.4258|-0.4258	5|9	.|0.72032	.|D	.|0.01	-4.903|-4.903	19.2305|19.2305	0.93836|0.93836	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|260;260;260	.|A7E2V4;A7E2V4-5;A7E2V4-4	.|K0913_HUMAN;.;.	V|C	63|260	.|ENSP00000381693:S260C	.|ENSP00000381693:S260C	L|S	+|+	1|2	0|0	KIAA0913|KIAA0913	75219760|75219760	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.253000|7.253000	0.78320|0.78320	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	CTT|TCT	KIAA0913	-	NULL	ENSG00000214655		0.567	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	43	0.00	0	C	NM_001242487		75549754	75549754	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	1.000	G
RIC1	57589	genome.wustl.edu	37	9	5763849	5763849	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr9:5763849C>T	ENST00000414202.2	+	19	3013	c.2822C>T	c.(2821-2823)tCt>tTt	p.S941F	KIAA1432_ENST00000418622.3_Missense_Mutation_p.S862F|KIAA1432_ENST00000251879.6_Missense_Mutation_p.S941F|KIAA1432_ENST00000449720.2_Missense_Mutation_p.S825F|KIAA1432_ENST00000381532.2_Missense_Mutation_p.S862F	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.S862F(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		ACAGCTGCCTCTTACCTTATT	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	102.0	101.0					9																	5763849		2203	4291	6494	-	-	-	SO:0001583	missense	0																														ENST00000414202.2:c.2822C>T	9.37:g.5763849C>T	ENSP00000416696:p.Ser941Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.S862F	ENST00000414202.2	37	c.2585	CCDS34982.2	9	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166938	0.78339	.	.	ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	.	.	.	5.91	5.91	0.95273	Ribosome control protein 1 (1);	0.000000	0.85682	D	0.000000	D	0.85809	0.5783	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.995;0.996;0.996;0.991	D	0.87153	0.2210	9	0.72032	D	0.01	-19.7813	20.2885	0.98538	0.0:1.0:0.0:0.0	.	825;862;941;941	B7ZM67;B2RN24;Q4ADV7;G5E932	.;.;RIC1_HUMAN;.	F	941;941;862;862;825	.	ENSP00000251879:S941F	S	+	2	0	KIAA1432	5753849	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.791000	0.96007	0.650000	0.86243	TCT	KIAA1432	-	pfam_Ribosome_control_1	ENSG00000107036		0.388	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	274	0.00	0	C			5763849	5763849	+1	no_errors	ENST00000418622	ensembl	human	known	69_37n	missense	510	14.69	88	SNP	1.000	T
KIF4B	285643	genome.wustl.edu	37	5	154395982	154395982	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr5:154395982G>A	ENST00000435029.4	+	1	2723	c.2563G>A	c.(2563-2565)Gag>Aag	p.E855K		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	855	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.E855K(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ACAATGCTGGGAGAATATTGC	0.458																																						dbGAP											2	Substitution - Missense(2)	breast(2)											79.0	78.0	78.0					5																	154395982		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2563G>A	5.37:g.154395982G>A	ENSP00000387875:p.Glu855Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E855K	ENST00000435029.4	37	c.2563	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	g	16.59	3.165497	0.57476	.	.	ENSG00000226650	ENST00000435029	T	0.68903	-0.36	1.79	1.79	0.24919	.	.	.	.	.	T	0.58609	0.2134	L	0.59436	1.845	0.51233	D	0.999918	P	0.36789	0.57	B	0.35114	0.196	T	0.61357	-0.7079	9	0.46703	T	0.11	.	9.5502	0.39306	0.0:0.0:1.0:0.0	.	855	Q2VIQ3	KIF4B_HUMAN	K	855	ENSP00000387875:E855K	ENSP00000387875:E855K	E	+	1	0	KIF4B	154376175	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	5.996000	0.70639	1.325000	0.45301	0.557000	0.71058	GAG	KIF4B	-	NULL	ENSG00000226650		0.458	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	142	0.00	0	G			154395982	154395982	+1	no_errors	ENST00000435029	ensembl	human	known	69_37n	missense	164	28.07	64	SNP	1.000	A
KIT	3815	genome.wustl.edu	37	4	55561727	55561727	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr4:55561727C>G	ENST00000288135.5	+	2	214	c.117C>G	c.(115-117)atC>atG	p.I39M		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	39	Ig-like C2-type 1.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.I39M(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CACCATCCATCCATCCAGGAA	0.483		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													dbGAP	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - Missense(1)	breast(1)											89.0	80.0	83.0					4																	55561727		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.117C>G	4.37:g.55561727C>G	ENSP00000288135:p.Ile39Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.I39M	ENST00000288135.5	37	c.117	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483277	0.44147	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	T;T	0.58358	0.34;0.34	5.36	5.36	0.76844	Immunoglobulin-like fold (1);	0.247255	0.28914	N	0.013727	T	0.70037	0.3178	M	0.67397	2.05	0.42842	D	0.99405	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.992	T	0.72431	-0.4296	10	0.87932	D	0	.	14.4558	0.67416	0.0:1.0:0.0:0.0	.	39;39	P10721-2;P10721	.;KIT_HUMAN	M	39	ENSP00000288135:I39M;ENSP00000390987:I39M	ENSP00000288135:I39M	I	+	3	3	KIT	55256484	0.718000	0.27976	0.986000	0.45419	0.029000	0.11900	0.962000	0.29280	2.788000	0.95919	0.650000	0.86243	ATC	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000157404		0.483	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	49	0.00	0	C			55561727	55561727	+1	no_errors	ENST00000288135	ensembl	human	known	69_37n	missense	71	26.80	26	SNP	0.988	G
KRT35	3886	genome.wustl.edu	37	17	39637326	39637326	+	Silent	SNP	G	G	T	rs143248012	byFrequency	TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr17:39637326G>T	ENST00000393989.1	-	1	66	c.24C>A	c.(22-24)gcC>gcA	p.A8A	KRT35_ENST00000246639.2_5'UTR	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	8	Head.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.A8A(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				AAGAGAAGCCGGCCTTGAGGC	0.577																																						dbGAP											2	Substitution - coding silent(2)	prostate(1)|breast(1)											35.0	40.0	39.0					17																	39637326		1866	4098	5964	-	-	-	SO:0001819	synonymous_variant	0			X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.24C>A	17.37:g.39637326G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O76012|Q92651	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.A8	ENST00000393989.1	37	c.24	CCDS11394.2	17																																																																																			KRT35	-	NULL	ENSG00000197079		0.577	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT35	HGNC	protein_coding		29	0.00	0	G	NM_002280		39637326	39637326	-1	no_errors	ENST00000393989	ensembl	human	known	69_37n	silent	25	35.90	14	SNP	0.002	T
LCA5L	150082	genome.wustl.edu	37	21	40792688	40792688	+	Missense_Mutation	SNP	G	G	C	rs200548913		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr21:40792688G>C	ENST00000358268.2	-	6	1447	c.919C>G	c.(919-921)Cag>Gag	p.Q307E	LCA5L_ENST00000380671.2_Missense_Mutation_p.Q307E|LCA5L_ENST00000288350.3_Missense_Mutation_p.Q307E			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	307								p.Q307E(2)		breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				GTAGCTGTCTGAGCTGCTAAA	0.398																																						dbGAP											2	Substitution - Missense(2)	breast(2)											55.0	56.0	56.0					21																	40792688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.919C>G	21.37:g.40792688G>C	ENSP00000351008:p.Gln307Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSI0|Q3ZCT0	Missense_Mutation	SNP	NULL	p.Q307E	ENST00000358268.2	37	c.919	CCDS13665.1	21	.	.	.	.	.	.	.	.	.	.	G	9.206	1.029636	0.19512	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	T;T;T	0.78246	-1.16;-1.16;-1.16	5.94	3.97	0.46021	.	0.802180	0.11495	N	0.558320	T	0.73016	0.3533	L	0.58428	1.81	0.09310	N	1	P	0.46859	0.885	B	0.43052	0.406	T	0.60151	-0.7319	10	0.20519	T	0.43	-9.5495	8.8332	0.35096	0.067:0.0939:0.6779:0.1612	.	307	O95447	LCA5L_HUMAN	E	307	ENSP00000288350:Q307E;ENSP00000370046:Q307E;ENSP00000351008:Q307E	ENSP00000288350:Q307E	Q	-	1	0	LCA5L	39714558	0.130000	0.22417	0.518000	0.27811	0.148000	0.21650	2.448000	0.44926	1.530000	0.49136	0.650000	0.86243	CAG	LCA5L	-	NULL	ENSG00000157578		0.398	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	102	0.00	0	G	NM_152505		40792688	40792688	-1	no_errors	ENST00000288350	ensembl	human	known	69_37n	missense	100	34.42	53	SNP	0.006	C
LIMA1	51474	genome.wustl.edu	37	12	50598427	50598427	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr12:50598427C>G	ENST00000341247.4	-	6	921	c.772G>C	c.(772-774)Gaa>Caa	p.E258Q	LIMA1_ENST00000547825.1_5'Flank|LIMA1_ENST00000552909.1_Missense_Mutation_p.E98Q|LIMA1_ENST00000552783.1_Missense_Mutation_p.E98Q|LIMA1_ENST00000394943.3_Missense_Mutation_p.E258Q|LIMA1_ENST00000552823.1_Missense_Mutation_p.E98Q|LIMA1_ENST00000552008.1_5'UTR	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	258					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)	p.E258Q(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						CGTGGAAGTTCCAGATTTCGT	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											160.0	143.0	149.0					12																	50598427		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.772G>C	12.37:g.50598427C>G	ENSP00000340184:p.Glu258Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.E258Q	ENST00000341247.4	37	c.772	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775641	0.90195	.	.	ENSG00000050405	ENST00000552823;ENST00000394943;ENST00000341247;ENST00000552783;ENST00000552909;ENST00000420992	T;D;T;T;T	0.84730	-1.48;-1.89;-1.16;-1.48;-1.48	5.57	5.57	0.84162	.	0.325192	0.32430	N	0.006109	D	0.87884	0.6290	L	0.54323	1.7	0.34831	D	0.739681	D;P;P	0.61697	0.99;0.951;0.94	P;P;P	0.52823	0.71;0.447;0.595	D	0.91356	0.5108	10	0.59425	D	0.04	.	17.6877	0.88260	0.0:1.0:0.0:0.0	.	267;258;98	Q59FE8;Q9UHB6;F8VQE1	.;LIMA1_HUMAN;.	Q	98;258;258;98;98;177	ENSP00000450266:E98Q;ENSP00000378400:E258Q;ENSP00000340184:E258Q;ENSP00000448779:E98Q;ENSP00000450087:E98Q	ENSP00000340184:E258Q	E	-	1	0	LIMA1	48884694	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.298000	0.59067	2.784000	0.95788	0.585000	0.79938	GAA	LIMA1	-	NULL	ENSG00000050405		0.413	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	96	0.00	0	C	NM_016357		50598427	50598427	-1	no_errors	ENST00000394943	ensembl	human	known	69_37n	missense	156	24.27	50	SNP	1.000	G
LIN54	132660	genome.wustl.edu	37	4	83905831	83905831	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr4:83905831G>C	ENST00000340417.3	-	2	544	c.167C>G	c.(166-168)tCt>tGt	p.S56C	LIN54_ENST00000510557.1_Intron|LIN54_ENST00000505397.1_Missense_Mutation_p.S56C|LIN54_ENST00000395282.2_Missense_Mutation_p.S56C|LIN54_ENST00000506560.1_Missense_Mutation_p.S56C|LIN54_ENST00000395283.2_Missense_Mutation_p.S56C|LIN54_ENST00000442461.2_Intron|LIN54_ENST00000446851.2_Intron	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	56					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)	p.S56C(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				CGTGGCTGTAGAGTCACCAGT	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											235.0	219.0	224.0					4																	83905831		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.167C>G	4.37:g.83905831G>C	ENSP00000341947:p.Ser56Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	pfam_TCR	p.S56C	ENST00000340417.3	37	c.167	CCDS3599.1	4	.	.	.	.	.	.	.	.	.	.	G	9.494	1.101405	0.20632	.	.	ENSG00000189308	ENST00000340417;ENST00000395283;ENST00000395282;ENST00000506560;ENST00000505397	.	.	.	5.36	5.36	0.76844	.	0.600069	0.17466	N	0.173277	T	0.42562	0.1208	N	0.14661	0.345	0.80722	D	1	B;B	0.10296	0.003;0.0	B;B	0.06405	0.002;0.0	T	0.26950	-1.0088	9	0.44086	T	0.13	-10.6014	14.6567	0.68838	0.0:0.1452:0.8548:0.0	.	56;56	Q6MZP7-2;Q6MZP7	.;LIN54_HUMAN	C	56	.	ENSP00000341947:S56C	S	-	2	0	LIN54	84124855	1.000000	0.71417	0.998000	0.56505	0.062000	0.15995	4.430000	0.59907	2.505000	0.84491	0.655000	0.94253	TCT	LIN54	-	NULL	ENSG00000189308		0.408	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN54	HGNC	protein_coding	OTTHUMT00000252626.2	151	0.00	0	G	NM_194282		83905831	83905831	-1	no_errors	ENST00000340417	ensembl	human	known	69_37n	missense	262	28.73	106	SNP	0.994	C
LMAN1L	79748	genome.wustl.edu	37	15	75116744	75116744	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr15:75116744C>T	ENST00000309664.5	+	13	1515	c.1376C>T	c.(1375-1377)tCg>tTg	p.S459L	LMAN1L_ENST00000379709.3_Missense_Mutation_p.S447L|CPLX3_ENST00000395018.4_5'Flank|RP11-414J4.2_ENST00000564823.1_RNA	NM_021819.2	NP_068591.2	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like	459						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.S459L(1)		NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGGGCCTCCTCGTGCCTGCAG	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	106.0	104.0					15																	75116744		2197	4295	6492	-	-	-	SO:0001583	missense	0			AF303398	CCDS10270.1	15q24.1	2005-08-05			ENSG00000140506	ENSG00000140506			6632	protein-coding gene	gene with protein product		609548				11255007	Standard	NM_021819		Approved	ERGL, ERGIC-53L	uc002ayt.1	Q9HAT1	OTTHUMG00000142813	ENST00000309664.5:c.1376C>T	15.37:g.75116744C>T	ENSP00000310431:p.Ser459Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWN2	Missense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	p.S459L	ENST00000309664.5	37	c.1376	CCDS10270.1	15	.	.	.	.	.	.	.	.	.	.	C	11.63	1.697265	0.30142	.	.	ENSG00000140506	ENST00000309664;ENST00000379709	T;T	0.46819	0.94;0.86	3.89	0.924	0.19418	.	0.737577	0.11661	N	0.541857	T	0.33933	0.0880	L	0.42245	1.32	0.09310	N	1	B;B	0.28470	0.213;0.136	B;B	0.21917	0.037;0.009	T	0.31558	-0.9939	10	0.87932	D	0	.	3.7724	0.08647	0.0:0.5669:0.2058:0.2273	.	447;459	Q9HAT1-3;Q9HAT1	.;LMA1L_HUMAN	L	459;447	ENSP00000310431:S459L;ENSP00000369031:S447L	ENSP00000310431:S459L	S	+	2	0	LMAN1L	72903797	0.000000	0.05858	0.005000	0.12908	0.071000	0.16799	0.538000	0.23160	0.225000	0.20959	0.561000	0.74099	TCG	LMAN1L	-	NULL	ENSG00000140506		0.597	LMAN1L-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	LMAN1L	HGNC	protein_coding	OTTHUMT00000286397.4	62	0.00	0	C			75116744	75116744	+1	no_errors	ENST00000309664	ensembl	human	known	69_37n	missense	44	27.87	17	SNP	0.002	T
LTBP1	4052	genome.wustl.edu	37	2	33590449	33590449	+	Silent	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr2:33590449G>C	ENST00000404816.2	+	31	4943	c.4590G>C	c.(4588-4590)ctG>ctC	p.L1530L	LTBP1_ENST00000354476.3_Silent_p.L1531L|LTBP1_ENST00000407925.1_Silent_p.L1204L|LTBP1_ENST00000404525.1_Silent_p.L1151L|LTBP1_ENST00000272273.5_Silent_p.L428L|LTBP1_ENST00000390003.4_Silent_p.L1205L|LTBP1_ENST00000402934.1_Silent_p.L1149L|LTBP1_ENST00000418533.2_Silent_p.L1162L			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1530	TB 4.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.L1531L(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GGGAACATCTGAGTGATGAAT	0.468																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											139.0	131.0	134.0					2																	33590449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4590G>C	2.37:g.33590449G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.L1531	ENST00000404816.2	37	c.4593	CCDS33177.2	2																																																																																			LTBP1	-	superfamily_TB_dom	ENSG00000049323		0.468	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	76	0.00	0	G	NM_206943		33590449	33590449	+1	no_errors	ENST00000354476	ensembl	human	known	69_37n	silent	133	28.88	54	SNP	1.000	C
MAGEB1	4112	genome.wustl.edu	37	X	30269534	30269534	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chrX:30269534G>A	ENST00000378981.3	+	4	1245	c.924G>A	c.(922-924)ttG>ttA	p.L308L	MAGEB1_ENST00000397550.1_Silent_p.L308L|MAGEB1_ENST00000397548.2_Silent_p.L308L	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	308								p.L308L(1)		NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						AAGAGGCTTTGAGAGATGAGG	0.522																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											105.0	90.0	95.0					X																	30269534		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.924G>A	X.37:g.30269534G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.L308	ENST00000378981.3	37	c.924	CCDS14222.1	X																																																																																			MAGEB1	-	NULL	ENSG00000214107		0.522	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB1	HGNC	protein_coding	OTTHUMT00000056160.1	205	0.00	0	G	NM_002363		30269534	30269534	+1	no_errors	ENST00000378981	ensembl	human	known	69_37n	silent	233	19.93	58	SNP	0.002	A
