#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM19	8728	genome.wustl.edu	37	5	156907994	156907994	+	IGR	SNP	G	G	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr5:156907994G>C	ENST00000517905.1	-	0	3312				ADAM19_ENST00000394020.1_Nonsense_Mutation_p.S909*|ADAM19_ENST00000430702.2_Intron|ADAM19_ENST00000257527.4_Nonsense_Mutation_p.S907*			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19						heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGCCCTCTGTGATCTGTATTC	0.517																																						dbGAP											0													98.0	91.0	93.0					5																	156907994		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242		5.37:g.156907994G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZL5|Q9UHP2	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S909*	ENST00000517905.1	37	c.2726		5	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045673	0.75846	.	.	ENSG00000135074	ENST00000257527;ENST00000394020	.	.	.	5.41	2.65	0.31530	.	1.252360	0.05637	N	0.582767	.	.	.	.	.	.	0.37921	D	0.931698	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5484	0.27781	0.2704:0.0:0.7296:0.0	.	.	.	.	X	907;909	.	.	S	-	2	0	ADAM19	156840572	0.916000	0.31088	0.096000	0.21009	0.071000	0.16799	1.349000	0.33998	0.263000	0.21812	-0.251000	0.11542	TCA	ADAM19	-	NULL	ENSG00000135074		0.517	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	HGNC	protein_coding	OTTHUMT00000373918.1	101	0.00	0	G	NM_033274		156907994	156907994	-1	no_errors	ENST00000394020	ensembl	human	known	69_37n	nonsense	67	15.19	12	SNP	0.022	C
ADAMTS20	80070	genome.wustl.edu	37	12	43826141	43826141	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr12:43826141G>A	ENST00000389420.3	-	21	3061	c.3062C>T	c.(3061-3063)tCc>tTc	p.S1021F	ADAMTS20_ENST00000395541.2_Missense_Mutation_p.S175F|ADAMTS20_ENST00000553158.1_Missense_Mutation_p.S1021F	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1021	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACTGGGACAGGAAAATTCATT	0.393																																						dbGAP											0													116.0	109.0	112.0					12																	43826141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3062C>T	12.37:g.43826141G>A	ENSP00000374071:p.Ser1021Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.S1021F	ENST00000389420.3	37	c.3062	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810540	0.70797	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.61627	0.09;0.09;0.09;0.09	5.04	5.04	0.67666	.	0.350782	0.22152	N	0.063919	T	0.72692	0.3492	M	0.84948	2.725	0.24783	N	0.9928	P;D	0.56287	0.91;0.975	P;P	0.58454	0.77;0.839	T	0.67776	-0.5583	10	0.56958	D	0.05	.	10.5098	0.44855	0.1212:0.0:0.8788:0.0	.	1021;175	P59510;E9PBD5	ATS20_HUMAN;.	F	1021;187;175;1021;1021	ENSP00000374071:S1021F;ENSP00000447427:S187F;ENSP00000378911:S175F;ENSP00000448341:S1021F	ENSP00000374068:S1021F	S	-	2	0	ADAMTS20	42112408	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.006000	0.57083	2.706000	0.92434	0.655000	0.94253	TCC	ADAMTS20	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000173157		0.393	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	183	0.00	0	G	NM_025003		43826141	43826141	-1	no_errors	ENST00000389420	ensembl	human	known	69_37n	missense	126	11.89	17	SNP	1.000	A
AIM1	202	genome.wustl.edu	37	6	106967193	106967193	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:106967193A>G	ENST00000369066.3	+	2	1373	c.886A>G	c.(886-888)Act>Gct	p.T296A		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CCAAAGGAATACTCCTGCCTC	0.433																																						dbGAP											0													56.0	56.0	56.0					6																	106967193		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.886A>G	6.37:g.106967193A>G	ENSP00000358062:p.Thr296Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.T296A	ENST00000369066.3	37	c.886	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	A	7.143	0.582277	0.13749	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.70749	-0.51	5.73	-0.823	0.10815	.	2.272740	0.01908	N	0.039628	T	0.32194	0.0821	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.10177	-1.0641	10	0.06099	T	0.92	.	5.9988	0.19509	0.5379:0.2315:0.2306:0.0	.	296	Q9Y4K1	AIM1_HUMAN	A	704;296	ENSP00000358062:T296A	ENSP00000285105:T704A	T	+	1	0	AIM1	107073886	0.000000	0.05858	0.029000	0.17559	0.009000	0.06853	0.160000	0.16462	0.077000	0.16863	-0.256000	0.11100	ACT	AIM1	-	NULL	ENSG00000112297		0.433	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	94	0.00	0	A			106967193	106967193	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	106	12.80	16	SNP	0.000	G
AKNA	80709	genome.wustl.edu	37	9	117120303	117120303	+	Silent	SNP	G	G	A	rs557155287		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr9:117120303G>A	ENST00000307564.4	-	12	2798	c.2637C>T	c.(2635-2637)tcC>tcT	p.S879S	AKNA_ENST00000374075.5_Silent_p.S798S|AKNA_ENST00000223791.3_Silent_p.S339S|AKNA_ENST00000374088.3_Silent_p.S879S	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	879					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GGGATGCTGCGGACTTGGTGC	0.662													g|||	1	0.000199681	0.0	0.0	5008	,	,		18481	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													65.0	64.0	64.0					9																	117120303		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2637C>T	9.37:g.117120303G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Silent	SNP	pfam_TF_AT-hook	p.S879	ENST00000307564.4	37	c.2637	CCDS6805.1	9																																																																																			AKNA	-	NULL	ENSG00000106948		0.662	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	47	0.00	0	G	NM_030767		117120303	117120303	-1	no_errors	ENST00000307564	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	0.000	A
ALG8	79053	genome.wustl.edu	37	11	77820538	77820538	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr11:77820538G>A	ENST00000299626.5	-	9	1059	c.988C>T	c.(988-990)Ccc>Tcc	p.P330S	ALG8_ENST00000532552.2_5'UTR|ALG8_ENST00000376156.3_Missense_Mutation_p.P330S	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	330					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)			NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			GTCACTGAGGGAAGGACTGTG	0.423																																						dbGAP											0													199.0	168.0	178.0					11																	77820538		2200	4292	6492	-	-	-	SO:0001583	missense	0			AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.988C>T	11.37:g.77820538G>A	ENSP00000299626:p.Pro330Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDW6|O60860	Missense_Mutation	SNP	pfam_Glyco_trans_ALG6/ALG8	p.P330S	ENST00000299626.5	37	c.988	CCDS8258.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.271300|4.271300	0.80469|0.80469	.|.	.|.	ENSG00000159063|ENSG00000159063	ENST00000299626;ENST00000376156;ENST00000532440|ENST00000526849	D;D;D|T	0.83673|0.48522	-1.75;-1.75;-1.75|0.81	5.69|5.69	3.82|3.82	0.43975|0.43975	.|.	0.049709|.	0.85682|.	N|.	0.000000|.	T|T	0.67961|0.67961	0.2949|0.2949	M|M	0.89163|0.89163	3.01|3.01	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.71771|0.71771	-0.4492|-0.4492	10|6	0.62326|.	D|.	0.03|.	-12.3542|-12.3542	12.1629|12.1629	0.54113|0.54113	0.1382:0.0:0.8618:0.0|0.1382:0.0:0.8618:0.0	.|.	330;330;330|.	B3KQL8;Q9BVK2;A6NDW6|.	.;ALG8_HUMAN;.|.	S|F	330;330;148|12	ENSP00000299626:P330S;ENSP00000365326:P330S;ENSP00000433429:P148S|ENSP00000434388:S12F	ENSP00000299626:P330S|.	P|S	-|-	1|2	0|0	ALG8|ALG8	77498186|77498186	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.989000|0.989000	0.77384|0.77384	8.815000|8.815000	0.91973|0.91973	0.758000|0.758000	0.33059|0.33059	0.655000|0.655000	0.94253|0.94253	CCC|TCC	ALG8	-	pfam_Glyco_trans_ALG6/ALG8	ENSG00000159063		0.423	ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG8	HGNC	protein_coding	OTTHUMT00000390637.1	127	0.00	0	G	NM_024079		77820538	77820538	-1	no_errors	ENST00000299626	ensembl	human	known	69_37n	missense	150	13.29	23	SNP	0.999	A
ANGEL2	90806	genome.wustl.edu	37	1	213180387	213180387	+	Intron	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:213180387G>A	ENST00000366962.3	-	4	867				ANGEL2_ENST00000544555.1_Intron|ANGEL2_ENST00000360506.2_Intron|ANGEL2_ENST00000535388.1_Intron|ANGEL2_ENST00000540642.1_Intron	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)											central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		agtgagccatgattgtgccac	0.473																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.712+83C>T	1.37:g.213180387G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	RNA	SNP	-	NULL	ENST00000366962.3	37	NULL	CCDS1512.1	1																																																																																			ANGEL2	-	-	ENSG00000174606		0.473	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	61	0.00	0	G	NM_144567		213180387	213180387	-1	no_errors	ENST00000460337	ensembl	human	known	69_37n	rna	71	12.35	10	SNP	0.018	A
ANKRD17	26057	genome.wustl.edu	37	4	74043217	74043217	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr4:74043217C>T	ENST00000358602.4	-	2	543	c.427G>A	c.(427-429)Gaa>Aaa	p.E143K	ANKRD17_ENST00000330838.6_Missense_Mutation_p.E143K|ANKRD17_ENST00000509867.2_Missense_Mutation_p.E30K	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	143					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTGGATTTTCCAAATCATCC	0.443																																						dbGAP											0													86.0	78.0	81.0					4																	74043217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.427G>A	4.37:g.74043217C>T	ENSP00000351416:p.Glu143Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.W27*	ENST00000358602.4	37	c.81	CCDS34004.1	4	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979630	0.92982	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.81163	-1.46;-1.46;-0.33	5.64	4.8	0.61643	.	0.000000	0.64402	D	0.000003	T	0.80232	0.4585	N	0.19112	0.55	0.33145	D	0.544908	P;D;P;B	0.56968	0.735;0.978;0.952;0.239	P;P;P;B	0.61003	0.491;0.882;0.504;0.07	D	0.84007	0.0346	10	0.36615	T	0.2	.	14.8361	0.70183	0.0:0.9306:0.0:0.0694	.	143;143;143;30	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	K	143;143;143;30;143	ENSP00000351416:E143K;ENSP00000332265:E143K;ENSP00000427151:E30K	ENSP00000332265:E143K	E	-	1	0	ANKRD17	74262081	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	1.382000	0.46385	0.591000	0.81541	GAA	ANKRD17	-	NULL	ENSG00000132466		0.443	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD17	HGNC	protein_coding	OTTHUMT00000362475.1	333	0.00	0	C	NM_032217		74043217	74043217	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000558247	ensembl	human	known	69_37n	nonsense	247	13.33	38	SNP	1.000	T
ARHGAP29	9411	genome.wustl.edu	37	1	94643587	94643587	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:94643587G>A	ENST00000260526.6	-	21	2799	c.2617C>T	c.(2617-2619)Cgc>Tgc	p.R873C	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	873	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTACCAAGCGTGCTTGATTT	0.453																																						dbGAP											0													146.0	138.0	140.0					1																	94643587		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2617C>T	1.37:g.94643587G>A	ENSP00000260526:p.Arg873Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.R873C	ENST00000260526.6	37	c.2617	CCDS748.1	1	.	.	.	.	.	.	.	.	.	.	G	9.213	1.031394	0.19590	.	.	ENSG00000137962	ENST00000260526	T	0.23552	1.9	5.75	2.63	0.31362	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.000000	0.34676	N	0.003765	T	0.37544	0.1007	M	0.86573	2.825	0.28764	N	0.900729	D;P	0.89917	1.0;0.945	D;B	0.63703	0.917;0.304	T	0.28038	-1.0056	10	0.62326	D	0.03	-2.1991	11.4116	0.49929	0.0:0.1223:0.624:0.2537	.	873;873	F8VWZ8;Q52LW3	.;RHG29_HUMAN	C	873	ENSP00000260526:R873C	ENSP00000260526:R873C	R	-	1	0	ARHGAP29	94416175	0.998000	0.40836	0.007000	0.13788	0.020000	0.10135	3.748000	0.55142	0.740000	0.32651	0.563000	0.77884	CGC	ARHGAP29	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000137962		0.453	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	202	0.00	0	G	NM_004815		94643587	94643587	-1	no_errors	ENST00000260526	ensembl	human	known	69_37n	missense	182	11.22	23	SNP	0.066	A
ATP5A1	498	genome.wustl.edu	37	18	43667040	43667040	+	Silent	SNP	T	T	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr18:43667040T>G	ENST00000398752.6	-	8	1231	c.1110A>C	c.(1108-1110)atA>atC	p.I370I	ATP5A1_ENST00000282050.2_Silent_p.I370I|ATP5A1_ENST00000590665.1_Silent_p.I348I|ATP5A1_ENST00000593152.2_Silent_p.I320I	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	370					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						CCTGTGTTTCTATGACTGGCA	0.423																																						dbGAP											0													56.0	53.0	54.0					18																	43667040		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.1110A>C	18.37:g.43667040T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Silent	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/A1-cplx_a/bsu_N,tigrfam_ATPase_F1-cplx_asu	p.I370	ENST00000398752.6	37	c.1110	CCDS11927.1	18																																																																																			ATP5A1	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,tigrfam_ATPase_F1-cplx_asu	ENSG00000152234		0.423	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5A1	HGNC	protein_coding	OTTHUMT00000255884.1	163	0.00	0	T	NM_004046		43667040	43667040	-1	no_errors	ENST00000282050	ensembl	human	known	69_37n	silent	86	28.93	35	SNP	0.959	G
ATP6V0B	533	genome.wustl.edu	37	1	44442306	44442306	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:44442306C>A	ENST00000472174.2	+	5	716	c.323C>A	c.(322-324)gCa>gAa	p.A108E	ATP6V0B_ENST00000532642.1_Missense_Mutation_p.A108E|ATP6V0B_ENST00000471859.2_Missense_Mutation_p.A155E|ATP6V0B_ENST00000498664.1_Missense_Mutation_p.A61E|B4GALT2_ENST00000434555.2_5'Flank|ATP6V0B_ENST00000236067.4_Missense_Mutation_p.A61E|B4GALT2_ENST00000372324.1_5'Flank|ATP6V0B_ENST00000472277.1_Intron	NM_004047.3	NP_004038.1	Q99437	VATO_HUMAN	ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b	108					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuole (GO:0005773)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(2)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				ATCATCATGGCAATTGTCATT	0.488																																						dbGAP											0													114.0	104.0	107.0					1																	44442306		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000423	CCDS505.1, CCDS41315.1, CCDS72772.1	1p32.3	2010-04-21	2006-01-20	2002-05-10	ENSG00000117410	ENSG00000117410		"""ATPases / V-type"""	861	protein-coding gene	gene with protein product		603717	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD"", ""ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c''"""	ATP6F		9653649	Standard	XM_005270944		Approved	VMA16, HATPL	uc001cld.3	Q99437	OTTHUMG00000008298	ENST00000472174.2:c.323C>A	1.37:g.44442306C>A	ENSP00000431605:p.Ala108Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPY5|Q6IB32	Missense_Mutation	SNP	pfam_ATPase_F0/V0-cplx_csu,superfamily_ATPase_F0/V0-cplx_csu,prints_ATPase_V0-cplx_csu	p.A108E	ENST00000472174.2	37	c.323	CCDS505.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.642191	0.96704	.	.	ENSG00000117410	ENST00000472505;ENST00000472174;ENST00000532642;ENST00000236067;ENST00000471859;ENST00000498664	T;T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42;0.42	5.11	5.11	0.69529	ATPase, F0/V0 complex, subunit C (3);	0.000000	0.85682	D	0.000000	T	0.81927	0.4926	H	0.96301	3.8	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.991;0.993	D	0.88244	0.2912	10	0.87932	D	0	-3.888	18.5346	0.91006	0.0:1.0:0.0:0.0	.	108;108	Q99437;E9PNL3	VATO_HUMAN;.	E	61;108;108;61;155;61	ENSP00000432994:A61E;ENSP00000431605:A108E;ENSP00000434729:A108E;ENSP00000236067:A61E;ENSP00000432754:A155E;ENSP00000434094:A61E	ENSP00000236067:A61E	A	+	2	0	ATP6V0B	44214893	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.288000	0.78691	2.377000	0.81083	0.561000	0.74099	GCA	ATP6V0B	-	pfam_ATPase_F0/V0-cplx_csu,superfamily_ATPase_F0/V0-cplx_csu	ENSG00000117410		0.488	ATP6V0B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0B	HGNC	protein_coding	OTTHUMT00000022854.2	110	0.00	0	C	NM_004047		44442306	44442306	+1	no_errors	ENST00000472174	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	1.000	A
B3GALT4	8705	genome.wustl.edu	37	6	33245209	33245209	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:33245209C>A	ENST00000451237.1	+	1	293	c.13C>A	c.(13-15)Ctc>Atc	p.L5I		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	5					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						GCAGCTCAGGCTCTTCCGGCG	0.667																																						dbGAP											0													44.0	48.0	47.0					6																	33245209		2203	4296	6499	-	-	-	SO:0001583	missense	0			Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.13C>A	6.37:g.33245209C>A	ENSP00000390784:p.Leu5Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Glyco_trans_31	p.L5I	ENST00000451237.1	37	c.13	CCDS34425.1	6	.	.	.	.	.	.	.	.	.	.	C	6.426	0.446673	0.12223	.	.	ENSG00000235863	ENST00000451237	T	0.51071	0.72	4.34	2.57	0.30868	.	1.788220	0.03174	N	0.171187	T	0.14614	0.0353	N	0.19112	0.55	0.09310	N	1	B	0.24186	0.099	B	0.27608	0.081	T	0.17289	-1.0374	10	0.25751	T	0.34	.	6.5869	0.22626	0.0:0.7824:0.0:0.2176	.	5	O96024	B3GT4_HUMAN	I	5	ENSP00000390784:L5I	ENSP00000390784:L5I	L	+	1	0	B3GALT4	33353187	0.131000	0.22433	0.902000	0.35471	0.056000	0.15407	0.717000	0.25851	0.483000	0.27608	0.549000	0.68633	CTC	B3GALT4	-	NULL	ENSG00000235863		0.667	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT4	HGNC	protein_coding	OTTHUMT00000076162.2	53	0.00	0	C			33245209	33245209	+1	no_errors	ENST00000451237	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.131	A
BCOR	54880	genome.wustl.edu	37	X	39932241	39932241	+	Silent	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chrX:39932241C>T	ENST00000378444.4	-	4	2586	c.2358G>A	c.(2356-2358)aaG>aaA	p.K786K	BCOR_ENST00000378455.4_Silent_p.K786K|BCOR_ENST00000342274.4_Silent_p.K786K|BCOR_ENST00000397354.3_Silent_p.K786K	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	786					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TGGGGTTCGGCTTTAGGTTCT	0.493			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															dbGAP		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													179.0	179.0	179.0					X																	39932241		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2358G>A	X.37:g.39932241C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K786	ENST00000378444.4	37	c.2358	CCDS48093.1	X																																																																																			BCOR	-	NULL	ENSG00000183337		0.493	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	94	0.00	0	C	NM_017745		39932241	39932241	-1	no_errors	ENST00000378444	ensembl	human	known	69_37n	silent	117	10.69	14	SNP	0.703	T
CATSPERG	57828	genome.wustl.edu	37	19	38853402	38853402	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr19:38853402C>T	ENST00000409235.3	+	20	2520	c.2405C>T	c.(2404-2406)gCc>gTc	p.A802V	CATSPERG_ENST00000215069.4_3'UTR|AC005625.1_ENST00000590304.1_RNA|CATSPERG_ENST00000410018.1_Missense_Mutation_p.A762V	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	802					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						GTGGTGCTGGCCGACCCCGGC	0.652																																						dbGAP											0													70.0	72.0	71.0					19																	38853402		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.2405C>T	19.37:g.38853402C>T	ENSP00000386962:p.Ala802Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEG6|Q659E1	Missense_Mutation	SNP	NULL	p.A802V	ENST00000409235.3	37	c.2405	CCDS12514.2	19	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764620	0.69878	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	T;T	0.33216	1.42;1.42	4.52	3.47	0.39725	.	0.396830	0.21531	N	0.073048	T	0.45236	0.1332	M	0.69823	2.125	0.30857	N	0.733931	D;P	0.54207	0.965;0.801	P;P	0.55087	0.768;0.521	T	0.53676	-0.8405	10	0.72032	D	0.01	-24.128	10.3987	0.44216	0.0:0.8015:0.1984:0.0	.	802;762	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	V	762;802;802	ENSP00000387057:A762V;ENSP00000386962:A802V	ENSP00000386962:A802V	A	+	2	0	CATSPERG	43545242	0.913000	0.31002	0.502000	0.27614	0.554000	0.35429	2.138000	0.42140	1.108000	0.41662	0.462000	0.41574	GCC	CATSPERG	-	NULL	ENSG00000099338		0.652	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPERG	HGNC	protein_coding	OTTHUMT00000330204.1	85	0.00	0	C	NM_021185		38853402	38853402	+1	no_errors	ENST00000409235	ensembl	human	known	69_37n	missense	102	11.97	14	SNP	0.319	T
