#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTSL3	57188	genome.wustl.edu	37	15	84657563	84657563	+	Silent	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr15:84657563G>A	ENST00000286744.5	+	22	4061	c.3837G>A	c.(3835-3837)ctG>ctA	p.L1279L	ADAMTSL3_ENST00000567476.1_Silent_p.L1279L|AC027807.1_ENST00000408557.1_RNA	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1279	Ig-like C2-type 2.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTTCTGTGCTGTATGCAGGTA	0.318																																						dbGAP											0													144.0	131.0	136.0					15																	84657563		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3837G>A	15.37:g.84657563G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A566|A1A567|Q9ULI7	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.L1279	ENST00000286744.5	37	c.3837	CCDS10326.1	15																																																																																			ADAMTSL3	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000156218		0.318	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	51	0.00	0	G	NM_207517		84657563	84657563	+1	no_errors	ENST00000286744	ensembl	human	known	69_37n	silent	37	17.78	8	SNP	0.094	A
AHNAK2	113146	genome.wustl.edu	37	14	105416842	105416842	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr14:105416842T>A	ENST00000333244.5	-	7	5065	c.4946A>T	c.(4945-4947)aAg>aTg	p.K1649M	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1649						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGTCACCGCCTTGTCGGCCAG	0.592																																						dbGAP											0													186.0	207.0	200.0					14																	105416842		1944	4102	6046	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4946A>T	14.37:g.105416842T>A	ENSP00000353114:p.Lys1649Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K1649M	ENST00000333244.5	37	c.4946	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	t	13.50	2.255997	0.39896	.	.	ENSG00000185567	ENST00000333244	T	0.00856	5.61	3.81	2.61	0.31194	.	.	.	.	.	T	0.03959	0.0111	M	0.73598	2.24	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.36407	-0.9749	9	0.48119	T	0.1	-5.8737	6.2081	0.20613	0.0:0.1238:0.0:0.8762	.	1649	Q8IVF2	AHNK2_HUMAN	M	1649	ENSP00000353114:K1649M	ENSP00000353114:K1649M	K	-	2	0	AHNAK2	104487887	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	-0.332000	0.07904	0.329000	0.23460	0.397000	0.26171	AAG	AHNAK2	-	NULL	ENSG00000185567		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	45	0.00	0	T	NM_138420		105416842	105416842	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.025	A
AIM2	9447	genome.wustl.edu	37	1	159043162	159043162	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:159043162G>A	ENST00000368130.4	-	2	416	c.128C>T	c.(127-129)gCa>gTa	p.A43V	AIM2_ENST00000411768.1_5'UTR	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	43	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TATTCTGTTTGCAGTATGTAG	0.393																																						dbGAP											0													96.0	94.0	95.0					1																	159043162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.128C>T	1.37:g.159043162G>A	ENSP00000357112:p.Ala43Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,superfamily_NA-bd_OB-fold-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.A43V	ENST00000368130.4	37	c.128	CCDS1181.1	1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.071301	0.36566	.	.	ENSG00000163568	ENST00000368130;ENST00000411768	T;T	0.56941	0.43;0.43	3.76	-0.683	0.11335	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.39989	0.1099	M	0.61703	1.905	0.09310	N	1	D	0.55605	0.972	P	0.54312	0.748	T	0.20706	-1.0267	9	0.62326	D	0.03	-5.062	4.7987	0.13284	0.1121:0.0:0.3459:0.542	.	43	O14862	AIM2_HUMAN	V	43	ENSP00000357112:A43V;ENSP00000405197:A43V	ENSP00000357112:A43V	A	-	2	0	AIM2	157309786	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.273000	0.08548	-0.005000	0.14395	0.561000	0.74099	GCA	AIM2	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000163568		0.393	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM2	HGNC	protein_coding	OTTHUMT00000090341.1	45	0.00	0	G	NM_004833		159043162	159043162	-1	no_errors	ENST00000368130	ensembl	human	known	69_37n	missense	62	15.07	11	SNP	0.000	A
