#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCD1	215	genome.wustl.edu	37	X	153008483	153008483	+	Missense_Mutation	SNP	G	G	A	rs78993751		TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chrX:153008483G>A	ENST00000218104.3	+	8	2222	c.1823G>A	c.(1822-1824)gGc>gAc	p.G608D	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	608	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		G -> D (in ALD; CALD-type). {ECO:0000269|PubMed:11438993}.		alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGTCGGGTGGCGAGAAGCAG	0.652																																						dbGAP											0			GRCh37	CM012040	ABCD1	M	rs78993751																																			-	-	-	SO:0001583	missense	0			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1823G>A	X.37:g.153008483G>A	ENSP00000218104:p.Gly608Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTZ2	Missense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	p.G608D	ENST00000218104.3	37	c.1823	CCDS14728.1	X	.	.	.	.	.	.	.	.	.	.	G	27.8	4.864716	0.91511	.	.	ENSG00000101986	ENST00000218104	D	0.99981	-10.31	5.46	5.46	0.80206	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000002	D	0.99984	0.9995	H	0.98178	4.165	0.09310	P	1.0	D	0.89917	1.0	D	0.91635	0.999	D	0.99264	1.0891	9	0.87932	D	0	-31.6285	17.0243	0.86441	0.0:0.0:1.0:0.0	.	608	P33897	ABCD1_HUMAN	D	608	ENSP00000218104:G608D	ENSP00000218104:G608D	G	+	2	0	ABCD1	152661677	1.000000	0.71417	0.632000	0.29296	0.808000	0.45660	9.405000	0.97313	2.283000	0.76528	0.429000	0.28392	GGC	ABCD1	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_FA_transporter	ENSG00000101986		0.652	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD1	HGNC	protein_coding	OTTHUMT00000061041.1	11	0.00	0	G	NM_000033		153008483	153008483	+1	no_errors	ENST00000218104	ensembl	human	known	69_37n	missense	0	100.00	3	SNP	1.000	A
AKR1A1	10327	genome.wustl.edu	37	1	46033710	46033711	+	Frame_Shift_Ins	INS	-	-	A	rs61758860	byFrequency	TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr1:46033710_46033711insA	ENST00000372070.3	+	6	1160_1161	c.413_414insA	c.(412-417)acccacfs	p.H139fs	AKR1A1_ENST00000473038.1_3'UTR|AKR1A1_ENST00000351829.4_Frame_Shift_Ins_p.H139fs	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	139					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	TACGACTCCACCCACTACAAGG	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	Exception_encountered	1.37:g.46033710_46033711insA	ENSP00000361140:p.His139fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAL8|D3DQ04|Q6IAZ4	Frame_Shift_Ins	INS	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.H139fs	ENST00000372070.3	37	c.413_414	CCDS523.1	1																																																																																			AKR1A1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000117448		0.574	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1A1	HGNC	protein_coding	OTTHUMT00000020851.1	28	0.00	0	-	NM_006066		46033710	46033711	+1	no_errors	ENST00000351829	ensembl	human	known	69_37n	frame_shift_ins	24	31.43	11	INS	0.073:0.229	A
ANGPTL2	23452	genome.wustl.edu	37	9	129870474	129870474	+	Silent	SNP	C	C	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr9:129870474C>A	ENST00000373425.3	-	2	1154	c.537G>T	c.(535-537)ctG>ctT	p.L179L	ANGPTL2_ENST00000373417.1_Intron|RALGPS1_ENST00000394022.3_Intron|RALGPS1_ENST00000373436.1_Intron|RALGPS1_ENST00000259351.5_Intron|RALGPS1_ENST00000373434.1_Intron|ANGPTL2_ENST00000491991.1_5'Flank|RALGPS1_ENST00000424082.2_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	179					multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						ACTTGTGCTCCAGGTCCTTGT	0.622																																						dbGAP											0													60.0	54.0	56.0					9																	129870474		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.537G>T	9.37:g.129870474C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT58|Q8NCH7	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.L179	ENST00000373425.3	37	c.537	CCDS6868.1	9																																																																																			ANGPTL2	-	NULL	ENSG00000136859		0.622	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL2	HGNC	protein_coding	OTTHUMT00000054129.1	43	0.00	0	C	NM_012098		129870474	129870474	-1	no_errors	ENST00000373425	ensembl	human	known	69_37n	silent	38	13.64	6	SNP	1.000	A
ANK1	286	genome.wustl.edu	37	8	41553949	41553950	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr8:41553949_41553950insG	ENST00000347528.4	-	26	2974_2975	c.2891_2892insC	c.(2890-2892)ccafs	p.P964fs	ANK1_ENST00000396942.1_Frame_Shift_Ins_p.P964fs|ANK1_ENST00000289734.7_Frame_Shift_Ins_p.P964fs|ANK1_ENST00000352337.4_Frame_Shift_Ins_p.P964fs|ANK1_ENST00000265709.8_Frame_Shift_Ins_p.P1005fs|ANK1_ENST00000396945.1_Frame_Shift_Ins_p.P964fs|ANK1_ENST00000379758.2_Frame_Shift_Ins_p.P964fs	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	964	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCTCGGCCAGTGGGGGCGGCGT	0.708																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.2892dupC	8.37:g.41553954_41553954dupG	ENSP00000339620:p.Pro964fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.L965fs	ENST00000347528.4	37	c.2892_2891	CCDS6119.1	8																																																																																			ANK1	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000029534		0.708	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	12	0.00	0	-	NM_020475		41553949	41553950	-1	no_errors	ENST00000396942	ensembl	human	known	69_37n	frame_shift_ins	8	20.00	2	INS	0.048:0.999	G
B3GALTL	145173	genome.wustl.edu	37	13	31903712	31903712	+	Silent	SNP	C	C	T	rs372748811	byFrequency	TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr13:31903712C>T	ENST00000343307.4	+	15	1553	c.1404C>T	c.(1402-1404)atC>atT	p.I468I		NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	468					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		ACTGGAACATCGATCCAGTGA	0.478													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20013	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													137.0	131.0	133.0					13																	31903712		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.1404C>T	13.37:g.31903712C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5F8|Q5W0H2|Q6NUI3	Silent	SNP	pfam_Fringe-like	p.I468	ENST00000343307.4	37	c.1404	CCDS9341.1	13																																																																																			B3GALTL	-	pfam_Fringe-like	ENSG00000187676		0.478	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALTL	HGNC	protein_coding	OTTHUMT00000044396.3	137	0.00	0	C	NM_194318		31903712	31903712	+1	no_errors	ENST00000343307	ensembl	human	known	69_37n	silent	85	32.00	40	SNP	0.964	T
ATP11A	23250	genome.wustl.edu	37	13	113464932	113464932	+	Splice_Site	SNP	G	G	C			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr13:113464932G>C	ENST00000487903.1	+	5	421		c.e5-1		ATP11A_ENST00000375630.2_Splice_Site|ATP11A_ENST00000283558.8_Splice_Site|ATP11A_ENST00000375645.3_Splice_Site			P98196	AT11A_HUMAN	ATPase, class VI, type 11A						phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				cctTTTTTTAGGGTTATGAAG	0.463																																						dbGAP											0													94.0	94.0	94.0					13																	113464932		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.334-1G>C	13.37:g.113464932G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXT2	Splice_Site	SNP	-	e5-1	ENST00000487903.1	37	c.334-1	CCDS32011.1	13	.	.	.	.	.	.	.	.	.	.	G	19.57	3.851786	0.71719	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000418678	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0821	0.86601	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP11A	112512933	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	8.312000	0.89976	2.385000	0.81259	0.563000	0.77884	.	ATP11A	-	-	ENSG00000068650		0.463	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	59	0.00	0	G	NM_015205	Intron	113464932	113464932	+1	no_errors	ENST00000375630	ensembl	human	known	69_37n	splice_site	51	25.00	17	SNP	1.000	C