MDN1	23195	genome.wustl.edu	37	6	90385248	90385248	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:90385248C>A	ENST00000369393.3	-	78	12811	c.12696G>T	c.(12694-12696)ttG>ttT	p.L4232F	MDN1_ENST00000428876.1_Missense_Mutation_p.L4232F|RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000468568.1_5'Flank			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4232					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.L4232F(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCATCTTCATCAAATGTGCTG	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	100.0	111.0					6																	90385248		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12696G>T	6.37:g.90385248C>A	ENSP00000358400:p.Leu4232Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.L4232F	ENST00000369393.3	37	c.12696	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488567	0.44249	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.08102	3.13;3.13	5.84	1.69	0.24217	.	0.000000	0.64402	D	0.000004	T	0.09992	0.0245	M	0.66939	2.045	0.43930	D	0.996588	D	0.89917	1.0	D	0.85130	0.997	T	0.13442	-1.0509	10	0.45353	T	0.12	.	1.2661	0.02011	0.2241:0.3545:0.2514:0.1699	.	4232	Q9NU22	MDN1_HUMAN	F	4232	ENSP00000358400:L4232F;ENSP00000413970:L4232F	ENSP00000358400:L4232F	L	-	3	2	MDN1	90441969	0.934000	0.31675	1.000000	0.80357	0.695000	0.40330	0.012000	0.13287	0.816000	0.34421	0.561000	0.74099	TTG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.537	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	45	0.00	0	C			90385248	90385248	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	69	31.00	31	SNP	0.995	A
MDN1	23195	genome.wustl.edu	37	6	90400449	90400449	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:90400449C>T	ENST00000369393.3	-	64	10807	c.10692G>A	c.(10690-10692)ctG>ctA	p.L3564L	MDN1_ENST00000428876.1_Silent_p.L3564L			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3564					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.L3564L(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CCTCTTCACTCAGGGCTGTCC	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											136.0	107.0	117.0					6																	90400449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.10692G>A	6.37:g.90400449C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.L3564	ENST00000369393.3	37	c.10692	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.512	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	48	0.00	0	C			90400449	90400449	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	silent	95	25.20	32	SNP	1.000	T
METTL2B	55798	genome.wustl.edu	37	7	128133877	128133877	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr7:128133877C>G	ENST00000262432.8	+	6	726	c.689C>G	c.(688-690)cCt>cGt	p.P230R	RP11-212P7.3_ENST00000462662.1_RNA|METTL2B_ENST00000480046.1_Missense_Mutation_p.P165R	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	230					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)	p.P230R(1)		breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GAATATGATCCTTCTCGGTGT	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	143.0	146.0					7																	128133877		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.689C>G	7.37:g.128133877C>G	ENSP00000262432:p.Pro230Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd	p.P230R	ENST00000262432.8	37	c.689	CCDS5803.2	7	.	.	.	.	.	.	.	.	.	.	C	9.361	1.068092	0.20067	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;T;T	0.03951	3.75;3.75;3.75	3.16	3.16	0.36331	Methyltransferase type 12 (1);	0.218658	0.48286	D	0.000192	T	0.10723	0.0262	M	0.66939	2.045	0.52501	D	0.999956	P;B	0.36683	0.565;0.316	P;B	0.44946	0.465;0.408	T	0.03852	-1.0998	10	0.52906	T	0.07	-2.8421	11.7956	0.52098	0.0:1.0:0.0:0.0	.	165;230	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	R	224;230;165	ENSP00000418634:P224R;ENSP00000262432:P230R;ENSP00000418402:P165R	ENSP00000262432:P230R	P	+	2	0	METTL2B	127921113	0.966000	0.33281	0.997000	0.53966	0.262000	0.26303	4.106000	0.57804	1.588000	0.49971	0.195000	0.17529	CCT	METTL2B	-	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd	ENSG00000165055		0.358	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2B	HGNC	protein_coding	OTTHUMT00000289817.1	122	0.00	0	C	NM_018396		128133877	128133877	+1	no_errors	ENST00000262432	ensembl	human	known	69_37n	missense	444	19.57	108	SNP	1.000	G
MR1	3140	genome.wustl.edu	37	1	181024397	181024397	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:181024397G>A	ENST00000367580.5	+	6	1027	c.1022G>A	c.(1021-1023)cGa>cAa	p.R341Q	MR1_ENST00000282990.6_Missense_Mutation_p.R249Q|MR1_ENST00000438435.2_3'UTR|MR1_ENST00000367579.3_Missense_Mutation_p.R296Q|MR1_ENST00000434571.2_Missense_Mutation_p.R214Q	NM_001531.2	NP_001522.1	Q95460	HMR1_HUMAN	major histocompatibility complex, class I-related	341					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	MHC class I receptor activity (GO:0032393)|peptide antigen binding (GO:0042605)	p.R341Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	18					Antithymocyte globulin(DB00098)	ACACCAGATCGATGATTGCAG	0.448																																					Colon(174;1412 1962 45296 46549 47110)	dbGAP											1	Substitution - Missense(1)	breast(1)											247.0	214.0	225.0					1																	181024397		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF010446	CCDS1342.1, CCDS53440.1, CCDS53441.1, CCDS53442.1	1q25.3	2013-01-11	2003-03-05	2003-03-07	ENSG00000153029	ENSG00000153029		"""Immunoglobulin superfamily / C1-set domain containing"""	4975	protein-coding gene	gene with protein product		600764	"""major histocompatibility complex, class I-like sequence"""	HLALS		7624800, 9784382	Standard	NM_001194999		Approved		uc001goq.2	Q95460	OTTHUMG00000035175	ENST00000367580.5:c.1022G>A	1.37:g.181024397G>A	ENSP00000356552:p.Arg341Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V9|B4E3B1|O97985|O97986|Q53GM1|Q95HB8|Q9MY23|Q9NPL2|Q9TQB3|Q9TQB9|Q9TQK3	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,prints_MHC_I_a_a1/a2,pfscan_Ig-like	p.R341Q	ENST00000367580.5	37	c.1022	CCDS1342.1	1	.	.	.	.	.	.	.	.	.	.	G	11.28	1.592384	0.28357	.	.	ENSG00000153029	ENST00000434571;ENST00000367580;ENST00000282990;ENST00000367579	T;T;T;T	0.01015	5.93;5.92;5.86;5.44	3.95	-3.62	0.04543	.	1.916530	0.03000	N	0.148064	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.49447	-0.8939	10	0.87932	D	0	.	0.8574	0.01186	0.2914:0.3243:0.2256:0.1588	.	214;249;296;341	B4E3B1;Q95460-3;Q95460-2;Q95460	.;.;.;HMR1_HUMAN	Q	214;341;249;296	ENSP00000388504:R214Q;ENSP00000356552:R341Q;ENSP00000282990:R249Q;ENSP00000356551:R296Q	ENSP00000282990:R249Q	R	+	2	0	MR1	179291020	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.314000	0.19432	-0.845000	0.04179	0.508000	0.49915	CGA	MR1	-	NULL	ENSG00000153029		0.448	MR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MR1	HGNC	protein_coding	OTTHUMT00000085134.2	155	0.00	0	G	NM_001531		181024397	181024397	+1	no_errors	ENST00000367580	ensembl	human	known	69_37n	missense	380	22.13	108	SNP	0.000	A
MYB	4602	genome.wustl.edu	37	6	135515566	135515566	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:135515566G>A	ENST00000367814.4	+	8	1102	c.916G>A	c.(916-918)Gag>Aag	p.E306K	MYB_ENST00000534121.1_Missense_Mutation_p.E306K|MYB_ENST00000316528.8_Missense_Mutation_p.E306K|MYB_ENST00000442647.2_Missense_Mutation_p.E306K|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000528774.1_Missense_Mutation_p.E306K|MYB_ENST00000534044.1_Missense_Mutation_p.E306K|MYB_ENST00000420123.2_Missense_Mutation_p.E282K|MYB_ENST00000525369.1_Missense_Mutation_p.E306K|MYB_ENST00000533624.1_Intron|MYB_ENST00000341911.5_Missense_Mutation_p.E306K|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000527615.1_Missense_Mutation_p.E306K	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	306	Transcription activation domain (PubMed:2189102). {ECO:0000269|PubMed:2189102}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E306K(2)		breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AATGTCAACCGAGAATGAGCT	0.413			T	NFIB	adenoid cystic carcinoma																																	dbGAP		Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	2	Substitution - Missense(2)	breast(2)											100.0	94.0	96.0					6																	135515566		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.916G>A	6.37:g.135515566G>A	ENSP00000356788:p.Glu306Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E306K	ENST00000367814.4	37	c.916	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.416045	0.96092	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000420123;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000430686	T;T;T;T;T;T;T;T;T	0.42131	2.15;1.99;1.78;1.83;0.98;1.92;2.35;2.06;1.44	5.56	5.56	0.83823	Transcription regulator Wos2-domain (1);	0.000000	0.85682	D	0.000000	T	0.57403	0.2051	L	0.58810	1.83	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.995;0.998;0.994;0.998;0.998;0.999;0.996;0.999;0.997	T	0.59841	-0.7378	10	0.87932	D	0	-14.936	19.5216	0.95187	0.0:0.0:1.0:0.0	.	306;282;306;306;306;306;306;306;306	E9PLZ5;E9PMQ0;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;.;MYB_HUMAN;.	K	306;306;306;306;306;306;282;306;306;306;306;260	ENSP00000339992:E306K;ENSP00000410825:E306K;ENSP00000326328:E306K;ENSP00000356788:E306K;ENSP00000433227:E306K;ENSP00000435938:E306K;ENSP00000434723:E306K;ENSP00000432851:E306K;ENSP00000435055:E306K	ENSP00000237302:E306K	E	+	1	0	MYB	135557259	1.000000	0.71417	0.995000	0.50966	0.721000	0.41392	9.837000	0.99465	2.609000	0.88269	0.561000	0.74099	GAG	MYB	-	pfam_Tscrpt_reg_Wos2-domain	ENSG00000118513		0.413	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	105	0.00	0	G			135515566	135515566	+1	no_errors	ENST00000341911	ensembl	human	known	69_37n	missense	170	28.27	67	SNP	1.000	A
N4BP1	9683	genome.wustl.edu	37	16	48576901	48576901	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr16:48576901C>G	ENST00000262384.3	-	7	2841	c.2605G>C	c.(2605-2607)Gag>Cag	p.E869Q	N4BP1_ENST00000565423.1_5'UTR	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	869					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)		p.E869Q(1)|p.E916Q(1)		breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				AGTCTTTGCTCTGAGTCAGGG	0.507																																						dbGAP											2	Substitution - Missense(2)	breast(2)											114.0	105.0	108.0					16																	48576901		1946	4142	6088	-	-	-	SO:0001583	missense	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2605G>C	16.37:g.48576901C>G	ENSP00000262384:p.Glu869Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD49|Q2YDX1	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.E869Q	ENST00000262384.3	37	c.2605	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061516	0.76187	.	.	ENSG00000102921	ENST00000262384	T	0.50277	0.75	5.63	4.68	0.58851	.	0.152557	0.64402	D	0.000019	T	0.66187	0.2764	M	0.66939	2.045	0.38318	D	0.943458	D	0.89917	1.0	D	0.76071	0.987	T	0.72541	-0.4262	10	0.62326	D	0.03	-25.5049	14.4568	0.67420	0.0:0.9293:0.0:0.0707	.	869	O75113	N4BP1_HUMAN	Q	869	ENSP00000262384:E869Q	ENSP00000262384:E869Q	E	-	1	0	N4BP1	47134402	0.998000	0.40836	0.866000	0.34008	0.984000	0.73092	3.749000	0.55150	1.372000	0.46190	0.650000	0.86243	GAG	N4BP1	-	NULL	ENSG00000102921		0.507	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	HGNC	protein_coding	OTTHUMT00000429920.1	77	0.00	0	C	NM_014664		48576901	48576901	-1	no_errors	ENST00000262384	ensembl	human	known	69_37n	missense	50	49.49	49	SNP	0.983	G
NCL	4691	genome.wustl.edu	37	2	232326353	232326353	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr2:232326353C>T	ENST00000322723.4	-	3	751	c.511G>A	c.(511-513)Gaa>Aaa	p.E171K	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	171	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.E171K(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		GCTGCTGGTTCAATTtcatct	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											405.0	259.0	309.0					2																	232326353		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.511G>A	2.37:g.232326353C>T	ENSP00000318195:p.Glu171Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.E171K	ENST00000322723.4	37	c.511	CCDS33397.1	2	.	.	.	.	.	.	.	.	.	.	C	15.21	2.765272	0.49574	.	.	ENSG00000115053	ENST00000322723;ENST00000392033;ENST00000322732;ENST00000454824;ENST00000417652	T;T;T	0.67865	2.03;-0.29;-0.29	5.34	4.45	0.53987	.	0.484707	0.24730	N	0.036062	T	0.52451	0.1735	L	0.38175	1.15	0.24669	N	0.993421	B	0.09022	0.002	B	0.08055	0.003	T	0.40924	-0.9537	10	0.33940	T	0.23	-18.3082	7.5518	0.27802	0.0:0.7432:0.1689:0.0879	.	171	P19338	NUCL_HUMAN	K	171;113;171;155;155	ENSP00000318195:E171K;ENSP00000401620:E155K;ENSP00000392747:E155K	ENSP00000318195:E171K	E	-	1	0	NCL	232034597	1.000000	0.71417	0.719000	0.30619	0.583000	0.36354	1.377000	0.34317	1.235000	0.43724	0.555000	0.69702	GAA	NCL	-	NULL	ENSG00000115053		0.507	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCL	HGNC	protein_coding	OTTHUMT00000332731.1	90	0.00	0	C	NM_005381		232326353	232326353	-1	no_errors	ENST00000322723	ensembl	human	known	69_37n	missense	192	30.69	85	SNP	0.472	T
NDUFAF5	79133	genome.wustl.edu	37	20	13797576	13797576	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr20:13797576G>A	ENST00000378106.5	+	10	1037	c.918G>A	c.(916-918)atG>atA	p.M306I	NDUFAF5_ENST00000475968.1_3'UTR|NDUFAF5_ENST00000463598.1_Missense_Mutation_p.M278I	NM_024120.4	NP_077025.2	Q5TEU4	NDUF5_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 5	306					mitochondrial respiratory chain complex I assembly (GO:0032981)	extrinsic component of mitochondrial inner membrane (GO:0031314)	methyltransferase activity (GO:0008168)	p.M306I(1)									TCTATTACATGATAGGATGGA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	105.0	108.0					20																	13797576		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13118.1, CCDS33441.1	20p12.1	2012-10-12	2012-05-08	2012-05-08	ENSG00000101247	ENSG00000101247		"""Mitochondrial respiratory chain complex assembly factors"""	15899	protein-coding gene	gene with protein product		612360	"""chromosome 20 open reading frame 7"""	C20orf7		18940309, 21607760	Standard	NM_024120		Approved	dJ842G6.1	uc002wom.3	Q5TEU4	OTTHUMG00000031909	ENST00000378106.5:c.918G>A	20.37:g.13797576G>A	ENSP00000367346:p.Met306Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K166|Q6GPH3|Q9H6F4	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_Put_SAM_MeTrfase	p.M306I	ENST00000378106.5	37	c.918	CCDS13118.1	20	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256807	0.80246	.	.	ENSG00000101247	ENST00000378106;ENST00000463598	D;D	0.86627	-2.15;-2.15	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.89719	0.6796	M	0.85041	2.73	0.80722	D	1	P;P	0.37276	0.589;0.454	B;B	0.40901	0.343;0.342	D	0.88681	0.3202	10	0.30854	T	0.27	-32.2998	17.4348	0.87548	0.0:0.0:1.0:0.0	.	278;306	Q5TEU4-2;Q5TEU4	.;CT007_HUMAN	I	306;278	ENSP00000367346:M306I;ENSP00000420497:M278I	ENSP00000367346:M306I	M	+	3	0	C20orf7	13745576	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	8.480000	0.90434	2.550000	0.86006	0.591000	0.81541	ATG	NDUFAF5	-	NULL	ENSG00000101247		0.353	NDUFAF5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF5	HGNC	protein_coding	OTTHUMT00000078057.2	229	0.00	0	G	NM_001039375		13797576	13797576	+1	no_errors	ENST00000378106	ensembl	human	known	69_37n	missense	252	24.78	83	SNP	1.000	A