ALPK3	57538	genome.wustl.edu	37	15	85382269	85382269	+	Silent	SNP	T	T	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr15:85382269T>C	ENST00000258888.5	+	4	1136	c.969T>C	c.(967-969)tgT>tgC	p.C323C		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	323	Ig-like 1.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ACCGCTACTGTGGCTTGCCAA	0.552																																						dbGAP											0													59.0	48.0	52.0					15																	85382269		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.969T>C	15.37:g.85382269T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L6	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.C323	ENST00000258888.5	37	c.969	CCDS10333.1	15																																																																																			ALPK3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000136383		0.552	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	27	0.00	0	T	NM_020778		85382269	85382269	+1	no_errors	ENST00000258888	ensembl	human	known	69_37n	silent	25	24.24	8	SNP	1.000	C
ANGPTL5	253935	genome.wustl.edu	37	11	101777841	101777841	+	Silent	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr11:101777841G>A	ENST00000334289.3	-	3	829	c.234C>T	c.(232-234)ttC>ttT	p.F78F		NM_178127.4	NP_835228.2	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	78						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(2)|skin(3)	29		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		TACTACACATGAAATGTTTTT	0.279																																						dbGAP											0													63.0	61.0	62.0					11																	101777841		2191	4279	6470	-	-	-	SO:0001819	synonymous_variant	0			BC049170	CCDS8312.1	11q22.2	2013-02-06				ENSG00000187151		"""Fibrinogen C domain containing"""	19705	protein-coding gene	gene with protein product		607666				12624729	Standard	NM_178127		Approved		uc001pgl.3	Q86XS5		ENST00000334289.3:c.234C>T	11.37:g.101777841G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K658|Q86VR9	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.F78	ENST00000334289.3	37	c.234	CCDS8312.1	11																																																																																			ANGPTL5	-	NULL	ENSG00000187151		0.279	ANGPTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL5	HGNC	protein_coding	OTTHUMT00000394138.1	56	0.00	0	G	NM_178127		101777841	101777841	-1	no_errors	ENST00000334289	ensembl	human	known	69_37n	silent	40	25.93	14	SNP	0.998	A
ANKRD36	375248	genome.wustl.edu	37	2	97864218	97864218	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr2:97864218C>T	ENST00000461153.2	+	43	2916	c.2672C>T	c.(2671-2673)cCa>cTa	p.P891L	ANKRD36_ENST00000420699.2_Missense_Mutation_p.P891L			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	891										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GAGAAACCACCAGGCTTGAAG	0.299																																						dbGAP											0													108.0	109.0	109.0					2																	97864218		692	1590	2282	-	-	-	SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2672C>T	2.37:g.97864218C>T	ENSP00000419530:p.Pro891Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P891L	ENST00000461153.2	37	c.2672	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	6.053	0.378062	0.11466	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000393513;ENST00000461694	T;T	0.75589	-0.95;-0.95	0.418	0.418	0.16429	.	.	.	.	.	T	0.71829	0.3386	L	0.34521	1.04	0.09310	N	1	D;D	0.76494	0.987;0.999	D;D	0.78314	0.966;0.991	T	0.60727	-0.7206	8	0.02654	T	1	.	.	.	.	.	891;307	A6QL64;F2Z332	AN36A_HUMAN;.	L	891;891;307;253	ENSP00000419530:P891L;ENSP00000391950:P891L	ENSP00000377149:P307L	P	+	2	0	ANKRD36	97227945	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	0.015000	0.13355	0.455000	0.26910	0.186000	0.17326	CCA	ANKRD36	-	NULL	ENSG00000135976		0.299	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	193	0.00	0	C			97864218	97864218	+1	no_errors	ENST00000420699	ensembl	human	known	69_37n	missense	130	10.96	16	SNP	0.003	T
ASIC3	9311	genome.wustl.edu	37	7	150749825	150749825	+	3'UTR	SNP	A	A	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr7:150749825A>G	ENST00000349064.5	+	0	1880				ASIC3_ENST00000297512.8_3'UTR|ASIC3_ENST00000357922.4_Missense_Mutation_p.I541M	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3						cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										CACCCCAAATAAAGTCCTAAT	0.542																																						dbGAP											0													262.0	231.0	241.0					7																	150749825		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.*86A>G	7.37:g.150749825A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.I541M	ENST00000349064.5	37	c.1623	CCDS5916.1	7	.	.	.	.	.	.	.	.	.	.	A	18.33	3.599661	0.66332	.	.	ENSG00000213199	ENST00000357922	T	0.67865	-0.29	4.73	4.73	0.59995	.	.	.	.	.	T	0.77061	0.4075	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.75139	-0.3423	8	0.31617	T	0.26	.	10.7754	0.46346	1.0:0.0:0.0:0.0	.	541	Q9UHC3-2	.	M	541	ENSP00000350600:I541M	ENSP00000350600:I541M	I	+	3	3	ACCN3	150380758	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.935000	0.48963	2.113000	0.64589	0.459000	0.35465	ATA	ASIC3	-	NULL	ENSG00000213199		0.542	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC3	HGNC	protein_coding	OTTHUMT00000351725.1	54	0.00	0	A	NM_004769		150749825	150749825	+1	no_errors	ENST00000357922	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	1.000	G