C6	729	genome.wustl.edu	37	5	41160256	41160256	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr5:41160256C>T	ENST00000263413.3	-	11	1936	c.1672G>A	c.(1672-1674)Gat>Aat	p.D558N	C6_ENST00000337836.5_Missense_Mutation_p.D558N|C6_ENST00000475349.1_5'Flank	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	558					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GATTTATAATCTGGAGACTGT	0.418																																						dbGAP											0													91.0	91.0	91.0					5																	41160256		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1672G>A	5.37:g.41160256C>T	ENSP00000263413:p.Asp558Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal-type_dom,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.D558N	ENST00000263413.3	37	c.1672	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294155	0.60086	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.61274	0.12;0.12	6.06	6.06	0.98353	.	1.329030	0.04512	N	0.382988	T	0.68622	0.3021	M	0.73598	2.24	0.58432	D	0.999999	P	0.39748	0.686	B	0.39094	0.29	T	0.63431	-0.6639	10	0.38643	T	0.18	-18.6999	20.6208	0.99490	0.0:1.0:0.0:0.0	.	558	P13671	CO6_HUMAN	N	558	ENSP00000338861:D558N;ENSP00000263413:D558N	ENSP00000263413:D558N	D	-	1	0	C6	41196013	1.000000	0.71417	0.489000	0.27452	0.316000	0.28119	7.459000	0.80802	2.882000	0.98803	0.655000	0.94253	GAT	C6	-	NULL	ENSG00000039537		0.418	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	164	0.00	0	C			41160256	41160256	-1	no_errors	ENST00000263413	ensembl	human	known	69_37n	missense	138	42.08	101	SNP	1.000	T
CCDC180	100499483	genome.wustl.edu	37	9	100070026	100070026	+	Missense_Mutation	SNP	C	C	T	rs577188983		TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr9:100070026C>T	ENST00000357054.1	+	15	1341	c.406C>T	c.(406-408)Cgg>Tgg	p.R136W	CCDC180_ENST00000375202.2_5'UTR|CCDC180_ENST00000411667.2_5'UTR|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000395220.1_Missense_Mutation_p.R136W|CCDC180_ENST00000529487.1_5'UTR|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	136						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGAGTCCCTTCGGATTTGCGC	0.522																																						dbGAP											0													109.0	108.0	109.0					9																	100070026		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.406C>T	9.37:g.100070026C>T	ENSP00000349562:p.Arg136Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.R136W	ENST00000357054.1	37	c.406		9	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424540	0.43020	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000541524	T;T	0.19806	3.03;2.12	3.59	-7.19	0.01500	.	2.112880	0.02899	N	0.135140	T	0.17023	0.0409	.	.	.	0.09310	N	0.999997	B;B	0.15473	0.013;0.013	B;B	0.06405	0.002;0.002	T	0.30534	-0.9975	9	0.87932	D	0	.	12.1329	0.53952	0.0:0.1557:0.6755:0.1688	.	136;136	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	W	136;136;20	ENSP00000349562:R136W;ENSP00000378646:R136W	ENSP00000349562:R136W	R	+	1	2	C9orf174	99109847	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-1.828000	0.01702	-1.915000	0.01077	-0.291000	0.09656	CGG	C9orf174	-	NULL	ENSG00000197816		0.522	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		72	0.00	0	C	NM_020893		100070026	100070026	+1	no_errors	ENST00000357054	ensembl	human	known	69_37n	missense	9	73.53	25	SNP	0.000	T
CLEC4G	339390	genome.wustl.edu	37	19	7795289	7795289	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr19:7795289C>G	ENST00000328853.5	-	6	494	c.426G>C	c.(424-426)gaG>gaC	p.E142D	CLEC4G_ENST00000598081.1_5'Flank	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G	142						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						TGCGGACGTCCTCACGGCCCC	0.692																																					Esophageal Squamous(146;540 1807 3349 19438 30853)	dbGAP											0													27.0	32.0	30.0					19																	7795289		2201	4288	6489	-	-	-	SO:0001583	missense	0			AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.426G>C	19.37:g.7795289C>G	ENSP00000327599:p.Glu142Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.E142D	ENST00000328853.5	37	c.426	CCDS12185.1	19	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186759	0.38609	.	.	ENSG00000182566	ENST00000328853;ENST00000381308	T	0.01099	5.34	5.62	1.78	0.24846	.	0.402896	0.18315	N	0.144999	T	0.01558	0.0050	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	P	0.60473	0.875	T	0.55952	-0.8059	10	0.29301	T	0.29	.	6.0584	0.19824	0.0:0.6466:0.1615:0.1919	.	142	Q6UXB4	CLC4G_HUMAN	D	142;26	ENSP00000327599:E142D	ENSP00000327599:E142D	E	-	3	2	CLEC4G	7701289	0.003000	0.15002	0.045000	0.18777	0.014000	0.08584	0.377000	0.20552	0.699000	0.31761	0.655000	0.94253	GAG	CLEC4G	-	NULL	ENSG00000182566		0.692	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4G	HGNC	protein_coding	OTTHUMT00000461989.1	24	0.00	0	C	NM_198492		7795289	7795289	-1	no_errors	ENST00000328853	ensembl	human	known	69_37n	missense	7	50.00	7	SNP	0.004	G
COL5A3	50509	genome.wustl.edu	37	19	10084293	10084293	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr19:10084293G>A	ENST00000264828.3	-	50	3704	c.3619C>T	c.(3619-3621)Cga>Tga	p.R1207*		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1207	Triple-helical region.		R -> P (in dbSNP:rs2287813).		axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GCGTCCCCTCGCTCACCCTGC	0.622																																						dbGAP											0													52.0	55.0	54.0					19																	10084293		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3619C>T	19.37:g.10084293G>A	ENSP00000264828:p.Arg1207*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ6	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.R1207*	ENST00000264828.3	37	c.3619	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	G	43	9.842604	0.99277	.	.	ENSG00000080573	ENST00000264828	.	.	.	4.95	3.91	0.45181	.	0.164651	0.40908	D	0.000998	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	11.1494	0.48449	0.0916:0.0:0.9084:0.0	.	.	.	.	X	1207	.	ENSP00000264828:R1207X	R	-	1	2	COL5A3	9945293	1.000000	0.71417	0.995000	0.50966	0.767000	0.43475	3.150000	0.50662	1.203000	0.43233	0.491000	0.48974	CGA	COL5A3	-	NULL	ENSG00000080573		0.622	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	51	0.00	0	G	NM_015719		10084293	10084293	-1	no_errors	ENST00000264828	ensembl	human	known	69_37n	nonsense	20	47.37	18	SNP	1.000	A