NOV	4856	genome.wustl.edu	37	8	120431514	120431514	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr8:120431514G>A	ENST00000259526.3	+	4	933	c.706G>A	c.(706-708)Gag>Aag	p.E236K	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	1557	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.E236K(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			CCGTCAATGTGAGATGCTGAA	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	134.0	137.0					8																	120431514		2203	4300	6503	-	-	-	SO:0001583	missense	0			X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.706G>A	8.37:g.120431514G>A	ENSP00000259526:p.Glu236Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IGFBP-like,pfam_Cys_knot,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.E236K	ENST00000259526.3	37	c.706	CCDS6328.1	8	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842567	0.71488	.	.	ENSG00000136999	ENST00000259526	T	0.52983	0.64	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.29061	0.0722	N	0.10733	0.035	0.40630	D	0.981844	P	0.42908	0.793	B	0.34652	0.187	T	0.11397	-1.0589	10	0.23891	T	0.37	-25.3749	20.422	0.99049	0.0:0.0:1.0:0.0	.	236	P48745	NOV_HUMAN	K	236	ENSP00000259526:E236K	ENSP00000259526:E236K	E	+	1	0	NOV	120500695	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.284000	0.51708	2.832000	0.97577	0.655000	0.94253	GAG	NOV	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pirsf_IGFBP_CNN,pfscan_Thrombospondin_1_rpt	ENSG00000136999		0.542	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOV	HGNC	protein_coding	OTTHUMT00000381301.1	134	0.00	0	G	NM_002514		120431514	120431514	+1	no_errors	ENST00000259526	ensembl	human	known	69_37n	missense	113	15.67	21	SNP	1.000	A
NPTXR	23467	genome.wustl.edu	37	22	39222669	39222670	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr22:39222669_39222670insA	ENST00000333039.2	-	3	1056_1057	c.933_934insT	c.(931-936)aaggctfs	p.A312fs		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	312	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					TCGGGCAGAGCCTTCCGCACGC	0.639																																					Pancreas(139;2521 3281 36965)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.933_934insT	22.37:g.39222669_39222670insA	ENSP00000327545:p.Ala312fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.A311fs	ENST00000333039.2	37	c.934_933	CCDS33647.1	22																																																																																			NPTXR	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin	ENSG00000221890		0.639	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2	32	0.00	0	-	NM_014293		39222669	39222670	-1	no_errors	ENST00000333039	ensembl	human	known	69_37n	frame_shift_ins	44	35.29	24	INS	0.976:0.998	A
OR2T27	403239	genome.wustl.edu	37	1	248813660	248813660	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:248813660G>C	ENST00000344889.3	-	1	525	c.526C>G	c.(526-528)Cac>Gac	p.H176D		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H176D(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGAAGAAGTGGTTGATCTCC	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											19.0	7.0	11.0					1																	248813660		2140	3940	6080	-	-	-	SO:0001583	missense	0				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.526C>G	1.37:g.248813660G>C	ENSP00000342008:p.His176Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H176D	ENST00000344889.3	37	c.526	CCDS31124.1	1	.	.	.	.	.	.	.	.	.	.	.	10.45	1.352784	0.24512	.	.	ENSG00000187701	ENST00000344889	T	0.00174	8.62	3.3	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43579	D	0.000550	T	0.00496	0.0016	M	0.91300	3.195	0.21802	N	0.999532	P	0.46395	0.877	P	0.53185	0.72	T	0.13818	-1.0495	10	0.87932	D	0	.	10.0416	0.42162	0.1074:0.0:0.8926:0.0	.	176	Q8NH04	O2T27_HUMAN	D	176	ENSP00000342008:H176D	ENSP00000342008:H176D	H	-	1	0	OR2T27	246880283	0.918000	0.31147	0.953000	0.39169	0.114000	0.19823	2.199000	0.42715	0.708000	0.31955	0.194000	0.17425	CAC	OR2T27	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000187701		0.557	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T27	HGNC	protein_coding	OTTHUMT00000097124.1	54	0.00	0	G	NM_001001824		248813660	248813660	-1	no_errors	ENST00000344889	ensembl	human	known	69_37n	missense	96	15.04	17	SNP	0.834	C
OR52N2	390077	genome.wustl.edu	37	11	5841832	5841832	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:5841832C>T	ENST00000317037.2	+	1	289	c.267C>T	c.(265-267)ttC>ttT	p.F89F	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F89F(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TATTCTGGTTCAACCTCAAGG	0.532																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											159.0	139.0	146.0					11																	5841832		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.267C>T	11.37:g.5841832C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFF9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F89	ENST00000317037.2	37	c.267	CCDS31399.1	11																																																																																			OR52N2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000180988		0.532	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N2	HGNC	protein_coding	OTTHUMT00000401143.1	306	0.00	0	C	NM_001005174		5841832	5841832	+1	no_errors	ENST00000317037	ensembl	human	known	69_37n	silent	302	24.50	98	SNP	0.166	T
OSBP	5007	genome.wustl.edu	37	11	59367985	59367985	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:59367985G>C	ENST00000263847.1	-	7	1774	c.1295C>G	c.(1294-1296)tCt>tGt	p.S432C		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	432	Sterol binding. {ECO:0000250}.				lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)	p.S432C(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GGGGATCTTAGAGAGTTCTTT	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											196.0	181.0	186.0					11																	59367985		2201	4295	6496	-	-	-	SO:0001583	missense	0			AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1295C>G	11.37:g.59367985G>C	ENSP00000263847:p.Ser432Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P524	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S432C	ENST00000263847.1	37	c.1295	CCDS7974.1	11	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092597	0.76756	.	.	ENSG00000110048	ENST00000263847	T	0.48836	0.8	5.51	5.51	0.81932	.	0.118463	0.64402	D	0.000016	T	0.78291	0.4260	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84882	0.0831	10	0.87932	D	0	-14.1586	14.6249	0.68614	0.0:0.1456:0.8544:0.0	.	432	P22059	OSBP1_HUMAN	C	432	ENSP00000263847:S432C	ENSP00000263847:S432C	S	-	2	0	OSBP	59124561	1.000000	0.71417	0.964000	0.40570	0.997000	0.91878	7.884000	0.87274	2.604000	0.88044	0.655000	0.94253	TCT	OSBP	-	pfam_Oxysterol-bd	ENSG00000110048		0.478	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBP	HGNC	protein_coding	OTTHUMT00000394555.1	236	0.00	0	G			59367985	59367985	-1	no_errors	ENST00000263847	ensembl	human	known	69_37n	missense	294	28.05	115	SNP	1.000	C
OTOP2	92736	genome.wustl.edu	37	17	72929469	72929469	+	Splice_Site	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr17:72929469G>A	ENST00000580223.1	+	6	1548		c.e6-1		OTOP3_ENST00000328801.4_5'Flank|OTOP2_ENST00000331427.4_Splice_Site			Q7RTS6	OTOP2_HUMAN	otopetrin 2							integral component of membrane (GO:0016021)		p.?(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					TCTCCACACAGCTGTGGATCA	0.582																																						dbGAP											1	Unknown(1)	breast(1)											120.0	102.0	108.0					17																	72929469		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1519-1G>A	17.37:g.72929469G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e6-1	ENST00000580223.1	37	c.1519-1	CCDS11708.1	17	.	.	.	.	.	.	.	.	.	.	G	22.7	4.329144	0.81690	.	.	ENSG00000183034	ENST00000331427	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8698	0.88808	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OTOP2	70441064	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.779000	0.99018	2.381000	0.81170	0.561000	0.74099	.	OTOP2	-	-	ENSG00000183034		0.582	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1	57	0.00	0	G	NM_178160	Intron	72929469	72929469	+1	no_errors	ENST00000331427	ensembl	human	known	69_37n	splice_site	94	12.96	14	SNP	1.000	A
PCLO	27445	genome.wustl.edu	37	7	82390016	82390016	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr7:82390016C>T	ENST00000333891.9	-	24	15564	c.15227G>A	c.(15226-15228)cGa>cAa	p.R5076Q		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CGAAGGCTCTCGATCATGTCT	0.323																																						dbGAP											0													136.0	133.0	134.0					7																	82390016		1832	4073	5905	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15227G>A	7.37:g.82390016C>T	ENSP00000334319:p.Arg5076Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.R5076Q	ENST00000333891.9	37	c.15227	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571588	0.65765	.	.	ENSG00000186472	ENST00000333891	T	0.08193	3.12	5.25	5.25	0.73442	.	0.000000	0.39909	U	0.001236	T	0.24275	0.0588	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00567	-1.1667	10	0.87932	D	0	.	18.8516	0.92232	0.0:1.0:0.0:0.0	.	5076	Q9Y6V0-5	.	Q	5076	ENSP00000334319:R5076Q	ENSP00000334319:R5076Q	R	-	2	0	PCLO	82227952	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.818000	0.86416	2.446000	0.82766	0.585000	0.79938	CGA	PCLO	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000186472		0.323	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	193	0.00	0	C	NM_014510		82390016	82390016	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	247	27.57	94	SNP	1.000	T
PER2	8864	genome.wustl.edu	37	2	239164479	239164479	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr2:239164479G>A	ENST00000254657.3	-	18	2418	c.2139C>T	c.(2137-2139)ctC>ctT	p.L713L	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	713	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.L713L(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TCTCTTGGCTGAGACCACAGG	0.592																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											78.0	86.0	83.0					2																	239164479		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2139C>T	2.37:g.239164479G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.L713	ENST00000254657.3	37	c.2139	CCDS2528.1	2																																																																																			PER2	-	NULL	ENSG00000132326		0.592	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1	82	0.00	0	G	NM_022817		239164479	239164479	-1	no_errors	ENST00000254657	ensembl	human	known	69_37n	silent	72	33.33	36	SNP	0.002	A
PHF3	23469	genome.wustl.edu	37	6	64423044	64423044	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:64423044C>T	ENST00000262043.3	+	16	5900	c.5560C>T	c.(5560-5562)Ccc>Tcc	p.P1854S	PHF3_ENST00000393387.1_Missense_Mutation_p.P1854S			Q92576	PHF3_HUMAN	PHD finger protein 3	1854	Pro-rich.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.P1854S(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TCCCATGGTTCCCTGGCCACC	0.498																																					GBM(135;136 1820 29512 34071 46235)	dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	120.0	118.0					6																	64423044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.5560C>T	6.37:g.64423044C>T	ENSP00000262043:p.Pro1854Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.P1854S	ENST00000262043.3	37	c.5560	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132159	0.37630	.	.	ENSG00000118482	ENST00000262043;ENST00000393387	T;T	0.26223	1.75;1.75	5.97	5.97	0.96955	.	0.000000	0.39341	N	0.001398	T	0.24812	0.0602	L	0.27053	0.805	0.49798	D	0.999829	D	0.69078	0.997	P	0.61874	0.895	T	0.01078	-1.1459	9	.	.	.	-3.9098	15.8681	0.79080	0.0:0.8653:0.1347:0.0	.	1854	Q92576	PHF3_HUMAN	S	1854	ENSP00000262043:P1854S;ENSP00000377048:P1854S	.	P	+	1	0	PHF3	64481003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.662000	0.54510	2.836000	0.97738	0.655000	0.94253	CCC	PHF3	-	NULL	ENSG00000118482		0.498	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	HGNC	protein_coding	OTTHUMT00000041086.2	323	0.00	0	C			64423044	64423044	+1	no_errors	ENST00000262043	ensembl	human	known	69_37n	missense	350	27.18	131	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr3:178938934G>A	ENST00000263967.3	+	14	2333	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	726			E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E726K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAGAAGGATGAAACACAAAA	0.428		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	lung(4)|large_intestine(2)|breast(2)											89.0	78.0	82.0					3																	178938934		1917	4118	6035	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2176G>A	3.37:g.178938934G>A	ENSP00000263967:p.Glu726Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E726K	ENST00000263967.3	37	c.2176	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308869	0.60305	.	.	ENSG00000121879	ENST00000263967	T	0.80653	-1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.166180	0.38778	U	0.001568	T	0.73450	0.3588	L	0.36672	1.1	0.80722	D	1	P	0.46064	0.872	B	0.42738	0.396	T	0.71401	-0.4604	10	0.02654	T	1	-19.3819	19.7612	0.96319	0.0:0.0:1.0:0.0	.	726	P42336	PK3CA_HUMAN	K	726	ENSP00000263967:E726K	ENSP00000263967:E726K	E	+	1	0	PIK3CA	180421628	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.476000	0.97823	2.670000	0.90874	0.655000	0.94253	GAA	PIK3CA	-	superfamily_Kinase-like_dom	ENSG00000121879		0.428	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	57	0.00	0	G			178938934	178938934	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	108	10.74	13	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	3.37:g.178952085A>T	ENSP00000263967:p.His1047Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047L	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	134	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	246	27.22	92	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110457083	110457083	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr8:110457083A>G	ENST00000378402.5	+	38	5089	c.4985A>G	c.(4984-4986)gAc>gGc	p.D1662G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1662	IPT/TIG 9.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.D1664G(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCAAACATTGACCTGGTGTTG	0.433										HNSCC(38;0.096)																												dbGAP											1	Substitution - Missense(1)	breast(1)											158.0	157.0	157.0					8																	110457083		1927	4126	6053	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4985A>G	8.37:g.110457083A>G	ENSP00000367655:p.Asp1662Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.D1662G	ENST00000378402.5	37	c.4985	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	A	13.84	2.356919	0.41801	.	.	ENSG00000205038	ENST00000378402	T	0.77229	-1.08	6.03	4.86	0.63082	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.176786	0.47455	D	0.000230	D	0.84338	0.5450	M	0.78801	2.425	0.28609	N	0.908786	P	0.41188	0.741	P	0.53185	0.72	T	0.79688	-0.1699	10	0.49607	T	0.09	.	11.6052	0.51029	0.8506:0.1494:0.0:0.0	.	1662	Q86WI1	PKHL1_HUMAN	G	1662	ENSP00000367655:D1662G	ENSP00000367655:D1662G	D	+	2	0	PKHD1L1	110526259	0.968000	0.33430	0.080000	0.20451	0.385000	0.30292	4.377000	0.59562	1.067000	0.40740	0.533000	0.62120	GAC	PKHD1L1	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000205038		0.433	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	268	0.00	0	A	NM_177531		110457083	110457083	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	233	30.45	102	SNP	0.938	G
LOC102724392	102724392	genome.wustl.edu	37	5	70671685	70671685	+	lincRNA	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr5:70671685C>T	ENST00000502659.2	-	0	698				PMCHL2_ENST00000450213.2_RNA|RP11-136K7.3_ENST00000518473.1_lincRNA																							CATGGTCTGTCACTGAATCTG	0.388																																						dbGAP											0																																										-	-	-			0																															5.37:g.70671685C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000502659.2	37	NULL		5																																																																																			PMCHL2	-	-	ENSG00000169040		0.388	RP11-136K7.2-001	KNOWN	basic	lincRNA	PMCHL2	HGNC	lincRNA	OTTHUMT00000374679.1	70	0.00	0	C			70671685	70671685	+1	no_errors	ENST00000415808	ensembl	human	known	69_37n	rna	82	37.40	49	SNP	0.994	T