CCDC112	153733	genome.wustl.edu	37	5	114611095	114611095	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr5:114611095G>A	ENST00000512261.1	-	7	903	c.487C>T	c.(487-489)Cga>Tga	p.R163*	CCDC112_ENST00000506442.1_Nonsense_Mutation_p.R163*|CCDC112_ENST00000503027.1_5'UTR|CCDC112_ENST00000395557.4_Nonsense_Mutation_p.R163*|CCDC112_ENST00000379611.5_Nonsense_Mutation_p.R246*			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	163										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		GCACCTTGTCGCCCTCCTGTT	0.408																																						dbGAP											0													145.0	145.0	145.0					5																	114611095		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.487C>T	5.37:g.114611095G>A	ENSP00000423712:p.Arg163*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6A334	Nonsense_Mutation	SNP	superfamily_Homeodomain-like	p.R246*	ENST00000512261.1	37	c.736	CCDS4117.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.637658	0.98403	.	.	ENSG00000164221	ENST00000379611;ENST00000512261;ENST00000506442;ENST00000395557	.	.	.	5.95	5.95	0.96441	.	0.245379	0.39985	N	0.001213	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.2598	15.7258	0.77756	0.0:0.0:0.802:0.198	.	.	.	.	X	246;163;163;163	.	ENSP00000368931:R246X	R	-	1	2	CCDC112	114638994	0.392000	0.25229	0.996000	0.52242	0.976000	0.68499	1.391000	0.34475	2.810000	0.96702	0.650000	0.86243	CGA	CCDC112	-	NULL	ENSG00000164221		0.408	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CCDC112	HGNC	protein_coding	OTTHUMT00000370999.1	285	0.00	0	G	NM_152549		114611095	114611095	-1	no_errors	ENST00000379611	ensembl	human	known	69_37n	nonsense	172	22.87	51	SNP	1.000	A
CCDC66	285331	genome.wustl.edu	37	3	56653531	56653531	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr3:56653531G>A	ENST00000394672.3	+	16	2681	c.2611G>A	c.(2611-2613)Gac>Aac	p.D871N	CCDC66_ENST00000436465.2_Missense_Mutation_p.D871N|CCDC66_ENST00000326595.7_Missense_Mutation_p.D837N	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	871					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TTCAACCCAGGACCCTCAGTA	0.383																																						dbGAP											0													87.0	94.0	91.0					3																	56653531		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.2611G>A	3.37:g.56653531G>A	ENSP00000378167:p.Asp871Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	NULL	p.D871N	ENST00000394672.3	37	c.2611	CCDS46852.1	3	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007138	0.35415	.	.	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	T;T;T	0.25250	1.81;1.81;1.81	5.23	2.44	0.29823	.	0.247415	0.38548	N	0.001641	T	0.18923	0.0454	L	0.38838	1.175	0.53688	D	0.999978	B	0.27997	0.197	B	0.25614	0.062	T	0.04294	-1.0962	10	0.37606	T	0.19	-2.5362	10.7481	0.46191	0.2139:0.0:0.7861:0.0	.	871	A2RUB6	CCD66_HUMAN	N	871;837;871	ENSP00000378167:D871N;ENSP00000326050:D837N;ENSP00000404320:D871N	ENSP00000326050:D837N	D	+	1	0	CCDC66	56628571	0.984000	0.35163	0.016000	0.15963	0.007000	0.05969	1.881000	0.39638	0.300000	0.22699	0.591000	0.81541	GAC	CCDC66	-	NULL	ENSG00000180376		0.383	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC66	HGNC	protein_coding	OTTHUMT00000341473.1	369	0.27	1	G	NM_001012506		56653531	56653531	+1	no_errors	ENST00000394672	ensembl	human	known	69_37n	missense	194	14.10	32	SNP	0.517	A
CCNE1	898	genome.wustl.edu	37	19	30313457	30313457	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr19:30313457G>A	ENST00000262643.3	+	11	1336	c.1057G>A	c.(1057-1059)Gct>Act	p.A353T	CCNE1_ENST00000357943.5_Missense_Mutation_p.A310T|CCNE1_ENST00000444983.2_Missense_Mutation_p.A338T	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	353					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			CAGGGGCGTCGCTGATGAAGA	0.483			A		serous ovarian																																	dbGAP		Dom	yes		19	19q12	898	cyclin E1		E	0													191.0	187.0	188.0					19																	30313457		2203	4300	6503	-	-	-	SO:0001583	missense	0			M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.1057G>A	19.37:g.30313457G>A	ENSP00000262643:p.Ala353Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.A353T	ENST00000262643.3	37	c.1057	CCDS12419.1	19	.	.	.	.	.	.	.	.	.	.	G	5.208	0.223859	0.09863	.	.	ENSG00000105173	ENST00000262643;ENST00000357943;ENST00000444983	T;T;T	0.23147	1.92;1.92;1.92	6.17	4.04	0.47022	Cyclin, C-terminal (1);Cyclin-like (1);	0.324781	0.38164	N	0.001797	T	0.14830	0.0358	N	0.24115	0.695	0.20703	N	0.999869	P	0.36974	0.576	B	0.20184	0.028	T	0.06058	-1.0848	10	0.19147	T	0.46	.	17.4324	0.87543	0.0:0.5125:0.4875:0.0	.	353	P24864	CCNE1_HUMAN	T	353;310;338	ENSP00000262643:A353T;ENSP00000350625:A310T;ENSP00000410179:A338T	ENSP00000262643:A353T	A	+	1	0	CCNE1	35005297	0.038000	0.19896	0.008000	0.14137	0.019000	0.09904	0.705000	0.25675	0.923000	0.37045	-0.951000	0.02657	GCT	CCNE1	-	pfam_Cyclin_C,pirsf_Cyclin_A/B/D/E	ENSG00000105173		0.483	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNE1	HGNC	protein_coding	OTTHUMT00000438138.1	123	0.00	0	G	NM_001238		30313457	30313457	+1	no_errors	ENST00000262643	ensembl	human	known	69_37n	missense	119	30.64	53	SNP	0.225	A
CCR7	1236	genome.wustl.edu	37	17	38711716	38711716	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr17:38711716T>A	ENST00000246657.2	-	3	477	c.415A>T	c.(415-417)Agc>Tgc	p.S139C	CCR7_ENST00000579344.1_Missense_Mutation_p.S133C	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	139					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				CTGAAGAAGCTCATCTTGTAG	0.577																																						dbGAP											0													53.0	48.0	50.0					17																	38711716		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.415A>T	17.37:g.38711716T>A	ENSP00000246657:p.Ser139Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Chemokine_CCR7,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CCR11,pfscan_GPCR_Rhodpsn_supfam	p.S139C	ENST00000246657.2	37	c.415	CCDS11369.1	17	.	.	.	.	.	.	.	.	.	.	T	23.8	4.462860	0.84425	.	.	ENSG00000126353	ENST00000246657	T	0.39229	1.09	5.16	5.16	0.70880	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59569	0.2203	L	0.55743	1.74	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.62671	-0.6805	10	0.72032	D	0.01	.	15.1446	0.72641	0.0:0.0:0.0:1.0	.	139	P32248	CCR7_HUMAN	C	139	ENSP00000246657:S139C	ENSP00000246657:S139C	S	-	1	0	CCR7	35965242	1.000000	0.71417	0.942000	0.38095	0.992000	0.81027	7.868000	0.87116	2.174000	0.68829	0.459000	0.35465	AGC	CCR7	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000126353		0.577	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR7	HGNC	protein_coding	OTTHUMT00000257222.1	102	0.00	0	T			38711716	38711716	-1	no_errors	ENST00000246657	ensembl	human	known	69_37n	missense	93	17.70	20	SNP	1.000	A
CDC14A	8556	genome.wustl.edu	37	1	100921011	100921011	+	Silent	SNP	A	A	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:100921011A>G	ENST00000336454.3	+	8	925	c.570A>G	c.(568-570)gcA>gcG	p.A190A	CDC14A_ENST00000542213.1_Silent_p.A132A|CDC14A_ENST00000370124.3_Silent_p.A190A|CDC14A_ENST00000544534.1_Silent_p.A190A|CDC14A_ENST00000370125.2_Intron|CDC14A_ENST00000361544.6_Silent_p.A190A	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	190	B.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		AATTTTTAGCATTTAGTGGAC	0.289																																						dbGAP											0													75.0	81.0	79.0					1																	100921011		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.570A>G	1.37:g.100921011A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A190	ENST00000336454.3	37	c.570	CCDS769.1	1																																																																																			CDC14A	-	NULL	ENSG00000079335		0.289	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDC14A	HGNC	protein_coding	OTTHUMT00000030220.1	243	0.00	0	A	NM_033312		100921011	100921011	+1	no_errors	ENST00000361544	ensembl	human	known	69_37n	silent	116	18.31	26	SNP	0.997	G
CDCA7L	55536	genome.wustl.edu	37	7	21947807	21947807	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:21947807G>T	ENST00000406877.3	-	4	901	c.622C>A	c.(622-624)Cag>Aag	p.Q208K	CDCA7L_ENST00000465490.1_5'UTR|CDCA7L_ENST00000356195.5_Missense_Mutation_p.Q174K|CDCA7L_ENST00000373934.4_Missense_Mutation_p.Q162K	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like	208					positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						GAACTCTCCTGGCTCTCATCC	0.478																																						dbGAP											0													77.0	69.0	72.0					7																	21947807		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.622C>A	7.37:g.21947807G>T	ENSP00000383986:p.Gln208Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Missense_Mutation	SNP	pfam_Znf-4CXXC_R1	p.Q208K	ENST00000406877.3	37	c.622	CCDS5374.1	7	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132175	0.56828	.	.	ENSG00000164649	ENST00000356195;ENST00000406877;ENST00000373934	T;T;T	0.42131	0.98;0.98;0.98	5.54	4.66	0.58398	.	0.457938	0.23302	N	0.049662	T	0.36276	0.0961	L	0.57536	1.79	0.28371	N	0.919997	P;P;P;P	0.45283	0.773;0.728;0.728;0.855	B;B;B;B	0.37480	0.127;0.095;0.095;0.251	T	0.42464	-0.9450	10	0.59425	D	0.04	-8.3449	9.3437	0.38096	0.0816:0.2562:0.6621:0.0	.	208;162;208;207	A8K8X5;C9K0Y1;Q96GN5;Q96GN5-2	.;.;CDA7L_HUMAN;.	K	174;208;162	ENSP00000348523:Q174K;ENSP00000383986:Q208K;ENSP00000363045:Q162K	ENSP00000348523:Q174K	Q	-	1	0	CDCA7L	21914332	0.978000	0.34361	0.988000	0.46212	0.985000	0.73830	1.765000	0.38481	1.319000	0.45190	0.563000	0.77884	CAG	CDCA7L	-	NULL	ENSG00000164649		0.478	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7L	HGNC	protein_coding	OTTHUMT00000250218.4	77	0.00	0	G	NM_018719		21947807	21947807	-1	no_errors	ENST00000406877	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	0.900	T
CDKAL1	54901	genome.wustl.edu	37	6	21201369	21201369	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:21201369T>G	ENST00000378610.1	+	13	1422	c.1412T>G	c.(1411-1413)aTg>aGg	p.M471R	CDKAL1_ENST00000274695.4_Missense_Mutation_p.M471R|CDKAL1_ENST00000476517.1_3'UTR|CDKAL1_ENST00000378624.4_Missense_Mutation_p.M380R			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	471	TRAM. {ECO:0000255|PROSITE- ProRule:PRU00208}.				maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CCTGCGTTCATGGGGAAGATG	0.373																																						dbGAP											0													114.0	113.0	114.0					6																	21201369		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.1412T>G	6.37:g.21201369T>G	ENSP00000367873:p.Met471Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	pfam_Methylthiotransferase_N,pfam_rSAM,pfam_TRAM_dom,smart_Elp3/MiaB/NifB,pfscan_TRAM_dom,tigrfam_MiaB-like_B,tigrfam_Methylthiotransferase	p.M471R	ENST00000378610.1	37	c.1412	CCDS4546.1	6	.	.	.	.	.	.	.	.	.	.	T	14.84	2.655148	0.47467	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	T;T;T	0.45276	0.9;0.9;0.9	6.17	6.17	0.99709	Deoxyribonuclease/rho motif-related TRAM (2);	0.130738	0.64402	D	0.000001	T	0.48003	0.1476	M	0.76170	2.325	0.48632	D	0.999687	P;B	0.39696	0.683;0.372	P;B	0.48454	0.578;0.209	T	0.51188	-0.8737	10	0.59425	D	0.04	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	380;471	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	R	471;380;471	ENSP00000274695:M471R;ENSP00000367889:M380R;ENSP00000367873:M471R	ENSP00000274695:M471R	M	+	2	0	CDKAL1	21309348	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.595000	0.61048	2.371000	0.80710	0.533000	0.62120	ATG	CDKAL1	-	pfam_TRAM_dom,pfscan_TRAM_dom,tigrfam_MiaB-like_B,tigrfam_Methylthiotransferase	ENSG00000145996		0.373	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKAL1	HGNC	protein_coding	OTTHUMT00000039986.1	297	0.33	1	T	NM_017774		21201369	21201369	+1	no_errors	ENST00000274695	ensembl	human	known	69_37n	missense	275	18.40	62	SNP	1.000	G
CERS2	29956	genome.wustl.edu	37	1	150941434	150941434	+	Silent	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:150941434G>A	ENST00000271688.6	-	2	519	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CERS2_ENST00000561294.1_Silent_p.L45L|CERS2_ENST00000368954.5_Silent_p.L45L|RP11-316M1.12_ENST00000561111.1_RNA|RP11-316M1.12_ENST00000560481.1_RNA|CERS2_ENST00000345896.4_Intron	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	45					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AGCAAGGCCAGGGGCAGCGTG	0.537																																						dbGAP											0													159.0	127.0	138.0					1																	150941434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.133C>T	1.37:g.150941434G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV06|Q5SZE5|Q9HD96|Q9NW79	Silent	SNP	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_TLC-dom,pfscan_TLC-dom,pfscan_Homeodomain	p.L45	ENST00000271688.6	37	c.133	CCDS973.1	1																																																																																			CERS2	-	pirsf_Longevity_assurance_LAG1_LAC1	ENSG00000143418		0.537	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS2	HGNC	protein_coding	OTTHUMT00000084897.2	73	0.00	0	G	NM_022075		150941434	150941434	-1	no_errors	ENST00000271688	ensembl	human	known	69_37n	silent	97	15.65	18	SNP	1.000	A
CHD9	80205	genome.wustl.edu	37	16	53279531	53279531	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr16:53279531A>C	ENST00000398510.3	+	14	3310	c.3223A>C	c.(3223-3225)Aaa>Caa	p.K1075Q	CHD9_ENST00000447540.1_Missense_Mutation_p.K1075Q|CHD9_ENST00000566029.1_Missense_Mutation_p.K1075Q|CHD9_ENST00000564845.1_Missense_Mutation_p.K1075Q			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1075					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				GGCTATCCTGAAACCAATGAT	0.289																																						dbGAP											0													76.0	73.0	74.0					16																	53279531		1813	4072	5885	-	-	-	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.3223A>C	16.37:g.53279531A>C	ENSP00000381522:p.Lys1075Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K1075Q	ENST00000398510.3	37	c.3223		16	.	.	.	.	.	.	.	.	.	.	A	26.4	4.733114	0.89482	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	D;D	0.93189	-3.18;-3.18	5.65	5.65	0.86999	SNF2-related (1);	0.000000	0.64402	D	0.000010	D	0.95373	0.8498	L	0.48877	1.53	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.87578	0.998;0.985;0.998;0.996	D	0.95902	0.8916	10	0.87932	D	0	-25.6875	16.1778	0.81874	1.0:0.0:0.0:0.0	.	601;1075;1075;1075	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	Q	1075;1075;601	ENSP00000396345:K1075Q;ENSP00000381522:K1075Q	ENSP00000219084:K601Q	K	+	1	0	CHD9	51837032	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.281000	0.95811	2.279000	0.76181	0.533000	0.62120	AAA	CHD9	-	pfam_SNF2_N	ENSG00000177200		0.289	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	174	0.00	0	A	NM_025134		53279531	53279531	+1	no_errors	ENST00000398510	ensembl	human	known	69_37n	missense	156	22.77	46	SNP	1.000	C
CHIA	27159	genome.wustl.edu	37	1	111854943	111854943	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:111854943A>G	ENST00000369740.1	+	4	290	c.187A>G	c.(187-189)Aac>Gac	p.N63D	CHIA_ENST00000451398.2_Intron|CHIA_ENST00000343320.6_Missense_Mutation_p.N63D|CHIA_ENST00000483391.1_Intron|CHIA_ENST00000430615.1_Intron|CHIA_ENST00000353665.6_Intron	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	63					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TGGGAGGCAGAACAACGAGAT	0.517																																						dbGAP											0													126.0	122.0	123.0					1																	111854943		2022	4190	6212	-	-	-	SO:0001583	missense	0			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.187A>G	1.37:g.111854943A>G	ENSP00000358755:p.Asn63Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.N63D	ENST00000369740.1	37	c.187	CCDS41368.1	1	.	.	.	.	.	.	.	.	.	.	A	4.504	0.093472	0.08632	.	.	ENSG00000134216	ENST00000369740;ENST00000343320	T;T	0.05649	3.41;3.41	4.93	-2.36	0.06663	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.246164	0.32273	N	0.006334	T	0.01156	0.0038	L	0.28776	0.89	0.23669	N	0.997158	B	0.12013	0.005	B	0.19946	0.027	T	0.45934	-0.9227	10	0.25751	T	0.34	-11.8123	5.8396	0.18627	0.5425:0.1344:0.3231:0.0	.	63	Q9BZP6	CHIA_HUMAN	D	63	ENSP00000358755:N63D;ENSP00000341828:N63D	ENSP00000341828:N63D	N	+	1	0	CHIA	111656466	0.000000	0.05858	0.007000	0.13788	0.027000	0.11550	0.226000	0.17776	-0.251000	0.09542	-0.290000	0.09829	AAC	CHIA	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000134216		0.517	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1	252	0.00	0	A			111854943	111854943	+1	no_errors	ENST00000343320	ensembl	human	known	69_37n	missense	173	12.63	25	SNP	0.009	G
CLASP2	23122	genome.wustl.edu	37	3	33668523	33668523	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr3:33668523A>G	ENST00000468888.2	-	10	1041	c.995T>C	c.(994-996)aTt>aCt	p.I332T	CLASP2_ENST00000313350.6_Missense_Mutation_p.I104T|CLASP2_ENST00000487200.1_Missense_Mutation_p.I104T|CLASP2_ENST00000480013.1_Missense_Mutation_p.I98T|CLASP2_ENST00000359576.5_Missense_Mutation_p.I331T|CLASP2_ENST00000307312.7_5'UTR|CLASP2_ENST00000482896.1_5'UTR|CLASP2_ENST00000461133.3_Missense_Mutation_p.I98T|CLASP2_ENST00000333778.6_Missense_Mutation_p.I108T|CLASP2_ENST00000399362.4_Missense_Mutation_p.I331T|CLASP2_ENST00000539981.1_Missense_Mutation_p.I83T			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	98	Ser-rich.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						ATCTGACAAAATTTCCCTGAT	0.284																																						dbGAP											0													61.0	59.0	59.0					3																	33668523		1889	4132	6021	-	-	-	SO:0001583	missense	0			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.995T>C	3.37:g.33668523A>G	ENSP00000419974:p.Ile332Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.I331T	ENST00000468888.2	37	c.992		3	.	.	.	.	.	.	.	.	.	.	A	16.35	3.098171	0.56183	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000539981;ENST00000480013;ENST00000461133;ENST00000313350;ENST00000487200;ENST00000333778;ENST00000485378;ENST00000496954	T;T;T;T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.6	5.6	0.85130	.	0.048036	0.85682	D	0.000000	T	0.45054	0.1323	L	0.42245	1.32	0.80722	D	1	B;P;B;P	0.41569	0.051;0.755;0.041;0.557	B;P;B;B	0.46208	0.098;0.507;0.059;0.234	T	0.45527	-0.9255	10	0.72032	D	0.01	-19.7327	14.3515	0.66705	1.0:0.0:0.0:0.0	.	108;104;104;331	E7ENG2;B3KR06;O75122-2;F5H604	.;.;.;.	T	332;331;331;83;98;98;104;104;108;104;99	ENSP00000419974:I332T;ENSP00000382297:I331T;ENSP00000352581:I331T;ENSP00000439039:I83T;ENSP00000417518:I98T;ENSP00000419305:I98T;ENSP00000324364:I104T;ENSP00000418939:I104T;ENSP00000327760:I108T;ENSP00000418945:I104T;ENSP00000418411:I99T	ENSP00000324364:I104T	I	-	2	0	CLASP2	33643527	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.140000	0.66376	0.477000	0.44152	ATT	CLASP2	-	pfam_CLASP_N_dom,superfamily_ARM-type_fold	ENSG00000163539		0.284	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000344320.4	49	0.00	0	A	NM_001207044		33668523	33668523	-1	no_errors	ENST00000399362	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	G
CNTLN	54875	genome.wustl.edu	37	9	17235769	17235769	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr9:17235769A>T	ENST00000380647.3	+	4	732	c.648A>T	c.(646-648)aaA>aaT	p.K216N	CNTLN_ENST00000425824.1_Missense_Mutation_p.K216N|CNTLN_ENST00000262360.5_Missense_Mutation_p.K216N|CNTLN_ENST00000380641.4_Missense_Mutation_p.K216N			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	216					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AGAAATTTAAAGATAAAAGTC	0.343																																						dbGAP											0													115.0	115.0	115.0					9																	17235769		1832	4084	5916	-	-	-	SO:0001583	missense	0			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.648A>T	9.37:g.17235769A>T	ENSP00000370021:p.Lys216Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	superfamily_Prefoldin	p.K216N	ENST00000380647.3	37	c.648	CCDS43789.1	9	.	.	.	.	.	.	.	.	.	.	A	10.92	1.487647	0.26686	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360;ENST00000380641	T;T;T;T	0.07021	3.23;3.23;3.23;3.23	5.42	2.87	0.33458	.	.	.	.	.	T	0.08044	0.0201	L	0.50333	1.59	0.27362	N	0.955924	B;B;P	0.35793	0.005;0.003;0.521	B;B;B	0.34652	0.009;0.009;0.187	T	0.24476	-1.0159	9	0.17369	T	0.5	.	8.3571	0.32338	0.7318:0.1371:0.0:0.1311	.	216;216;216	C9J1F9;Q9NXG0-2;Q9NXG0-3	.;.;.	N	216	ENSP00000370021:K216N;ENSP00000392798:K216N;ENSP00000262360:K216N;ENSP00000370015:K216N	ENSP00000262360:K216N	K	+	3	2	CNTLN	17225769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.223000	0.42936	0.965000	0.38133	0.528000	0.53228	AAA	CNTLN	-	superfamily_Prefoldin	ENSG00000044459		0.343	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	HGNC	protein_coding	OTTHUMT00000051793.3	482	0.00	0	A	NM_017738		17235769	17235769	+1	no_errors	ENST00000380647	ensembl	human	known	69_37n	missense	273	18.99	64	SNP	1.000	T