CNFN	84518	genome.wustl.edu	37	19	42891312	42891312	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr19:42891312C>T	ENST00000222032.5	-	4	381	c.332G>A	c.(331-333)cGa>cAa	p.R111Q	CNFN_ENST00000597255.1_Missense_Mutation_p.R111Q	NM_032488.3	NP_115877.2	Q9BYD5	CNFN_HUMAN	cornifelin	111					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				lung(1)|prostate(1)	2		Prostate(69;0.00899)				TCCTTACTCTCGGATCTTCAG	0.637																																						dbGAP											0													51.0	59.0	56.0					19																	42891312		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB049591	CCDS12606.1	19q13.31	2006-01-11				ENSG00000105427			30183	protein-coding gene	gene with protein product		611764					Standard	NM_032488		Approved	PLAC8L2	uc002otp.4	Q9BYD5		ENST00000222032.5:c.332G>A	19.37:g.42891312C>T	ENSP00000222032:p.Arg111Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R569	Missense_Mutation	SNP	pfam_Uncharacterised_Cys-rich,tigrfam_Uncharacterised_Cys-rich	p.R111Q	ENST00000222032.5	37	c.332	CCDS12606.1	19	.	.	.	.	.	.	.	.	.	.	C	28.2	4.900544	0.92035	.	.	ENSG00000105427	ENST00000222032	.	.	.	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.78604	0.4309	M	0.82823	2.61	0.48901	D	0.999726	D	0.69078	0.997	D	0.67725	0.953	T	0.82100	-0.0624	9	0.87932	D	0	-6.2243	13.481	0.61336	0.0:1.0:0.0:0.0	.	111	Q9BYD5	CNFN_HUMAN	Q	111	.	ENSP00000222032:R111Q	R	-	2	0	CNFN	47583152	1.000000	0.71417	0.991000	0.47740	0.688000	0.40055	2.762000	0.47597	2.447000	0.82792	0.551000	0.68910	CGA	CNFN	-	NULL	ENSG00000105427		0.637	CNFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNFN	HGNC	protein_coding	OTTHUMT00000463859.1	9	0.00	0	C	NM_032488		42891312	42891312	-1	no_errors	ENST00000222032	ensembl	human	known	69_37n	missense	6	45.45	5	SNP	1.000	T
CTAGE9	643854	genome.wustl.edu	37	6	132031833	132031833	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr6:132031833C>T	ENST00000314099.8	-	1	373	c.325G>A	c.(325-327)Gag>Aag	p.E109K	ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000414305.1_Intron|ENPP3_ENST00000358229.5_Intron	NM_001145659.1|NM_001278507.1	NP_001139131.1|NP_001265436.1	A4FU28	CTGE9_HUMAN	CTAGE family, member 9	109						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						AAAGATGACTCTACTTCATAG	0.413																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS47475.1	6q23.2	2010-06-23			ENSG00000236761	ENSG00000236761			37275	protein-coding gene	gene with protein product							Standard	NM_001145659		Approved		uc011ece.2	A4FU28	OTTHUMG00000047966	ENST00000314099.8:c.325G>A	6.37:g.132031833C>T	ENSP00000395587:p.Glu109Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E109K	ENST00000314099.8	37	c.325	CCDS47475.1	6	.	.	.	.	.	.	.	.	.	.	-	6.369	0.436109	0.12104	.	.	ENSG00000236761	ENST00000314099	T	0.37235	1.21	.	.	.	.	.	.	.	.	T	0.17365	0.0417	M	0.69463	2.115	0.09310	N	1	B	0.24533	0.105	B	0.33890	0.172	T	0.38908	-0.9639	6	0.30078	T	0.28	.	.	.	.	.	109	A4FU28	CTGE9_HUMAN	K	109	ENSP00000395587:E109K	ENSP00000395587:E109K	E	-	1	0	CTAGE9	132073526	0.914000	0.31030	.	.	.	.	0.191000	0.17076	.	.	.	.	GAG	CTAGE9	-	NULL	ENSG00000236761		0.413	CTAGE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTAGE9	HGNC	protein_coding	OTTHUMT00000109220.1	290	0.34	1	C	NM_001145659		132031833	132031833	-1	no_errors	ENST00000314099	ensembl	human	known	69_37n	missense	187	23.36	57	SNP	0.000	T
CYHR1	50626	genome.wustl.edu	37	8	145689658	145689659	+	Intron	INS	-	-	C	rs547376015	byFrequency	TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr8:145689658_145689659insC	ENST00000438911.2	-	2	380				CYHR1_ENST00000424149.2_Frame_Shift_Ins_p.A144fs|CYHR1_ENST00000403000.2_Frame_Shift_Ins_p.A144fs|KIFC2_ENST00000301332.2_5'Flank|CYHR1_ENST00000306145.5_Frame_Shift_Ins_p.A144fs|CTD-2517M22.16_ENST00000525461.1_RNA|CYHR1_ENST00000530374.1_5'Flank	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1							cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)	p.A144fs*>50(1)		haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			ACCCAGCATCGCCCCCCCCCAC	0.634											OREG0019056	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	CCCCCCCCC|CCCCCCCCC|CCCCCCCCCC|insertion	17	0.00339457	0.0061	0.0	5008	,	,		19552	0.005		0.001	False		,,,				2504	0.0031					dbGAP											1	Insertion - Frameshift(1)	ovary(1)																																								-	-	-	SO:0001627	intron_variant	0			AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.246+183->G	8.37:g.145689667_145689667dupC		Somatic	1696	WXS	Illumina GAIIx	Phase_IV	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Frame_Shift_Ins	INS	NULL	p.A144fs	ENST00000438911.2	37	c.431_430	CCDS47943.1	8																																																																																			CYHR1	-	NULL	ENSG00000187954		0.634	CYHR1-001	KNOWN	basic|CCDS	protein_coding	CYHR1	HGNC	protein_coding	OTTHUMT00000382438.1	16	0.00	0	-	NM_032687		145689658	145689659	-1	no_errors	ENST00000306145	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.002:0.000	C
DPPA2	151871	genome.wustl.edu	37	3	109026960	109026960	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr3:109026960C>T	ENST00000478945.1	-	6	823	c.577G>A	c.(577-579)Gct>Act	p.A193T		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	193					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GCTCTTGCAGCAATTCTTGCC	0.438																																						dbGAP											0													142.0	128.0	133.0					3																	109026960		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.577G>A	3.37:g.109026960C>T	ENSP00000417710:p.Ala193Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WVF0	Missense_Mutation	SNP	pfscan_SAP_DNA-bd	p.A193T	ENST00000478945.1	37	c.577	CCDS2956.1	3	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247901	0.39697	.	.	ENSG00000163530	ENST00000478945	T	0.58358	0.34	4.43	2.57	0.30868	.	0.503658	0.18683	N	0.134084	T	0.44685	0.1305	L	0.48877	1.53	0.29102	N	0.881401	P	0.48834	0.916	P	0.45681	0.49	T	0.39742	-0.9599	10	0.44086	T	0.13	-15.2144	5.0458	0.14483	0.2371:0.655:0.0:0.1079	.	193	Q7Z7J5	DPPA2_HUMAN	T	193	ENSP00000417710:A193T	ENSP00000417710:A193T	A	-	1	0	DPPA2	110509650	0.972000	0.33761	0.970000	0.41538	0.605000	0.37080	0.491000	0.22419	0.754000	0.32968	0.555000	0.69702	GCT	DPPA2	-	NULL	ENSG00000163530		0.438	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA2	HGNC	protein_coding	OTTHUMT00000353938.1	124	0.00	0	C	NM_138815		109026960	109026960	-1	no_errors	ENST00000478945	ensembl	human	known	69_37n	missense	126	22.70	37	SNP	0.972	T
DST	667	genome.wustl.edu	37	6	56473226	56473226	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr6:56473226C>T	ENST00000361203.3	-	36	5574	c.5567G>A	c.(5566-5568)cGa>cAa	p.R1856Q	DST_ENST00000370769.4_Missense_Mutation_p.R1856Q|DST_ENST00000421834.2_Intron|DST_ENST00000312431.6_Missense_Mutation_p.R1856Q|DST_ENST00000446842.2_Missense_Mutation_p.R1530Q|DST_ENST00000244364.6_Intron|DST_ENST00000370754.5_Missense_Mutation_p.R2034Q|DST_ENST00000370788.2_Intron			Q03001	DYST_HUMAN	dystonin	1856					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AACATAGCCTCGCTGAGCTTC	0.438																																						dbGAP											0													77.0	76.0	76.0					6																	56473226		1911	4134	6045	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.5567G>A	6.37:g.56473226C>T	ENSP00000354508:p.Arg1856Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.R2034Q	ENST00000361203.3	37	c.6101		6	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726714	0.48833	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73;-0.73	5.01	5.01	0.66863	.	0.000000	0.43919	D	0.000503	T	0.53029	0.1771	.	.	.	0.32447	N	0.5459689999999999	P	0.41848	0.763	B	0.37601	0.254	T	0.59327	-0.7475	8	0.36615	T	0.2	.	18.2754	0.90081	0.0:1.0:0.0:0.0	.	1530	Q03001-9	.	Q	2034;1856;1530;1856;1856;1530	ENSP00000359790:R2034Q;ENSP00000359805:R1856Q;ENSP00000393645:R1530Q;ENSP00000307959:R1856Q;ENSP00000354508:R1856Q;ENSP00000404924:R1530Q	ENSP00000307959:R1856Q	R	-	2	0	DST	56581185	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	1.930000	0.40124	2.477000	0.83638	0.455000	0.32223	CGA	DST	-	pfam_Plectin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Plectin_repeat	ENSG00000151914		0.438	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	146	0.00	0	C	NM_001723		56473226	56473226	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	139	22.35	40	SNP	1.000	T