PNLIPRP1	5407	genome.wustl.edu	37	10	118352049	118352049	+	Missense_Mutation	SNP	G	G	A	rs567295917		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:118352049G>A	ENST00000528052.1	+	4	397	c.326G>A	c.(325-327)tGc>tAc	p.C109Y	PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.C109Y|PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.C109Y|PNLIPRP1_ENST00000480870.2_3'UTR|PNLIPRP1_ENST00000442761.1_Missense_Mutation_p.C109Y			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	109					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)	p.C109Y(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		ACAGACATGTGCAAGGTAGGA	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		19247	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	80.0	81.0					10																	118352049		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.326G>A	10.37:g.118352049G>A	ENSP00000433933:p.Cys109Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase_panc,prints_Lipase	p.C109Y	ENST00000528052.1	37	c.326	CCDS7595.1	10	.	.	.	.	.	.	.	.	.	.	G	14.06	2.424016	0.43020	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000442761;ENST00000530319;ENST00000527980;ENST00000471549;ENST00000534537	D;D;D;D;D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77;-2.77;-2.77;-2.77;-2.77	5.21	4.3	0.51218	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95781	0.8627	M	0.90483	3.12	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96278	0.9204	10	0.87932	D	0	-10.1575	13.106	0.59247	0.0796:0.0:0.9204:0.0	.	109;109	P54315;P54315-2	LIPR1_HUMAN;.	Y	109	ENSP00000436123:C109Y;ENSP00000351695:C109Y;ENSP00000433933:C109Y;ENSP00000400963:C109Y;ENSP00000437263:C109Y;ENSP00000433785:C109Y;ENSP00000431207:C109Y;ENSP00000434159:C109Y	ENSP00000351695:C109Y	C	+	2	0	PNLIPRP1	118342039	1.000000	0.71417	1.000000	0.80357	0.331000	0.28603	5.822000	0.69265	1.319000	0.45190	0.655000	0.94253	TGC	PNLIPRP1	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase_panc,prints_Lipase	ENSG00000187021		0.448	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PNLIPRP1	HGNC	protein_coding	OTTHUMT00000384633.1	127	0.00	0	G	NM_006229		118352049	118352049	+1	no_errors	ENST00000358834	ensembl	human	known	69_37n	missense	149	32.58	72	SNP	1.000	A
PRKCB	5579	genome.wustl.edu	37	16	24043543	24043543	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr16:24043543C>T	ENST00000321728.7	+	4	550	c.375C>T	c.(373-375)ctC>ctT	p.L125L	PRKCB_ENST00000303531.7_Silent_p.L125L	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	125					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.L125L(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TGTATGGACTCATCCACCAGG	0.527																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											93.0	81.0	85.0					16																	24043543		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.375C>T	16.37:g.24043543C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.L125	ENST00000321728.7	37	c.375	CCDS10618.1	16																																																																																			PRKCB	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000166501		0.527	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	47	0.00	0	C	NM_212535		24043543	24043543	+1	no_errors	ENST00000303531	ensembl	human	known	69_37n	silent	78	40.00	52	SNP	1.000	T
PRMT6	55170	genome.wustl.edu	37	1	107599767	107599767	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:107599767G>C	ENST00000370078.1	+	1	467	c.430G>C	c.(430-432)Gag>Cag	p.E144Q	PRMT6_ENST00000361318.5_Missense_Mutation_p.E85Q			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	144	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)	p.E85Q(1)		biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		GGAGACTGTAGAGTTGCCGGA	0.652																																						dbGAP											1	Substitution - Missense(1)	breast(1)											81.0	95.0	90.0					1																	107599767		2191	4289	6480	-	-	-	SO:0001583	missense	0			AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.430G>C	1.37:g.107599767G>C	ENSP00000359095:p.Glu144Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_Methyltransf_11,pfam_tRNA_mo5U34_MeTrfase,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.E144Q	ENST00000370078.1	37	c.430	CCDS41360.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.64|14.64	2.596817|2.596817	0.46318|0.46318	.|.	.|.	ENSG00000198890|ENSG00000198890	ENST00000361318;ENST00000370078|ENST00000540389	T;T|.	0.64618|.	-0.11;-0.11|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.50377|0.50377	0.1612|0.1612	N|N	0.25647|0.25647	0.755|0.755	0.46609|0.46609	D|D	0.999124|0.999124	B|.	0.29188|.	0.236|.	P|.	0.45276|.	0.475|.	T|T	0.56932|0.56932	-0.7897|-0.7897	10|6	0.41790|0.87932	T|D	0.15|0	-24.4387|-24.4387	17.4474|17.4474	0.87581|0.87581	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	144|.	Q96LA8|.	ANM6_HUMAN|.	Q|T	85;144|37	ENSP00000355145:E85Q;ENSP00000359095:E144Q|.	ENSP00000355145:E85Q|ENSP00000440829:R37T	E|R	+|+	1|2	0|0	PRMT6|PRMT6	107401290|107401290	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.003000|0.003000	0.03518|0.03518	3.742000|3.742000	0.55097|0.55097	2.711000|2.711000	0.92665|0.92665	0.544000|0.544000	0.68410|0.68410	GAG|AGA	PRMT6	-	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_Methyltransf_11,pfam_tRNA_mo5U34_MeTrfase,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	ENSG00000198890		0.652	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT6	HGNC	protein_coding	OTTHUMT00000030185.1	65	0.00	0	G	NM_018137		107599767	107599767	+1	no_errors	ENST00000370078	ensembl	human	known	69_37n	missense	37	30.91	17	SNP	1.000	C
PRPF8	10594	genome.wustl.edu	37	17	1580966	1580966	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr17:1580966C>A	ENST00000572621.1	-	13	2142	c.1877G>T	c.(1876-1878)gGc>gTc	p.G626V	PRPF8_ENST00000304992.6_Missense_Mutation_p.G626V			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	626					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.G626V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GAAGCCACAGCCAGGACCCTT	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											70.0	73.0	72.0					17																	1580966		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1877G>T	17.37:g.1580966C>A	ENSP00000460348:p.Gly626Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.G626V	ENST00000572621.1	37	c.1877	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.080455	0.94050	.	.	ENSG00000174231	ENST00000304992	D	0.82803	-1.65	5.94	5.94	0.96194	PROCN (1);	0.000000	0.85682	D	0.000000	D	0.94398	0.8198	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95153	0.8274	10	0.87932	D	0	.	20.3594	0.98849	0.0:1.0:0.0:0.0	.	626	Q6P2Q9	PRP8_HUMAN	V	626	ENSP00000304350:G626V	ENSP00000304350:G626V	G	-	2	0	PRPF8	1527716	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.696000	0.84270	2.816000	0.96949	0.563000	0.77884	GGC	PRPF8	-	pfam_PROCN	ENSG00000174231		0.537	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	74	0.00	0	C			1580966	1580966	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	missense	113	34.86	61	SNP	1.000	A
RB1	5925	genome.wustl.edu	37	13	49050906	49050906	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr13:49050906G>T	ENST00000267163.4	+	25	2728	c.2590G>T	c.(2590-2592)Gaa>Taa	p.E864*	RB1_ENST00000484879.1_3'UTR	NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	864	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)|p.E864*(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAGAAGTGCTGAAGGAAGCAA	0.378		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	28	Whole gene deletion(15)|Unknown(11)|Substitution - Nonsense(2)	bone(11)|breast(6)|haematopoietic_and_lymphoid_tissue(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)											124.0	121.0	122.0					13																	49050906		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2590G>T	13.37:g.49050906G>T	ENSP00000267163:p.Glu864*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.E864*	ENST00000267163.4	37	c.2590	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	42	9.719522	0.99247	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.84	5.84	0.93424	.	0.058093	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.7343	0.96195	0.0:0.0:1.0:0.0	.	.	.	.	X	843;864	.	ENSP00000267163:E864X	E	+	1	0	RB1	47948907	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.724000	0.91462	2.751000	0.94390	0.591000	0.81541	GAA	RB1	-	pfam_Rb_C	ENSG00000139687		0.378	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	169	0.00	0	G			49050906	49050906	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	nonsense	92	48.31	86	SNP	1.000	T
RBM14	10432	genome.wustl.edu	37	11	66391892	66391892	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:66391892C>G	ENST00000310137.4	+	2	684	c.545C>G	c.(544-546)tCt>tGt	p.S182C	RBM4_ENST00000503028.2_Intron|RBM14_ENST00000443702.1_3'UTR|RBM14_ENST00000409372.1_3'UTR|RBM14_ENST00000393979.3_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM14_ENST00000461478.1_3'UTR|RBM4_ENST00000514361.3_Intron|RBM14_ENST00000409738.4_Intron|RBM14-RBM4_ENST00000412278.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	182					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.S182C(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						GGTGGCTTCTCTGCCACCTTC	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	56.0	55.0					11																	66391892		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.545C>G	11.37:g.66391892C>G	ENSP00000311747:p.Ser182Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S182C	ENST00000310137.4	37	c.545	CCDS8147.1	11	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609671	0.46527	.	.	ENSG00000239306	ENST00000310137	D	0.81996	-1.56	5.83	5.83	0.93111	.	0.147015	0.47455	D	0.000233	T	0.81706	0.4879	N	0.14661	0.345	0.80722	D	1	D	0.69078	0.997	D	0.64410	0.925	T	0.81413	-0.0944	10	0.39692	T	0.17	-5.1179	12.5443	0.56190	0.1662:0.8338:0.0:0.0	.	182	Q96PK6	RBM14_HUMAN	C	182	ENSP00000311747:S182C	ENSP00000311747:S182C	S	+	2	0	RBM14	66148468	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.191000	0.50981	2.769000	0.95229	0.655000	0.94253	TCT	RBM14	-	NULL	ENSG00000239306		0.612	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000277128.1	49	0.00	0	C	NM_006328		66391892	66391892	+1	no_errors	ENST00000310137	ensembl	human	known	69_37n	missense	60	35.48	33	SNP	1.000	G
RBM14	10432	genome.wustl.edu	37	11	66392021	66392021	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:66392021C>G	ENST00000310137.4	+	2	813	c.674C>G	c.(673-675)tCt>tGt	p.S225C	RBM4_ENST00000503028.2_Intron|RBM14_ENST00000409372.1_3'UTR|RBM14_ENST00000393979.3_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14_ENST00000409738.4_Intron|RBM14-RBM4_ENST00000412278.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	225	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.S225C(1)	RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CCCCGAGCCTCTTATGTGGCT	0.657																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	41.0	41.0					11																	66392021		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.674C>G	11.37:g.66392021C>G	ENSP00000311747:p.Ser225Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S225C	ENST00000310137.4	37	c.674	CCDS8147.1	11	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901021	0.52227	.	.	ENSG00000239306	ENST00000310137	D	0.82081	-1.57	5.58	5.58	0.84498	.	0.272165	0.30277	N	0.009988	T	0.81427	0.4820	N	0.14661	0.345	0.80722	D	1	D	0.63880	0.993	P	0.61533	0.89	D	0.83659	0.0160	10	0.72032	D	0.01	-4.9986	12.0671	0.53594	0.172:0.828:0.0:0.0	.	225	Q96PK6	RBM14_HUMAN	C	225	ENSP00000311747:S225C	ENSP00000311747:S225C	S	+	2	0	RBM14	66148597	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	3.178000	0.50879	2.620000	0.88729	0.655000	0.94253	TCT	RBM14	-	NULL	ENSG00000239306		0.657	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000277128.1	26	0.00	0	C	NM_006328		66392021	66392021	+1	no_errors	ENST00000310137	ensembl	human	known	69_37n	missense	84	28.21	33	SNP	1.000	G
RNF213	57674	genome.wustl.edu	37	17	78321847	78321847	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr17:78321847G>A	ENST00000582970.1	+	29	9855	c.9712G>A	c.(9712-9714)Ggt>Agt	p.G3238S	RNF213_ENST00000336301.6_Missense_Mutation_p.G1311S|RNF213_ENST00000508628.2_Missense_Mutation_p.G3287S	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3238					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G3287S(1)|p.G1311S(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGAGAGGCAGGGTCCCCGGGC	0.602																																						dbGAP											2	Substitution - Missense(2)	breast(2)											61.0	55.0	57.0					17																	78321847		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9712G>A	17.37:g.78321847G>A	ENSP00000464087:p.Gly3238Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.G3238S	ENST00000582970.1	37	c.9712	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	10.69	1.419971	0.25552	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.16324	2.35	5.41	2.3	0.28687	.	0.300707	0.32416	N	0.006121	T	0.14917	0.0360	L	0.61036	1.89	0.09310	N	1	B	0.12630	0.006	B	0.15870	0.014	T	0.17349	-1.0372	10	0.30854	T	0.27	.	4.9557	0.14038	0.2749:0.2989:0.4263:0.0	.	1311	Q63HN8	RN213_HUMAN	S	3238;3287;1311	ENSP00000338218:G1311S	ENSP00000338218:G1311S	G	+	1	0	RNF213	75936442	0.416000	0.25424	0.012000	0.15200	0.000000	0.00434	2.812000	0.47994	0.785000	0.33685	-0.973000	0.02599	GGT	RNF213	-	NULL	ENSG00000173821		0.602	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	26	0.00	0	G	NM_020914		78321847	78321847	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.002	A
ROS1	6098	genome.wustl.edu	37	6	117709171	117709171	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:117709171C>T	ENST00000368508.3	-	13	1984	c.1786G>A	c.(1786-1788)Gaa>Aaa	p.E596K	ROS1_ENST00000368507.3_Intron|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	596	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E596K(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCAAAGAGTTCAATAATATCA	0.443			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																	dbGAP		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	2	Substitution - Missense(2)	breast(2)											91.0	92.0	91.0					6																	117709171		2203	4300	6503	-	-	-	SO:0001583	missense	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.1786G>A	6.37:g.117709171C>T	ENSP00000357494:p.Glu596Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.E596K	ENST00000368508.3	37	c.1786	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	C	11.71	1.718570	0.30503	.	.	ENSG00000047936	ENST00000368508	D	0.86164	-2.08	4.74	1.15	0.20763	.	1.461070	0.04918	N	0.454501	T	0.62380	0.2423	N	0.08118	0	0.38086	D	0.936826	B	0.23377	0.084	B	0.15870	0.014	T	0.18085	-1.0348	10	0.40728	T	0.16	.	12.5599	0.56275	0.8237:0.1763:0.0:0.0	.	596	P08922	ROS1_HUMAN	K	596	ENSP00000357494:E596K	ENSP00000357494:E596K	E	-	1	0	ROS1	117815864	0.066000	0.20996	0.328000	0.25416	0.770000	0.43624	3.082000	0.50128	0.118000	0.18165	0.462000	0.41574	GAA	ROS1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000047936		0.443	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	207	0.00	0	C			117709171	117709171	-1	no_errors	ENST00000368508	ensembl	human	known	69_37n	missense	187	30.37	82	SNP	0.608	T
S100A1	6271	genome.wustl.edu	37	1	153603056	153603056	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:153603056C>T	ENST00000292169.1	+	2	172	c.59C>T	c.(58-60)tCg>tTg	p.S20L	RP1-178F15.4_ENST00000469931.2_RNA|S100A13_ENST00000491177.1_5'UTR|RP1-178F15.4_ENST00000607839.1_RNA|S100A1_ENST00000469893.1_3'UTR|S100A1_ENST00000368698.3_Missense_Mutation_p.S73L|S100A13_ENST00000440685.2_5'Flank|S100A1_ENST00000368696.3_Missense_Mutation_p.S20L|S100A13_ENST00000368699.1_Intron|RP1-178F15.5_ENST00000497086.1_RNA|S100A13_ENST00000339556.4_5'Flank	NM_006271.1	NP_006262.1	P23297	S10A1_HUMAN	S100 calcium binding protein A1	20	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|regulation of heart contraction (GO:0008016)|substantia nigra development (GO:0021762)	M band (GO:0031430)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)	p.S20L(1)		breast(1)|cervix(1)|lung(2)	4	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	CACGCCCACTCGGGCAAAGAG	0.582																																					Ovarian(74;601 1703 10548 31787)	dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	81.0	83.0					1																	153603056		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014392	CCDS1047.1	1q21	2013-01-10	2001-11-28		ENSG00000160678	ENSG00000160678		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10486	protein-coding gene	gene with protein product		176940	"""S100 calcium-binding protein A1"""	S100A		1998503	Standard	NM_006271		Approved	S100-alpha	uc001fck.1	P23297	OTTHUMG00000037041	ENST00000292169.1:c.59C>T	1.37:g.153603056C>T	ENSP00000292169:p.Ser20Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5D9|Q5T7Y3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S73L	ENST00000292169.1	37	c.218	CCDS1047.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.041504	0.75732	.	.	ENSG00000160678	ENST00000368698;ENST00000292169;ENST00000368696;ENST00000436839	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	5.18	5.18	0.71444	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46308	0.1386	.	.	.	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.47935	-0.9078	9	0.87932	D	0	.	16.2363	0.82377	0.0:1.0:0.0:0.0	.	20	P23297	S10A1_HUMAN	L	73;20;20;20	ENSP00000357687:S73L;ENSP00000292169:S20L;ENSP00000357685:S20L;ENSP00000389708:S20L	ENSP00000292169:S20L	S	+	2	0	S100A1	151869680	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.090000	0.76916	2.689000	0.91719	0.561000	0.74099	TCG	S100A1	-	pfam_S100_Ca-bd_sub	ENSG00000160678		0.582	S100A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A1	HGNC	protein_coding	OTTHUMT00000089933.1	17	0.00	0	C	NM_006271		153603056	153603056	+1	no_errors	ENST00000368698	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	1.000	T