CNTN4	152330	genome.wustl.edu	37	3	3080650	3080650	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr3:3080650G>A	ENST00000397461.1	+	18	2510	c.2126G>A	c.(2125-2127)gGc>gAc	p.G709D	CNTN4_ENST00000397459.2_Missense_Mutation_p.G381D|CNTN4_ENST00000427331.1_Missense_Mutation_p.G709D|CNTN4_ENST00000418658.1_Missense_Mutation_p.G709D|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000448906.2_Missense_Mutation_p.G381D|CNTN4_ENST00000358480.3_Missense_Mutation_p.G490D	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	709	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GTCAGTGGTGGCGGAGGCAGC	0.473																																						dbGAP											0													100.0	95.0	97.0					3																	3080650		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2126G>A	3.37:g.3080650G>A	ENSP00000380602:p.Gly709Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G709D	ENST00000397461.1	37	c.2126	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	G	28.4	4.921258	0.92249	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64	5.49	5.49	0.81192	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75095	0.3803	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	0.987;1.0	D;D	0.97110	0.937;1.0	T	0.79396	-0.1821	10	0.54805	T	0.06	.	17.5773	0.87953	0.0:0.0:1.0:0.0	.	708;709	Q8IWV2-3;Q8IWV2	.;CNTN4_HUMAN	D	709;709;709;490;381;381	ENSP00000396010:G709D;ENSP00000380602:G709D;ENSP00000413642:G709D;ENSP00000351267:G490D;ENSP00000380600:G381D;ENSP00000392077:G381D	ENSP00000351267:G490D	G	+	2	0	CNTN4	3055650	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	9.247000	0.95444	2.565000	0.86533	0.655000	0.94253	GGC	CNTN4	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144619		0.473	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	81	0.00	0	G			3080650	3080650	+1	no_errors	ENST00000397461	ensembl	human	known	69_37n	missense	47	28.79	19	SNP	1.000	A
COG3	83548	genome.wustl.edu	37	13	46065675	46065675	+	Splice_Site	SNP	T	T	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr13:46065675T>C	ENST00000349995.5	+	10	1207		c.e10+2		COG3_ENST00000465942.1_Splice_Site	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3						ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		TGTGCCTTGGTAAGTTTCTAC	0.398																																					Ovarian(150;1048 1859 18083 21577 42700)	dbGAP											0													114.0	115.0	115.0					13																	46065675		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1095+2T>C	13.37:g.46065675T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Splice_Site	SNP	-	e10+2	ENST00000349995.5	37	c.1095+2	CCDS9398.1	13	.	.	.	.	.	.	.	.	.	.	T	20.5	3.993679	0.74703	.	.	ENSG00000136152	ENST00000349995	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8287	0.70132	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	COG3	44963676	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	7.765000	0.85310	2.091000	0.63221	0.528000	0.53228	.	COG3	-	-	ENSG00000136152		0.398	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG3	HGNC	protein_coding	OTTHUMT00000044777.2	208	0.00	0	T		Intron	46065675	46065675	+1	no_errors	ENST00000349995	ensembl	human	known	69_37n	splice_site	126	11.89	17	SNP	1.000	C
CPA1	1357	genome.wustl.edu	37	7	130025723	130025723	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:130025723A>G	ENST00000011292.3	+	9	1181	c.1031A>G	c.(1030-1032)tAc>tGc	p.Y344C	CPA1_ENST00000484324.1_Missense_Mutation_p.Y256C	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	344					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					GCCTCTCTCTACGGGACCAAG	0.542																																						dbGAP											0													108.0	94.0	99.0					7																	130025723		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.1031A>G	7.37:g.130025723A>G	ENSP00000011292:p.Tyr344Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.Y344C	ENST00000011292.3	37	c.1031	CCDS5820.1	7	.	.	.	.	.	.	.	.	.	.	A	15.50	2.853455	0.51270	.	.	ENSG00000091704	ENST00000011292;ENST00000476062;ENST00000484324	T;T;T	0.03580	3.88;3.88;3.88	5.44	5.44	0.79542	Peptidase M14, carboxypeptidase A (2);	0.110925	0.64402	D	0.000005	T	0.26448	0.0646	H	0.94345	3.525	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.984;0.989	T	0.21211	-1.0252	10	0.87932	D	0	.	13.7347	0.62811	1.0:0.0:0.0:0.0	.	344;256	P15085;C9JUF9	CBPA1_HUMAN;.	C	344;256;256	ENSP00000011292:Y344C;ENSP00000419408:Y256C;ENSP00000419497:Y256C	ENSP00000011292:Y344C	Y	+	2	0	CPA1	129812959	1.000000	0.71417	0.965000	0.40720	0.184000	0.23303	7.185000	0.77714	2.198000	0.70561	0.533000	0.62120	TAC	CPA1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000091704		0.542	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA1	HGNC	protein_coding	OTTHUMT00000349736.2	19	0.00	0	A	NM_001868		130025723	130025723	+1	no_errors	ENST00000011292	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.999	G
DAPK1	1612	genome.wustl.edu	37	9	90220079	90220079	+	Silent	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr9:90220079G>T	ENST00000408954.3	+	3	608	c.273G>T	c.(271-273)ctG>ctT	p.L91L	DAPK1_ENST00000469640.2_Silent_p.L91L|DAPK1_ENST00000491893.1_Silent_p.L91L|DAPK1_ENST00000358077.5_Silent_p.L91L|DAPK1_ENST00000472284.1_Silent_p.L91L	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	91	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						ACGTCATCCTGATCTTGGAAC	0.617									Chronic Lymphocytic Leukemia, Familial Clustering of																													dbGAP											0													65.0	64.0	64.0					9																	90220079		2196	4298	6494	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.273G>T	9.37:g.90220079G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt	p.L91	ENST00000408954.3	37	c.273	CCDS43842.1	9																																																																																			DAPK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196730		0.617	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	72	0.00	0	G	NM_004938		90220079	90220079	+1	no_errors	ENST00000469640	ensembl	human	known	69_37n	silent	72	16.28	14	SNP	0.859	T
DEFB115	245929	genome.wustl.edu	37	20	29847380	29847380	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr20:29847380A>T	ENST00000400552.1	+	2	212	c.212A>T	c.(211-213)aAg>aTg	p.K71M		NM_001037730.1	NP_001032819.1	Q30KQ5	DB115_HUMAN	defensin, beta 115	71					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|lung(3)|ovary(1)|skin(1)	6			Colorectal(19;0.00445)|COAD - Colon adenocarcinoma(19;0.0347)			CCTAAAGAAAAGGATAAACTA	0.348																																						dbGAP											0													87.0	82.0	83.0					20																	29847380		1864	4107	5971	-	-	-	SO:0001583	missense	0			DQ012019	CCDS42859.1	20q11.1	2008-07-17			ENSG00000215547	ENSG00000215547		"""Defensins, beta"""	18096	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037730		Approved	DEFB-15	uc002wvp.1	Q30KQ5	OTTHUMG00000159284	ENST00000400552.1:c.212A>T	20.37:g.29847380A>T	ENSP00000383398:p.Lys71Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.K71M	ENST00000400552.1	37	c.212	CCDS42859.1	20	.	.	.	.	.	.	.	.	.	.	A	8.425	0.847356	0.17034	.	.	ENSG00000215547	ENST00000400552	T	0.34472	1.36	3.17	2.07	0.26955	.	.	.	.	.	T	0.47857	0.1468	.	.	.	0.09310	N	1	D	0.71674	0.998	P	0.61477	0.889	T	0.27502	-1.0072	8	0.72032	D	0.01	.	5.0088	0.14302	0.86:0.0:0.14:0.0	.	71	Q30KQ5	DB115_HUMAN	M	71	ENSP00000383398:K71M	ENSP00000383398:K71M	K	+	2	0	DEFB115	29311041	0.006000	0.16342	0.013000	0.15412	0.004000	0.04260	0.232000	0.17891	0.627000	0.30340	0.329000	0.21502	AAG	DEFB115	-	NULL	ENSG00000215547		0.348	DEFB115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB115	HGNC	protein_coding	OTTHUMT00000354402.1	188	0.00	0	A	NM_001037730		29847380	29847380	+1	no_errors	ENST00000400552	ensembl	human	known	69_37n	missense	277	15.29	50	SNP	0.015	T
ELOVL6	79071	genome.wustl.edu	37	4	110980805	110980805	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr4:110980805G>C	ENST00000394607.3	-	4	490	c.327C>G	c.(325-327)agC>agG	p.S109R	ELOVL6_ENST00000302274.3_Missense_Mutation_p.S109R|ELOVL6_ENST00000506461.1_5'UTR			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	109					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		CCCAGAATTTGCTGACAGGTC	0.448																																						dbGAP											0													92.0	80.0	84.0					4																	110980805		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.327C>G	4.37:g.110980805G>C	ENSP00000378105:p.Ser109Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5L0|Q8NCD1	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.S109R	ENST00000394607.3	37	c.327	CCDS3690.1	4	.	.	.	.	.	.	.	.	.	.	G	22.7	4.330199	0.81690	.	.	ENSG00000170522	ENST00000394607;ENST00000302274;ENST00000506625	T;T;T	0.22539	1.95;1.95;1.95	5.51	5.51	0.81932	.	0.074811	0.85682	D	0.000000	T	0.26738	0.0654	L	0.52364	1.645	0.80722	D	1	B	0.33299	0.407	B	0.38985	0.287	T	0.02404	-1.1164	10	0.16420	T	0.52	-9.7023	19.8016	0.96509	0.0:0.0:1.0:0.0	.	109	Q9H5J4	ELOV6_HUMAN	R	109	ENSP00000378105:S109R;ENSP00000304736:S109R;ENSP00000425488:S109R	ENSP00000304736:S109R	S	-	3	2	ELOVL6	111200254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.737000	0.98831	2.770000	0.95276	0.655000	0.94253	AGC	ELOVL6	-	pfam_GNS1_SUR4	ENSG00000170522		0.448	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELOVL6	HGNC	protein_coding	OTTHUMT00000255748.1	168	0.59	1	G	NM_024090		110980805	110980805	-1	no_errors	ENST00000394607	ensembl	human	known	69_37n	missense	178	10.10	20	SNP	1.000	C
EPB41L1	2036	genome.wustl.edu	37	20	34775661	34775661	+	Nonsense_Mutation	SNP	C	C	G	rs369598371		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr20:34775661C>G	ENST00000338074.2	+	8	1010	c.849C>G	c.(847-849)taC>taG	p.Y283*	EPB41L1_ENST00000373941.1_Nonsense_Mutation_p.Y283*|EPB41L1_ENST00000441639.1_Nonsense_Mutation_p.Y221*|EPB41L1_ENST00000373950.2_Nonsense_Mutation_p.Y186*|EPB41L1_ENST00000202028.5_Nonsense_Mutation_p.Y221*|EPB41L1_ENST00000373946.3_Nonsense_Mutation_p.Y252*	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	283	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TTTCCATGTACGGAGTAGACC	0.542																																						dbGAP											0													75.0	64.0	68.0					20																	34775661		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.849C>G	20.37:g.34775661C>G	ENSP00000337168:p.Tyr283*	Somatic		WXS	Illumina GAIIx	Phase_IV	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Nonsense_Mutation	SNP	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.Y283*	ENST00000338074.2	37	c.849	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903361	0.72754	.	.	ENSG00000088367	ENST00000202028;ENST00000430276;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	.	.	.	5.65	-10.6	0.00265	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.5852	0.91187	0.0:0.6152:0.0:0.3848	.	.	.	.	X	221;221;186;283;186;221;252;283;283	.	ENSP00000202028:Y221X	Y	+	3	2	EPB41L1	34239075	0.000000	0.05858	0.316000	0.25252	0.952000	0.60782	-2.443000	0.01013	-2.406000	0.00574	-2.035000	0.00420	TAC	EPB41L1	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000088367		0.542	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	81	0.00	0	C	NM_012156		34775661	34775661	+1	no_errors	ENST00000338074	ensembl	human	known	69_37n	nonsense	85	22.73	25	SNP	0.174	G
EXT1	2131	genome.wustl.edu	37	8	118842508	118842508	+	Nonsense_Mutation	SNP	A	A	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr8:118842508A>C	ENST00000378204.2	-	4	2051	c.1245T>G	c.(1243-1245)taT>taG	p.Y415*		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	415					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CTGAAGAAAAATAAGCCTCCC	0.403			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																													dbGAP	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	0													92.0	93.0	92.0					8																	118842508		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1245T>G	8.37:g.118842508A>C	ENSP00000367446:p.Tyr415*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V2|Q9BVI9	Nonsense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.Y415*	ENST00000378204.2	37	c.1245	CCDS6324.1	8	.	.	.	.	.	.	.	.	.	.	a	44	10.628432	0.99440	.	.	ENSG00000182197	ENST00000378204	.	.	.	6.16	6.16	0.99307	.	0.054165	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3948	16.8061	0.85666	1.0:0.0:0.0:0.0	.	.	.	.	X	415	.	ENSP00000367446:Y415X	Y	-	3	2	EXT1	118911689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.926000	0.56491	2.367000	0.80283	0.528000	0.53228	TAT	EXT1	-	NULL	ENSG00000182197		0.403	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXT1	HGNC	protein_coding	OTTHUMT00000132768.3	125	0.00	0	A	NM_000127		118842508	118842508	-1	no_errors	ENST00000378204	ensembl	human	known	69_37n	nonsense	86	49.12	84	SNP	1.000	C
GLUL	2752	genome.wustl.edu	37	1	182354560	182354560	+	Silent	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:182354560C>T	ENST00000331872.6	-	6	1275	c.735G>A	c.(733-735)ggG>ggA	p.G245G	GLUL_ENST00000311223.5_Silent_p.G245G|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000417584.2_Silent_p.G245G|GLUL_ENST00000339526.4_Silent_p.G245G	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	245					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	CATTCCAGTTCCCAGGAATGG	0.517																																						dbGAP											0													57.0	54.0	55.0					1																	182354560		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.735G>A	1.37:g.182354560C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Silent	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.G245	ENST00000331872.6	37	c.735	CCDS1344.1	1																																																																																			GLUL	-	pfam_Gln_synth_cat_dom	ENSG00000135821		0.517	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	HGNC	protein_coding	OTTHUMT00000091043.1	96	0.00	0	C	NM_002065		182354560	182354560	-1	no_errors	ENST00000311223	ensembl	human	known	69_37n	silent	126	12.50	18	SNP	0.004	T
GRIK2	2898	genome.wustl.edu	37	6	102124623	102124623	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:102124623G>C	ENST00000421544.1	+	4	1157	c.667G>C	c.(667-669)Gag>Cag	p.E223Q	GRIK2_ENST00000369137.3_Missense_Mutation_p.E223Q|GRIK2_ENST00000413795.1_Missense_Mutation_p.E223Q|GRIK2_ENST00000318991.6_Missense_Mutation_p.E223Q|GRIK2_ENST00000358361.3_Missense_Mutation_p.E223Q|GRIK2_ENST00000369138.1_Missense_Mutation_p.E223Q|GRIK2_ENST00000369134.4_Missense_Mutation_p.E174Q	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	223					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AAGAGGCAAGGAGTTTCATGT	0.348																																						dbGAP											0													82.0	84.0	83.0					6																	102124623		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.667G>C	6.37:g.102124623G>C	ENSP00000397026:p.Glu223Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E223Q	ENST00000421544.1	37	c.667	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	G	26.6	4.758020	0.89843	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076	D;D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.77	5.77	0.91146	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.89959	0.6866	M	0.74881	2.28	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.981;0.989;0.981	D	0.88339	0.2973	10	0.45353	T	0.12	.	19.9928	0.97374	0.0:0.0:1.0:0.0	.	223;223;223	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	Q	223;223;223;223;223;223;223;174;185	ENSP00000397026:E223Q;ENSP00000405596:E223Q;ENSP00000358134:E223Q;ENSP00000351128:E223Q;ENSP00000358133:E223Q;ENSP00000313276:E223Q;ENSP00000358130:E174Q	ENSP00000313276:E223Q	E	+	1	0	GRIK2	102231316	1.000000	0.71417	0.997000	0.53966	0.924000	0.55760	9.867000	0.99620	2.745000	0.94114	0.650000	0.86243	GAG	GRIK2	-	pfam_ANF_lig-bd_rcpt	ENSG00000164418		0.348	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	152	0.00	0	G			102124623	102124623	+1	no_errors	ENST00000421544	ensembl	human	known	69_37n	missense	79	15.05	14	SNP	1.000	C
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72658101	72658101	+	RNA	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:72658101G>A	ENST00000425256.1	-	0	1810									GTF2I repeat domain containing 2 pseudogene 1																		ttcagtccccgggagcatatc	0.507																																						dbGAP											0																																										-	-	-			0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72658101G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.507	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1	91	0.00	0	G	NR_002164		72658101	72658101	-1	no_errors	ENST00000425256	ensembl	human	known	69_37n	rna	99	22.48	29	SNP	0.993	A
HEG1	57493	genome.wustl.edu	37	3	124748125	124748125	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr3:124748125G>C	ENST00000311127.4	-	2	591	c.524C>G	c.(523-525)tCt>tGt	p.S175C		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	175					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TCTACTTGAAGAGCCGCTCCT	0.507																																						dbGAP											0													91.0	89.0	90.0					3																	124748125		1959	4178	6137	-	-	-	SO:0001583	missense	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.524C>G	3.37:g.124748125G>C	ENSP00000311502:p.Ser175Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.S175C	ENST00000311127.4	37	c.524	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859295	0.71834	.	.	ENSG00000173706	ENST00000311127	T	0.51574	0.7	5.38	5.38	0.77491	.	.	.	.	.	T	0.58652	0.2137	L	0.32530	0.975	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.95	T	0.52779	-0.8530	9	0.72032	D	0.01	.	14.5121	0.67794	0.0:0.0:1.0:0.0	.	175;175	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	C	175	ENSP00000311502:S175C	ENSP00000311502:S175C	S	-	2	0	HEG1	126230815	0.018000	0.18449	0.111000	0.21465	0.199000	0.23934	1.931000	0.40134	2.793000	0.96121	0.655000	0.94253	TCT	HEG1	-	NULL	ENSG00000173706		0.507	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	74	0.00	0	G	XM_087386		124748125	124748125	-1	no_errors	ENST00000311127	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.180	C
HIPK2	28996	genome.wustl.edu	37	7	139305147	139305147	+	Splice_Site	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:139305147C>T	ENST00000406875.3	-	7	1876	c.1782G>A	c.(1780-1782)caG>caA	p.Q594Q	HIPK2_ENST00000342645.6_Splice_Site_p.Q594Q|HIPK2_ENST00000428878.2_Splice_Site_p.Q594Q	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	594	Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					TCCCACTTACCTGGTTGTGGA	0.532																																						dbGAP											0													163.0	157.0	159.0					7																	139305147		2061	4206	6267	-	-	-	SO:0001630	splice_region_variant	0			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1782+1G>A	7.37:g.139305147C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MR7|Q8WWI4|Q9H2Y1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q594	ENST00000406875.3	37	c.1782		7																																																																																			HIPK2	-	NULL	ENSG00000064393		0.532	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	HGNC	protein_coding	OTTHUMT00000349430.3	328	0.00	0	C	NM_022740	Silent	139305147	139305147	-1	no_errors	ENST00000406875	ensembl	human	known	69_37n	silent	215	12.60	31	SNP	1.000	T
HIPK2	28996	genome.wustl.edu	37	7	139416107	139416107	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:139416107C>A	ENST00000406875.3	-	2	821	c.727G>T	c.(727-729)Gaa>Taa	p.E243*	HIPK2_ENST00000342645.6_Nonsense_Mutation_p.E243*|HIPK2_ENST00000428878.2_Nonsense_Mutation_p.E243*	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	243	Interaction with DAXX.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					ATGCTCACTTCAATCTGACCT	0.542																																						dbGAP											0													73.0	65.0	68.0					7																	139416107		1568	3582	5150	-	-	-	SO:0001587	stop_gained	0			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.727G>T	7.37:g.139416107C>A	ENSP00000385571:p.Glu243*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MR7|Q8WWI4|Q9H2Y1	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E243*	ENST00000406875.3	37	c.727		7	.	.	.	.	.	.	.	.	.	.	C	37	6.286908	0.97444	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.6737	0.91521	0.0:1.0:0.0:0.0	.	.	.	.	X	243	.	ENSP00000343108:E243X	E	-	1	0	HIPK2	139062593	1.000000	0.71417	0.996000	0.52242	0.820000	0.46376	7.818000	0.86416	2.394000	0.81467	0.591000	0.81541	GAA	HIPK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000064393		0.542	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	HGNC	protein_coding	OTTHUMT00000349430.3	183	0.00	0	C	NM_022740		139416107	139416107	-1	no_errors	ENST00000406875	ensembl	human	known	69_37n	nonsense	203	10.18	23	SNP	1.000	A