ERAL1	26284	genome.wustl.edu	37	17	27185468	27185468	+	Silent	SNP	G	G	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr17:27185468G>A	ENST00000254928.5	+	6	772	c.675G>A	c.(673-675)aaG>aaA	p.K225K	MIR144_ENST00000385059.1_lincRNA	NM_005702.2	NP_005693.1	O75616	ERAL1_HUMAN	Era-like 12S mitochondrial rRNA chaperone 1	225	Era-type G.				ribosomal small subunit assembly (GO:0000028)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			GCTTGACCAAGTACTCCCAGA	0.537																																						dbGAP											0													149.0	114.0	126.0					17																	27185468		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF082657	CCDS11244.1	17q11.2	2013-05-22	2013-05-22		ENSG00000132591	ENSG00000132591			3424	protein-coding gene	gene with protein product		607435	"""Era (E. coli G-protein homolog)-like 1"", ""Era G-protein-like 1 (E. coli)"""			10945472, 20604745	Standard	NM_005702		Approved	HERA-B	uc002hcy.1	O75616	OTTHUMG00000132675	ENST00000254928.5:c.675G>A	17.37:g.27185468G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN21|C9JEC6|O75617|Q8WUY4|Q96LE2|Q96TC0	Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_MIRO-like,pfam_Dynamin_GTPase,pfam_AIG1,pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.S225N	ENST00000254928.5	37	c.674	CCDS11244.1	17																																																																																			ERAL1	-	pfam_GTP_binding_domain,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,tigrfam_Small_GTP-bd_dom	ENSG00000132591		0.537	ERAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAL1	HGNC	protein_coding	OTTHUMT00000255937.2	223	0.00	0	G			27185468	27185468	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000461894	ensembl	human	known	69_37n	missense	231	13.16	35	SNP	1.000	A
ESPL1	9700	genome.wustl.edu	37	12	53684751	53684751	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr12:53684751delT	ENST00000257934.4	+	25	5582	c.5491delT	c.(5491-5493)tggfs	p.W1831fs	ESPL1_ENST00000552462.1_Frame_Shift_Del_p.W1831fs	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1831					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GGACTGTGGCTGGAAATATCC	0.637																																					Colon(53;1069 1201 2587 5382)	dbGAP											0													22.0	20.0	20.0					12																	53684751		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5491delT	12.37:g.53684751delT	ENSP00000257934:p.Trp1831fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Peptidase_C50	p.W1831fs	ENST00000257934.4	37	c.5491	CCDS8852.1	12																																																																																			ESPL1	-	pfam_Peptidase_C50	ENSG00000135476		0.637	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	10	0.00	0	T	NM_012291		53684751	53684751	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	frame_shift_del	3	40.00	2	DEL	1.000	-
FAM81A	145773	genome.wustl.edu	37	15	59784566	59784566	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr15:59784566G>A	ENST00000288228.5	+	4	578	c.391G>A	c.(391-393)Gat>Aat	p.D131N		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	131										endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						CGGTTTGGGAGATCTTCGAGG	0.463																																						dbGAP											0													46.0	46.0	46.0					15																	59784566		1843	4086	5929	-	-	-	SO:0001583	missense	0				CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.391G>A	15.37:g.59784566G>A	ENSP00000288228:p.Asp131Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Ferritin/RR-like	p.D131N	ENST00000288228.5	37	c.391	CCDS45269.1	15	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584078	0.86748	.	.	ENSG00000157470	ENST00000288228	T	0.29142	1.58	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000003	T	0.52917	0.1764	M	0.69358	2.11	0.41511	D	0.988345	D	0.67145	0.996	D	0.79784	0.993	T	0.57069	-0.7874	10	0.87932	D	0	-22.7737	13.8198	0.63313	0.0:0.0:1.0:0.0	.	131	Q8TBF8	FA81A_HUMAN	N	131	ENSP00000288228:D131N	ENSP00000288228:D131N	D	+	1	0	FAM81A	57571858	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	6.310000	0.72830	2.329000	0.79093	0.555000	0.69702	GAT	FAM81A	-	NULL	ENSG00000157470		0.463	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81A	HGNC	protein_coding	OTTHUMT00000415876.1	68	0.00	0	G	NM_152450		59784566	59784566	+1	no_errors	ENST00000288228	ensembl	human	known	69_37n	missense	50	25.37	17	SNP	1.000	A
GPC5	2262	genome.wustl.edu	37	13	93518661	93518661	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr13:93518661G>T	ENST00000377067.3	+	8	2060	c.1688G>T	c.(1687-1689)aGt>aTt	p.S563I		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	563					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ACTCTGATAAGTGTGGTGATG	0.438																																						dbGAP											0													392.0	292.0	326.0					13																	93518661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1688G>T	13.37:g.93518661G>T	ENSP00000366267:p.Ser563Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.S563I	ENST00000377067.3	37	c.1688	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	G	5.197	0.221930	0.09863	.	.	ENSG00000179399	ENST00000377067	T	0.48836	0.8	5.81	3.04	0.35103	.	1.261290	0.05908	N	0.631135	T	0.37073	0.0990	N	0.22421	0.69	0.09310	N	1	B	0.27316	0.175	B	0.27076	0.076	T	0.32666	-0.9898	10	0.33141	T	0.24	-16.4658	10.3377	0.43860	0.0709:0.3764:0.5526:0.0	.	563	P78333	GPC5_HUMAN	I	563	ENSP00000366267:S563I	ENSP00000366267:S563I	S	+	2	0	GPC5	92316662	0.994000	0.37717	0.035000	0.18076	0.077000	0.17291	2.058000	0.41374	0.317000	0.23160	0.650000	0.86243	AGT	GPC5	-	pfam_Glypican	ENSG00000179399		0.438	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	230	0.00	0	G	NM_004466		93518661	93518661	+1	no_errors	ENST00000377067	ensembl	human	known	69_37n	missense	179	41.69	128	SNP	0.140	T
HUNK	30811	genome.wustl.edu	37	21	33331189	33331189	+	Silent	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr21:33331189C>T	ENST00000270112.2	+	5	1141	c.781C>T	c.(781-783)Ctg>Ttg	p.L261L		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						GACCGGGACGCTGCCTTTCAC	0.542																																						dbGAP											0													154.0	138.0	143.0					21																	33331189		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.781C>T	21.37:g.33331189C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L261	ENST00000270112.2	37	c.781	CCDS13610.1	21																																																																																			HUNK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000142149		0.542	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	HGNC	protein_coding	OTTHUMT00000192782.1	157	0.00	0	C	NM_014586		33331189	33331189	+1	no_errors	ENST00000270112	ensembl	human	known	69_37n	silent	107	13.71	17	SNP	1.000	T