SACS	26278	genome.wustl.edu	37	13	23911264	23911264	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr13:23911264G>C	ENST00000382292.3	-	9	7024	c.6751C>G	c.(6751-6753)Caa>Gaa	p.Q2251E	SACS_ENST00000402364.1_Missense_Mutation_p.Q1501E|SACS_ENST00000382298.3_Missense_Mutation_p.Q2251E			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2251					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.Q2104E(1)|p.Q2251E(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ACTATATCTTGATGTTCAGCT	0.368																																						dbGAP											2	Substitution - Missense(2)	breast(2)											61.0	62.0	62.0					13																	23911264		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.6751C>G	13.37:g.23911264G>C	ENSP00000371729:p.Gln2251Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin,superfamily_ATPase-like_ATP-bd,superfamily_DnaJ_N,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_N,pfscan_Ubiquitin_supergroup	p.Q2251E	ENST00000382292.3	37	c.6751	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	16.70	3.197022	0.58126	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.86865	-2.02;-2.18;-2.02	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.83764	0.5325	L	0.41236	1.265	0.51767	D	0.999934	B	0.33549	0.417	B	0.33196	0.159	T	0.80719	-0.1257	10	0.30854	T	0.27	.	19.949	0.97192	0.0:0.0:1.0:0.0	.	2251	Q9NZJ4	SACS_HUMAN	E	2251;1501;2251	ENSP00000371729:Q2251E;ENSP00000385844:Q1501E;ENSP00000371735:Q2251E	ENSP00000371729:Q2251E	Q	-	1	0	SACS	22809264	1.000000	0.71417	0.993000	0.49108	0.843000	0.47879	9.476000	0.97823	2.706000	0.92434	0.655000	0.94253	CAA	SACS	-	NULL	ENSG00000151835		0.368	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	74	0.00	0	G	NM_014363		23911264	23911264	-1	no_errors	ENST00000382292	ensembl	human	known	69_37n	missense	76	40.62	52	SNP	1.000	C
SCN9A	6335	genome.wustl.edu	37	2	167138306	167138306	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr2:167138306G>C	ENST00000409435.1	-	12	1986	c.1987C>G	c.(1987-1989)Caa>Gaa	p.Q663E	SCN9A_ENST00000409672.1_Missense_Mutation_p.Q652E|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.Q664E|SCN9A_ENST00000375387.4_Missense_Mutation_p.Q664E			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	663					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.Q652E(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGTGTATTTGATTGGTCGTG	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											136.0	128.0	131.0					2																	167138306		1851	4104	5955	-	-	-	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1987C>G	2.37:g.167138306G>C	ENSP00000386330:p.Gln663Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.Q664E	ENST00000409435.1	37	c.1990	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.461946	0.01062	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.90444	-2.57;-2.57;-2.57;-2.57;-2.67;-2.57	5.71	3.81	0.43845	Domain of unknown function DUF3451 (1);	0.523755	0.18960	N	0.126421	T	0.69993	0.3173	N	0.01576	-0.805	0.30501	N	0.770437	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.62248	-0.6894	10	0.02654	T	1	.	9.3116	0.37908	0.0:0.3448:0.5348:0.1203	.	652;663;664	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	E	652;664;664;663;517;528	ENSP00000386306:Q652E;ENSP00000364536:Q664E;ENSP00000304748:Q664E;ENSP00000386330:Q663E;ENSP00000413212:Q517E;ENSP00000393141:Q528E	ENSP00000304748:Q664E	Q	-	1	0	SCN9A	166846552	1.000000	0.71417	0.045000	0.18777	0.030000	0.12068	4.136000	0.58004	2.861000	0.98227	0.650000	0.86243	CAA	SCN9A	-	pfam_DUF3451	ENSG00000169432		0.348	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	172	0.00	0	G	NM_002977		167138306	167138306	-1	no_errors	ENST00000303354	ensembl	human	known	69_37n	missense	175	26.47	63	SNP	0.994	C
SEC24B	10427	genome.wustl.edu	37	4	110460811	110460811	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr4:110460811C>T	ENST00000265175.5	+	24	3842	c.3787C>T	c.(3787-3789)Cag>Tag	p.Q1263*	SEC24B_ENST00000399100.2_Nonsense_Mutation_p.Q1228*|SEC24B_ENST00000504968.2_Nonsense_Mutation_p.Q1293*	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	1263					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.Q1263*(1)|p.Q1228*(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		GCTTCATGTTCAGCAGCAGAT	0.363																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											79.0	69.0	72.0					4																	110460811		1807	4076	5883	-	-	-	SO:0001587	stop_gained	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.3787C>T	4.37:g.110460811C>T	ENSP00000265175:p.Gln1263*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM8|B7ZKN4|Q0VG08	Nonsense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.Q1263*	ENST00000265175.5	37	c.3787	CCDS47124.1	4	.	.	.	.	.	.	.	.	.	.	C	40	8.452672	0.98817	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	.	.	.	5.31	5.31	0.75309	.	0.178216	0.51477	D	0.000090	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-4.9325	19.1814	0.93625	0.0:1.0:0.0:0.0	.	.	.	.	X	1293;1228;1263	.	ENSP00000265175:Q1263X	Q	+	1	0	SEC24B	110680260	1.000000	0.71417	0.950000	0.38849	0.972000	0.66771	7.562000	0.82300	2.779000	0.95612	0.591000	0.81541	CAG	SEC24B	-	NULL	ENSG00000138802		0.363	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2	54	0.00	0	C			110460811	110460811	+1	no_errors	ENST00000265175	ensembl	human	known	69_37n	nonsense	128	11.72	17	SNP	1.000	T
SETX	23064	genome.wustl.edu	37	9	135211682	135211682	+	Splice_Site	SNP	C	C	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr9:135211682C>A	ENST00000224140.5	-	6	901		c.e6+1		SETX_ENST00000393220.1_Splice_Site|SETX_ENST00000372169.2_Splice_Site	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin						cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.?(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATAATACTCACCTAACCAATA	0.398																																						dbGAP											1	Unknown(1)	breast(1)											62.0	58.0	59.0					9																	135211682		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.718+1G>T	9.37:g.135211682C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Splice_Site	SNP	-	e4+1	ENST00000224140.5	37	c.718+1	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478257	0.84747	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5772	0.95449	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETX	134201503	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.012000	0.70767	2.876000	0.98609	0.650000	0.86243	.	SETX	-	-	ENSG00000107290		0.398	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	117	0.00	0	C	NM_015046	Intron	135211682	135211682	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	splice_site	191	28.62	77	SNP	1.000	A
SFMBT1	51460	genome.wustl.edu	37	3	52947576	52947576	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr3:52947576G>T	ENST00000394752.3	-	15	1920	c.1538C>A	c.(1537-1539)tCa>tAa	p.S513*	SFMBT1_ENST00000296295.6_Nonsense_Mutation_p.S513*|SFMBT1_ENST00000358080.2_Nonsense_Mutation_p.S513*|SFMBT1_ENST00000394750.1_Nonsense_Mutation_p.S513*	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	513					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)	p.S513*(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		ATATGGCCCTGAGAAGCAACG	0.403																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											126.0	121.0	123.0					3																	52947576		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.1538C>A	3.37:g.52947576G>T	ENSP00000378235:p.Ser513*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q402F7|Q96C73|Q9Y4Q9	Nonsense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.S513*	ENST00000394752.3	37	c.1538	CCDS2867.1	3	.	.	.	.	.	.	.	.	.	.	G	43	10.022604	0.99319	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.8467	0.92210	0.0:0.0:1.0:0.0	.	.	.	.	X	513	.	ENSP00000296295:S513X	S	-	2	0	SFMBT1	52922616	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.563000	0.98148	2.691000	0.91804	0.462000	0.41574	TCA	SFMBT1	-	pfam_DUF3588	ENSG00000163935		0.403	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT1	HGNC	protein_coding	OTTHUMT00000353040.3	75	0.00	0	G	NM_016329		52947576	52947576	-1	no_errors	ENST00000358080	ensembl	human	known	69_37n	nonsense	85	32.54	41	SNP	1.000	T
SIRT3	23410	genome.wustl.edu	37	11	223832	223832	+	Intron	SNP	C	C	A	rs144507767	byFrequency	TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:223832C>A	ENST00000382743.4	-	5	1072				SIRT3_ENST00000524564.1_Intron|SIRT3_ENST00000528702.1_5'Flank|SIRT3_ENST00000529382.1_Intron|SIRT3_ENST00000525319.1_Intron|SIRT3_ENST00000532956.1_Intron	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3						aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		TGCCCTCCAGCCTCCTCCCTG	0.647													C|||	1223	0.244209	0.0234	0.3069	5008	,	,		10951	0.5089		0.2396	False		,,,				2504	0.2301					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.969+245G>T	11.37:g.223832C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5U6|Q9Y6E8	Missense_Mutation	SNP	pfam_NAD-dep_deAcase_sirtuin,pfscan_NAD-dep_deAcase_sirtuin	p.R109S	ENST00000382743.4	37	c.327	CCDS7691.1	11																																																																																			SIRT3	-	pfscan_NAD-dep_deAcase_sirtuin	ENSG00000142082		0.647	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	HGNC	protein_coding	OTTHUMT00000239288.3	10	0.00	0	C			223832	223832	-1	no_errors	ENST00000529937	ensembl	human	known	69_37n	missense	24	21.88	7	SNP	0.000	A
SLC34A1	6569	genome.wustl.edu	37	5	176821143	176821143	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr5:176821143A>C	ENST00000324417.5	+	10	1212	c.1121A>C	c.(1120-1122)aAc>aCc	p.N374T	SLC34A1_ENST00000513614.1_Intron	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	374					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGATGCTCAACTCCCTGCTC	0.607																																						dbGAP											0													185.0	177.0	180.0					5																	176821143		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1121A>C	5.37:g.176821143A>C	ENSP00000321424:p.Asn374Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPE3	Missense_Mutation	SNP	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt	p.N374T	ENST00000324417.5	37	c.1121	CCDS4418.1	5	.	.	.	.	.	.	.	.	.	.	A	21.2	4.114889	0.77210	.	.	ENSG00000131183	ENST00000324417	D	0.85339	-1.97	5.34	4.19	0.49359	.	0.000000	0.85682	D	0.000000	D	0.88209	0.6375	L	0.59912	1.85	0.46279	D	0.998965	P	0.50272	0.933	P	0.58391	0.838	D	0.87062	0.2154	10	0.51188	T	0.08	-29.2019	10.9191	0.47154	0.9261:0.0:0.0739:0.0	.	374	Q06495	NPT2A_HUMAN	T	374	ENSP00000321424:N374T	ENSP00000321424:N374T	N	+	2	0	SLC34A1	176753749	1.000000	0.71417	0.991000	0.47740	0.971000	0.66376	7.407000	0.80029	0.875000	0.35847	0.379000	0.24179	AAC	SLC34A1	-	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt	ENSG00000131183		0.607	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A1	HGNC	protein_coding	OTTHUMT00000253431.1	40	0.00	0	A	NM_003052		176821143	176821143	+1	no_errors	ENST00000324417	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	1.000	C
SLCO1A2	6579	genome.wustl.edu	37	12	21453307	21453307	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr12:21453307C>T	ENST00000307378.6	-	9	1605	c.885G>A	c.(883-885)aaG>aaA	p.K295K	SLCO1A2_ENST00000390670.3_Silent_p.K293K|SLCO1A2_ENST00000537524.1_Silent_p.K163K|SLCO1A2_ENST00000452078.1_Silent_p.K295K|SLCO1A2_ENST00000458504.1_Silent_p.K163K	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	295					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.K295K(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	ATTTTTCCTTCTTGACCTCTT	0.294																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											91.0	93.0	92.0					12																	21453307		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.885G>A	12.37:g.21453307C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UGP7|Q9UL38	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.K295	ENST00000307378.6	37	c.885	CCDS8686.1	12																																																																																			SLCO1A2	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000084453		0.294	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1A2	HGNC	protein_coding	OTTHUMT00000343648.3	138	0.00	0	C	NM_021094		21453307	21453307	-1	no_errors	ENST00000307378	ensembl	human	known	69_37n	silent	156	22.77	46	SNP	0.013	T
SNTG1	54212	genome.wustl.edu	37	8	51569549	51569549	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr8:51569549G>A	ENST00000522124.1	+	14	1591	c.930G>A	c.(928-930)ctG>ctA	p.L310L	SNTG1_ENST00000276467.5_Silent_p.L310L|SNTG1_ENST00000517473.1_Silent_p.L310L|SNTG1_ENST00000518864.1_Silent_p.L310L	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	310	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.L310L(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TCCTGGCCCTGAGGGGCTCAT	0.483																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											102.0	95.0	98.0					8																	51569549		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.930G>A	8.37:g.51569549G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.E84K	ENST00000522124.1	37	c.250	CCDS6147.1	8																																																																																			SNTG1	-	NULL	ENSG00000147481		0.483	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	78	0.00	0	G			51569549	51569549	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524004	ensembl	human	known	69_37n	missense	175	34.81	94	SNP	0.743	A
SRRT	51593	genome.wustl.edu	37	7	100485916	100485916	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr7:100485916C>T	ENST00000347433.4	+	19	2625	c.2467C>T	c.(2467-2469)Cca>Tca	p.P823S	SRRT_ENST00000388793.4_Missense_Mutation_p.P822S|SRRT_ENST00000457580.2_Missense_Mutation_p.P819S|SRRT_ENST00000432932.1_Missense_Mutation_p.P818S			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	823	Pro-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.P823S(1)		breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AGGAGGCCCTCCATACCCCCA	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	66.0	65.0					7																	100485916		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2467C>T	7.37:g.100485916C>T	ENSP00000314491:p.Pro823Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.P822S	ENST00000347433.4	37	c.2464	CCDS34709.1	7	.	.	.	.	.	.	.	.	.	.	C	9.976	1.226682	0.22542	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000448764	.	.	.	4.41	4.41	0.53225	Arsenite-resistance protein 2 (1);	0.122950	0.56097	D	0.000034	T	0.43942	0.1270	L	0.46741	1.465	0.45015	D	0.998038	B;P;B;P	0.41450	0.386;0.75;0.426;0.481	B;B;B;B	0.36335	0.125;0.222;0.098;0.157	T	0.42120	-0.9470	9	0.31617	T	0.26	.	14.5209	0.67849	0.0:1.0:0.0:0.0	.	822;818;819;823	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	S	819;822;818;823;446	.	ENSP00000314491:P823S	P	+	1	0	SRRT	100323852	1.000000	0.71417	0.986000	0.45419	0.609000	0.37215	5.049000	0.64244	2.282000	0.76494	0.484000	0.47621	CCA	SRRT	-	pfam_Arsenite-R_2	ENSG00000087087		0.557	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	49	0.00	0	C	NM_015908		100485916	100485916	+1	no_errors	ENST00000388793	ensembl	human	known	69_37n	missense	51	47.42	46	SNP	0.999	T