HNF4A	3172	genome.wustl.edu	37	20	43042402	43042402	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr20:43042402A>T	ENST00000316099.4	+	4	543	c.454A>T	c.(454-456)Atc>Ttc	p.I152F	HNF4A_ENST00000316673.4_Missense_Mutation_p.I130F|HNF4A_ENST00000443598.2_Missense_Mutation_p.I152F|HNF4A_ENST00000457232.1_Missense_Mutation_p.I130F|HNF4A_ENST00000609795.1_Missense_Mutation_p.I130F|HNF4A_ENST00000415691.2_Missense_Mutation_p.I152F	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	152					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCTGCCCTCCATCAATGCGCT	0.632																																					Colon(79;2 1269 8820 14841 52347)	dbGAP											0													78.0	59.0	66.0					20																	43042402		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.454A>T	20.37:g.43042402A>T	ENSP00000312987:p.Ile152Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.I152F	ENST00000316099.4	37	c.454	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	A	27.3	4.820067	0.90873	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37	5.16	5.16	0.70880	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.94231	0.8148	M	0.79475	2.455	0.80722	D	1	P;B;B;P;B;B;B	0.43477	0.808;0.015;0.005;0.763;0.016;0.013;0.218	B;B;B;P;B;B;B	0.46076	0.288;0.031;0.021;0.503;0.023;0.051;0.046	D	0.94881	0.8039	10	0.87932	D	0	.	14.9881	0.71365	1.0:0.0:0.0:0.0	.	145;152;152;152;130;130;130	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	F	130;130;152;152;182;152	ENSP00000315180:I130F;ENSP00000396216:I130F;ENSP00000312987:I152F;ENSP00000410911:I152F;ENSP00000412111:I152F	ENSP00000312987:I152F	I	+	1	0	HNF4A	42475816	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.299000	0.96137	1.934000	0.56057	0.455000	0.32223	ATC	HNF4A	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000101076		0.632	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	35	0.00	0	A			43042402	43042402	+1	no_errors	ENST00000316099	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	T
HUWE1	10075	genome.wustl.edu	37	X	53644083	53644083	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chrX:53644083C>G	ENST00000342160.3	-	20	2262	c.1805G>C	c.(1804-1806)gGc>gCc	p.G602A	HUWE1_ENST00000262854.6_Missense_Mutation_p.G602A|HUWE1_ENST00000218328.8_Missense_Mutation_p.G602A			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	602					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.G602V(2)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGGGAGGGAGCCAAGGACTTC	0.453																																						dbGAP											2	Substitution - Missense(2)	lung(2)											54.0	49.0	51.0					X																	53644083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.1805G>C	X.37:g.53644083C>G	ENSP00000340648:p.Gly602Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.G602A	ENST00000342160.3	37	c.1805	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578186	0.65878	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.64085	-0.08;-0.08;1.0	5.45	5.45	0.79879	E3 ubiquitin ligase, domain of unknown function DUF913 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	N	0.13327	0.33	0.80722	D	1	P	0.39576	0.679	P	0.47134	0.539	T	0.55471	-0.8136	10	0.30078	T	0.28	.	17.0476	0.86508	0.0:1.0:0.0:0.0	.	602	Q7Z6Z7	HUWE1_HUMAN	A	602	ENSP00000340648:G602A;ENSP00000262854:G602A;ENSP00000218328:G602A	ENSP00000218328:G602A	G	-	2	0	HUWE1	53660808	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	7.421000	0.80204	2.289000	0.77006	0.594000	0.82650	GGC	HUWE1	-	pfam_E3_Ub_ligase_DUF913,superfamily_ARM-type_fold	ENSG00000086758		0.453	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	124	0.00	0	C	XM_497119		53644083	53644083	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	101	12.17	14	SNP	1.000	G
IFNA10	3446	genome.wustl.edu	37	9	21206600	21206600	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr9:21206600A>C	ENST00000357374.2	-	1	542	c.497T>G	c.(496-498)gTt>gGt	p.V166G		NM_002171.1	NP_002162.1	P01566	IFN10_HUMAN	interferon, alpha 10	166					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(1)|large_intestine(3)|liver(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		TGCTCTGACAACCTCCCAGGC	0.428																																						dbGAP											0													246.0	250.0	249.0					9																	21206600		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6499.1	9p22	2010-08-24			ENSG00000186803	ENSG00000186803		"""Interferons"""	5418	protein-coding gene	gene with protein product		147577				1385305	Standard	NM_002171		Approved	IFN-alphaC	uc003zoq.1	P01566	OTTHUMG00000019658	ENST00000357374.2:c.497T>G	9.37:g.21206600A>C	ENSP00000369566:p.Val166Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV13	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.V166G	ENST00000357374.2	37	c.497	CCDS6499.1	9	.	.	.	.	.	.	.	.	.	.	-	17.34	3.365694	0.61513	.	.	ENSG00000186803	ENST00000357374	T	0.04603	3.59	3.75	1.35	0.21983	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.603739	0.16506	N	0.211438	T	0.21841	0.0526	M	0.90870	3.155	0.09310	N	0.999993	D	0.57899	0.981	D	0.70935	0.971	T	0.04307	-1.0961	10	0.87932	D	0	.	6.2313	0.20736	0.7807:0.0:0.2193:0.0	.	166	P01566	IFN10_HUMAN	G	166	ENSP00000369566:V166G	ENSP00000369566:V166G	V	-	2	0	IFNA10	21196600	0.000000	0.05858	0.022000	0.16811	0.853000	0.48598	0.185000	0.16958	0.052000	0.16007	0.409000	0.27619	GTT	IFNA10	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	ENSG00000186803		0.428	IFNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA10	HGNC	protein_coding	OTTHUMT00000051887.1	637	0.93	6	A	NM_002171		21206600	21206600	-1	no_errors	ENST00000357374	ensembl	human	known	69_37n	missense	454	14.15	75	SNP	0.013	C
IFT46	56912	genome.wustl.edu	37	11	118416559	118416559	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr11:118416559G>T	ENST00000264021.3	-	10	1100	c.682C>A	c.(682-684)Ccc>Acc	p.P228T	IFT46_ENST00000264020.2_Missense_Mutation_p.P279T|TMEM25_ENST00000354284.4_Intron|IFT46_ENST00000530872.1_Missense_Mutation_p.P279T|TMEM25_ENST00000442938.2_Intron	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	228					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						TCTGCCGTGGGCAGGCTTACC	0.512																																						dbGAP											0													134.0	110.0	118.0					11																	118416559		2200	4295	6495	-	-	-	SO:0001583	missense	0			AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.682C>A	11.37:g.118416559G>T	ENSP00000264021:p.Pro228Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0F6|Q9H6V5	Missense_Mutation	SNP	pfam_Intraflagellar_transp_cmplxB	p.P279T	ENST00000264021.3	37	c.835	CCDS53718.1	11	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947534	0.73787	.	.	ENSG00000118096	ENST00000264021;ENST00000264020;ENST00000530872	T;T;T	0.56444	0.5;0.46;0.47	6.03	6.03	0.97812	.	0.055980	0.64402	D	0.000001	T	0.58221	0.2107	M	0.68593	2.085	0.80722	D	1	P;P;P	0.41475	0.568;0.751;0.707	B;B;B	0.40375	0.229;0.327;0.278	T	0.62315	-0.6880	10	0.72032	D	0.01	-4.558	20.177	0.98182	0.0:0.0:1.0:0.0	.	279;228;279	E9PR06;Q9NQC8;Q9NQC8-2	.;IFT46_HUMAN;.	T	228;279;279	ENSP00000264021:P228T;ENSP00000264020:P279T;ENSP00000432384:P279T	ENSP00000264020:P279T	P	-	1	0	IFT46	117921769	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.813000	0.86123	2.854000	0.98071	0.655000	0.94253	CCC	IFT46	-	pfam_Intraflagellar_transp_cmplxB	ENSG00000118096		0.512	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT46	HGNC	protein_coding	OTTHUMT00000389627.1	81	0.00	0	G	NM_020153		118416559	118416559	-1	no_errors	ENST00000264020	ensembl	human	known	69_37n	missense	78	29.73	33	SNP	1.000	T
IFT52	51098	genome.wustl.edu	37	20	42275617	42275617	+	Silent	SNP	T	T	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr20:42275617T>C	ENST00000373030.3	+	14	1438	c.1308T>C	c.(1306-1308)aaT>aaC	p.N436N	IFT52_ENST00000471199.1_3'UTR|IFT52_ENST00000373039.4_Silent_p.N436N	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	436					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TCCAGAACAATTTCTGAAGAC	0.328																																						dbGAP											0													174.0	163.0	167.0					20																	42275617		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1308T>C	20.37:g.42275617T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Silent	SNP	pfam_ABC_transp_unknown	p.N436	ENST00000373030.3	37	c.1308	CCDS33470.1	20																																																																																			IFT52	-	NULL	ENSG00000101052		0.328	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	HGNC	protein_coding	OTTHUMT00000079317.1	128	0.00	0	T	NM_016004		42275617	42275617	+1	no_errors	ENST00000373030	ensembl	human	known	69_37n	silent	184	28.68	74	SNP	0.855	C
INPP5J	27124	genome.wustl.edu	37	22	31522391	31522391	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr22:31522391C>A	ENST00000331075.5	+	3	1350	c.1301C>A	c.(1300-1302)aCt>aAt	p.T434N	INPP5J_ENST00000404453.1_5'Flank|INPP5J_ENST00000405300.1_Missense_Mutation_p.T67N|INPP5J_ENST00000412277.2_Missense_Mutation_p.T367N|INPP5J_ENST00000404390.3_Missense_Mutation_p.T66N|INPP5J_ENST00000401755.1_5'Flank|INPP5J_ENST00000400294.2_Missense_Mutation_p.T67N|INPP5J_ENST00000402238.1_5'Flank	NM_001284285.1	NP_001271214.1	Q15735	PI5PA_HUMAN	inositol polyphosphate-5-phosphatase J	434	Catalytic. {ECO:0000255}.				inositol phosphate metabolic process (GO:0043647)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	12						AACGTGGGCACTGCCATGCCC	0.617																																						dbGAP											0													122.0	130.0	127.0					22																	31522391		2173	4256	6429	-	-	-	SO:0001583	missense	0			U45975	CCDS46687.1, CCDS63453.1, CCDS63454.1, CCDS63455.1, CCDS74847.1	22q12.2	2008-09-09	2008-09-09	2008-09-09	ENSG00000185133	ENSG00000185133			8956	protein-coding gene	gene with protein product		606481	"""phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A"""	PIB5PA		10591208	Standard	NM_001284287		Approved	INPP5	uc003aju.4	Q15735	OTTHUMG00000151206	ENST00000331075.5:c.1301C>A	22.37:g.31522391C>A	ENSP00000333262:p.Thr434Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS54|Q32M61|Q6ZTH6|Q8N902|Q9UDT9	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.T434N	ENST00000331075.5	37	c.1301		22	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930432	0.73327	.	.	ENSG00000185133	ENST00000331075;ENST00000412277;ENST00000400294;ENST00000405300;ENST00000404390	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	4.8	4.8	0.61643	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.263947	0.37669	N	0.001992	D	0.82384	0.5025	N	0.26042	0.785	0.43187	D	0.995019	D;B	0.71674	0.998;0.198	D;B	0.72625	0.978;0.171	T	0.82303	-0.0524	10	0.41790	T	0.15	.	13.9412	0.64057	0.0:0.8479:0.1521:0.0	.	434;66	Q15735;Q15735-3	PI5PA_HUMAN;.	N	434;367;67;67;66	ENSP00000333262:T434N;ENSP00000392924:T367N;ENSP00000383150:T67N;ENSP00000384596:T67N;ENSP00000384534:T66N	ENSP00000333262:T434N	T	+	2	0	INPP5J	29852391	0.999000	0.42202	0.959000	0.39883	0.813000	0.45954	4.555000	0.60767	2.395000	0.81488	0.561000	0.74099	ACT	INPP5J	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000185133		0.617	INPP5J-002	KNOWN	basic|appris_candidate_longest	protein_coding	INPP5J	HGNC	protein_coding	OTTHUMT00000321784.1	44	0.00	0	C	NM_001002837		31522391	31522391	+1	no_errors	ENST00000331075	ensembl	human	known	69_37n	missense	38	11.36	5	SNP	0.994	A
IQCD	115811	genome.wustl.edu	37	12	113633529	113633529	+	Missense_Mutation	SNP	C	C	G	rs139909736		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr12:113633529C>G	ENST00000416617.2	-	5	1391	c.1201G>C	c.(1201-1203)Gta>Cta	p.V401L	IQCD_ENST00000299732.2_Missense_Mutation_p.V299L			Q96DY2	IQCD_HUMAN	IQ motif containing D	401	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.									endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						GCCGCCCGTACCATGCGCACC	0.587																																						dbGAP											0													156.0	138.0	144.0					12																	113633529		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.1201G>C	12.37:g.113633529C>G	ENSP00000400669:p.Val401Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZSU0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.V401L	ENST00000416617.2	37	c.1201		12	.	.	.	.	.	.	.	.	.	.	C	12.06	1.824278	0.32237	.	.	ENSG00000166578	ENST00000299732;ENST00000416617	T;T	0.45276	3.0;0.9	4.14	1.31	0.21738	.	.	.	.	.	T	0.45816	0.1361	.	.	.	0.80722	D	1	P	0.52316	0.952	P	0.53649	0.731	T	0.26155	-1.0111	8	0.35671	T	0.21	-11.0971	7.2071	0.25913	0.0:0.6229:0.0:0.3771	.	299	Q96DY2-2	.	L	299;401	ENSP00000299732:V299L;ENSP00000400669:V401L	ENSP00000299732:V299L	V	-	1	0	IQCD	112117912	0.981000	0.34729	0.446000	0.26920	0.267000	0.26476	0.717000	0.25851	0.085000	0.17107	0.561000	0.74099	GTA	IQCD	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000166578		0.587	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	IQCD	HGNC	protein_coding	OTTHUMT00000405327.1	69	0.00	0	C	NM_138451		113633529	113633529	-1	no_errors	ENST00000416617	ensembl	human	known	69_37n	missense	66	20.48	17	SNP	0.985	G
IRAK2	3656	genome.wustl.edu	37	3	10255044	10255044	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr3:10255044C>T	ENST00000256458.4	+	5	772	c.682C>T	c.(682-684)Cac>Tac	p.H228Y		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	228	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						CTACAGAGGGCACAGGCACGG	0.562																																						dbGAP											0													64.0	62.0	63.0					3																	10255044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.682C>T	3.37:g.10255044C>T	ENSP00000256458:p.His228Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQZ6|Q08AG6|Q5K546	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H228Y	ENST00000256458.4	37	c.682	CCDS33697.1	3	.	.	.	.	.	.	.	.	.	.	C	0.030	-1.342770	0.01277	.	.	ENSG00000134070	ENST00000256458	T	0.33438	1.41	5.48	3.68	0.42216	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.706306	0.13268	N	0.400744	T	0.13243	0.0321	N	0.11313	0.125	0.09310	N	1	B	0.31383	0.321	B	0.30251	0.113	T	0.24440	-1.0160	10	0.02654	T	1	-1.0597	8.2982	0.31997	0.0:0.7607:0.1551:0.0841	.	228	O43187	IRAK2_HUMAN	Y	228	ENSP00000256458:H228Y	ENSP00000256458:H228Y	H	+	1	0	IRAK2	10230044	0.760000	0.28428	0.017000	0.16124	0.021000	0.10359	1.360000	0.34125	0.780000	0.33566	-0.126000	0.14955	CAC	IRAK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000134070		0.562	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	HGNC	protein_coding	OTTHUMT00000339623.1	54	0.00	0	C			10255044	10255044	+1	no_errors	ENST00000256458	ensembl	human	known	69_37n	missense	79	11.24	10	SNP	0.086	T
JAK2	3717	genome.wustl.edu	37	9	5022119	5022119	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr9:5022119C>A	ENST00000381652.3	+	3	626	c.132C>A	c.(130-132)taC>taA	p.Y44*	JAK2_ENST00000539801.1_Nonsense_Mutation_p.Y44*	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	44	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TGTATCTTTACCATTCCCTTG	0.403		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																													dbGAP		Dom	yes		9	9p24	3717	Janus kinase 2		L	0													145.0	138.0	141.0					9																	5022119		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database			CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.132C>A	9.37:g.5022119C>A	ENSP00000371067:p.Tyr44*	Somatic		WXS	Illumina GAIIx	Phase_IV	O14636|O75297	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak2,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y44*	ENST00000381652.3	37	c.132	CCDS6457.1	9	.	.	.	.	.	.	.	.	.	.	C	18.14	3.556984	0.65425	.	.	ENSG00000096968	ENST00000539801;ENST00000381652	.	.	.	5.57	0.111	0.14619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.2886	10.5271	0.44954	0.0:0.3907:0.0:0.6093	.	.	.	.	X	44	.	.	Y	+	3	2	JAK2	5012119	1.000000	0.71417	0.995000	0.50966	0.928000	0.56348	0.983000	0.29552	-0.230000	0.09840	0.460000	0.39030	TAC	JAK2	-	smart_Band_41_domain,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain	ENSG00000096968		0.403	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK2	HGNC	protein_coding	OTTHUMT00000051609.1	548	0.00	0	C			5022119	5022119	+1	no_errors	ENST00000381652	ensembl	human	known	69_37n	nonsense	289	34.17	150	SNP	0.996	A
KCNQ5	56479	genome.wustl.edu	37	6	73900398	73900398	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:73900398G>T	ENST00000370398.1	+	12	1789	c.1680G>T	c.(1678-1680)atG>atT	p.M560I	KCNQ5_ENST00000414165.2_Missense_Mutation_p.M450I|KCNQ5_ENST00000355194.4_Missense_Mutation_p.M560I|KCNQ5_ENST00000342056.2_Missense_Mutation_p.M579I|KCNQ5_ENST00000403813.2_Missense_Mutation_p.M551I|KCNQ5_ENST00000402622.2_Missense_Mutation_p.M570I|KCNQ5_ENST00000355635.3_Missense_Mutation_p.M561I	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	560					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	ATCTGGACATGTTGTGTAGAA	0.353																																					GBM(142;1375 1859 14391 23261 44706)	dbGAP											0													106.0	91.0	96.0					6																	73900398		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1680G>T	6.37:g.73900398G>T	ENSP00000359425:p.Met560Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.M570I	ENST00000370398.1	37	c.1710	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443737	0.83993	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99698	-6.44;-6.44;-6.44;-6.44;-6.44;-6.44;-6.44	5.04	4.17	0.49024	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99576	0.9847	M	0.84511	2.7	0.30034	N	0.813177	P;D;D;D;D	0.69078	0.813;0.984;0.997;0.997;0.988	P;D;D;D;D	0.71870	0.469;0.943;0.975;0.974;0.966	D	0.98740	1.0716	10	0.87932	D	0	.	13.6069	0.62052	0.0757:0.0:0.9243:0.0	.	450;570;579;551;560	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	I	579;579;560;560;570;561;551;450	ENSP00000345055:M579I;ENSP00000347326:M560I;ENSP00000359425:M560I;ENSP00000385501:M570I;ENSP00000347853:M561I;ENSP00000384453:M551I;ENSP00000409861:M450I	ENSP00000345055:M579I	M	+	3	0	KCNQ5	73957119	1.000000	0.71417	0.944000	0.38274	0.996000	0.88848	9.864000	0.99589	1.093000	0.41377	0.655000	0.94253	ATG	KCNQ5	-	pfam_K_chnl_volt-dep_KCNQ_C	ENSG00000185760		0.353	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	125	0.00	0	G	NM_019842		73900398	73900398	+1	no_errors	ENST00000402622	ensembl	human	known	69_37n	missense	99	18.85	23	SNP	1.000	T
KIF20B	9585	genome.wustl.edu	37	10	91497158	91497158	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr10:91497158A>T	ENST00000371728.3	+	20	2625	c.2560A>T	c.(2560-2562)Agt>Tgt	p.S854C	KIF20B_ENST00000260753.4_Missense_Mutation_p.S814C|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000416354.1_Missense_Mutation_p.S884C|KIF20B_ENST00000394289.2_Missense_Mutation_p.S854C	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	854					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TATCCATGTTAGTTCAGCTAT	0.318																																						dbGAP											0													37.0	42.0	40.0					10																	91497158		2193	4291	6484	-	-	-	SO:0001583	missense	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.2560A>T	10.37:g.91497158A>T	ENSP00000360793:p.Ser854Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S884C	ENST00000371728.3	37	c.2650		10	.	.	.	.	.	.	.	.	.	.	A	12.26	1.885675	0.33255	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.72051	-0.62;-0.55;-0.59;-0.52	5.67	0.844	0.18943	.	0.551479	0.17846	N	0.160035	T	0.71065	0.3296	L	0.38838	1.175	0.09310	N	1	D;D	0.76494	0.999;0.979	P;P	0.61328	0.887;0.723	T	0.62144	-0.6916	10	0.87932	D	0	-0.2119	8.7924	0.34859	0.6087:0.0:0.3913:0.0	.	854;814	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	C	814;884;854;854	ENSP00000260753:S814C;ENSP00000411545:S884C;ENSP00000377830:S854C;ENSP00000360793:S854C	ENSP00000260753:S814C	S	+	1	0	KIF20B	91487138	0.007000	0.16637	0.000000	0.03702	0.823000	0.46562	2.347000	0.44036	0.114000	0.18032	0.397000	0.26171	AGT	KIF20B	-	NULL	ENSG00000138182		0.318	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	229	0.00	0	A	NM_016195		91497158	91497158	+1	no_errors	ENST00000416354	ensembl	human	known	69_37n	missense	141	10.19	16	SNP	0.000	T
KIT	3815	genome.wustl.edu	37	4	55589813	55589813	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr4:55589813G>A	ENST00000288135.5	+	8	1392	c.1295G>A	c.(1294-1296)gGa>gAa	p.G432E		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	432	Ig-like C2-type 5.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTGGCAGCAGGATTCCCAGAG	0.463		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													dbGAP	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													117.0	106.0	110.0					4																	55589813		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1295G>A	4.37:g.55589813G>A	ENSP00000288135:p.Gly432Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.G432E	ENST00000288135.5	37	c.1295	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539967	0.65085	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.24151	3.74;1.87	6.04	6.04	0.98038	Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000025	T	0.62514	0.2434	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67841	-0.5566	10	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	432;432	P10721-2;P10721	.;KIT_HUMAN	E	432	ENSP00000288135:G432E;ENSP00000390987:G432E	ENSP00000288135:G432E	G	+	2	0	KIT	55284570	1.000000	0.71417	0.991000	0.47740	0.111000	0.19643	9.110000	0.94302	2.873000	0.98535	0.563000	0.77884	GGA	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000157404		0.463	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	94	0.00	0	G			55589813	55589813	+1	no_errors	ENST00000288135	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	A