ITIH6	347365	genome.wustl.edu	37	X	54777709	54777709	+	Missense_Mutation	SNP	G	G	A	rs201158794		TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chrX:54777709G>A	ENST00000218436.6	-	12	3486	c.3457C>T	c.(3457-3459)Cgg>Tgg	p.R1153W		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1153					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										GTATAGGCCCGGGGTTTGTCT	0.587													G|||	1	0.000264901	0.0008	0.0	3775	,	,		14138	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													76.0	64.0	68.0					X																	54777709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3457C>T	X.37:g.54777709G>A	ENSP00000218436:p.Arg1153Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN03	Missense_Mutation	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.R1153W	ENST00000218436.6	37	c.3457	CCDS14361.1	X	1	6.027727546714888E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	1.585	-0.530650	0.04112	.	.	ENSG00000102313	ENST00000218436	T	0.12039	2.72	3.44	-1.19	0.09585	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	779.484000	0.00166	N	0.000004	T	0.11580	0.0282	L	0.39898	1.24	0.09310	N	1	B	0.15930	0.015	B	0.11329	0.006	T	0.24799	-1.0150	10	0.51188	T	0.08	.	1.1165	0.01715	0.317:0.1473:0.3833:0.1524	.	1153	Q6UXX5	ITH5L_HUMAN	W	1153	ENSP00000218436:R1153W	ENSP00000218436:R1153W	R	-	1	2	ITIH5L	54794434	0.000000	0.05858	0.001000	0.08648	0.105000	0.19272	0.005000	0.13129	-1.111000	0.02988	-0.907000	0.02831	CGG	ITIH6	-	pfam_ITI_HC_C	ENSG00000102313		0.587	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH6	HGNC	protein_coding	OTTHUMT00000056814.2	39	0.00	0	G	NM_198510		54777709	54777709	-1	no_errors	ENST00000218436	ensembl	human	known	69_37n	missense	51	19.05	12	SNP	0.000	A
ITPR1	3708	genome.wustl.edu	37	3	4853138	4853138	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr3:4853138G>A	ENST00000443694.2	+	53	7417	c.7417G>A	c.(7417-7419)Gtt>Att	p.V2473I	ITPR1_ENST00000302640.8_Missense_Mutation_p.V2473I|ITPR1_ENST00000463980.1_3'UTR|ITPR1_ENST00000357086.4_Missense_Mutation_p.V2440I|ITPR1_ENST00000456211.2_Missense_Mutation_p.V2425I|ITPR1_ENST00000544951.1_Missense_Mutation_p.V451I|ITPR1_ENST00000354582.6_Missense_Mutation_p.V2473I|AC018816.3_ENST00000489771.1_5'Flank|ITPR1_ENST00000423119.2_Missense_Mutation_p.V2440I			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2488	Interaction with ERP44. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TGAAACAGCTGTTCCAGGTGG	0.373																																						dbGAP											0													109.0	105.0	106.0					3																	4853138		1863	4098	5961	-	-	-	SO:0001583	missense	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.7417G>A	3.37:g.4853138G>A	ENSP00000401671:p.Val2473Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.V2473I	ENST00000443694.2	37	c.7417	CCDS54551.1	3	.	.	.	.	.	.	.	.	.	.	G	1.540	-0.541961	0.04053	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	D;D;D;D;D;D;D	0.97279	-2.69;-2.7;-2.69;-2.69;-2.69;-4.32;-2.69	5.47	1.51	0.23008	Ion transport (1);	1.098630	0.06790	N	0.786842	D	0.92371	0.7579	N	0.14661	0.345	0.09310	N	1	B;B;B	0.22414	0.069;0.003;0.0	B;B;B	0.24701	0.055;0.009;0.002	D	0.84567	0.0653	10	0.36615	T	0.2	.	7.9521	0.30021	0.0:0.3524:0.4482:0.1994	.	451;2488;2440	B7ZMI3;Q14643;G5E9P1	.;ITPR1_HUMAN;.	I	2488;2473;2473;2440;934;2440;2425;451;2473	ENSP00000306253:V2473I;ENSP00000346595:V2473I;ENSP00000405934:V2440I;ENSP00000349597:V2440I;ENSP00000397885:V2425I;ENSP00000440564:V451I;ENSP00000401671:V2473I	ENSP00000306253:V2473I	V	+	1	0	ITPR1	4828138	0.025000	0.19082	0.029000	0.17559	0.262000	0.26303	0.160000	0.16462	0.200000	0.20447	0.563000	0.77884	GTT	ITPR1	-	pfam_Ion_trans_dom	ENSG00000150995		0.373	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	185	0.00	0	G	NM_002222		4853138	4853138	+1	no_errors	ENST00000302640	ensembl	human	known	69_37n	missense	121	14.79	21	SNP	0.051	A
PCGF1	84759	genome.wustl.edu	37	2	74729939	74729940	+	IGR	INS	-	-	C			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr2:74729939_74729940insC	ENST00000233630.6	-	0	1792				LBX2-AS1_ENST00000548978.2_RNA|LBX2_ENST00000460508.3_Frame_Shift_Ins_p.G16fs|LBX2_ENST00000550249.1_Intron|LBX2-AS1_ENST00000603175.1_RNA|PCGF1_ENST00000480844.2_5'Flank|RP11-523H20.3_ENST00000606287.1_RNA|LBX2_ENST00000341396.2_Intron	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1						histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)	p.G16fs*99(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						GACACTTTTCTCCCCCCAACTC	0.629																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001628	intergenic_variant	0			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954		2.37:g.74729945_74729945dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z506	Frame_Shift_Ins	INS	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.E17fs	ENST00000233630.6	37	c.48_47	CCDS1946.2	2																																																																																			LBX2	-	NULL	ENSG00000179528		0.629	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBX2	HGNC	protein_coding	OTTHUMT00000252216.1	49	0.00	0	-	NM_032673		74729939	74729940	-1	no_errors	ENST00000460508	ensembl	human	known	69_37n	frame_shift_ins	23	11.54	3	INS	0.000:0.000	C
LTBP4	8425	genome.wustl.edu	37	19	41123021	41123021	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr19:41123021G>A	ENST00000308370.7	+	24	3161	c.3161G>A	c.(3160-3162)cGg>cAg	p.R1054Q	LTBP4_ENST00000243562.9_Missense_Mutation_p.R108Q|LTBP4_ENST00000545697.1_Intron|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000204005.9_Missense_Mutation_p.R1017Q|LTBP4_ENST00000396819.3_Missense_Mutation_p.R987Q	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1054	Cys-rich.|EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GACGAATGCCGGAACCGGTCC	0.627																																						dbGAP											0													67.0	74.0	72.0					19																	41123021		2092	4218	6310	-	-	-	SO:0001583	missense	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3161G>A	19.37:g.41123021G>A	ENSP00000311905:p.Arg1054Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R1054Q	ENST00000308370.7	37	c.3161		19	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648402	0.67358	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819;ENST00000243562	D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98	4.19	4.19	0.49359	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.36444	N	0.002600	D	0.89563	0.6751	N	0.12443	0.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.937;0.937	D	0.85166	0.0995	10	0.12766	T	0.61	.	11.1025	0.48184	0.0:0.0:0.8147:0.1853	.	987;1054;1017	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	Q	1017;1054;987;108	ENSP00000204005:R1017Q;ENSP00000311905:R1054Q;ENSP00000380031:R987Q;ENSP00000243562:R108Q	ENSP00000204005:R1017Q	R	+	2	0	LTBP4	45814861	0.813000	0.29090	1.000000	0.80357	0.997000	0.91878	0.406000	0.21032	2.330000	0.79161	0.563000	0.77884	CGG	LTBP4	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000090006		0.627	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		46	0.00	0	G	NM_003573		41123021	41123021	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	missense	27	38.64	17	SNP	1.000	A
MAP3K1	4214	genome.wustl.edu	37	5	56160761	56160761	+	Splice_Site	SNP	G	G	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr5:56160761G>A	ENST00000399503.3	+	4	1035	c.1035G>A	c.(1033-1035)caG>caA	p.Q345Q	AC008937.2_ENST00000415589.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	345					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TTGGGCCTCAGGTAGGATTCG	0.388																																						dbGAP											0													80.0	79.0	79.0					5																	56160761		1839	4078	5917	-	-	-	SO:0001630	splice_region_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1035+1G>A	5.37:g.56160761G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.Q345	ENST00000399503.3	37	c.1035	CCDS43318.1	5																																																																																			MAP3K1	-	pfscan_Znf_SWIM	ENSG00000095015		0.388	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	127	0.00	0	G	XM_042066	Silent	56160761	56160761	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	silent	79	31.90	37	SNP	1.000	A