STARD3	10948	genome.wustl.edu	37	17	37818592	37818595	+	Frame_Shift_Del	DEL	CTCA	CTCA	-			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	CTCA	CTCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr17:37818592_37818595delCTCA	ENST00000336308.5	+	14	1446_1449	c.1228_1231delCTCA	c.(1228-1233)ctcaagfs	p.LK410fs	STARD3_ENST00000394250.4_Frame_Shift_Del_p.LK392fs|TCAP_ENST00000309889.2_5'Flank|STARD3_ENST00000580611.1_Frame_Shift_Del_p.LK384fs|STARD3_ENST00000544210.2_Frame_Shift_Del_p.LK410fs	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	410	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TAATACAGATCTCAAGGTGGGGTG	0.583																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.1228_1231delCTCA	17.37:g.37818592_37818595delCTCA	ENSP00000337446:p.Leu410fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Frame_Shift_Del	DEL	pfam_MENTAL,pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	p.L410fs	ENST00000336308.5	37	c.1228_1231	CCDS11341.1	17																																																																																			STARD3	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	ENSG00000131748		0.583	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	HGNC	protein_coding	OTTHUMT00000256933.1	13	0.00	0	CTCA			37818592	37818595	+1	no_errors	ENST00000336308	ensembl	human	known	69_37n	frame_shift_del	5	69.72	76	DEL	1.000:1.000:1.000:1.000	-
STARD3	10948	genome.wustl.edu	37	17	37818596	37818597	+	Splice_Site	INS	-	-	GT			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr17:37818596_37818597insGT	ENST00000336308.5	+	14	1450_1451	c.1232_1233insGT	c.(1231-1236)aagggc>aaGTgggc	p.G412fs	STARD3_ENST00000394250.4_Splice_Site_p.G394fs|TCAP_ENST00000309889.2_5'Flank|STARD3_ENST00000580611.1_Frame_Shift_Ins_p.V386fs|STARD3_ENST00000544210.2_Splice_Site_p.G412fs	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	412	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACAGATCTCAAGGTGGGGTGCT	0.584																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.1233+1->GT	17.37:g.37818596_37818597insGT		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Frame_Shift_Ins	INS	pfam_MENTAL,pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	p.G412fs	ENST00000336308.5	37	c.1232_1233	CCDS11341.1	17																																																																																			STARD3	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	ENSG00000131748		0.584	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	HGNC	protein_coding	OTTHUMT00000256933.1	11	0.00	0	-		Frame_Shift_Ins	37818596	37818597	+1	no_errors	ENST00000336308	ensembl	human	known	69_37n	frame_shift_ins	13	85.23	75	INS	1.000:1.000	GT
STON2	85439	genome.wustl.edu	37	14	81743560	81743560	+	Frame_Shift_Del	DEL	C	C	-	rs535388753		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr14:81743560delC	ENST00000267540.2	-	4	2295	c.2095delG	c.(2095-2097)gcafs	p.A699fs	STON2_ENST00000556280.1_5'Flank|STON2_ENST00000555447.1_Frame_Shift_Del_p.A699fs	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	699	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TCCACCTCTGCCCCATTGACA	0.552																																						dbGAP											0													116.0	114.0	115.0					14																	81743560		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2095delG	14.37:g.81743560delC	ENSP00000267540:p.Ala699fs	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Frame_Shift_Del	DEL	pfam_Stonin2_N,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C,pfscan_SHD	p.A699fs	ENST00000267540.2	37	c.2095	CCDS9875.1	14																																																																																			STON2	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C	ENSG00000140022		0.552	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STON2	HGNC	protein_coding	OTTHUMT00000413317.1	133	0.00	0	C	NM_033104		81743560	81743560	-1	no_errors	ENST00000267540	ensembl	human	known	69_37n	frame_shift_del	125	30.00	54	DEL	1.000	-
SYNE1	23345	genome.wustl.edu	37	6	152453309	152453309	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:152453309G>C	ENST00000367255.5	-	144	26643	c.26042C>G	c.(26041-26043)tCa>tGa	p.S8681*	SYNE1_ENST00000539504.1_Nonsense_Mutation_p.S836*|SYNE1_ENST00000356820.4_Nonsense_Mutation_p.S3205*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.S8293*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.S8633*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.S8681*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.S8633*|SYNE1_ENST00000354674.4_Nonsense_Mutation_p.S859*|SYNE1_ENST00000347037.5_5'UTR	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8681	Ser-rich.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S8681*(2)|p.S8633*(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CACAGACCCTGAGGTGTCCAG	0.507										HNSCC(10;0.0054)																												dbGAP											3	Substitution - Nonsense(3)	breast(3)											179.0	157.0	164.0					6																	152453309		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.26042C>G	6.37:g.152453309G>C	ENSP00000356224:p.Ser8681*	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S8681*	ENST00000367255.5	37	c.26042	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	52	19.448166	0.99919	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	.	.	.	5.75	5.75	0.90469	.	0.000000	0.42548	D	0.000683	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	19.9447	0.97177	0.0:0.0:1.0:0.0	.	.	.	.	X	8681;836;1327;8633;8681;8633;8293;3205;866;861;1626;859	.	ENSP00000265368:S8681X	S	-	2	0	SYNE1	152495002	1.000000	0.71417	0.960000	0.40013	0.979000	0.70002	9.230000	0.95299	2.719000	0.93026	0.655000	0.94253	TCA	SYNE1	-	NULL	ENSG00000131018		0.507	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	176	0.00	0	G	NM_182961		152453309	152453309	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	nonsense	199	27.11	74	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152454417	152454417	+	Silent	SNP	A	A	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr6:152454417A>G	ENST00000367255.5	-	143	26596	c.25995T>C	c.(25993-25995)agT>agC	p.S8665S	SYNE1_ENST00000539504.1_Silent_p.S820S|SYNE1_ENST00000356820.4_Silent_p.S3189S|SYNE1_ENST00000341594.5_Silent_p.S8277S|SYNE1_ENST00000448038.1_Silent_p.S8617S|SYNE1_ENST00000265368.4_Silent_p.S8665S|SYNE1_ENST00000423061.1_Silent_p.S8617S|SYNE1_ENST00000354674.4_Silent_p.S843S|SYNE1_ENST00000347037.5_5'UTR	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8665	Ser-rich.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S8665S(2)|p.S8617S(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTACCTGCTGACTACTTGACA	0.373										HNSCC(10;0.0054)																												dbGAP											3	Substitution - coding silent(3)	breast(3)											181.0	159.0	166.0					6																	152454417		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.25995T>C	6.37:g.152454417A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S8665	ENST00000367255.5	37	c.25995	CCDS5236.2	6																																																																																			SYNE1	-	NULL	ENSG00000131018		0.373	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	272	0.00	0	A	NM_182961		152454417	152454417	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	317	26.11	112	SNP	1.000	G
TIFA	92610	genome.wustl.edu	37	4	113199522	113199522	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr4:113199522C>G	ENST00000361717.3	-	2	332	c.51G>C	c.(49-51)caG>caC	p.Q17H	TIFA_ENST00000500655.2_Missense_Mutation_p.Q17H	NM_052864.2	NP_443096.1	Q96CG3	TIFA_HUMAN	TRAF-interacting protein with forkhead-associated domain	17					I-kappaB kinase/NF-kappaB signaling (GO:0007249)			p.Q17H(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)	6		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00172)		AAACCGTCATCTGGAGACAAG	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	86.0	85.0					4																	113199522		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC008294	CCDS34051.1	4q25	2008-03-17				ENSG00000145365			19075	protein-coding gene	gene with protein product	"""TRAF2 binding protein"", ""TRAF6 binding protein"""	609028				1179819	Standard	NM_052864		Approved	MGC20791, T2BP, T6BP, TIFAA	uc003ial.3	Q96CG3		ENST00000361717.3:c.51G>C	4.37:g.113199522C>G	ENSP00000354911:p.Gln17His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,pfscan_FHA_dom	p.Q17H	ENST00000361717.3	37	c.51	CCDS34051.1	4	.	.	.	.	.	.	.	.	.	.	C	6.129	0.392024	0.11581	.	.	ENSG00000145365	ENST00000361717;ENST00000438746;ENST00000500655	T;T	0.44881	0.91;0.91	5.92	1.97	0.26223	.	0.514945	0.22775	N	0.055789	T	0.24084	0.0583	L	0.37897	1.145	0.27670	N	0.946805	B	0.02656	0.0	B	0.01281	0.0	T	0.11665	-1.0578	10	0.10111	T	0.7	-12.3424	4.5714	0.12212	0.209:0.295:0.4198:0.0762	.	17	Q96CG3	TIFA_HUMAN	H	17	ENSP00000354911:Q17H;ENSP00000424231:Q17H	ENSP00000354911:Q17H	Q	-	3	2	TIFA	113418971	0.642000	0.27260	0.997000	0.53966	0.977000	0.68977	-0.099000	0.11007	1.501000	0.48654	0.650000	0.86243	CAG	TIFA	-	superfamily_SMAD_FHA_domain	ENSG00000145365		0.428	TIFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIFA	HGNC	protein_coding	OTTHUMT00000363647.2	280	0.00	0	C	NM_052864		113199522	113199522	-1	no_errors	ENST00000361717	ensembl	human	known	69_37n	missense	236	24.60	77	SNP	0.849	G
TIGD6	81789	genome.wustl.edu	37	5	149375540	149375540	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr5:149375540C>T	ENST00000296736.3	-	2	1146	c.372G>A	c.(370-372)ctG>ctA	p.L124L	TIGD6_ENST00000515406.2_Silent_p.L124L	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	124	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L124L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TAAATCTGTTCAGCCAGCCCA	0.403																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											146.0	148.0	147.0					5																	149375540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.372G>A	5.37:g.149375540C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTZ8|Q96MQ4|Q9H0X7	Silent	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.L124	ENST00000296736.3	37	c.372	CCDS4301.1	5																																																																																			TIGD6	-	pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom	ENSG00000164296		0.403	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD6	HGNC	protein_coding	OTTHUMT00000252324.1	145	0.00	0	C	NM_030953		149375540	149375540	-1	no_errors	ENST00000296736	ensembl	human	known	69_37n	silent	260	31.22	118	SNP	0.984	T
TMEM50B	757	genome.wustl.edu	37	21	34832793	34832793	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr21:34832793G>A	ENST00000542230.2	-	5	514	c.300C>T	c.(298-300)ttC>ttT	p.F100F		NM_006134.6	NP_006125.2	P56557	TM50B_HUMAN	transmembrane protein 50B	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F100F(1)		breast(1)|kidney(1)|ovary(1)|skin(1)	4						TGAAACCAATGAAAAGCCAAA	0.363																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											81.0	74.0	77.0					21																	34832793		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF045606	CCDS13625.1	21q22.1	2008-07-29	2005-06-02	2005-06-02	ENSG00000142188	ENSG00000142188			1280	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 4"""	C21orf4			Standard	NR_040016		Approved		uc002yrs.2	P56557	OTTHUMG00000065286	ENST00000542230.2:c.300C>T	21.37:g.34832793G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4L4|D3DSF1|O60537|Q5PY47	Missense_Mutation	SNP	NULL	p.S40L	ENST00000542230.2	37	c.119	CCDS13625.1	21																																																																																			TMEM50B	-	NULL	ENSG00000142188		0.363	TMEM50B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM50B	HGNC	protein_coding	OTTHUMT00000140080.5	132	0.00	0	G			34832793	34832793	-1	no_errors	ENST00000441128	ensembl	human	known	69_37n	missense	149	28.02	58	SNP	1.000	A
TNKS1BP1	85456	genome.wustl.edu	37	11	57088085	57088085	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:57088085G>A	ENST00000532437.1	-	2	507	c.196C>T	c.(196-198)Cgg>Tgg	p.R66W	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.R66W			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	66	Arg/Glu/Lys/Pro-rich (charged).				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.R66W(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CGGGGAGGCCGAGGCCCAACA	0.672																																						dbGAP											1	Substitution - Missense(1)	breast(1)											15.0	19.0	18.0					11																	57088085		2197	4289	6486	-	-	-	SO:0001583	missense	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.196C>T	11.37:g.57088085G>A	ENSP00000437271:p.Arg66Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	NULL	p.R66W	ENST00000532437.1	37	c.196	CCDS7951.1	11	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835595	0.71373	.	.	ENSG00000149115	ENST00000358252;ENST00000532437;ENST00000527207	T;T	0.40225	1.04;1.04	4.58	3.59	0.41128	.	0.000000	0.36234	N	0.002708	T	0.48277	0.1491	N	0.24115	0.695	0.27634	N	0.947923	D	0.89917	1.0	D	0.85130	0.997	T	0.36720	-0.9736	10	0.56958	D	0.05	-18.2842	13.0209	0.58787	0.0:0.0:0.828:0.172	.	66	Q9C0C2	TB182_HUMAN	W	66	ENSP00000350990:R66W;ENSP00000437271:R66W	ENSP00000350990:R66W	R	-	1	2	TNKS1BP1	56844661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.832000	0.55783	2.347000	0.79759	0.563000	0.77884	CGG	TNKS1BP1	-	NULL	ENSG00000149115		0.672	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1	15	0.00	0	G	NM_033396		57088085	57088085	-1	no_errors	ENST00000358252	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.952	A
TP53BP1	7158	genome.wustl.edu	37	15	43724569	43724569	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr15:43724569C>G	ENST00000263801.3	-	17	3735	c.3483G>C	c.(3481-3483)ttG>ttC	p.L1161F	TP53BP1_ENST00000450115.2_Missense_Mutation_p.L1166F|TP53BP1_ENST00000382039.3_Missense_Mutation_p.L1166F|TP53BP1_ENST00000382044.4_Missense_Mutation_p.L1166F	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1161					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.L1161F(1)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTGGGACCCTCAAGGAACACT	0.453								Other conserved DNA damage response genes																														dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	105.0	110.0					15																	43724569		2201	4298	6499	-	-	-	SO:0001583	missense	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3483G>C	15.37:g.43724569C>G	ENSP00000263801:p.Leu1161Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.L1166F	ENST00000263801.3	37	c.3498	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	C	3.343	-0.134281	0.06711	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.04603	3.59;3.59;3.59;3.61	4.79	-9.58	0.00559	.	0.472269	0.19600	N	0.110420	T	0.05410	0.0143	L	0.56769	1.78	0.09310	N	1	D;D;D;D	0.60575	0.988;0.963;0.978;0.978	P;B;P;P	0.55222	0.771;0.42;0.624;0.624	T	0.08722	-1.0708	10	0.11794	T	0.64	-1.9308	2.7646	0.05316	0.1876:0.1264:0.153:0.5331	.	1166;1161;1166;1166	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	F	1161;1166;1166;1166	ENSP00000263801:L1161F;ENSP00000371475:L1166F;ENSP00000371470:L1166F;ENSP00000393497:L1166F	ENSP00000263801:L1161F	L	-	3	2	TP53BP1	41511861	0.000000	0.05858	0.000000	0.03702	0.188000	0.23474	-2.624000	0.00876	-3.167000	0.00226	-0.312000	0.09012	TTG	TP53BP1	-	NULL	ENSG00000067369		0.453	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	178	0.56	1	C			43724569	43724569	-1	no_errors	ENST00000382044	ensembl	human	known	69_37n	missense	223	30.09	96	SNP	0.000	G