KRT3	3850	genome.wustl.edu	37	12	53184633	53184633	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr12:53184633G>A	ENST00000417996.2	-	8	1633	c.1559C>T	c.(1558-1560)gCt>gTt	p.A520V	KRT3_ENST00000309505.3_Missense_Mutation_p.A521V	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	520	Tail.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GATGCTGACAGCACTCGGACA	0.428																																						dbGAP											0													67.0	65.0	65.0					12																	53184633		2014	4183	6197	-	-	-	SO:0001583	missense	0				CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1559C>T	12.37:g.53184633G>A	ENSP00000413479:p.Ala520Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIS2|Q701L8	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.A521V	ENST00000417996.2	37	c.1562	CCDS44895.1	12	.	.	.	.	.	.	.	.	.	.	G	14.51	2.555621	0.45487	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	T;T	0.53640	0.61;0.61	5.33	4.38	0.52667	.	0.152578	0.30879	N	0.008694	T	0.41305	0.1153	L	0.43923	1.385	0.26807	N	0.969076	P	0.41673	0.759	B	0.40410	0.328	T	0.44952	-0.9294	10	0.56958	D	0.05	.	12.3173	0.54964	0.0:0.0:0.712:0.288	.	520	P12035	K2C3_HUMAN	V	520;521	ENSP00000413479:A520V;ENSP00000312206:A521V	ENSP00000312206:A521V	A	-	2	0	KRT3	51470900	0.258000	0.24033	1.000000	0.80357	0.552000	0.35366	2.981000	0.49329	2.670000	0.90874	0.561000	0.74099	GCT	KRT3	-	NULL	ENSG00000186442		0.428	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRT3	HGNC	protein_coding	OTTHUMT00000405930.1	31	0.00	0	G	NM_057088		53184633	53184633	-1	no_errors	ENST00000309505	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.999	A
LGR5	8549	genome.wustl.edu	37	12	71978313	71978313	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr12:71978313G>T	ENST00000266674.5	+	18	2834	c.2523G>T	c.(2521-2523)tgG>tgT	p.W841C	LGR5_ENST00000540815.2_Missense_Mutation_p.W817C|LGR5_ENST00000536515.1_Missense_Mutation_p.W769C|RP11-186F10.2_ENST00000546601.1_RNA			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	841					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						CCTACGTCTGGACAAGATCAA	0.448																																						dbGAP											0													132.0	126.0	128.0					12																	71978313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2523G>T	12.37:g.71978313G>T	ENSP00000266674:p.Trp841Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.W841C	ENST00000266674.5	37	c.2523	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507592	0.27036	.	.	ENSG00000139292	ENST00000266674;ENST00000536515;ENST00000540815	T;T;T	0.36520	1.25;1.25;1.25	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000007	T	0.45196	0.1330	M	0.73598	2.24	0.80722	D	1	B;B	0.17852	0.024;0.007	B;B	0.18871	0.023;0.005	T	0.35226	-0.9797	10	0.59425	D	0.04	.	19.3434	0.94355	0.0:0.0:1.0:0.0	.	817;841	O75473-2;O75473	.;LGR5_HUMAN	C	841;769;817	ENSP00000266674:W841C;ENSP00000443033:W769C;ENSP00000441035:W817C	ENSP00000266674:W841C	W	+	3	0	LGR5	70264580	1.000000	0.71417	0.931000	0.37212	0.554000	0.35429	5.417000	0.66423	2.812000	0.96745	0.557000	0.71058	TGG	LGR5	-	NULL	ENSG00000139292		0.448	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	252	0.00	0	G	NM_003667		71978313	71978313	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	missense	263	14.61	45	SNP	1.000	T
LMX1A	4009	genome.wustl.edu	37	1	165173228	165173228	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:165173228A>T	ENST00000342310.3	-	9	1420	c.1038T>A	c.(1036-1038)agT>agA	p.S346R	LMX1A_ENST00000294816.2_Missense_Mutation_p.S346R|LMX1A_ENST00000489443.2_5'UTR|LMX1A_ENST00000367893.4_Missense_Mutation_p.S346R	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	346					axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					CACCCAGGTTACTGAGGGAGG	0.507																																						dbGAP											0													110.0	105.0	106.0					1																	165173228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.1038T>A	1.37:g.165173228A>T	ENSP00000340226:p.Ser346Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.S346R	ENST00000342310.3	37	c.1038	CCDS1247.1	1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.474447	0.43942	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	D;D;D	0.86769	-2.17;-2.17;-2.17	5.14	2.85	0.33270	.	0.253377	0.45361	D	0.000361	T	0.59390	0.2190	L	0.34521	1.04	0.34861	D	0.742659	P	0.40000	0.698	B	0.30401	0.115	T	0.51458	-0.8703	9	0.29301	T	0.29	.	6.6644	0.23032	0.5998:0.0:0.4002:0.0	.	346	Q8TE12	LMX1A_HUMAN	R	346	ENSP00000340226:S346R;ENSP00000294816:S346R;ENSP00000356868:S346R	ENSP00000294816:S346R	S	-	3	2	LMX1A	163439852	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.199000	0.51043	0.443000	0.26582	-0.379000	0.06801	AGT	LMX1A	-	NULL	ENSG00000162761		0.507	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMX1A	HGNC	protein_coding	OTTHUMT00000083668.2	88	0.00	0	A	NM_177398		165173228	165173228	-1	no_errors	ENST00000294816	ensembl	human	known	69_37n	missense	54	17.91	12	SNP	1.000	T
LOXL4	84171	genome.wustl.edu	37	10	100015449	100015449	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr10:100015449C>A	ENST00000260702.3	-	10	1626	c.1476G>T	c.(1474-1476)atG>atT	p.M492I	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	492	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GCACCCCACTCATCACCACCT	0.667																																						dbGAP											0													69.0	64.0	66.0					10																	100015449		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1476G>T	10.37:g.100015449C>A	ENSP00000260702:p.Met492Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Lysyl_oxidase,prints_Srcr_rcpt	p.M492I	ENST00000260702.3	37	c.1476	CCDS7473.1	10	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234381	0.58886	.	.	ENSG00000138131	ENST00000260702	T	0.34859	1.34	5.25	5.25	0.73442	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.087074	0.85682	D	0.000000	T	0.45397	0.1340	M	0.79258	2.445	0.49798	D	0.999828	B	0.30511	0.282	B	0.30029	0.11	T	0.51132	-0.8744	10	0.72032	D;D	0.01;0.01	.	18.8572	0.92257	0.0:1.0:0.0:0.0	.	492	Q96JB6	LOXL4_HUMAN	I	492	ENSP00000260702:M492I	ENSP00000260702:M492I;ENSP00000260702:M492I	M	-	3	0	LOXL4	100005439	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.809000	0.55606	2.456000	0.83038	0.561000	0.74099	ATG	LOXL4	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000138131		0.667	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL4	HGNC	protein_coding	OTTHUMT00000049766.1	40	0.00	0	C	NM_032211		100015449	100015449	-1	no_errors	ENST00000260702	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	A
LZTS1	11178	genome.wustl.edu	37	8	20112577	20112577	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr8:20112577T>C	ENST00000381569.1	-	2	473	c.116A>G	c.(115-117)gAc>gGc	p.D39G	LZTS1_ENST00000522290.1_Missense_Mutation_p.D39G|LZTS1_ENST00000265801.6_Missense_Mutation_p.D39G			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	39					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CAGCAGCCCGTCGGAATACCG	0.582																																						dbGAP											0													80.0	81.0	81.0					8																	20112577		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.116A>G	8.37:g.20112577T>C	ENSP00000370981:p.Asp39Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	pfam_Fez1	p.D39G	ENST00000381569.1	37	c.116	CCDS6015.1	8	.	.	.	.	.	.	.	.	.	.	T	27.3	4.819647	0.90873	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248;ENST00000334294	T;T;T	0.37584	1.58;1.58;1.19	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.987;0.998	T	0.54892	-0.8225	10	0.87932	D	0	-39.8934	15.3021	0.73962	0.0:0.0:0.0:1.0	.	39;39	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	G	39	ENSP00000370981:D39G;ENSP00000265801:D39G;ENSP00000429263:D39G	ENSP00000265801:D39G	D	-	2	0	LZTS1	20156857	1.000000	0.71417	0.910000	0.35882	0.881000	0.50899	5.898000	0.69838	2.288000	0.76882	0.528000	0.53228	GAC	LZTS1	-	NULL	ENSG00000061337		0.582	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS1	HGNC	protein_coding	OTTHUMT00000214122.1	60	0.00	0	T	NM_021020		20112577	20112577	-1	no_errors	ENST00000265801	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.999	C
MACF1	23499	genome.wustl.edu	37	1	39799640	39799640	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:39799640T>G	ENST00000372915.3	+	36	7482	c.7395T>G	c.(7393-7395)atT>atG	p.I2465M	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.I900M|MACF1_ENST00000564288.1_Missense_Mutation_p.I2460M|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.I2497M|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2465					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGATTAATTAGTTTACAAA	0.423																																						dbGAP											0													87.0	93.0	91.0					1																	39799640		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.7395T>G	1.37:g.39799640T>G	ENSP00000362006:p.Ile2465Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.I2497M	ENST00000372915.3	37	c.7491		1	.	.	.	.	.	.	.	.	.	.	T	5.290	0.238975	0.10023	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.68181	-0.31;-0.31	5.37	-1.06	0.10002	.	0.000000	0.53938	D	0.000046	T	0.69260	0.3091	L	0.50333	1.59	0.40360	D	0.979237	D	0.56521	0.976	P	0.60068	0.868	T	0.68633	-0.5357	10	0.66056	D	0.02	.	9.7553	0.40500	0.0:0.3977:0.0:0.6023	.	2465	Q9UPN3	MACF1_HUMAN	M	2465;900	ENSP00000362006:I2465M;ENSP00000289893:I900M	ENSP00000289893:I900M	I	+	3	3	MACF1	39572227	0.003000	0.15002	0.064000	0.19789	0.995000	0.86356	-0.032000	0.12266	-0.200000	0.10300	0.459000	0.35465	ATT	MACF1	-	superfamily_RNaseH-like_dom,smart_Plectin_repeat	ENSG00000127603		0.423	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	322	0.00	0	T	NM_033044		39799640	39799640	+1	no_errors	ENST00000567887	ensembl	human	putative	69_37n	missense	213	11.98	29	SNP	0.154	G
MGAM	8972	genome.wustl.edu	37	7	141766522	141766522	+	Intron	SNP	G	G	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:141766522G>C	ENST00000549489.2	+	38	4713				MGAM_ENST00000475668.2_Splice_Site	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGCTCCATGAGTGAGTGTCCA	0.483																																						dbGAP											0													252.0	198.0	215.0					7																	141766522		875	1949	2824	-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4618+1254G>C	7.37:g.141766522G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Splice_Site	SNP	-	e40+1	ENST00000549489.2	37	c.4919+1	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862344	0.32884	.	.	ENSG00000257335	ENST00000475668;ENST00000548812	.	.	.	3.82	3.82	0.43975	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5521	0.68073	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MGAM	141412991	1.000000	0.71417	1.000000	0.80357	0.141000	0.21300	9.607000	0.98328	1.675000	0.50919	0.306000	0.20318	.	MGAM	-	-	ENSG00000257335		0.483	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	85	0.00	0	G			141766522	141766522	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	splice_site	71	18.39	16	SNP	1.000	C
MGAM	8972	genome.wustl.edu	37	7	141802435	141802435	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:141802435T>G	ENST00000549489.2	+	46	5376	c.5281T>G	c.(5281-5283)Tat>Gat	p.Y1761D	MGAM_ENST00000475668.2_Missense_Mutation_p.Y2657D	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1761	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGCAGATACCTATGGGAAAGG	0.428																																						dbGAP											0													159.0	145.0	149.0					7																	141802435		1887	4122	6009	-	-	-	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.5281T>G	7.37:g.141802435T>G	ENSP00000447378:p.Tyr1761Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.Y1761D	ENST00000549489.2	37	c.5281	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359206	0.61403	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.90504	-2.68	6.07	-0.794	0.10918	.	.	.	.	.	D	0.85613	0.5737	M	0.76727	2.345	0.22199	N	0.999291	B	0.33135	0.399	B	0.25506	0.061	T	0.75622	-0.3254	9	0.72032	D	0.01	.	2.0248	0.03516	0.3927:0.0748:0.1359:0.3966	.	1761	O43451	MGA_HUMAN	D	1761;2658	ENSP00000447378:Y1761D	ENSP00000373973:Y1761D	Y	+	1	0	MGAM	141448904	0.923000	0.31300	0.530000	0.27963	0.943000	0.58893	1.050000	0.30404	-0.351000	0.08249	0.533000	0.62120	TAT	MGAM	-	NULL	ENSG00000257335		0.428	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	77	0.00	0	T			141802435	141802435	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	missense	56	28.21	22	SNP	0.818	G
MTRR	4552	genome.wustl.edu	37	5	7878078	7878078	+	Silent	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr5:7878078G>A	ENST00000264668.2	+	5	534	c.504G>A	c.(502-504)ccG>ccA	p.P168P	MTRR_ENST00000502509.1_3'UTR|MTRR_ENST00000440940.2_Silent_p.P141P|MTRR_ENST00000341013.6_3'UTR	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	168	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TGGTTGAGCCGTGGATTGCTG	0.468																																						dbGAP											0													69.0	70.0	70.0					5																	7878078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.504G>A	5.37:g.7878078G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	pfam_Flavodoxin/NO_synth,pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavdoxin	p.V150M	ENST00000264668.2	37	c.448	CCDS3874.1	5	.	.	.	.	.	.	.	.	.	.	G	4.992	0.184212	0.09495	.	.	ENSG00000124275	ENST00000514220	.	.	.	5.91	-10.8	0.00216	.	.	.	.	.	T	0.33147	0.0853	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39643	-0.9604	4	.	.	.	-33.404	2.4579	0.04534	0.3062:0.1273:0.3785:0.188	.	.	.	.	M	70	.	.	V	+	1	0	MTRR	7931078	0.000000	0.05858	0.379000	0.26080	0.543000	0.35085	-2.971000	0.00668	-2.203000	0.00744	-0.907000	0.02831	GTG	MTRR	-	pfam_Flavodoxin/NO_synth,pfscan_Flavodoxin/NO_synth	ENSG00000124275		0.468	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	HGNC	protein_coding	OTTHUMT00000206931.1	118	0.00	0	G			7878078	7878078	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000510525	ensembl	human	known	69_37n	missense	125	13.10	19	SNP	0.030	A
MYO1B	4430	genome.wustl.edu	37	2	192250662	192250662	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr2:192250662C>A	ENST00000392318.3	+	16	1653	c.1406C>A	c.(1405-1407)aCa>aAa	p.T469K	MYO1B_ENST00000339514.4_Missense_Mutation_p.T469K|MYO1B_ENST00000304164.4_Missense_Mutation_p.T469K|MYO1B_ENST00000392316.1_Missense_Mutation_p.T469K	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	469	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			AGACCTGGCACAGTCACTGAT	0.463																																						dbGAP											0													195.0	186.0	189.0					2																	192250662		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.1406C>A	2.37:g.192250662C>A	ENSP00000376132:p.Thr469Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43794|Q7Z6L5	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T469K	ENST00000392318.3	37	c.1406	CCDS46477.1	2	.	.	.	.	.	.	.	.	.	.	C	3.488	-0.104530	0.06967	.	.	ENSG00000128641	ENST00000339514;ENST00000392318;ENST00000304164;ENST00000392316	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.23	4.35	0.52113	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.64778	0.2629	N	0.02213	-0.635	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.10450	0.002;0.002;0.005	T	0.57653	-0.7774	10	0.08599	T	0.76	.	6.5557	0.22460	0.1453:0.7045:0.0:0.1502	.	469;469;469	B0I1S9;O43795;O43795-2	.;MYO1B_HUMAN;.	K	469	ENSP00000341903:T469K;ENSP00000376132:T469K;ENSP00000306382:T469K;ENSP00000376130:T469K	ENSP00000306382:T469K	T	+	2	0	MYO1B	191958907	0.998000	0.40836	0.960000	0.40013	0.743000	0.42351	3.786000	0.55431	1.336000	0.45506	0.579000	0.79373	ACA	MYO1B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000128641		0.463	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1B	HGNC	protein_coding	OTTHUMT00000334774.1	389	0.00	0	C	NM_012223		192250662	192250662	+1	no_errors	ENST00000304164	ensembl	human	known	69_37n	missense	317	14.32	53	SNP	0.985	A
NAV2	89797	genome.wustl.edu	37	11	20119207	20119207	+	Missense_Mutation	SNP	C	C	G	rs374882958		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr11:20119207C>G	ENST00000396087.3	+	34	6373	c.6274C>G	c.(6274-6276)Cgc>Ggc	p.R2092G	NAV2_ENST00000527559.2_Missense_Mutation_p.R2021G|NAV2_ENST00000540292.1_Missense_Mutation_p.R2023G|NAV2_ENST00000533917.1_Missense_Mutation_p.R1097G|NAV2_ENST00000349880.4_Missense_Mutation_p.R2033G|NAV2_ENST00000311043.8_Missense_Mutation_p.R1097G|NAV2_ENST00000396085.1_Missense_Mutation_p.R2036G|NAV2_ENST00000360655.4_Missense_Mutation_p.R1969G	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	2092					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AGAAATCAAGCGCAGCAACAC	0.463																																						dbGAP											0													124.0	119.0	120.0					11																	20119207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.6274C>G	11.37:g.20119207C>G	ENSP00000379396:p.Arg2092Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.R2092G	ENST00000396087.3	37	c.6274	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765358	0.69878	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000311043	T;T;T;T;T;T;T;T	0.41400	1.0;1.1;1.09;1.2;1.1;1.1;2.64;2.64	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000002	T	0.70850	0.3271	M	0.84948	2.725	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.71290	-0.4637	9	.	.	.	.	20.2585	0.98435	0.0:1.0:0.0:0.0	.	2036;1097;2033;1969	A7E2D6;Q8IVL1-5;Q8IVL1-3;Q8IVL1-4	.;.;.;.	G	1969;2036;2033;2092;2021;2023;1097;1097	ENSP00000353871:R1969G;ENSP00000379394:R2036G;ENSP00000309577:R2033G;ENSP00000379396:R2092G;ENSP00000435395:R2021G;ENSP00000443489:R2023G;ENSP00000437316:R1097G;ENSP00000312169:R1097G	.	R	+	1	0	NAV2	20075783	0.994000	0.37717	0.867000	0.34043	0.042000	0.13812	3.176000	0.50863	2.894000	0.99253	0.655000	0.94253	CGC	NAV2	-	NULL	ENSG00000166833		0.463	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	105	0.00	0	C	NM_145117		20119207	20119207	+1	no_errors	ENST00000396087	ensembl	human	known	69_37n	missense	138	18.82	32	SNP	1.000	G
NEDD9	4739	genome.wustl.edu	37	6	11213899	11213899	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:11213899C>T	ENST00000379446.5	-	2	240	c.74G>A	c.(73-75)cGc>cAc	p.R25H	NEDD9_ENST00000504387.1_Missense_Mutation_p.R25H|NEDD9_ENST00000379433.5_Missense_Mutation_p.R25H|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	25	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GTCTCCCTTGCGAAAGGCCAG	0.522																																						dbGAP											0													118.0	103.0	108.0					6																	11213899		2203	4300	6503	-	-	-	SO:0001583	missense	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.74G>A	6.37:g.11213899C>T	ENSP00000368759:p.Arg25His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.R25H	ENST00000379446.5	37	c.74	CCDS4520.1	6	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481859	0.84747	.	.	ENSG00000111859	ENST00000379446;ENST00000504387;ENST00000379433;ENST00000513989;ENST00000397378	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;1.92	6.17	6.17	0.99709	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	L	0.41492	1.28	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.978;0.998;1.0	T	0.54899	-0.8224	10	0.56958	D	0.05	-28.1266	20.8794	0.99867	0.0:1.0:0.0:0.0	.	25;25;25	G5E9Y9;Q5XKI0;Q14511	.;.;CASL_HUMAN	H	25;25;25;19;25	ENSP00000368759:R25H;ENSP00000422871:R25H;ENSP00000368745:R25H;ENSP00000421282:R19H;ENSP00000380534:R25H	ENSP00000368745:R25H	R	-	2	0	NEDD9	11321885	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.461000	0.80834	2.941000	0.99782	0.655000	0.94253	CGC	NEDD9	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000111859		0.522	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	194	0.00	0	C	NM_006403		11213899	11213899	-1	no_errors	ENST00000379446	ensembl	human	known	69_37n	missense	195	11.76	26	SNP	1.000	T