MAP3K1	4214	genome.wustl.edu	37	5	56161795	56161795	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr5:56161795C>A	ENST00000399503.3	+	6	1292	c.1292C>A	c.(1291-1293)tCa>tAa	p.S431*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	431	Poly-Ser.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		ACGTCTAGTTCAGAAAACAGG	0.328																																						dbGAP											0													80.0	75.0	77.0					5																	56161795		1849	4095	5944	-	-	-	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1292C>A	5.37:g.56161795C>A	ENSP00000382423:p.Ser431*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.S431*	ENST00000399503.3	37	c.1292	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.082091	0.97267	.	.	ENSG00000095015	ENST00000399503	.	.	.	5.87	5.87	0.94306	.	0.270987	0.31989	N	0.006742	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1991	0.98252	0.0:1.0:0.0:0.0	.	.	.	.	X	431	.	ENSP00000382423:S431X	S	+	2	0	MAP3K1	56197552	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.534000	0.60622	2.775000	0.95449	0.650000	0.86243	TCA	MAP3K1	-	NULL	ENSG00000095015		0.328	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	129	0.00	0	C	XM_042066		56161795	56161795	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	nonsense	84	40.00	56	SNP	1.000	A
KMT2D	8085	genome.wustl.edu	37	12	49444769	49444769	+	Silent	SNP	G	G	C			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr12:49444769G>C	ENST00000301067.7	-	10	2696	c.2697C>G	c.(2695-2697)gcC>gcG	p.A899A		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	899	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCTCAGACAGGGCTGGCTCTC	0.647																																						dbGAP											0													56.0	61.0	60.0					12																	49444769		2018	4173	6191	-	-	-	SO:0001819	synonymous_variant	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2697C>G	12.37:g.49444769G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O14687	Silent	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.A899	ENST00000301067.7	37	c.2697	CCDS44873.1	12																																																																																			MLL2	-	NULL	ENSG00000167548		0.647	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	79	0.00	0	G			49444769	49444769	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	silent	18	53.85	21	SNP	0.896	C
MYO1E	4643	genome.wustl.edu	37	15	59519659	59519660	+	Splice_Site	DEL	TG	TG	-			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr15:59519659_59519660delTG	ENST00000288235.4	-	7	1039_1040	c.640_641delCA	c.(640-642)cag>g	p.Q214fs	MYO1E_ENST00000558814.1_5'UTR	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	214	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		CAGGAAAACCTGGTAAAATATG	0.441																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.642+1CA>-	15.37:g.59519659_59519660delTG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14778	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.Q214fs	ENST00000288235.4	37	c.641_640	CCDS32254.1	15																																																																																			MYO1E	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000157483		0.441	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1E	HGNC	protein_coding	OTTHUMT00000416024.1	107	0.00	0	TG	NM_004998	Frame_Shift_Del	59519659	59519660	-1	no_errors	ENST00000288235	ensembl	human	known	69_37n	frame_shift_del	71	31.07	32	DEL	1.000:1.000	-
NOP14	8602	genome.wustl.edu	37	4	2952748	2952749	+	Intron	INS	-	-	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr4:2952748_2952749insA	ENST00000314262.6	-	7	1051				NOP14_ENST00000398071.4_Intron|NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000502735.1_Intron|NOP14_ENST00000416614.2_Intron|NOP14-AS1_ENST00000503709.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						ATTTAAAATTCCCAACTGTAAT	0.262																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1002+91->T	4.37:g.2952748_2952749insA		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	RNA	INS	-	NULL	ENST00000314262.6	37	NULL	CCDS33945.1	4																																																																																			NOP14-AS1	-	-	ENSG00000249673		0.262	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14-AS1	HGNC	protein_coding	OTTHUMT00000358135.2	78	0.00	0	-	NM_003703		2952748	2952749	+1	no_errors	ENST00000515194	ensembl	human	known	69_37n	rna	36	10.00	4	INS	0.002:0.003	A
OSBP2	23762	genome.wustl.edu	37	22	31137337	31137338	+	Frame_Shift_Ins	INS	-	-	G	rs375203285		TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr22:31137337_31137338insG	ENST00000332585.6	+	2	938_939	c.834_835insG	c.(835-837)gtgfs	p.V279fs	OSBP2_ENST00000382310.3_Frame_Shift_Ins_p.V279fs|OSBP2_ENST00000446658.2_Frame_Shift_Ins_p.V279fs|OSBP2_ENST00000407373.1_Frame_Shift_Ins_p.V106fs|OSBP2_ENST00000403222.3_Frame_Shift_Ins_p.V114fs	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	279					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						AGGCTGTCCGCGTGATGAACAC	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.835dupG	22.37:g.31137338_31137338dupG	ENSP00000332576:p.Val279fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Frame_Shift_Ins	INS	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,superfamily_DNA-bd_dom_put,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V278fs	ENST00000332585.6	37	c.834_835	CCDS43002.1	22																																																																																			OSBP2	-	NULL	ENSG00000184792		0.599	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBP2	HGNC	protein_coding	OTTHUMT00000321547.2	23	0.00	0	-	NM_030758		31137337	31137338	+1	no_errors	ENST00000332585	ensembl	human	known	69_37n	frame_shift_ins	18	25.00	6	INS	1.000:0.999	G
PCDHB1	29930	genome.wustl.edu	37	5	140433373	140433373	+	Missense_Mutation	SNP	G	G	A	rs201121650		TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr5:140433373G>A	ENST00000306549.3	+	1	2395	c.2318G>A	c.(2317-2319)cGt>cAt	p.R773H		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	773					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R773H(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTCTTAAGCGTTTTATGCCC	0.468																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											134.0	136.0	135.0					5																	140433373		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.2318G>A	5.37:g.140433373G>A	ENSP00000307234:p.Arg773His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R773H	ENST00000306549.3	37	c.2318	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067021	0.36470	.	.	ENSG00000171815	ENST00000306549	T	0.50001	0.76	5.76	2.95	0.34219	.	0.000000	0.46758	D	0.000267	T	0.33933	0.0880	L	0.34521	1.04	0.34177	D	0.670475	B	0.02656	0.0	B	0.04013	0.001	T	0.40213	-0.9575	10	0.72032	D	0.01	.	7.8718	0.29571	0.1515:0.2374:0.6112:0.0	.	773	Q9Y5F3	PCDB1_HUMAN	H	773	ENSP00000307234:R773H	ENSP00000307234:R773H	R	+	2	0	PCDHB1	140413557	0.778000	0.28640	1.000000	0.80357	0.613000	0.37349	1.668000	0.37481	0.807000	0.34208	-0.812000	0.03155	CGT	PCDHB1	-	NULL	ENSG00000171815		0.468	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	143	0.00	0	G	NM_013340		140433373	140433373	+1	no_errors	ENST00000306549	ensembl	human	known	69_37n	missense	108	24.31	35	SNP	0.993	A