TP73	7161	genome.wustl.edu	37	1	3624237	3624237	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:3624237C>T	ENST00000378295.4	+	4	466	c.311C>T	c.(310-312)tCc>tTc	p.S104F	TP73_ENST00000378288.4_Missense_Mutation_p.S55F|TP73_ENST00000603362.1_Missense_Mutation_p.S104F|TP73_ENST00000378285.1_Missense_Mutation_p.S55F|TP73_ENST00000604479.1_Missense_Mutation_p.S104F|TP73_ENST00000378290.4_Missense_Mutation_p.S33F|TP73_ENST00000604074.1_Missense_Mutation_p.S104F|TP73_ENST00000346387.4_Missense_Mutation_p.S104F|TP73_ENST00000378280.1_Missense_Mutation_p.S55F|TP73_ENST00000357733.3_Missense_Mutation_p.S104F|TP73_ENST00000354437.4_Missense_Mutation_p.S104F	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	104					activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S104F(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		CAACCCAGCTCCACCTTCGAC	0.677																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	71.0	71.0					1																	3624237		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.311C>T	1.37:g.3624237C>T	ENSP00000367545:p.Ser104Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.S104F	ENST00000378295.4	37	c.311	CCDS49.1	1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379019	0.82682	.	.	ENSG00000078900	ENST00000378295;ENST00000354437;ENST00000357733;ENST00000346387;ENST00000378288;ENST00000378285;ENST00000378280;ENST00000378290	D;D;D;D;D;D;D;D	0.99519	-5.92;-6.07;-5.77;-5.85;-5.89;-6.02;-5.99;-5.87	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	D	0.99321	0.9762	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;0.999;1.0;0.999	D;D;D;D;D;D;D	0.97110	0.997;0.998;0.999;0.999;0.999;1.0;0.998	D	0.99107	1.0845	10	0.72032	D	0.01	-34.7465	16.3935	0.83548	0.0:1.0:0.0:0.0	.	55;33;55;55;55;104;104	B7Z8Z1;B7Z7J4;O15350-10;O15350-9;O15350-8;O15350-2;O15350	.;.;.;.;.;.;P73_HUMAN	F	104;104;104;104;55;55;55;33	ENSP00000367545:S104F;ENSP00000346423:S104F;ENSP00000350366:S104F;ENSP00000340740:S104F;ENSP00000367537:S55F;ENSP00000367534:S55F;ENSP00000367529:S55F;ENSP00000367539:S33F	ENSP00000340740:S104F	S	+	2	0	TP73	3614097	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.671000	0.83941	2.096000	0.63516	0.491000	0.48974	TCC	TP73	-	NULL	ENSG00000078900		0.677	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP73	HGNC	protein_coding	OTTHUMT00000001468.4	13	0.00	0	C	NM_005427		3624237	3624237	+1	no_errors	ENST00000378295	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	T
TRNAU1AP	54952	genome.wustl.edu	37	1	28880170	28880170	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:28880170G>T	ENST00000373830.3	+	2	72	c.46G>T	c.(46-48)Gag>Tag	p.E16*	TRNAU1AP_ENST00000495995.1_3'UTR	NM_017846.4	NP_060316.1	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine 1 associated protein 1	16	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				selenocysteine incorporation (GO:0001514)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E16*(1)		breast(1)|endometrium(2)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	8						CTACATGGATGAGAACTTCAT	0.582																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											78.0	65.0	69.0					1																	28880170		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS324.1	1p35.3	2013-02-12	2008-09-05	2008-09-05	ENSG00000180098	ENSG00000180098		"""RNA binding motif (RRM) containing"""	30813	protein-coding gene	gene with protein product			"""tRNA selenocysteine associated protein 1"""	TRSPAP1		10606267, 16230358	Standard	NM_017846		Approved	SECP43, FLJ20503	uc001bqi.3	Q9NX07	OTTHUMG00000003653	ENST00000373830.3:c.46G>T	1.37:g.28880170G>T	ENSP00000362936:p.Glu16*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SU7	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E16*	ENST00000373830.3	37	c.46	CCDS324.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.106367	0.94292	.	.	ENSG00000180098	ENST00000373830	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.3442	0.83117	0.0:0.0:1.0:0.0	.	.	.	.	X	16	.	ENSP00000362936:E16X	E	+	1	0	TRNAU1AP	28752757	1.000000	0.71417	1.000000	0.80357	0.362000	0.29581	7.449000	0.80643	2.633000	0.89246	0.632000	0.83419	GAG	TRNAU1AP	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000180098		0.582	TRNAU1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNAU1AP	HGNC	protein_coding	OTTHUMT00000010346.1	48	0.00	0	G	NM_017846		28880170	28880170	+1	no_errors	ENST00000373830	ensembl	human	known	69_37n	nonsense	101	31.76	47	SNP	1.000	T
TSSC2	650368	genome.wustl.edu	37	11	3430189	3430189	+	RNA	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr11:3430189G>A	ENST00000529482.1	+	0	2318									tumor suppressing subtransferable candidate 2 pseudogene																		CCTGGTGAATGAATTGGTTCT	0.532																																						dbGAP											0																																										-	-	-			0					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3430189G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000529482.1	37	NULL		11																																																																																			TSSC2	-	-	ENSG00000223756		0.532	TSSC2-003	KNOWN	basic	processed_transcript	TSSC2	HGNC	pseudogene	OTTHUMT00000392020.1	18	0.00	0	G			3430189	3430189	+1	no_errors	ENST00000529482	ensembl	human	known	69_37n	rna	23	37.84	14	SNP	0.001	A
TTN	7273	genome.wustl.edu	37	2	179467114	179467114	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr2:179467114G>C	ENST00000591111.1	-	233	50316	c.50092C>G	c.(50092-50094)Ctg>Gtg	p.L16698V	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L18339V|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L9466V|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L15771V|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L9399V|TTN_ENST00000460472.2_Missense_Mutation_p.L9274V			Q8WZ42	TITIN_HUMAN	titin	16698	Fibronectin type-III 21. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L15771V(2)|p.L9466V(1)|p.L9399V(1)|p.L9274V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTCTTTCAGATTAGGCACC	0.413																																						dbGAP											5	Substitution - Missense(5)	breast(5)											145.0	143.0	143.0					2																	179467114		1894	4110	6004	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50092C>G	2.37:g.179467114G>C	ENSP00000465570:p.Leu16698Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L15771V	ENST00000591111.1	37	c.47311		2	.	.	.	.	.	.	.	.	.	.	G	9.717	1.158623	0.21454	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	5.62	2.25	0.28309	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91181	0.7222	M	0.82193	2.58	0.45318	D	0.998316	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.90189	0.4248	9	0.87932	D	0	.	9.1722	0.37089	0.3724:0.0:0.6276:0.0	.	9274;9399;9466;16698	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	15771;9274;9466;9399;9274	ENSP00000343764:L15771V;ENSP00000434586:L9274V;ENSP00000340554:L9466V;ENSP00000352154:L9399V	ENSP00000340554:L9466V	L	-	1	2	TTN	179175359	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	2.161000	0.42358	0.615000	0.30124	0.650000	0.86243	CTG	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	117	0.00	0	G	NM_133378		179467114	179467114	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	185	24.49	60	SNP	1.000	C
TUBB8	347688	genome.wustl.edu	37	10	93505	93505	+	Missense_Mutation	SNP	C	C	T	rs147114528	byFrequency	TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:93505C>T	ENST00000309812.4	-	4	889	c.827G>A	c.(826-828)cGg>cAg	p.R276Q	TUBB8_ENST00000413237.3_5'Flank|TUBB8_ENST00000447903.2_Missense_Mutation_p.R204Q|TUBB8_ENST00000332708.5_3'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	276					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R276Q(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CTGGCTGCCCCGGCTGGTCAG	0.627																																					Pancreas(192;2041 3010 9013 18103)	dbGAP											1	Substitution - Missense(1)	NS(1)											21.0	26.0	24.0					10																	93505		1645	3246	4891	-	-	-	SO:0001583	missense	0			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.827G>A	10.37:g.93505C>T	ENSP00000311042:p.Arg276Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.R276Q	ENST00000309812.4	37	c.827	CCDS7051.1	10	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301072	0.23650	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.80994	-1.44	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.094074	0.38326	N	0.001737	T	0.77046	0.4073	M	0.66560	2.04	0.28122	N	0.930544	B;P	0.44776	0.06;0.843	B;P	0.45167	0.009;0.472	T	0.71020	-0.4713	9	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	239;276	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	Q	204;242;239;276	ENSP00000403895:R204Q	ENSP00000272035:R242Q	R	-	2	0	RP11-631M21.2	83505	0.994000	0.37717	0.219000	0.23793	0.222000	0.24845	3.707000	0.54838	0.119000	0.18210	0.121000	0.15741	CGG	TUBB8	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Alpha_tubulin	ENSG00000173876		0.627	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	117	0.00	0	C	NM_177987		93505	93505	-1	no_errors	ENST00000328974	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
UBASH3A	53347	genome.wustl.edu	37	21	43862566	43862566	+	Silent	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr21:43862566C>G	ENST00000319294.6	+	12	1522	c.1491C>G	c.(1489-1491)ctC>ctG	p.L497L	UBASH3A_ENST00000291535.6_Silent_p.L459L|UBASH3A_ENST00000398367.1_Silent_p.L459L	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	497	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.L497L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						ATCCAGAACTCAAACTGGAGA	0.428																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											105.0	107.0	106.0					21																	43862566		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1491C>G	21.37:g.43862566C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Silent	SNP	pfam_His_Pase_superF_clade-1,pfam_SH3_domain,superfamily_SH3_domain,superfamily_UBA-like,smart_SH3_domain,pfscan_SH3_domain,pfscan_UBA/transl_elong_EF1B_N_euk	p.L497	ENST00000319294.6	37	c.1491	CCDS13687.1	21																																																																																			UBASH3A	-	pfam_His_Pase_superF_clade-1	ENSG00000160185		0.428	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	UBASH3A	HGNC	protein_coding	OTTHUMT00000195382.1	219	0.00	0	C	NM_001001895		43862566	43862566	+1	no_errors	ENST00000319294	ensembl	human	known	69_37n	silent	426	28.28	168	SNP	1.000	G
UBR4	23352	genome.wustl.edu	37	1	19430614	19430614	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:19430614C>T	ENST00000375254.3	-	87	12892	c.12865G>A	c.(12865-12867)Gac>Aac	p.D4289N	UBR4_ENST00000375267.2_Missense_Mutation_p.D4289N|UBR4_ENST00000375226.2_Missense_Mutation_p.D4265N|UBR4_ENST00000543981.1_5'Flank|UBR4_ENST00000375224.1_5'UTR|UBR4_ENST00000375217.2_Missense_Mutation_p.D4282N	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	4289					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D4289N(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGCAGCATGTCCTGCGTCTCA	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											148.0	118.0	128.0					1																	19430614		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.12865G>A	1.37:g.19430614C>T	ENSP00000364403:p.Asp4289Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.D4289N	ENST00000375254.3	37	c.12865	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739883	0.89573	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.08	4.17	0.49024	.	0.165843	0.52532	N	0.000072	T	0.47838	0.1467	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46762	-0.9168	10	0.56958	D	0.05	.	10.8246	0.46625	0.0:0.9116:0.0:0.0884	.	4289	Q5T4S7	UBR4_HUMAN	N	4289;4289;4282;4265	ENSP00000364403:D4289N;ENSP00000364416:D4289N;ENSP00000364365:D4282N;ENSP00000364374:D4265N	ENSP00000364365:D4282N	D	-	1	0	UBR4	19303201	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.579000	0.67457	1.512000	0.48834	0.655000	0.94253	GAC	UBR4	-	NULL	ENSG00000127481		0.562	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	189	0.00	0	C	NM_020765		19430614	19430614	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	315	15.55	58	SNP	1.000	T
VCP	7415	genome.wustl.edu	37	9	35065250	35065250	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr9:35065250C>G	ENST00000358901.6	-	5	1469	c.574G>C	c.(574-576)Gag>Cag	p.E192Q		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	192					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)	p.E192Q(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AAACTCACCTCTCGTTTGATA	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											116.0	102.0	107.0					9																	35065250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.574G>C	9.37:g.35065250C>G	ENSP00000351777:p.Glu192Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase,tigrfam_ATPase_AAA_CDC48	p.E192Q	ENST00000358901.6	37	c.574	CCDS6573.1	9	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496106	0.85069	.	.	ENSG00000165280	ENST00000358901;ENST00000448530	D;D	0.97303	-4.33;-4.33	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.96393	0.8823	L	0.42245	1.32	0.80722	D	1	P	0.52577	0.954	P	0.47941	0.562	D	0.96084	0.9056	10	0.56958	D	0.05	-20.6129	20.6593	0.99626	0.0:1.0:0.0:0.0	.	192	P55072	TERA_HUMAN	Q	192;147	ENSP00000351777:E192Q;ENSP00000392088:E147Q	ENSP00000351777:E192Q	E	-	1	0	VCP	35055250	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.678000	0.84035	2.885000	0.99019	0.655000	0.94253	GAG	VCP	-	tigrfam_ATPase_AAA_CDC48	ENSG00000165280		0.517	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1	47	0.00	0	C	NM_007126		35065250	35065250	-1	no_errors	ENST00000358901	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	1.000	G
VSTM4	196740	genome.wustl.edu	37	10	50311891	50311891	+	Intron	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:50311891G>C	ENST00000332853.4	-	2	481				VSTM4_ENST00000298454.3_Missense_Mutation_p.P158A	NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P158A(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						CTCTCCACTGGATGGCTGGAG	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	66.0	69.0					10																	50311891		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.457+3747C>G	10.37:g.50311891G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNI6|Q96MX7	Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.P158A	ENST00000332853.4	37	c.472	CCDS31198.1	10	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.864688	0.00547	.	.	ENSG00000165633	ENST00000298454	T	0.15603	2.41	2.75	0.846	0.18955	.	.	.	.	.	T	0.05456	0.0144	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41980	-0.9478	8	0.05436	T	0.98	.	4.9122	0.13827	0.3019:0.0:0.6981:0.0	.	158	Q8IW00-2	.	A	158	ENSP00000298454:P158A	ENSP00000298454:P158A	P	-	1	0	VSTM4	49981897	0.002000	0.14202	0.031000	0.17742	0.139000	0.21198	0.413000	0.21148	0.221000	0.20879	0.467000	0.42956	CCA	VSTM4	-	NULL	ENSG00000165633		0.552	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM4	HGNC	protein_coding	OTTHUMT00000047966.2	52	0.00	0	G	NM_144984		50311891	50311891	-1	no_errors	ENST00000298454	ensembl	human	known	69_37n	missense	103	24.82	34	SNP	0.042	C
WDFY2	115825	genome.wustl.edu	37	13	52329500	52329500	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr13:52329500G>A	ENST00000298125.5	+	9	1018	c.838G>A	c.(838-840)Gaa>Aaa	p.E280K		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	280							metal ion binding (GO:0046872)	p.E280K(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		CAAGACCCCTGAATGGTTGGA	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											137.0	124.0	129.0					13																	52329500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.838G>A	13.37:g.52329500G>A	ENSP00000298125:p.Glu280Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL86|Q96CS1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_FYVE,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,smart_WD40_repeat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E280K	ENST00000298125.5	37	c.838	CCDS9429.1	13	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676797	0.88445	.	.	ENSG00000139668	ENST00000298125	T	0.64991	-0.13	5.59	5.59	0.84812	Zinc finger, RING/FYVE/PHD-type (1);WD40 repeat-like-containing domain (1);Zinc finger, FYVE-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.55561	0.1928	L	0.39467	1.215	0.80722	D	1	P	0.43169	0.8	B	0.43575	0.424	T	0.52837	-0.8522	10	0.06099	T	0.92	-19.5884	18.5983	0.91236	0.0:0.0:1.0:0.0	.	280	Q96P53	WDFY2_HUMAN	K	280	ENSP00000298125:E280K	ENSP00000298125:E280K	E	+	1	0	WDFY2	51227501	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.376000	0.73141	2.640000	0.89533	0.650000	0.86243	GAA	WDFY2	-	superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE	ENSG00000139668		0.458	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY2	HGNC	protein_coding	OTTHUMT00000045985.3	102	0.00	0	G	NM_052950		52329500	52329500	+1	no_errors	ENST00000298125	ensembl	human	known	69_37n	missense	73	51.97	79	SNP	1.000	A