NFASC	23114	genome.wustl.edu	37	1	204966311	204966311	+	Missense_Mutation	SNP	G	G	T	rs376651731		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:204966311G>T	ENST00000401399.1	+	24	2995	c.2796G>T	c.(2794-2796)ttG>ttT	p.L932F	NFASC_ENST00000367172.4_Missense_Mutation_p.L1039F|NFASC_ENST00000338586.6_Intron|NFASC_ENST00000495396.1_Intron|NFASC_ENST00000367170.4_Intron|NFASC_ENST00000404907.1_Intron|NFASC_ENST00000338515.6_Missense_Mutation_p.L1039F|NFASC_ENST00000339876.6_Missense_Mutation_p.L932F|NFASC_ENST00000513543.1_Intron|NFASC_ENST00000367171.4_Intron|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000360049.4_Intron|NFASC_ENST00000539706.1_Intron|NFASC_ENST00000404076.1_Intron			O94856	NFASC_HUMAN	neurofascin	1039					axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CTCCCACATTGCCCCCGACTA	0.622																																						dbGAP											0													72.0	85.0	81.0					1																	204966311		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2796G>T	1.37:g.204966311G>T	ENSP00000385637:p.Leu932Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L1039F	ENST00000401399.1	37	c.3117	CCDS53460.1	1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423091	0.62733	.	.	ENSG00000163531	ENST00000367172;ENST00000338515;ENST00000339876;ENST00000401399	T;T;T;T	0.67698	-0.28;-0.26;-0.26;-0.26	5.11	3.11	0.35812	.	0.849605	0.09837	N	0.749439	T	0.43765	0.1262	.	.	.	0.80722	D	1	B;B	0.27882	0.192;0.0	B;B	0.21917	0.037;0.001	T	0.23833	-1.0177	9	0.09843	T	0.71	.	6.2588	0.20889	0.0999:0.1878:0.7123:0.0	.	1039;932	O94856-7;O94856-9	.;.	F	1039;1039;932;932	ENSP00000356140:L1039F;ENSP00000342128:L1039F;ENSP00000344786:L932F;ENSP00000385637:L932F	ENSP00000342128:L1039F	L	+	3	2	NFASC	203232934	0.992000	0.36948	0.898000	0.35279	0.991000	0.79684	2.211000	0.42825	1.155000	0.42497	0.655000	0.94253	TTG	NFASC	-	superfamily_Fibronectin_type3	ENSG00000163531		0.622	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	28	0.00	0	G	NM_001005388		204966311	204966311	+1	no_errors	ENST00000367172	ensembl	human	known	69_37n	missense	51	13.33	8	SNP	0.915	T
NKAPL	222698	genome.wustl.edu	37	6	28227179	28227179	+	Silent	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:28227179C>A	ENST00000343684.3	+	1	82	c.30C>A	c.(28-30)tcC>tcA	p.S10S	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	10										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						CCAGCTATTCCGAGGACATCG	0.662																																						dbGAP											0													28.0	27.0	27.0					6																	28227179		2189	4279	6468	-	-	-	SO:0001819	synonymous_variant	0			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.30C>A	6.37:g.28227179C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIV1|Q9H4Q7	Silent	SNP	pfam_DUF926	p.S10	ENST00000343684.3	37	c.30	CCDS34353.1	6																																																																																			NKAPL	-	NULL	ENSG00000189134		0.662	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAPL	HGNC	protein_coding	OTTHUMT00000040185.1	41	0.00	0	C			28227179	28227179	+1	no_errors	ENST00000343684	ensembl	human	known	69_37n	silent	20	20.00	5	SNP	0.000	A
NLRC5	84166	genome.wustl.edu	37	16	57104491	57104491	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr16:57104491T>C	ENST00000262510.6	+	38	4853	c.4628T>C	c.(4627-4629)aTg>aCg	p.M1543T	NLRC5_ENST00000539144.1_Missense_Mutation_p.M1514T|NLRC5_ENST00000308149.7_Missense_Mutation_p.M1514T|NLRC5_ENST00000436936.1_3'UTR	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1543					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				AAGGCGCTGATGAGGGCCCTT	0.557																																						dbGAP											0													159.0	127.0	138.0					16																	57104491		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4628T>C	16.37:g.57104491T>C	ENSP00000262510:p.Met1543Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.M1543T	ENST00000262510.6	37	c.4628	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	T	6.893	0.534193	0.13188	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000539144	T;T;T	0.16196	2.36;2.36;2.36	4.21	1.91	0.25777	.	.	.	.	.	T	0.10165	0.0249	N	0.17631	0.505	0.20563	N	0.999887	B	0.15473	0.013	B	0.09377	0.004	T	0.29971	-0.9994	9	0.42905	T	0.14	.	5.9779	0.19391	0.0:0.215:0.0:0.785	.	1543	Q86WI3	NLRC5_HUMAN	T	1543;1514;1514	ENSP00000262510:M1543T;ENSP00000308886:M1514T;ENSP00000441727:M1514T	ENSP00000262510:M1543T	M	+	2	0	NLRC5	55661992	0.005000	0.15991	0.151000	0.22473	0.472000	0.32918	1.274000	0.33132	0.267000	0.21916	0.472000	0.43445	ATG	NLRC5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000140853		0.557	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	26	0.00	0	T	NM_032206		57104491	57104491	+1	no_errors	ENST00000262510	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.371	C
NMUR2	56923	genome.wustl.edu	37	5	151777641	151777641	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr5:151777641T>G	ENST00000255262.3	-	2	956	c.791A>C	c.(790-792)aAa>aCa	p.K264T	NMUR2_ENST00000518933.1_5'UTR	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	264					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			GTTGACTGATTTTCTGCAGGG	0.378																																						dbGAP											0													140.0	132.0	135.0					5																	151777641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.791A>C	5.37:g.151777641T>G	ENSP00000255262:p.Lys264Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_NeuromedU_rcpt_2,prints_NeuromedU_rcpt,prints_7TM_GPCR_Rhodpsn	p.K264T	ENST00000255262.3	37	c.791	CCDS4321.1	5	.	.	.	.	.	.	.	.	.	.	T	12.04	1.819675	0.32145	.	.	ENSG00000132911	ENST00000255262	T	0.74002	-0.8	5.8	5.8	0.92144	GPCR, rhodopsin-like superfamily (1);	0.070961	0.64402	D	0.000016	T	0.73297	0.3569	L	0.38531	1.155	0.45261	D	0.998262	D	0.63880	0.993	P	0.55055	0.767	T	0.70382	-0.4887	10	0.25106	T	0.35	-11.6546	11.2468	0.49002	0.0:0.0729:0.0:0.9271	.	264	Q9GZQ4	NMUR2_HUMAN	T	264	ENSP00000255262:K264T	ENSP00000255262:K264T	K	-	2	0	NMUR2	151757834	1.000000	0.71417	0.990000	0.47175	0.774000	0.43823	2.151000	0.42263	2.213000	0.71641	0.477000	0.44152	AAA	NMUR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000132911		0.378	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	HGNC	protein_coding	OTTHUMT00000252439.1	259	0.00	0	T	NM_020167		151777641	151777641	-1	no_errors	ENST00000255262	ensembl	human	known	69_37n	missense	167	11.64	22	SNP	1.000	G
OMA1	115209	genome.wustl.edu	37	1	59004723	59004723	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:59004723G>C	ENST00000371226.3	-	2	357	c.244C>G	c.(244-246)Ctc>Gtc	p.L82V	DAB1_ENST00000485760.1_Intron|OMA1_ENST00000467063.1_Intron|OMA1_ENST00000358603.2_Missense_Mutation_p.L82V	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	82					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					GTACTTGAGAGGCCTCCTGTT	0.378																																						dbGAP											0													119.0	124.0	122.0					1																	59004723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.244C>G	1.37:g.59004723G>C	ENSP00000360270:p.Leu82Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	pfam_Peptidase_M48	p.L82V	ENST00000371226.3	37	c.244	CCDS608.1	1	.	.	.	.	.	.	.	.	.	.	G	9.887	1.203214	0.22121	.	.	ENSG00000162600	ENST00000358603;ENST00000371226;ENST00000456980;ENST00000419242;ENST00000426139;ENST00000453710	T;T;T;T;T;T	0.35973	2.31;2.33;1.71;1.69;1.65;1.28	5.65	1.72	0.24424	.	0.835416	0.10745	N	0.638967	T	0.25827	0.0629	L	0.45581	1.43	0.09310	N	1	B;B	0.28850	0.083;0.225	B;B	0.28849	0.03;0.095	T	0.29181	-1.0020	9	.	.	.	-0.5492	1.0689	0.01617	0.2639:0.1141:0.3877:0.2344	.	82;82	Q96E52;Q96E52-2	OMA1_HUMAN;.	V	82	ENSP00000351417:L82V;ENSP00000360270:L82V;ENSP00000395053:L82V;ENSP00000409589:L82V;ENSP00000416495:L82V;ENSP00000392978:L82V	.	L	-	1	0	OMA1	58777311	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.092000	0.11129	0.174000	0.19809	0.655000	0.94253	CTC	OMA1	-	NULL	ENSG00000162600		0.378	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMA1	HGNC	protein_coding	OTTHUMT00000027819.1	505	0.00	0	G	NM_145243		59004723	59004723	-1	no_errors	ENST00000371226	ensembl	human	known	69_37n	missense	310	11.40	40	SNP	0.000	C
OR10A7	121364	genome.wustl.edu	37	12	55614826	55614826	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr12:55614826C>A	ENST00000326258.1	+	1	18	c.18C>A	c.(16-18)caC>caA	p.H6Q		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						GTGAAAATCACACCAGAGTCA	0.323																																						dbGAP											0													134.0	141.0	139.0					12																	55614826		2202	4300	6502	-	-	-	SO:0001583	missense	0			BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.18C>A	12.37:g.55614826C>A	ENSP00000326718:p.His6Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFD5|Q96R19	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H6Q	ENST00000326258.1	37	c.18	CCDS31815.1	12	.	.	.	.	.	.	.	.	.	.	c	0.554	-0.848325	0.02651	.	.	ENSG00000179919	ENST00000326258	T	0.11604	2.76	2.91	-0.0791	0.13712	.	0.333636	0.21475	N	0.073928	T	0.03348	0.0097	N	0.04768	-0.165	0.09310	N	0.999992	B	0.02656	0.0	B	0.10450	0.005	T	0.40021	-0.9585	10	0.14252	T	0.57	.	1.8267	0.03122	0.4396:0.2928:0.1534:0.1142	.	6	Q8NGE5	O10A7_HUMAN	Q	6	ENSP00000326718:H6Q	ENSP00000326718:H6Q	H	+	3	2	OR10A7	53901093	0.000000	0.05858	0.719000	0.30619	0.560000	0.35617	-2.284000	0.01154	-0.020000	0.14032	0.637000	0.83480	CAC	OR10A7	-	NULL	ENSG00000179919		0.323	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A7	HGNC	protein_coding	OTTHUMT00000406308.1	536	0.00	0	C			55614826	55614826	+1	no_errors	ENST00000326258	ensembl	human	known	69_37n	missense	456	17.39	96	SNP	0.179	A
PCNT	5116	genome.wustl.edu	37	21	47775512	47775512	+	Missense_Mutation	SNP	G	G	A	rs201188810	byFrequency	TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr21:47775512G>A	ENST00000359568.5	+	12	2014	c.1907G>A	c.(1906-1908)cGt>cAt	p.R636H	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	636	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CACGAGTGGCGTCTGGAACCC	0.652													G|||	2	0.000399361	0.0	0.0	5008	,	,		15838	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													47.0	40.0	42.0					21																	47775512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1907G>A	21.37:g.47775512G>A	ENSP00000352572:p.Arg636His	Somatic		WXS	Illumina GAIIx	Phase_IV	O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.R636H	ENST00000359568.5	37	c.1907	CCDS33592.1	21	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	7.010	0.556662	0.13436	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.01725	4.67	3.83	-7.66	0.01277	.	.	.	.	.	T	0.00906	0.0030	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.48139	-0.9061	9	0.59425	D	0.04	.	0.0686	0.00019	0.2653:0.1972:0.242:0.2955	.	518;636	O95613-2;O95613	.;PCNT_HUMAN	H	636;623	ENSP00000352572:R636H	ENSP00000338675:R623H	R	+	2	0	PCNT	46599940	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.066000	0.03454	-3.894000	0.00094	-1.305000	0.01319	CGT	PCNT	-	NULL	ENSG00000160299		0.652	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	27	0.00	0	G	NM_006031		47775512	47775512	+1	no_errors	ENST00000359568	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.000	A
PCSK1	5122	genome.wustl.edu	37	5	95746673	95746673	+	Silent	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr5:95746673C>A	ENST00000311106.3	-	8	1137	c.900G>T	c.(898-900)ggG>ggT	p.G300G	PCSK1_ENST00000508626.1_Silent_p.G253G|CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_Intron	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	300	Peptidase S8.				cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CGAAGATGGACCCCTTCCCCT	0.483																																						dbGAP											0													130.0	125.0	127.0					5																	95746673		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.900G>T	5.37:g.95746673C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8T7|E9PHA1|P78478|Q92532	Silent	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,pfam_Proho_convert,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.G300	ENST00000311106.3	37	c.900	CCDS4081.1	5																																																																																			PCSK1	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000175426		0.483	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK1	HGNC	protein_coding	OTTHUMT00000242851.1	277	0.36	1	C	NM_000439		95746673	95746673	-1	no_errors	ENST00000311106	ensembl	human	known	69_37n	silent	149	17.03	31	SNP	0.986	A
PMFBP1	83449	genome.wustl.edu	37	16	72170703	72170703	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr16:72170703G>T	ENST00000237353.10	-	8	1195	c.934C>A	c.(934-936)Cag>Aag	p.Q312K	PMFBP1_ENST00000537465.1_Missense_Mutation_p.Q312K|PMFBP1_ENST00000355636.6_Missense_Mutation_p.Q167K	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	312						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TTCTGCTCCTGCAAGTGCTTC	0.517																																						dbGAP											0													70.0	65.0	67.0					16																	72170703		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.934C>A	16.37:g.72170703G>T	ENSP00000237353:p.Gln312Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	NULL	p.Q312K	ENST00000237353.10	37	c.934	CCDS32483.1	16	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170997	0.57584	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.13901	2.56;2.57;2.55	5.04	4.02	0.46733	.	0.000000	0.38111	N	0.001820	T	0.19087	0.0458	N	0.24115	0.695	0.28171	N	0.92858	P;P;P	0.52577	0.954;0.75;0.954	D;P;D	0.67900	0.954;0.473;0.954	T	0.02121	-1.1210	10	0.36615	T	0.2	-11.0758	9.1452	0.36928	0.0:0.1652:0.6846:0.1501	.	312;312;312	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	K	312;312;167	ENSP00000443817:Q312K;ENSP00000237353:Q312K;ENSP00000347854:Q167K	ENSP00000237353:Q312K	Q	-	1	0	PMFBP1	70728204	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	1.549000	0.36212	2.326000	0.78906	0.462000	0.41574	CAG	PMFBP1	-	NULL	ENSG00000118557		0.517	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PMFBP1	HGNC	protein_coding	OTTHUMT00000396473.2	87	0.00	0	G	NM_031293		72170703	72170703	-1	no_errors	ENST00000537465	ensembl	human	known	69_37n	missense	45	23.73	14	SNP	0.774	T
PPEF2	5470	genome.wustl.edu	37	4	76782042	76782042	+	Silent	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr4:76782042G>A	ENST00000286719.7	-	17	2396	c.2040C>T	c.(2038-2040)acC>acT	p.T680T		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	680	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ACAGCTTCCAGGTCTGCCTGA	0.423																																					NSCLC(105;1359 1603 15961 44567 47947)	dbGAP											0													121.0	112.0	115.0					4																	76782042		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.2040C>T	4.37:g.76782042G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14831	Silent	SNP	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,pfam_PPP_dom,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,prints_Ser/Thr-sp_prot-phosphatase,pfscan_EF_HAND_2	p.T680	ENST00000286719.7	37	c.2040	CCDS34013.1	4																																																																																			PPEF2	-	pirsf_Ser/Thr-Pase_EF-hand_contain,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000156194		0.423	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	178	0.00	0	G	NM_006239		76782042	76782042	-1	no_errors	ENST00000286719	ensembl	human	known	69_37n	silent	123	10.87	15	SNP	0.767	A
PPP5C	5536	genome.wustl.edu	37	19	46890423	46890423	+	Silent	SNP	G	G	A	rs375447747		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr19:46890423G>A	ENST00000012443.4	+	8	1081	c.978G>A	c.(976-978)caG>caA	p.Q326Q	PPP5C_ENST00000391919.1_Silent_p.Q198Q	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	326	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		ACACAGCCCAGATGTACGAGC	0.572																																						dbGAP											0													151.0	106.0	121.0					19																	46890423		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.978G>A	19.37:g.46890423G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16722|Q53XV2	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_PPP_dom,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5,prints_Ser/Thr-sp_prot-phosphatase,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R325K	ENST00000012443.4	37	c.974	CCDS12684.1	19																																																																																			PPP5C	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5	ENSG00000011485		0.572	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP5C	HGNC	protein_coding	OTTHUMT00000258969.2	42	0.00	0	G	NM_006247		46890423	46890423	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000478046	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	A
PRSS35	167681	genome.wustl.edu	37	6	84233451	84233451	+	Silent	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr6:84233451G>A	ENST00000369700.3	+	2	468	c.291G>A	c.(289-291)agG>agA	p.R97R	PRSS35_ENST00000536636.1_Silent_p.R97R	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	97						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		CCTTAACCAGGGTGAAAGTTC	0.458																																						dbGAP											0													60.0	60.0	60.0					6																	84233451		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.291G>A	6.37:g.84233451G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B3|Q9BQP6	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.R97	ENST00000369700.3	37	c.291	CCDS4999.1	6																																																																																			PRSS35	-	NULL	ENSG00000146250		0.458	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	HGNC	protein_coding	OTTHUMT00000041352.1	210	0.00	0	G	NM_153362		84233451	84233451	+1	no_errors	ENST00000369700	ensembl	human	known	69_37n	silent	84	43.24	64	SNP	0.026	A
PSG11	5680	genome.wustl.edu	37	19	43530506	43530506	+	Missense_Mutation	SNP	G	G	C	rs201997880		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr19:43530506G>C	ENST00000401740.1	-	1	122	c.19C>G	c.(19-21)Cct>Gct	p.P7A	PSG11_ENST00000320078.7_Missense_Mutation_p.P7A|PSG11_ENST00000403486.1_Missense_Mutation_p.P7A|PSG11_ENST00000306322.7_Missense_Mutation_p.P7A			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	7					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GTGCAGGGAGGGGCTGAGAGG	0.582																																						dbGAP											0													115.0	108.0	110.0					19																	43530506		2200	4299	6499	-	-	-	SO:0001583	missense	0			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.19C>G	19.37:g.43530506G>C	ENSP00000384995:p.Pro7Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P7A	ENST00000401740.1	37	c.19	CCDS12614.2	19	.	.	.	.	.	.	.	.	.	.	g	9.642	1.139163	0.21205	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.31769	1.48;2.11;2.11;1.48	0.929	-0.317	0.12736	.	.	.	.	.	T	0.37571	0.1008	L	0.52905	1.665	0.09310	N	1	D;P	0.53619	0.961;0.791	P;P	0.58210	0.835;0.684	T	0.19877	-1.0292	9	0.59425	D	0.04	.	3.3319	0.07087	0.3228:0.0:0.6772:0.0	.	7;7	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	A	7	ENSP00000319140:P7A;ENSP00000385427:P7A;ENSP00000304913:P7A;ENSP00000384995:P7A	ENSP00000304913:P7A	P	-	1	0	PSG11	48222346	0.000000	0.05858	0.006000	0.13384	0.130000	0.20726	-0.983000	0.03759	-0.049000	0.13379	0.184000	0.17185	CCT	PSG11	-	NULL	ENSG00000243130		0.582	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG11	HGNC	protein_coding	OTTHUMT00000323079.1	187	0.00	0	G	NM_002785		43530506	43530506	-1	no_errors	ENST00000320078	ensembl	human	known	69_37n	missense	193	11.47	25	SNP	0.010	C
RAPGEFL1	51195	genome.wustl.edu	37	17	38345157	38345157	+	Silent	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr17:38345157G>A	ENST00000456989.2	+	5	466	c.420G>A	c.(418-420)aaG>aaA	p.K140K	RAPGEFL1_ENST00000540388.1_3'UTR|RAPGEFL1_ENST00000544503.1_Silent_p.K134K|RAPGEFL1_ENST00000264644.6_Silent_p.K85K|RAPGEFL1_ENST00000436615.3_Silent_p.K85K			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	291					G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						AGCAGGTGAAGCCACTCTTCC	0.612																																					Esophageal Squamous(28;274 750 6870 14218 42203)	dbGAP											0													53.0	53.0	53.0					17																	38345157		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.420G>A	17.37:g.38345157G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	p.K85	ENST00000456989.2	37	c.255		17																																																																																			RAPGEFL1	-	superfamily_Ras_GEF_dom	ENSG00000108352		0.612	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	RAPGEFL1	HGNC	protein_coding	OTTHUMT00000397518.1	23	0.00	0	G	NM_016339		38345157	38345157	+1	no_errors	ENST00000264644	ensembl	human	known	69_37n	silent	34	19.05	8	SNP	0.995	A