RAB40B	10966	genome.wustl.edu	37	17	80615975	80615975	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr17:80615975C>T	ENST00000571995.1	-	6	732	c.601G>A	c.(601-603)Gtg>Atg	p.V201M	RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000538809.2_3'UTR|RAB40B_ENST00000269347.6_Missense_Mutation_p.V22M	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	201	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GTGCAGGACACGACCGCCCGG	0.597																																						dbGAP											0													105.0	94.0	98.0					17																	80615975		2203	4300	6503	-	-	-	SO:0001583	missense	0			U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.601G>A	17.37:g.80615975C>T	ENSP00000461785:p.Val201Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WVG3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_SOCS_C,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_SOCS_C,pfscan_SOCS_C,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V201M	ENST00000571995.1	37	c.601	CCDS11816.1	17	.	.	.	.	.	.	.	.	.	.	C	19.38	3.815589	0.70912	.	.	ENSG00000141542	ENST00000269347;ENST00000538809	.	.	.	4.74	4.74	0.60224	SOCS protein, C-terminal (4);	0.000000	0.64402	D	0.000008	T	0.78323	0.4265	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80874	-0.1187	9	0.87932	D	0	.	18.2016	0.89840	0.0:1.0:0.0:0.0	.	201	Q12829	RB40B_HUMAN	M	201;235	.	ENSP00000269347:V201M	V	-	1	0	RAB40B	78209264	1.000000	0.71417	0.938000	0.37757	0.218000	0.24690	7.552000	0.82192	2.556000	0.86216	0.655000	0.94253	GTG	RAB40B	-	pfam_SOCS_C,smart_Ran_GTPase,smart_SOCS_C,pfscan_SOCS_C	ENSG00000141542		0.597	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40B	HGNC	protein_coding	OTTHUMT00000439007.1	42	0.00	0	C			80615975	80615975	-1	no_errors	ENST00000571995	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	T
RIPK1	8737	genome.wustl.edu	37	6	3081257	3081257	+	Silent	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr6:3081257C>T	ENST00000259808.4	+	4	664	c.366C>T	c.(364-366)atC>atT	p.I122I	RIPK1_ENST00000380409.2_Silent_p.I122I|RIPK1_ENST00000541791.1_Intron|RIPK1_ENST00000479389.1_3'UTR			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	122	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				TTTTGGAAATCATTGAAGGAA	0.363																																						dbGAP											0													123.0	111.0	115.0					6																	3081257		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.366C>T	6.37:g.3081257C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Death,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I122	ENST00000259808.4	37	c.366	CCDS4482.1	6																																																																																			RIPK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000137275		0.363	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	255	0.39	1	C	NM_003804		3081257	3081257	+1	no_errors	ENST00000259808	ensembl	human	known	69_37n	silent	181	19.20	43	SNP	1.000	T
RPL23AP7	118433	genome.wustl.edu	37	2	114369806	114369807	+	RNA	INS	-	-	CTT	rs368676524		TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr2:114369806_114369807insCTT	ENST00000416673.2	-	0	349_350					NR_000029.3				ribosomal protein L23a pseudogene 7																		GCAGGAGCTTCCTTCGCTTTCG	0.426																																						dbGAP											0																																										-	-	-			0			BC000596		2q14	2009-03-11				ENSG00000240356		"""L ribosomal proteins"""	17336	pseudogene	pseudogene						19123937	Standard	NR_000029		Approved	RPL23AL1, bA395L14.9	uc010yxy.1				2.37:g.114369807_114369809dupCTT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000416673.2	37	NULL		2																																																																																			AL078621.11	-	-	ENSG00000240356		0.426	RPL23AP7-003	KNOWN	basic	processed_transcript	RPL23AP7	Clone_based_vega_gene	pseudogene	OTTHUMT00000397215.1	8	0.00	0	-			114369806	114369807	-1	no_errors	ENST00000391616	ensembl	human	known	69_37n	rna	10	28.57	4	INS	1.000:1.000	CTT
RYR1	6261	genome.wustl.edu	37	19	38948842	38948842	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr19:38948842C>T	ENST00000359596.3	+	18	2077	c.2077C>T	c.(2077-2079)Ccc>Tcc	p.P693S	RYR1_ENST00000360985.3_Missense_Mutation_p.P693S|RYR1_ENST00000355481.4_Missense_Mutation_p.P693S			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	693	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGGCTACACCCCCTACCCTGG	0.627																																						dbGAP											0													54.0	52.0	53.0					19																	38948842		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2077C>T	19.37:g.38948842C>T	ENSP00000352608:p.Pro693Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.P693S	ENST00000359596.3	37	c.2077	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937426	0.73557	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96885	-4.16;-4.16;-4.16	5.02	5.02	0.67125	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000002	D	0.98385	0.9463	M	0.88105	2.93	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.99243	1.0885	10	0.72032	D	0.01	.	18.1733	0.89753	0.0:1.0:0.0:0.0	.	693;693	P21817-2;P21817	.;RYR1_HUMAN	S	693	ENSP00000352608:P693S;ENSP00000347667:P693S;ENSP00000354254:P693S	ENSP00000347667:P693S	P	+	1	0	RYR1	43640682	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.651000	0.83577	2.623000	0.88846	0.549000	0.68633	CCC	RYR1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000196218		0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	224	0.00	0	C			38948842	38948842	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	162	14.29	27	SNP	1.000	T
SGSH	6448	genome.wustl.edu	37	17	78195381	78195381	+	5'Flank	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr17:78195381C>T	ENST00000326317.6	-	0	0				SGSH_ENST00000572208.1_5'Flank|SGSH_ENST00000570923.1_5'Flank|SLC26A11_ENST00000411502.3_Silent_p.L8L|SGSH_ENST00000534910.1_5'Flank|SLC26A11_ENST00000546047.2_Silent_p.L8L|SLC26A11_ENST00000571602.1_3'UTR|SLC26A11_ENST00000361193.3_Silent_p.L8L|SLC26A11_ENST00000572725.1_Silent_p.L8L	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase						carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGTGACGGCGCTGGGTCAGGC	0.692																																						dbGAP											0													16.0	16.0	16.0					17																	78195381		2202	4295	6497	-	-	-	SO:0001631	upstream_gene_variant	0			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688			17.37:g.78195381C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E2	Silent	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	p.L8	ENST00000326317.6	37	c.22	CCDS11770.1	17																																																																																			SLC26A11	-	NULL	ENSG00000181045		0.692	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A11	HGNC	protein_coding	OTTHUMT00000437695.1	10	0.00	0	C	NM_000199		78195381	78195381	+1	no_errors	ENST00000361193	ensembl	human	known	69_37n	silent	5	44.44	4	SNP	0.564	T
SP4	6671	genome.wustl.edu	37	7	21469678	21469678	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr7:21469678C>A	ENST00000222584.3	+	3	1113	c.895C>A	c.(895-897)Caa>Aaa	p.Q299K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	299					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						CAATGGGAATCAATTAGTTTC	0.527																																						dbGAP											0													153.0	117.0	129.0					7																	21469678		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.895C>A	7.37:g.21469678C>A	ENSP00000222584:p.Gln299Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q299K	ENST00000222584.3	37	c.895	CCDS5373.1	7	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669307	0.67814	.	.	ENSG00000105866	ENST00000222584	T	0.11063	2.81	4.94	4.94	0.65067	.	0.055745	0.64402	D	0.000001	T	0.15912	0.0383	M	0.63843	1.955	0.80722	D	1	B	0.14438	0.01	B	0.14023	0.01	T	0.02668	-1.1126	10	0.40728	T	0.16	.	18.3502	0.90336	0.0:1.0:0.0:0.0	.	299	Q02446	SP4_HUMAN	K	299	ENSP00000222584:Q299K	ENSP00000222584:Q299K	Q	+	1	0	SP4	21436203	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.498000	0.66931	2.559000	0.86315	0.655000	0.94253	CAA	SP4	-	NULL	ENSG00000105866		0.527	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	86	0.00	0	C	NM_003112		21469678	21469678	+1	no_errors	ENST00000222584	ensembl	human	known	69_37n	missense	55	32.93	27	SNP	1.000	A