WDR3	10885	genome.wustl.edu	37	1	118495209	118495209	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:118495209C>T	ENST00000349139.5	+	19	2122	c.2075C>T	c.(2074-2076)tCa>tTa	p.S692L		NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	692						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S692L(1)		breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TATGTTGTATCATCGTCCCAT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	100.0	100.0					1																	118495209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.2075C>T	1.37:g.118495209C>T	ENSP00000308179:p.Ser692Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S692L	ENST00000349139.5	37	c.2075	CCDS898.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.291509	0.95546	.	.	ENSG00000065183	ENST00000349139	T	0.72615	-0.67	6.06	6.06	0.98353	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.110725	0.64402	D	0.000005	T	0.78046	0.4222	M	0.92367	3.3	0.80722	D	1	P	0.50528	0.936	B	0.43867	0.434	D	0.84241	0.0472	10	0.87932	D	0	-10.0592	20.6397	0.99537	0.0:1.0:0.0:0.0	.	692	Q9UNX4	WDR3_HUMAN	L	692	ENSP00000308179:S692L	ENSP00000308179:S692L	S	+	2	0	WDR3	118296732	1.000000	0.71417	0.840000	0.33206	0.914000	0.54420	7.678000	0.84035	2.880000	0.98712	0.650000	0.86243	TCA	WDR3	-	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000065183		0.423	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	HGNC	protein_coding	OTTHUMT00000033720.2	197	0.00	0	C	NM_006784		118495209	118495209	+1	no_errors	ENST00000349139	ensembl	human	known	69_37n	missense	209	35.58	116	SNP	1.000	T
WNK3	65267	genome.wustl.edu	37	X	54263737	54263737	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chrX:54263737G>C	ENST00000375159.2	-	19	4261	c.4262C>G	c.(4261-4263)tCt>tGt	p.S1421C	WNK3_ENST00000354646.2_Missense_Mutation_p.S1421C|WNK3_ENST00000375169.3_Missense_Mutation_p.S1374C			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1421					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S1421C(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TGCGCTGAAAGATAAGAAGTT	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	75.0	79.0					X																	54263737		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4262C>G	X.37:g.54263737G>C	ENSP00000364301:p.Ser1421Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S1421C	ENST00000375159.2	37	c.4262	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699460	0.48307	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.71698	-0.59;-0.57;-0.57	5.33	4.45	0.53987	.	0.608532	0.15648	N	0.251537	T	0.66076	0.2753	N	0.24115	0.695	0.27675	N	0.946644	D;D	0.58268	0.982;0.97	P;P	0.54026	0.74;0.671	T	0.58216	-0.7675	10	0.54805	T	0.06	-1.0203	8.3158	0.32100	0.0887:0.1559:0.7555:0.0	.	1374;1421	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	C	1374;1421;1421	ENSP00000364312:S1374C;ENSP00000346667:S1421C;ENSP00000364301:S1421C	ENSP00000346667:S1421C	S	-	2	0	WNK3	54280462	0.938000	0.31826	0.718000	0.30602	0.986000	0.74619	3.518000	0.53451	0.993000	0.38866	0.600000	0.82982	TCT	WNK3	-	NULL	ENSG00000196632		0.398	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	146	0.00	0	G	NM_020922		54263737	54263737	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	missense	212	30.49	93	SNP	0.919	C
ZFAND4	93550	genome.wustl.edu	37	10	46122005	46122005	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr10:46122005C>T	ENST00000344646.5	-	7	1481	c.1266G>A	c.(1264-1266)gtG>gtA	p.V422V	ZFAND4_ENST00000374366.3_Silent_p.V348V|ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374371.2_Intron	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	422							zinc ion binding (GO:0008270)	p.V422V(1)									ACTCCAGATTCACTTTGCACG	0.473																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											116.0	116.0	116.0					10																	46122005		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.1266G>A	10.37:g.46122005C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8V4|B2RAX2|Q5VVY5	Silent	SNP	pfam_Ubiquitin,pfam_Znf_AN1,smart_Ubiquitin,smart_Znf_AN1,prints_Ubiquitin_subgr,pfscan_Znf_AN1,pfscan_Ubiquitin_supergroup	p.V422	ENST00000344646.5	37	c.1266	CCDS7214.1	10																																																																																			ZFAND4	-	NULL	ENSG00000172671		0.473	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND4	HGNC	protein_coding	OTTHUMT00000047790.1	270	0.00	0	C	NM_174890		46122005	46122005	-1	no_errors	ENST00000344646	ensembl	human	known	69_37n	silent	364	32.53	176	SNP	0.001	T
ZNF266	10781	genome.wustl.edu	37	19	9524014	9524014	+	Silent	SNP	G	G	A			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:9524014G>A	ENST00000592904.1	-	5	3663	c.1587C>T	c.(1585-1587)ttC>ttT	p.F529F	ZNF266_ENST00000592292.1_Silent_p.F529F|ZNF266_ENST00000588933.1_Silent_p.F529F|ZNF266_ENST00000361151.1_Silent_p.F529F|ZNF266_ENST00000588221.1_Silent_p.F529F|ZNF266_ENST00000590306.1_Silent_p.F529F|ZNF266_ENST00000361451.2_Silent_p.F529F			Q14584	ZN266_HUMAN	zinc finger protein 266	529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F529F(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						TGGAAGAACTGAAGGCTTTCC	0.448																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											90.0	80.0	83.0					19																	9524014		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1587C>T	19.37:g.9524014G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F529	ENST00000592904.1	37	c.1587	CCDS12213.1	19																																																																																			ZNF266	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000174652		0.448	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF266	HGNC	protein_coding	OTTHUMT00000449033.1	185	0.00	0	G			9524014	9524014	-1	no_errors	ENST00000361151	ensembl	human	known	69_37n	silent	144	32.71	70	SNP	0.099	A
ZNF266	10781	genome.wustl.edu	37	19	9524258	9524258	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:9524258G>T	ENST00000592904.1	-	5	3419	c.1343C>A	c.(1342-1344)tCc>tAc	p.S448Y	ZNF266_ENST00000592292.1_Missense_Mutation_p.S448Y|ZNF266_ENST00000588933.1_Missense_Mutation_p.S448Y|ZNF266_ENST00000361151.1_Missense_Mutation_p.S448Y|ZNF266_ENST00000588221.1_Missense_Mutation_p.S448Y|ZNF266_ENST00000590306.1_Missense_Mutation_p.S448Y|ZNF266_ENST00000361451.2_Missense_Mutation_p.S448Y			Q14584	ZN266_HUMAN	zinc finger protein 266	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S448Y(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						AAGACTGGAGGAATGCGTAAA	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	60.0	61.0					19																	9524258		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1343C>A	19.37:g.9524258G>T	ENSP00000466714:p.Ser448Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S448Y	ENST00000592904.1	37	c.1343	CCDS12213.1	19	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851671	0.51270	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.07908	3.15;3.15	2.14	-0.441	0.12257	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07143	0.0181	M	0.71871	2.18	0.09310	N	1	B	0.31485	0.325	B	0.21917	0.037	T	0.36212	-0.9757	9	0.25106	T	0.35	.	0.8869	0.01246	0.1546:0.2389:0.3635:0.243	.	448	Q14584	ZN266_HUMAN	Y	448	ENSP00000354680:S448Y;ENSP00000355047:S448Y	ENSP00000355047:S448Y	S	-	2	0	ZNF266	9385258	0.000000	0.05858	0.000000	0.03702	0.693000	0.40251	-1.240000	0.02914	-0.012000	0.14223	0.555000	0.69702	TCC	ZNF266	-	pfam_Znf_C2H2,smart_Znf_BED_prd,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000174652		0.423	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF266	HGNC	protein_coding	OTTHUMT00000449033.1	144	0.00	0	G			9524258	9524258	-1	no_errors	ENST00000361151	ensembl	human	known	69_37n	missense	145	33.18	72	SNP	0.000	T
ZNF276	92822	genome.wustl.edu	37	16	89789056	89789057	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr16:89789056_89789057insG	ENST00000443381.2	+	2	420_421	c.323_324insG	c.(322-327)gcagagfs	p.E109fs	ZNF276_ENST00000446326.2_5'UTR|ZNF276_ENST00000289816.5_Frame_Shift_Ins_p.E34fs|ZNF276_ENST00000568064.1_Frame_Shift_Ins_p.E34fs|VPS9D1_ENST00000389386.3_5'Flank	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	109	ZAD.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		AGGCCATCCGCAGAGGAGCGCG	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	Exception_encountered	16.37:g.89789056_89789057insG	ENSP00000415836:p.Glu109fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VGA1|Q2TBE8|Q3B7H7	Frame_Shift_Ins	INS	pfam_Znf_AD,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E109fs	ENST00000443381.2	37	c.323_324	CCDS45554.1	16																																																																																			ZNF276	-	pfam_Znf_AD	ENSG00000158805		0.653	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF276	HGNC	protein_coding	OTTHUMT00000422517.1	9	0.00	0	-	NM_152287		89789056	89789057	+1	no_errors	ENST00000443381	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.856:0.791	G
ZNF443	10224	genome.wustl.edu	37	19	12541839	12541839	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:12541839G>C	ENST00000301547.5	-	4	1344	c.1147C>G	c.(1147-1149)Cat>Gat	p.H383D	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	383					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H383D(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GTTCTTTCATGACTTTGCAGT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											173.0	163.0	166.0					19																	12541839		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1147C>G	19.37:g.12541839G>C	ENSP00000301547:p.His383Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H383D	ENST00000301547.5	37	c.1147	CCDS32918.1	19	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550128	0.45383	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	D	0.86769	-2.17	1.36	1.36	0.22044	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95392	0.8504	H	0.97940	4.11	0.23645	N	0.99721	D	0.89917	1.0	D	0.97110	1.0	D	0.86416	0.1751	9	0.87932	D	0	.	10.3641	0.44012	0.0:0.0:1.0:0.0	.	383	Q9Y2A4	ZN443_HUMAN	D	383	ENSP00000301547:H383D	ENSP00000301547:H383D	H	-	1	0	ZNF443	12402839	1.000000	0.71417	0.003000	0.11579	0.066000	0.16364	5.355000	0.66046	1.074000	0.40909	0.454000	0.30748	CAT	ZNF443	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180855		0.418	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF443	HGNC	protein_coding	OTTHUMT00000344084.1	590	0.00	0	G	NM_005815		12541839	12541839	-1	no_errors	ENST00000301547	ensembl	human	known	69_37n	missense	922	28.48	368	SNP	0.374	C
ZNF43	7594	genome.wustl.edu	37	19	21990459	21990459	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:21990459C>G	ENST00000354959.4	-	4	2549	c.2380G>C	c.(2380-2382)Gat>Cat	p.D794H	ZNF43_ENST00000595461.1_Missense_Mutation_p.D788H|ZNF43_ENST00000594012.1_Missense_Mutation_p.D788H|ZNF43_ENST00000598381.1_Missense_Mutation_p.D788H	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	794					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D794H(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		ACTGTCACATCTTCAGGTTTG	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	53.0	52.0					19																	21990459		2201	4300	6501	-	-	-	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2380G>C	19.37:g.21990459C>G	ENSP00000347045:p.Asp794His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D794H	ENST00000354959.4	37	c.2380	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	C	4.595	0.110613	0.08780	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.05382	3.45	1.76	0.648	0.17801	.	.	.	.	.	T	0.03783	0.0107	N	0.16233	0.39	0.09310	N	1	P	0.48162	0.906	B	0.40534	0.332	T	0.39800	-0.9596	9	0.62326	D	0.03	.	4.1689	0.10320	0.0:0.2215:0.0:0.7785	.	794	P17038	ZNF43_HUMAN	H	793;794	ENSP00000347045:D794H	ENSP00000347045:D794H	D	-	1	0	ZNF43	21782299	0.000000	0.05858	0.001000	0.08648	0.222000	0.24845	-1.556000	0.02168	-0.020000	0.14032	0.305000	0.20034	GAT	ZNF43	-	NULL	ENSG00000198521		0.313	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2	101	0.00	0	C	NM_003423		21990459	21990459	-1	no_errors	ENST00000354959	ensembl	human	known	69_37n	missense	201	30.93	90	SNP	0.015	G
ZNF616	90317	genome.wustl.edu	37	19	52619379	52619379	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:52619379G>C	ENST00000600228.1	-	4	1299	c.1038C>G	c.(1036-1038)atC>atG	p.I346M	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	346					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I346M(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TTCCTGCATGGATTACCTGAT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											168.0	157.0	161.0					19																	52619379		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1038C>G	19.37:g.52619379G>C	ENSP00000471000:p.Ile346Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I346M	ENST00000600228.1	37	c.1038	CCDS33090.1	19	.	.	.	.	.	.	.	.	.	.	G	9.454	1.091284	0.20471	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.08	-2.15	0.07102	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40015	0.1100	L	0.42529	1.33	0.09310	N	1	D	0.59767	0.986	D	0.64877	0.93	T	0.37526	-0.9702	8	0.66056	D	0.02	.	1.0598	0.01598	0.2227:0.1436:0.387:0.2467	.	346	Q08AN1	ZN616_HUMAN	M	346	.	ENSP00000328722:I346M	I	-	3	3	ZNF616	57311191	0.000000	0.05858	0.000000	0.03702	0.703000	0.40648	-1.997000	0.01470	-2.136000	0.00810	0.305000	0.20034	ATC	ZNF616	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204611		0.418	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF616	HGNC	protein_coding	OTTHUMT00000462451.1	276	0.00	0	G	XM_030892		52619379	52619379	-1	no_errors	ENST00000330123	ensembl	human	known	69_37n	missense	511	27.75	197	SNP	0.001	C
ZNF324	25799	genome.wustl.edu	37	19	58982714	58982714	+	Silent	SNP	C	C	T	rs545497291		TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr19:58982714C>T	ENST00000536459.2	+	4	1564	c.855C>T	c.(853-855)taC>taT	p.Y285Y	ZNF324_ENST00000535298.1_Silent_p.Y62Y|ZNF324_ENST00000196482.3_Silent_p.Y285Y|ZNF446_ENST00000596341.1_5'Flank			O75467	Z324A_HUMAN	zinc finger protein 324	285					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		AGCGGCCCTACGAGTGCGCCC	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		20012	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													56.0	48.0	51.0					19																	58982714		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812		"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product							Standard	NM_014347		Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.855C>T	19.37:g.58982714C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRX1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y285	ENST00000536459.2	37	c.855	CCDS12981.1	19																																																																																			ZNF324	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000083812		0.662	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324	HGNC	protein_coding	OTTHUMT00000467044.1	32	0.00	0	C	NM_014347		58982714	58982714	+1	no_errors	ENST00000196482	ensembl	human	known	69_37n	silent	31	11.43	4	SNP	0.002	T
ZNHIT6	54680	genome.wustl.edu	37	1	86123612	86123612	+	Silent	SNP	C	C	T			TCGA-A8-A095-01A-11W-A019-09	TCGA-A8-A095-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d16f025a-4187-4632-b833-02a3ffa54210	9dafa22c-39df-467b-920b-a1e42c820671	g.chr1:86123612C>T	ENST00000370574.3	-	9	1423	c.1290G>A	c.(1288-1290)ttG>ttA	p.L430L	ZNHIT6_ENST00000431532.2_Silent_p.L391L			Q9NWK9	BCD1_HUMAN	zinc finger, HIT-type containing 6	430					box C/D snoRNP assembly (GO:0000492)|ribosome biogenesis (GO:0042254)	extracellular vesicular exosome (GO:0070062)|pre-snoRNP complex (GO:0070761)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.L430L(1)		autonomic_ganglia(1)|breast(2)|cervix(2)|large_intestine(10)|lung(1)|urinary_tract(1)	17						CTTTGTTCCTCAAATTGTCTA	0.279																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	94.0	93.0					1																	86123612		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AL442074	CCDS707.1, CCDS53338.1	1p22.3	2013-01-17	2010-09-15	2008-06-23	ENSG00000117174	ENSG00000117174		"""Zinc fingers, HIT-type"""	26089	protein-coding gene	gene with protein product	"""box C/D snoRNA essential 1 homolog (S. cerevisiae)"""		"""chromosome 1 open reading frame 181"", ""zinc finger, HIT type 6"""	C1orf181		12747765	Standard	NM_017953		Approved	FLJ20729, NY-BR-75, BCD1	uc001dlh.3	Q9NWK9	OTTHUMG00000010576	ENST00000370574.3:c.1290G>A	1.37:g.86123612C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBA1|B4DP13|D3DT20|Q9H278|Q9H3X3|Q9NWN0	Silent	SNP	pfam_Znf_HIT,pfscan_Znf_HIT	p.L430	ENST00000370574.3	37	c.1290	CCDS707.1	1																																																																																			ZNHIT6	-	NULL	ENSG00000117174		0.279	ZNHIT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT6	HGNC	protein_coding	OTTHUMT00000029186.1	135	0.00	0	C	NM_017953		86123612	86123612	-1	no_errors	ENST00000370574	ensembl	human	known	69_37n	silent	144	11.11	18	SNP	1.000	T