RBM23	55147	genome.wustl.edu	37	14	23371049	23371049	+	Silent	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr14:23371049G>A	ENST00000359890.3	-	13	1485	c.1290C>T	c.(1288-1290)ctC>ctT	p.L430L	RBM23_ENST00000346528.5_Silent_p.L396L|RBM23_ENST00000399922.2_Silent_p.L414L|RBM23_ENST00000542016.2_Silent_p.L260L|RBM23_ENST00000555209.1_Silent_p.L180L	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	430					mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		AGAGGCTGGAGAGCTGGAAAC	0.507																																						dbGAP											0													166.0	175.0	172.0					14																	23371049		2015	4180	6195	-	-	-	SO:0001819	synonymous_variant	0			AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.1290C>T	14.37:g.23371049G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L205F	ENST00000359890.3	37	c.613	CCDS41921.1	14	.	.	.	.	.	.	.	.	.	.	G	6.428	0.447064	0.12223	.	.	ENSG00000100461	ENST00000553884	T	0.68025	-0.3	5.34	1.14	0.20703	.	0.000000	0.50627	D	0.000117	T	0.61887	0.2383	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51140	-0.8743	6	.	.	.	-12.2991	6.2399	0.20785	0.4764:0.1317:0.392:0.0	.	.	.	.	F	205	ENSP00000451642:L205F	.	L	-	1	0	RBM23	22440889	0.999000	0.42202	0.990000	0.47175	0.959000	0.62525	0.508000	0.22692	-0.325000	0.08577	-1.268000	0.01426	CTC	RBM23	-	NULL	ENSG00000100461		0.507	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM23	HGNC	protein_coding	OTTHUMT00000413545.3	452	0.00	0	G			23371049	23371049	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553884	ensembl	human	putative	69_37n	missense	484	11.01	60	SNP	0.976	A
RINT1	60561	genome.wustl.edu	37	7	105187507	105187507	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:105187507A>T	ENST00000257700.2	+	5	897	c.666A>T	c.(664-666)aaA>aaT	p.K222N		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	222	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TCTGGCATAAAATTCTCAAGG	0.383																																						dbGAP											0													100.0	94.0	96.0					7																	105187507		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.666A>T	7.37:g.105187507A>T	ENSP00000257700:p.Lys222Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	pfam_RINT1_TIP1	p.K222N	ENST00000257700.2	37	c.666	CCDS34726.1	7	.	.	.	.	.	.	.	.	.	.	A	11.63	1.695656	0.30052	.	.	ENSG00000135249	ENST00000257700	T	0.23754	1.89	5.38	1.7	0.24286	.	0.090990	0.64402	D	0.000001	T	0.29321	0.0730	L	0.38175	1.15	0.58432	D	0.999998	D	0.69078	0.997	P	0.60789	0.879	T	0.03750	-1.1007	10	0.18276	T	0.48	-22.7119	8.5803	0.33623	0.6851:0.0:0.3149:0.0	.	222	Q6NUQ1	RINT1_HUMAN	N	222	ENSP00000257700:K222N	ENSP00000257700:K222N	K	+	3	2	RINT1	104974743	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.765000	0.38481	0.336000	0.23639	0.460000	0.39030	AAA	RINT1	-	NULL	ENSG00000135249		0.383	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	HGNC	protein_coding	OTTHUMT00000348686.1	130	0.00	0	A	NM_021930		105187507	105187507	+1	no_errors	ENST00000257700	ensembl	human	known	69_37n	missense	161	18.69	37	SNP	1.000	T
SACS	26278	genome.wustl.edu	37	13	23929666	23929666	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr13:23929666delT	ENST00000382292.3	-	7	1358	c.1085delA	c.(1084-1086)aagfs	p.K362fs	SACS_ENST00000382298.3_Frame_Shift_Del_p.K362fs|SACS_ENST00000402364.1_5'UTR|SACS_ENST00000476776.1_5'Flank			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	362					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GCTTGGAGTCTTTTTACAATA	0.388																																						dbGAP											0													115.0	115.0	115.0					13																	23929666		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.1085delA	13.37:g.23929666delT	ENSP00000371729:p.Lys362fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Frame_Shift_Del	DEL	pfam_HEPN,pfam_Ubiquitin,superfamily_ATPase-like_ATP-bd,superfamily_DnaJ_N,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_N,pfscan_Ubiquitin_supergroup	p.K362fs	ENST00000382292.3	37	c.1085	CCDS9300.2	13																																																																																			SACS	-	NULL	ENSG00000151835		0.388	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	133	0.00	0	T	NM_014363		23929666	23929666	-1	no_errors	ENST00000382292	ensembl	human	known	69_37n	frame_shift_del	112	11.11	14	DEL	0.011	-
SEMA7A	8482	genome.wustl.edu	37	15	74707008	74707009	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr15:74707008_74707009insA	ENST00000261918.4	-	10	1721_1722	c.1173_1174insT	c.(1171-1176)gtggagfs	p.E392fs	SEMA7A_ENST00000542748.1_Frame_Shift_Ins_p.E227fs|SEMA7A_ENST00000543145.2_Frame_Shift_Ins_p.E378fs	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	392	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						CCCATGGGCTCCACCCTCTGCG	0.619																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.1173_1174insT	15.37:g.74707008_74707009insA	ENSP00000261918:p.Glu392fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Frame_Shift_Ins	INS	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.E391fs	ENST00000261918.4	37	c.1174_1173	CCDS10262.1	15																																																																																			SEMA7A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000138623		0.619	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA7A	HGNC	protein_coding	OTTHUMT00000272904.3	46	0.00	0	-	NM_003612		74707008	74707009	-1	no_errors	ENST00000261918	ensembl	human	known	69_37n	frame_shift_ins	30	25.00	10	INS	0.998:0.992	A
SIPA1L1	26037	genome.wustl.edu	37	14	72055185	72055185	+	Missense_Mutation	SNP	G	G	C	rs138436535		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr14:72055185G>C	ENST00000555818.1	+	2	944	c.596G>C	c.(595-597)gGa>gCa	p.G199A	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.G199A|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.G199A	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	199					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TACAAGACTGGACCATCACTG	0.413																																						dbGAP											0													160.0	139.0	146.0					14																	72055185		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.596G>C	14.37:g.72055185G>C	ENSP00000450832:p.Gly199Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.G199A	ENST00000555818.1	37	c.596	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	G	12.30	1.895887	0.33442	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	T;T;T	0.46451	0.87;0.87;0.87	5.72	5.72	0.89469	.	0.093299	0.85682	D	0.000000	T	0.57725	0.2073	L	0.41824	1.3	0.80722	D	1	P;D;D	0.76494	0.473;0.994;0.999	B;D;D	0.81914	0.24;0.961;0.995	T	0.49925	-0.8887	10	0.33940	T	0.23	-25.4858	19.8891	0.96923	0.0:0.0:1.0:0.0	.	199;199;199	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	A	199	ENSP00000370630:G199A;ENSP00000450832:G199A;ENSP00000351352:G199A	ENSP00000351352:G199A	G	+	2	0	SIPA1L1	71124938	1.000000	0.71417	0.502000	0.27614	0.076000	0.17211	8.030000	0.88816	2.689000	0.91719	0.655000	0.94253	GGA	SIPA1L1	-	NULL	ENSG00000197555		0.413	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	419	0.00	0	G	NM_015556		72055185	72055185	+1	no_errors	ENST00000555818	ensembl	human	known	69_37n	missense	192	18.99	45	SNP	1.000	C
SLC26A5	375611	genome.wustl.edu	37	7	103051936	103051936	+	Silent	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr7:103051936G>T	ENST00000306312.3	-	6	762	c.501C>A	c.(499-501)ggC>ggA	p.G167G	SLC26A5_ENST00000339444.6_Silent_p.G167G|SLC26A5_ENST00000356767.4_Silent_p.G167G|SLC26A5_ENST00000432958.2_Silent_p.G167G|SLC26A5_ENST00000393727.1_Silent_p.G167G|SLC26A5_ENST00000354356.4_5'UTR|SLC26A5_ENST00000393735.2_Silent_p.G167G|SLC26A5_ENST00000393723.1_Silent_p.G167G|SLC26A5_ENST00000393730.1_Silent_p.G167G|SLC26A5_ENST00000393729.1_Silent_p.G130G	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	167					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						TGGCCTCTGTGCCATTGGTTG	0.458																																						dbGAP											0													206.0	169.0	182.0					7																	103051936		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.501C>A	7.37:g.103051936G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Silent	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.G167	ENST00000306312.3	37	c.501	CCDS5733.1	7																																																																																			SLC26A5	-	tigrfam_SulP_transpt	ENSG00000170615		0.458	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A5	HGNC	protein_coding	OTTHUMT00000313860.1	247	0.00	0	G	NM_198999		103051936	103051936	-1	no_errors	ENST00000306312	ensembl	human	known	69_37n	silent	168	10.64	20	SNP	0.272	T
SLC35F2	54733	genome.wustl.edu	37	11	107676086	107676086	+	Splice_Site	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr11:107676086G>T	ENST00000525815.1	-	5	1150	c.730C>A	c.(730-732)Cta>Ata	p.L244I	SLC35F2_ENST00000375682.4_Splice_Site_p.L197I|SLC35F2_ENST00000429869.1_Splice_Site_p.L244I|SLC35F2_ENST00000265836.7_Splice_Site_p.L96I|SLC35F2_ENST00000525071.1_Splice_Site_p.L244I	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	244					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		GAATCTTACAGCTGTATACCA	0.323																																						dbGAP											0													65.0	60.0	61.0					11																	107676086		1826	4088	5914	-	-	-	SO:0001630	splice_region_variant	0				CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.731+1C>A	11.37:g.107676086G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	pfam_DUF914_euk,pfam_DMT,pfam_UAA,pfam_DUF250	p.L244I	ENST00000525815.1	37	c.730	CCDS41709.1	11	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973368	0.34848	.	.	ENSG00000110660	ENST00000525815;ENST00000525071;ENST00000265836;ENST00000375682;ENST00000429869	T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79	5.42	2.41	0.29592	.	0.294903	0.32901	N	0.005517	T	0.68915	0.3053	L	0.37850	1.14	0.35441	D	0.794895	B	0.27450	0.179	B	0.42692	0.395	T	0.68146	-0.5486	10	0.35671	T	0.21	.	7.3349	0.26605	0.0672:0.123:0.6821:0.1277	.	244	Q8IXU6	S35F2_HUMAN	I	244;244;96;197;244	ENSP00000436785:L244I;ENSP00000265836:L96I;ENSP00000364834:L197I;ENSP00000393571:L244I	ENSP00000265836:L96I	L	-	1	2	SLC35F2	107181296	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.100000	0.41777	0.661000	0.30985	0.655000	0.94253	CTA	SLC35F2	-	pfam_DUF914_euk,pfam_DMT,pfam_UAA,pfam_DUF250	ENSG00000110660		0.323	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F2	HGNC	protein_coding	OTTHUMT00000389417.1	131	0.00	0	G	NM_017515	Missense_Mutation	107676086	107676086	-1	no_errors	ENST00000429869	ensembl	human	known	69_37n	missense	153	25.37	52	SNP	1.000	T
SLFN12L	100506736	genome.wustl.edu	37	17	33807026	33807026	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr17:33807026G>A	ENST00000260908.7	-	2	320	c.203C>T	c.(202-204)gCt>gTt	p.A68V	SLFN12L_ENST00000449046.1_Missense_Mutation_p.A99V|RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000361112.4_Missense_Mutation_p.A97V	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	68						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)			breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						ATTCAGCAGAGCACACACAGC	0.383																																						dbGAP											0													93.0	78.0	83.0					17																	33807026		692	1591	2283	-	-	-	SO:0001583	missense	0			AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.203C>T	17.37:g.33807026G>A	ENSP00000437635:p.Ala68Val	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H6G3	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.A99V	ENST00000260908.7	37	c.296	CCDS56026.1	17	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426508	0.62733	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	T;T;T	0.08370	3.13;3.26;3.1	2.72	2.72	0.32119	.	.	.	.	.	T	0.19167	0.0460	M	0.76328	2.33	0.09310	N	1	P	0.47962	0.903	P	0.52554	0.702	T	0.03651	-1.1016	9	0.87932	D	0	.	8.9486	0.35773	0.0:0.0:1.0:0.0	.	97	Q6IEE8-2	.	V	68;97;99	ENSP00000437635:A68V;ENSP00000354412:A97V;ENSP00000389348:A99V	ENSP00000437635:A68V	A	-	2	0	SLFN12L	30831139	0.996000	0.38824	0.007000	0.13788	0.444000	0.32077	4.263000	0.58853	1.504000	0.48704	0.205000	0.17691	GCT	SLFN12L	-	NULL	ENSG00000205045		0.383	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	SLFN12L	HGNC	protein_coding	OTTHUMT00000395748.2	233	0.85	2	G	XM_496206		33807026	33807026	-1	no_errors	ENST00000449046	ensembl	human	known	69_37n	missense	254	10.56	30	SNP	0.015	A
SNAP47	116841	genome.wustl.edu	37	1	227935803	227935803	+	Silent	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:227935803G>A	ENST00000366759.4	+	2	915	c.501G>A	c.(499-501)ctG>ctA	p.L167L	SNAP47_ENST00000315781.5_Silent_p.L167L|SNAP47-AS1_ENST00000413347.2_RNA|SNAP47_ENST00000366760.1_Intron	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	167	t-SNARE coiled-coil homology 1. {ECO:0000255|PROSITE-ProRule:PRU00202}.				long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						GCGAGGAGCTGACGGGACTCA	0.637																																						dbGAP											0													39.0	39.0	39.0					1																	227935803		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.501G>A	1.37:g.227935803G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	pfscan_T_SNARE_dom	p.D159N	ENST00000366759.4	37	c.475	CCDS1562.1	1	.	.	.	.	.	.	.	.	.	.	G	0.353	-0.943907	0.02322	.	.	ENSG00000143740	ENST00000426344	.	.	.	4.12	1.06	0.20224	.	.	.	.	.	T	0.43590	0.1254	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19582	-1.0301	4	.	.	.	-9.0155	2.9596	0.05888	0.0996:0.3377:0.3896:0.1731	.	.	.	.	N	159	.	.	D	+	1	0	SNAP47	226002426	1.000000	0.71417	0.535000	0.28026	0.001000	0.01503	0.615000	0.24329	0.049000	0.15920	-1.054000	0.02325	GAC	SNAP47	-	NULL	ENSG00000143740		0.637	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAP47	HGNC	protein_coding	OTTHUMT00000091961.1	59	0.00	0	G	NM_053052		227935803	227935803	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426344	ensembl	human	known	69_37n	missense	57	31.33	26	SNP	0.953	A
SNHG14	104472715	genome.wustl.edu	37	15	25448374	25448374	+	RNA	SNP	G	G	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr15:25448374G>T	ENST00000424208.1	+	0	2163				SNHG14_ENST00000424333.1_RNA|SNORD115-18_ENST00000363293.1_RNA|SNORD115-19_ENST00000363098.1_RNA|SNHG14_ENST00000450809.1_RNA|SNORD115-17_ENST00000364612.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		GCCCTGGGTTGGGTCGATGAT	0.512																																						dbGAP											0													254.0	261.0	259.0					15																	25448374		876	1991	2867	-	-	-			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25448374G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNORD115-18	-	-	ENSG00000200163		0.512	SNHG14-002	KNOWN	basic	antisense	SNORD115-18	HGNC	processed_transcript	OTTHUMT00000126729.2	38	0.00	0	G			25448374	25448374	+1	no_errors	ENST00000363293	ensembl	human	known	69_37n	rna	61	18.67	14	SNP	0.002	T
SNX20	124460	genome.wustl.edu	37	16	50707754	50707754	+	Missense_Mutation	SNP	G	G	A	rs562563894		TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr16:50707754G>A	ENST00000330943.4	-	4	685	c.514C>T	c.(514-516)Cgc>Tgc	p.R172C	SNX20_ENST00000300590.3_Intron|SNX20_ENST00000423026.2_Intron|RP11-401P9.5_ENST00000570167.1_RNA|RP11-401P9.5_ENST00000570241.2_RNA	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	172	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						CGCACGCAGCGGATGGCGTAG	0.692																																						dbGAP											0													28.0	29.0	29.0					16																	50707754		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.514C>T	16.37:g.50707754G>A	ENSP00000332062:p.Arg172Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R172C	ENST00000330943.4	37	c.514	CCDS10745.1	16	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981393	0.74474	.	.	ENSG00000167208	ENST00000330943	T	0.30714	1.52	5.63	4.59	0.56863	Phox homologous domain (5);	0.299003	0.35151	N	0.003402	T	0.27027	0.0662	M	0.71871	2.18	0.58432	D	0.999996	P	0.43938	0.822	B	0.31101	0.124	T	0.22138	-1.0225	10	0.87932	D	0	-38.0269	9.851	0.41057	0.0:0.1193:0.6828:0.198	.	172	Q7Z614	SNX20_HUMAN	C	172	ENSP00000332062:R172C	ENSP00000332062:R172C	R	-	1	0	SNX20	49265255	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.051000	0.49885	2.664000	0.90586	0.561000	0.74099	CGC	SNX20	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000167208		0.692	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX20	HGNC	protein_coding	OTTHUMT00000256879.2	15	0.00	0	G	NM_153337		50707754	50707754	-1	no_errors	ENST00000330943	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	A
STAT4	6775	genome.wustl.edu	37	2	191931190	191931190	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr2:191931190T>C	ENST00000392320.2	-	7	910	c.596A>G	c.(595-597)cAg>cGg	p.Q199R	STAT4_ENST00000358470.4_Missense_Mutation_p.Q199R	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	199					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			AAGCATTTCCTGCAGTGTCAA	0.363																																						dbGAP											0													111.0	99.0	103.0					2																	191931190		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.596A>G	2.37:g.191931190T>C	ENSP00000376134:p.Gln199Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96NZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.Q199R	ENST00000392320.2	37	c.596	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	T	23.8	4.456012	0.84209	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	T;T	0.61274	0.12;0.12	5.6	5.6	0.85130	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.288557	0.34314	N	0.004075	T	0.73489	0.3593	M	0.67569	2.06	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.79108	0.992;0.992;0.992	T	0.75326	-0.3357	10	0.54805	T	0.06	-18.8323	14.3541	0.66724	0.0:0.0:0.0:1.0	.	108;199;199	Q53S87;B4DV04;Q14765	.;.;STAT4_HUMAN	R	199	ENSP00000351255:Q199R;ENSP00000376134:Q199R	ENSP00000351255:Q199R	Q	-	2	0	STAT4	191639435	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.154000	0.77437	2.139000	0.66308	0.455000	0.32223	CAG	STAT4	-	pfam_STAT_TF_alpha,superfamily_STAT_TF_coiled-coil	ENSG00000138378		0.363	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	156	0.63	1	T	NM_003151		191931190	191931190	-1	no_errors	ENST00000358470	ensembl	human	known	69_37n	missense	107	15.75	20	SNP	1.000	C
SULT1A3	6818	genome.wustl.edu	37	16	30212154	30212154	+	Silent	SNP	A	A	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr16:30212154A>G	ENST00000395138.2	+	2	153	c.105A>G	c.(103-105)caA>caG	p.Q35Q	SULT1A3_ENST00000563322.1_Silent_p.Q35Q|SULT1A3_ENST00000354723.6_Silent_p.Q35Q|SLX1A-SULT1A3_ENST00000565342.1_RNA|SULT1A3_ENST00000395137.2_Silent_p.Q35Q|SULT1A3_ENST00000355544.5_Silent_p.Q35Q|SULT1A3_ENST00000338971.5_Silent_p.Q35Q			P0DMM9	ST1A3_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3	35					catecholamine metabolic process (GO:0006584)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	aryl sulfotransferase activity (GO:0004062)										AGAGCTTCCAAGCCCGACCTG	0.627																																						dbGAP											0													1.0	1.0	1.0					16																	30212154		753	2026	2779	-	-	-	SO:0001819	synonymous_variant	0			U20499	CCDS10674.1	16p11.2	2012-10-08			ENSG00000261052	ENSG00000261052	2.8.2.1	"""Sulfotransferases, cytosolic"""	11455	protein-coding gene	gene with protein product		600641		STM		8117269, 7829089	Standard	NM_177552		Approved	TL-PST	uc002dtb.3	P0DMM9	OTTHUMG00000048083	ENST00000395138.2:c.105A>G	16.37:g.30212154A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV0|O95603|P50224|Q1ET66|Q6ZWJ5	Silent	SNP	pfam_Sulfotransferase_dom	p.Q35	ENST00000395138.2	37	c.105	CCDS10674.1	16																																																																																			SULT1A3	-	NULL	ENSG00000261052		0.627	SULT1A3-010	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	SULT1A4	Clone_based_vega_gene	protein_coding	OTTHUMT00000434095.1	11	0.00	0	A	NM_003166		30212154	30212154	+1	no_errors	ENST00000338971	ensembl	human	known	69_37n	silent	4	55.56	5	SNP	0.053	G
SUPT16H	11198	genome.wustl.edu	37	14	21831260	21831260	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr14:21831260C>G	ENST00000216297.2	-	13	1782	c.1444G>C	c.(1444-1446)Gcg>Ccg	p.A482P		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	482					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		AGTTGAGCCGCTAGTTCTTTC	0.433																																						dbGAP											0													176.0	166.0	169.0					14																	21831260		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.1444G>C	14.37:g.21831260C>G	ENSP00000216297:p.Ala482Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.A482P	ENST00000216297.2	37	c.1444	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	C	32	5.157110	0.94686	.	.	ENSG00000092201	ENST00000216297	.	.	.	5.31	5.31	0.75309	.	0.118236	0.56097	D	0.000025	T	0.73830	0.3637	M	0.75615	2.305	0.80722	D	1	D	0.64830	0.994	P	0.54706	0.759	T	0.73613	-0.3927	9	0.35671	T	0.21	-14.7339	17.7445	0.88416	0.0:1.0:0.0:0.0	.	482	Q9Y5B9	SP16H_HUMAN	P	482	.	ENSP00000216297:A482P	A	-	1	0	SUPT16H	20901100	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.154000	0.77437	2.491000	0.84063	0.655000	0.94253	GCG	SUPT16H	-	NULL	ENSG00000092201		0.433	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	212	0.00	0	C			21831260	21831260	-1	no_errors	ENST00000216297	ensembl	human	known	69_37n	missense	255	10.84	31	SNP	1.000	G