TCF7L2	6934	genome.wustl.edu	37	10	114849277	114849277	+	Intron	SNP	T	T	C			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr10:114849277T>C	ENST00000355995.4	+	5	1059				TCF7L2_ENST00000536810.1_Intron|TCF7L2_ENST00000538897.1_Intron|TCF7L2_ENST00000349937.2_Intron|TCF7L2_ENST00000369395.1_Missense_Mutation_p.V202A|TCF7L2_ENST00000543371.1_Intron|TCF7L2_ENST00000534894.1_Intron|TCF7L2_ENST00000542695.1_Intron|TCF7L2_ENST00000352065.5_Intron|TCF7L2_ENST00000545257.1_Intron|TCF7L2_ENST00000369397.4_Intron|TCF7L2_ENST00000355717.4_Missense_Mutation_p.V201A			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)						blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TTACAAAAAGTTGGGGAGCCC	0.507			T	VTI1A	colorectal																																	dbGAP		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	0													53.0	49.0	50.0					10																	114849277		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.552+49392T>C	10.37:g.114849277T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	pfam_CTNNB1-bd_N,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.V201A	ENST00000355995.4	37	c.602		10	.	.	.	.	.	.	.	.	.	.	T	11.10	1.539547	0.27563	.	.	ENSG00000148737	ENST00000355717;ENST00000369395;ENST00000346198	D	0.99105	-5.43	4.89	4.89	0.63831	.	0.382905	0.19225	N	0.119580	D	0.95436	0.8518	N	0.08118	0	0.80722	D	1	B;B;B	0.22541	0.032;0.071;0.058	B;B;B	0.30401	0.049;0.115;0.047	D	0.93373	0.6737	10	0.16420	T	0.52	.	11.1288	0.48334	0.0:0.0:0.0:1.0	.	71;96;201	B4DWD5;C6ZRJ6;F8W7T5	.;.;.	A	201;202;171	ENSP00000347949:V201A	ENSP00000345640:V171A	V	+	2	0	TCF7L2	114839267	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.385000	0.34408	2.188000	0.69820	0.456000	0.33151	GTT	TCF7L2	-	pfam_CTNNB1-bd_N	ENSG00000148737		0.507	TCF7L2-203	KNOWN	basic	protein_coding	TCF7L2	HGNC	protein_coding		62	0.00	0	T	NM_030756		114849277	114849277	+1	no_errors	ENST00000355717	ensembl	human	known	69_37n	missense	60	14.29	10	SNP	1.000	C
TIGD6	81789	genome.wustl.edu	37	5	149375596	149375596	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr5:149375596G>C	ENST00000296736.3	-	2	1090	c.316C>G	c.(316-318)Cta>Gta	p.L106V	TIGD6_ENST00000515406.2_Missense_Mutation_p.L106V	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	106	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GCCAAGTTTAGTGCTTTTTTC	0.418																																						dbGAP											0													169.0	167.0	168.0					5																	149375596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.316C>G	5.37:g.149375596G>C	ENSP00000296736:p.Leu106Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTZ8|Q96MQ4|Q9H0X7	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.L106V	ENST00000296736.3	37	c.316	CCDS4301.1	5	.	.	.	.	.	.	.	.	.	.	G	9.745	1.165859	0.21538	.	.	ENSG00000164296	ENST00000296736;ENST00000515406	T;T	0.15603	2.41;2.41	4.81	3.01	0.34805	Homeodomain-related (1);Pogo transposase / Cenp-B / PDC2, DNA-binding HTH domain (3);Homeodomain-like (1);	0.000000	0.28130	U	0.016482	T	0.15955	0.0384	L	0.42245	1.32	0.25713	N	0.985466	P	0.40731	0.728	P	0.45998	0.5	T	0.06180	-1.0841	10	0.30078	T	0.28	.	4.4345	0.11544	0.1977:0.1883:0.6141:0.0	.	106	Q17RP2	TIGD6_HUMAN	V	106	ENSP00000296736:L106V;ENSP00000425318:L106V	ENSP00000296736:L106V	L	-	1	2	TIGD6	149355789	0.966000	0.33281	0.996000	0.52242	0.983000	0.72400	0.431000	0.21444	1.387000	0.46486	0.650000	0.86243	CTA	TIGD6	-	pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom	ENSG00000164296		0.418	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD6	HGNC	protein_coding	OTTHUMT00000252324.1	223	0.00	0	G	NM_030953		149375596	149375596	-1	no_errors	ENST00000296736	ensembl	human	known	69_37n	missense	182	17.65	39	SNP	0.998	C
TRPC5	7224	genome.wustl.edu	37	X	111095568	111095568	+	Silent	SNP	G	G	C			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chrX:111095568G>C	ENST00000262839.2	-	5	2253	c.1335C>G	c.(1333-1335)ctC>ctG	p.L445L		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	445					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTGCCAGGTAGAGGGAGTTCA	0.418																																						dbGAP											0													153.0	126.0	135.0					X																	111095568		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1335C>G	X.37:g.111095568G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP53|O75233|Q5JXY8|Q9Y514	Silent	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.L445	ENST00000262839.2	37	c.1335	CCDS14561.1	X																																																																																			TRPC5	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000072315		0.418	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	262	0.00	0	G	NM_012471		111095568	111095568	-1	no_errors	ENST00000262839	ensembl	human	known	69_37n	silent	265	22.29	76	SNP	1.000	C
UBE2Q2	92912	genome.wustl.edu	37	15	76146749	76146749	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09B-01A-11W-A019-09	TCGA-A8-A09B-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a8be37d2-2743-4fde-9aae-2623b5a03b60	6acddb6d-f866-498b-9b57-f46cbca2cdf9	g.chr15:76146749C>T	ENST00000267938.4	+	2	585	c.203C>T	c.(202-204)cCg>cTg	p.P68L	UBE2Q2_ENST00000561851.1_Missense_Mutation_p.P52L|UBE2Q2_ENST00000569423.1_Missense_Mutation_p.P68L|UBE2Q2_ENST00000562635.1_3'UTR|UBE2Q2_ENST00000338677.4_Missense_Mutation_p.P68L	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2	68					protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						TCTTCTTCACCGATATGGTTT	0.368																																						dbGAP											0													93.0	77.0	83.0					15																	76146749		2197	4294	6491	-	-	-	SO:0001583	missense	0			BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.203C>T	15.37:g.76146749C>T	ENSP00000267938:p.Pro68Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P68L	ENST00000267938.4	37	c.203	CCDS10286.1	15	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685215	0.88639	.	.	ENSG00000140367	ENST00000338677;ENST00000267938;ENST00000426727	T;T	0.61859	0.07;0.07	5.04	5.04	0.67666	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (2);	0.000000	0.85682	U	0.000000	T	0.74245	0.3691	M	0.81802	2.56	0.80722	D	1	D;D;D	0.65815	0.991;0.99;0.995	P;P;P	0.59825	0.621;0.554;0.864	T	0.79077	-0.1951	10	0.87932	D	0	.	15.9405	0.79750	0.0:1.0:0.0:0.0	.	52;52;68	E9PHD0;B7Z3Q2;Q8WVN8	.;.;UB2Q2_HUMAN	L	68;68;52	ENSP00000340187:P68L;ENSP00000267938:P68L	ENSP00000267938:P68L	P	+	2	0	UBE2Q2	73933804	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	6.395000	0.73228	2.364000	0.80123	0.537000	0.68136	CCG	UBE2Q2	-	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD	ENSG00000140367		0.368	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2Q2	HGNC	protein_coding	OTTHUMT00000286475.1	140	0.00	0	C	NM_173469		76146749	76146749	+1	no_errors	ENST00000267938	ensembl	human	known	69_37n	missense	71	17.44	15	SNP	1.000	T