SYNE2	23224	genome.wustl.edu	37	14	64519171	64519171	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr14:64519171A>C	ENST00000344113.4	+	48	8752	c.8540A>C	c.(8539-8541)cAa>cCa	p.Q2847P	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Missense_Mutation_p.Q2847P|SYNE2_ENST00000554584.1_Missense_Mutation_p.Q2880P	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2847					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGGAAGTTTCAACTTATGGTT	0.363																																						dbGAP											0													52.0	51.0	51.0					14																	64519171		1854	4088	5942	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.8540A>C	14.37:g.64519171A>C	ENSP00000341781:p.Gln2847Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q2847P	ENST00000344113.4	37	c.8540	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	A	6.475	0.455738	0.12283	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.58797	1.29;1.29;0.31	5.27	5.27	0.74061	.	0.528794	0.16459	N	0.213492	T	0.58323	0.2114	L	0.32530	0.975	0.80722	D	1	D;D	0.58620	0.971;0.983	P;P	0.53649	0.543;0.731	T	0.54029	-0.8354	10	0.32370	T	0.25	.	13.7819	0.63087	1.0:0.0:0.0:0.0	.	2847;2847	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	P	2847;2847;2880;2880	ENSP00000350719:Q2847P;ENSP00000341781:Q2847P;ENSP00000452570:Q2880P	ENSP00000261678:Q2880P	Q	+	2	0	SYNE2	63588924	0.992000	0.36948	0.118000	0.21660	0.051000	0.14879	3.434000	0.52841	2.004000	0.58718	0.260000	0.18958	CAA	SYNE2	-	NULL	ENSG00000054654		0.363	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	220	0.00	0	A	NM_182914		64519171	64519171	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	131	14.38	22	SNP	0.715	C
TEKT2	27285	genome.wustl.edu	37	1	36550806	36550806	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:36550806A>T	ENST00000207457.3	+	3	326	c.199A>T	c.(199-201)Agg>Tgg	p.R67W	RP4-665N4.4_ENST00000446354.1_RNA	NM_014466.2	NP_055281.2	Q9UIF3	TEKT2_HUMAN	tektin 2 (testicular)	67					cell projection organization (GO:0030030)|inner dynein arm assembly (GO:0036159)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)|skin(2)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ACTGGTGGAGAGGATTGATAC	0.532																																						dbGAP											0													127.0	120.0	123.0					1																	36550806		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033823	CCDS401.1	1p34.3	2008-02-05			ENSG00000092850	ENSG00000092850			11725	protein-coding gene	gene with protein product		608953				12029069, 11751288	Standard	NM_014466		Approved	TEKTB1	uc001bzr.3	Q9UIF3	OTTHUMG00000007629	ENST00000207457.3:c.199A>T	1.37:g.36550806A>T	ENSP00000207457:p.Arg67Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIS6|O60638	Missense_Mutation	SNP	pfam_Tektin,superfamily_Prefoldin,prints_Tektin	p.R67W	ENST00000207457.3	37	c.199	CCDS401.1	1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307941	0.81247	.	.	ENSG00000092850	ENST00000207457	T	0.10288	2.89	5.75	4.66	0.58398	.	0.051503	0.85682	D	0.000000	T	0.39759	0.1090	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48293	-0.9048	10	0.87932	D	0	.	12.13	0.53938	0.7349:0.2651:0.0:0.0	.	67	Q9UIF3	TEKT2_HUMAN	W	67	ENSP00000207457:R67W	ENSP00000207457:R67W	R	+	1	2	TEKT2	36323393	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.512000	0.45485	2.194000	0.70268	0.533000	0.62120	AGG	TEKT2	-	pfam_Tektin	ENSG00000092850		0.532	TEKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT2	HGNC	protein_coding	OTTHUMT00000020200.1	53	0.00	0	A	NM_014466		36550806	36550806	+1	no_errors	ENST00000207457	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	1.000	T
TMEM156	80008	genome.wustl.edu	37	4	38990517	38990517	+	Silent	SNP	A	A	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr4:38990517A>C	ENST00000381938.3	-	4	800	c.693T>G	c.(691-693)acT>acG	p.T231T		NM_024943.1	NP_079219.1	Q8N614	TM156_HUMAN	transmembrane protein 156	231						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						TTTTGCGGATAGTGAGGATGA	0.348																																						dbGAP											0													136.0	137.0	137.0					4																	38990517		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK026888	CCDS3448.1	4p14	2008-02-05			ENSG00000121895	ENSG00000121895			26260	protein-coding gene	gene with protein product						12477932	Standard	NM_024943		Approved	FLJ23235	uc003gto.3	Q8N614	OTTHUMG00000128582	ENST00000381938.3:c.693T>G	4.37:g.38990517A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H5N9	Silent	SNP	NULL	p.T231	ENST00000381938.3	37	c.693	CCDS3448.1	4																																																																																			TMEM156	-	NULL	ENSG00000121895		0.348	TMEM156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM156	HGNC	protein_coding	OTTHUMT00000250435.3	310	0.00	0	A	NM_024943		38990517	38990517	-1	no_errors	ENST00000381938	ensembl	human	known	69_37n	silent	284	12.07	39	SNP	0.735	C
TMTC2	160335	genome.wustl.edu	37	12	83359523	83359523	+	Splice_Site	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr12:83359523G>A	ENST00000321196.3	+	6	2576	c.1869G>A	c.(1867-1869)gaG>gaA	p.E623E	TMTC2_ENST00000548305.1_Silent_p.E623E|TMTC2_ENST00000549919.1_Splice_Site_p.E617E	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	623					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						GACACTATGAGGTCTGGCCAA	0.483																																						dbGAP											0													108.0	102.0	104.0					12																	83359523		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1869+1G>A	12.37:g.83359523G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCU7|Q8N2K8	Silent	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E623	ENST00000321196.3	37	c.1869	CCDS9025.1	12																																																																																			TMTC2	-	pfam_TPR-1,pfam_TPR_2,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000179104		0.483	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC2	HGNC	protein_coding	OTTHUMT00000405663.1	292	0.34	1	G	NM_152588	Silent	83359523	83359523	+1	no_errors	ENST00000321196	ensembl	human	known	69_37n	silent	188	17.90	41	SNP	1.000	A
TPP1	1200	genome.wustl.edu	37	11	6638634	6638634	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr11:6638634delC	ENST00000299427.6	-	5	466	c.406delG	c.(406-408)gctfs	p.A136fs	TPP1_ENST00000533371.1_5'UTR|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000534644.1_5'UTR	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	TGAAACTCAGCCCCAGGGAGC	0.552																																						dbGAP											0													71.0	74.0	73.0					11																	6638634		2201	4296	6497	-	-	-	SO:0001589	frameshift_variant	0			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.406delG	11.37:g.6638634delC	ENSP00000299427:p.Ala136fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71V64	Frame_Shift_Del	DEL	pfam_Peptidase_S53_propep,pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	p.A136fs	ENST00000299427.6	37	c.406	CCDS7770.1	11																																																																																			TPP1	-	pfam_Peptidase_S53_propep,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	ENSG00000166340		0.552	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257261.2	100	0.00	0	C			6638634	6638634	-1	no_errors	ENST00000299427	ensembl	human	known	69_37n	frame_shift_del	72	25.00	24	DEL	1.000	-
TRIM29	23650	genome.wustl.edu	37	11	120008036	120008036	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr11:120008036A>C	ENST00000341846.5	-	1	1125	c.704T>G	c.(703-705)tTc>tGc	p.F235C		NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	235					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		GGTCTGGCAGAAGAGCTCCAT	0.612																																						dbGAP											0													87.0	82.0	84.0					11																	120008036		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.704T>G	11.37:g.120008036A>C	ENSP00000343129:p.Phe235Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AA9|Q9BZY7	Missense_Mutation	SNP	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	p.F235C	ENST00000341846.5	37	c.704	CCDS8428.1	11	.	.	.	.	.	.	.	.	.	.	A	20.2	3.942266	0.73672	.	.	ENSG00000137699	ENST00000341846	T	0.57595	0.39	5.91	4.75	0.60458	Zinc finger, B-box (3);	0.000000	0.85682	D	0.000000	T	0.73783	0.3631	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76517	-0.2930	9	.	.	.	.	12.2965	0.54849	0.8729:0.0:0.0:0.127	.	235	Q14134	TRI29_HUMAN	C	235	ENSP00000343129:F235C	.	F	-	2	0	TRIM29	119513246	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.287000	0.51732	1.018000	0.39521	0.533000	0.62120	TTC	TRIM29	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000137699		0.612	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM29	HGNC	protein_coding	OTTHUMT00000277108.2	64	0.00	0	A	NM_012101		120008036	120008036	-1	no_errors	ENST00000341846	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	1.000	C
TRIM46	80128	genome.wustl.edu	37	1	155150624	155150625	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G|C	G|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:155150624_155150625GC>AT	ENST00000334634.4	+	6	1056_1057	c.1056_1057GC>AT	c.(1054-1059)gaGCac>gaATac	p.H353Y	TRIM46_ENST00000368382.1_Missense_Mutation_p.H330Y|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000543729.1_Missense_Mutation_p.H360Y|TRIM46_ENST00000368383.3_Missense_Mutation_p.H353Y|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368385.4_Missense_Mutation_p.H353Y|TRIM46_ENST00000545012.1_Missense_Mutation_p.H227Y|TRIM46_ENST00000392451.2_Missense_Mutation_p.H353Y	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	353						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGATCCAGGAGCACCGGAGCCT	0.619																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	Exception_encountered	1.37:g.155150624_155150625delinsAT	ENSP00000334657:p.His353Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Silent|Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.E352|p.H353Y	ENST00000334634.4	37	c.1056|c.1057	CCDS1097.1	1																																																																																			TRIM46	-	NULL	ENSG00000163462		0.619	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	HGNC	protein_coding	OTTHUMT00000086728.1	41	0.00	0	G|C	NM_025058		155150624|155150625	155150624|155150625	+1	no_errors	ENST00000334634	ensembl	human	known	69_37n	silent|missense	58|57	24.68|25.97	19|20	SNP	1.000	A|T
TRPM6	140803	genome.wustl.edu	37	9	77377214	77377214	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr9:77377214G>A	ENST00000360774.1	-	26	4610	c.4373C>T	c.(4372-4374)tCa>tTa	p.S1458L	TRPM6_ENST00000361255.3_Missense_Mutation_p.S1453L|TRPM6_ENST00000449912.2_Missense_Mutation_p.S1453L|TRPM6_ENST00000451710.3_Missense_Mutation_p.S1458L|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.S1458L|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1458					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATCACCTTCTGAAAATGCCCA	0.483																																						dbGAP											0													111.0	111.0	111.0					9																	77377214		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4373C>T	9.37:g.77377214G>A	ENSP00000354006:p.Ser1458Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.S1458L	ENST00000360774.1	37	c.4373	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801170	0.90538	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T	0.56275	0.55;0.55;0.55;0.55;0.47	5.81	5.81	0.92471	.	0.577218	0.17619	N	0.167792	T	0.51092	0.1654	N	0.08118	0	0.52099	D	0.999942	D;D;D	0.69078	0.995;0.992;0.997	P;P;P	0.55161	0.593;0.77;0.77	T	0.61579	-0.7034	10	0.87932	D	0	.	20.0621	0.97678	0.0:0.0:1.0:0.0	.	1458;1453;1453	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	L	1458;1458;1453;1453;1458	ENSP00000354006:S1458L;ENSP00000407341:S1458L;ENSP00000396672:S1453L;ENSP00000354962:S1453L;ENSP00000366060:S1458L	ENSP00000354006:S1458L	S	-	2	0	TRPM6	76567034	1.000000	0.71417	0.997000	0.53966	0.831000	0.47069	4.922000	0.63404	2.750000	0.94351	0.655000	0.94253	TCA	TRPM6	-	NULL	ENSG00000119121		0.483	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	331	0.00	0	G	NM_017662		77377214	77377214	-1	no_errors	ENST00000451710	ensembl	human	known	69_37n	missense	182	14.15	30	SNP	0.999	A
USP34	9736	genome.wustl.edu	37	2	61492665	61492665	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr2:61492665C>T	ENST00000398571.2	-	43	5721	c.5645G>A	c.(5644-5646)tGg>tAg	p.W1882*		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1882					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTCATGAGGCCAGTAATCCCA	0.393																																						dbGAP											0													130.0	121.0	124.0					2																	61492665		1887	4109	5996	-	-	-	SO:0001587	stop_gained	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5645G>A	2.37:g.61492665C>T	ENSP00000381577:p.Trp1882*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Nonsense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.W1882*	ENST00000398571.2	37	c.5645	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356770	0.82243	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	.	.	.	5.28	4.36	0.52297	.	0.129568	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2325	0.73401	0.1411:0.8589:0.0:0.0	.	.	.	.	X	1730;1730;1882;160	.	ENSP00000263989:W1730X	W	-	2	0	USP34	61346169	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.059000	0.71133	2.473000	0.83533	0.655000	0.94253	TGG	USP34	-	superfamily_ARM-type_fold	ENSG00000115464		0.393	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	328	0.00	0	C			61492665	61492665	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	nonsense	250	11.97	34	SNP	1.000	T
VPS13C	54832	genome.wustl.edu	37	15	62242616	62242616	+	Splice_Site	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr15:62242616C>A	ENST00000261517.5	-	41	4610	c.4537G>T	c.(4537-4539)Gca>Tca	p.A1513S	VPS13C_ENST00000395898.3_Splice_Site_p.A1470S|VPS13C_ENST00000395896.4_Splice_Site_p.A1513S|VPS13C_ENST00000249837.3_Splice_Site_p.A1470S	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TCACTGTCTGCCTACAAATAG	0.313																																						dbGAP											0													84.0	82.0	83.0					15																	62242616		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.4537-1G>T	15.37:g.62242616C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.A1513S	ENST00000261517.5	37	c.4537	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	25.0	4.594065	0.86953	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.30714	1.52;1.52;1.52	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.50820	0.1638	L	0.49126	1.545	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.85130	0.988;0.995;0.991;0.997	T	0.53049	-0.8493	10	0.72032	D	0.01	.	16.757	0.85502	0.0:1.0:0.0:0.0	.	1470;1513;1470;1513	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	S	1470;1513;1513;1513	ENSP00000249837:A1470S;ENSP00000261517:A1513S;ENSP00000379233:A1513S	ENSP00000249837:A1470S	A	-	1	0	VPS13C	60029908	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.989000	0.49393	2.358000	0.79984	0.467000	0.42956	GCA	VPS13C	-	NULL	ENSG00000129003		0.313	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	197	0.00	0	C	NM_017684	Missense_Mutation	62242616	62242616	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	87	10.20	10	SNP	1.000	A
VWA3B	200403	genome.wustl.edu	37	2	98928506	98928507	+	Intron	INS	-	-	G	rs374561862|rs550251243	byFrequency	TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr2:98928506_98928507insG	ENST00000477737.1	+	27	3939				VWA3B_ENST00000490947.2_Intron	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GTTTGGGTGATGGGGGGGGAAC	0.594													GGGGGGG|GGGGGGGG|GGGGGGGGG|cryptic_indel	5	0.000998403	0.0023	0.0	5008	,	,		17671	0.002		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.3735+11->G	2.37:g.98928514_98928514dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Frame_Shift_Ins	INS	pfscan_VWF_A	p.T662fs	ENST00000477737.1	37	c.1977_1978	CCDS42718.1	2																																																																																			VWA3B	-	NULL	ENSG00000168658		0.594	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2	30	0.00	0	-	NM_144992		98928506	98928507	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000473149	ensembl	human	putative	69_37n	frame_shift_ins	25	16.67	5	INS	0.000:0.004	G
WBP11P1	441818	genome.wustl.edu	37	18	30093381	30093381	+	RNA	SNP	C	C	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr18:30093381C>A	ENST00000567636.1	+	0	1756					NR_003558.1				WW domain binding protein 11 pseudogene 1																		TTGGGATCTGCCCCCCTGGGC	0.488																																						dbGAP											0																																										-	-	-			0			BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30093381C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			WBP11P1	-	-	ENSG00000260389		0.488	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	120	0.00	0	C			30093381	30093381	+1	no_errors	ENST00000567636	ensembl	human	known	69_37n	rna	145	11.04	18	SNP	0.976	A
WWC3	55841	genome.wustl.edu	37	X	10062266	10062266	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chrX:10062266C>T	ENST00000380861.4	+	7	993	c.602C>T	c.(601-603)gCt>gTt	p.A201V	WWC3_ENST00000454666.1_Missense_Mutation_p.A201V	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	201					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						CCTGGCGATGCTGGTGTACCC	0.602																																						dbGAP											0													122.0	107.0	112.0					X																	10062266		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.602C>T	X.37:g.10062266C>T	ENSP00000370242:p.Ala201Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.A201V	ENST00000380861.4	37	c.602	CCDS14136.1	X	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549106	0.45383	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000398613	T;T	0.04706	3.57;3.57	5.36	5.36	0.76844	.	0.341063	0.35262	N	0.003330	T	0.03739	0.0106	N	0.08118	0	0.23769	N	0.99689	B	0.27679	0.185	B	0.26969	0.075	T	0.46456	-0.9190	10	0.27082	T	0.32	-4.0611	18.1967	0.89825	0.0:1.0:0.0:0.0	.	201	Q9ULE0	WWC3_HUMAN	V	201	ENSP00000370242:A201V;ENSP00000399584:A201V	ENSP00000370242:A201V	A	+	2	0	WWC3	10022266	1.000000	0.71417	0.004000	0.12327	0.006000	0.05464	4.026000	0.57232	2.234000	0.73211	0.600000	0.82982	GCT	WWC3	-	NULL	ENSG00000047644		0.602	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	129	0.00	0	C	NM_015691		10062266	10062266	+1	no_errors	ENST00000380861	ensembl	human	known	69_37n	missense	89	21.93	25	SNP	0.595	T
ZNF644	84146	genome.wustl.edu	37	1	91405516	91405516	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A09A-01A-11W-A019-09	TCGA-A8-A09A-10A-01W-A062-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ecfedc29-5c31-4d3d-b599-fc0a1c0beafa	c3017ca7-a84a-4cc3-9eb0-0336f130be31	g.chr1:91405516T>A	ENST00000370440.1	-	3	1612	c.1395A>T	c.(1393-1395)aaA>aaT	p.K465N	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.K465N|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TAATCATATGTTTTAGAAGTG	0.403																																						dbGAP											0													120.0	119.0	119.0					1																	91405516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.1395A>T	1.37:g.91405516T>A	ENSP00000359469:p.Lys465Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K465N	ENST00000370440.1	37	c.1395	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.144574	0.37825	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	T;T	0.77358	-1.09;-1.09	5.82	2.64	0.31445	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.046270	0.85682	D	0.000000	T	0.67748	0.2926	N	0.20483	0.58	0.49915	D	0.999837	D	0.89917	1.0	D	0.87578	0.998	T	0.69566	-0.5111	10	0.48119	T	0.1	-12.2035	8.3581	0.32342	0.0:0.5452:0.0:0.4548	.	465	Q9H582	ZN644_HUMAN	N	465;465;37	ENSP00000359469:K465N;ENSP00000337008:K465N	ENSP00000337008:K465N	K	-	3	2	ZNF644	91178104	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	0.323000	0.19593	0.241000	0.21283	0.533000	0.62120	AAA	ZNF644	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000122482		0.403	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	194	0.00	0	T	NM_032186		91405516	91405516	-1	no_errors	ENST00000337393	ensembl	human	known	69_37n	missense	162	24.65	53	SNP	0.998	A