ATP1A4	480	genome.wustl.edu	37	1	160124840	160124840	+	Silent	SNP	T	T	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:160124840T>C	ENST00000368081.4	+	3	684	c.213T>C	c.(211-213)caT>caC	p.H71H		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	71					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CACAGGGCCATAGCCACCAAA	0.507																																						dbGAP											0													129.0	135.0	133.0					1																	160124840		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.213T>C	1.37:g.160124840T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.H71	ENST00000368081.4	37	c.213	CCDS1197.1	1																																																																																			ATP1A4	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000132681		0.507	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	28	0.00	0	T	NM_144699		160124840	160124840	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	silent	48	17.24	10	SNP	0.002	C
CAD	790	genome.wustl.edu	37	2	27447691	27447691	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr2:27447691G>T	ENST00000403525.1	+	10	1477	c.1333G>T	c.(1333-1335)Ggg>Tgg	p.G445W	CAD_ENST00000264705.4_Missense_Mutation_p.G445W			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACCTCCCAGGGGCTGGCCGA	0.512																																						dbGAP											0													150.0	158.0	155.0					2																	27447691		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.1333G>T	2.37:g.27447691G>T	ENSP00000384510:p.Gly445Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE_1,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf_euk,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf_euk	p.G445W	ENST00000403525.1	37	c.1333		2	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498104	0.85069	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.95412	-3.7;-3.7	5.71	4.83	0.62350	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.093421	0.85682	D	0.000000	D	0.98504	0.9501	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.99133	1.0853	10	0.87932	D	0	-3.5438	13.1853	0.59677	0.0774:0.0:0.9226:0.0	.	445;445	F8VPD4;P27708	.;PYR1_HUMAN	W	445	ENSP00000264705:G445W;ENSP00000384510:G445W	ENSP00000264705:G445W	G	+	1	0	CAD	27301195	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.525000	0.81892	1.413000	0.46997	0.462000	0.41574	GGG	CAD	-	pfam_CarbamoylP_synth_lsu_N,superfamily_PreATP-grasp_fold,tigrfam_CarbamoylP_synth_lsu	ENSG00000084774		0.512	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1	49	0.00	0	G			27447691	27447691	+1	no_errors	ENST00000264705	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	1.000	T
BCS1L	617	genome.wustl.edu	37	2	219527298	219527298	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr2:219527298C>T	ENST00000431802.1	+	6	1484	c.785C>T	c.(784-786)tCt>tTt	p.S262F	BCS1L_ENST00000392110.2_Missense_Mutation_p.S262F|BCS1L_ENST00000392111.2_Missense_Mutation_p.S262F|BCS1L_ENST00000465706.1_Intron|BCS1L_ENST00000359273.3_Missense_Mutation_p.S262F|BCS1L_ENST00000412366.1_Missense_Mutation_p.S262F|BCS1L_ENST00000439945.1_Missense_Mutation_p.S262F|BCS1L_ENST00000392109.1_Missense_Mutation_p.S262F			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	262					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCAGCCTCTCTGATGACCGA	0.607																																						dbGAP											0													60.0	55.0	56.0					2																	219527298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.785C>T	2.37:g.219527298C>T	ENSP00000413908:p.Ser262Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTW9|Q7Z2V7	Missense_Mutation	SNP	pfam_BCS1_N,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.S262F	ENST00000431802.1	37	c.785	CCDS2419.1	2	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023884	0.93462	.	.	ENSG00000074582	ENST00000443791;ENST00000359273;ENST00000392109;ENST00000392110;ENST00000392111;ENST00000412366;ENST00000439945;ENST00000431802	T;D;D;D;D;D;D;D	0.90900	-1.15;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75;-2.75	5.2	5.2	0.72013	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96062	0.8717	M	0.89030	3	0.80722	D	1	D	0.69078	0.997	D	0.70935	0.971	D	0.96502	0.9372	10	0.87932	D	0	-4.5212	18.9183	0.92515	0.0:1.0:0.0:0.0	.	262	Q9Y276	BCS1_HUMAN	F	142;262;262;262;262;262;262;262	ENSP00000412729:S142F;ENSP00000352219:S262F;ENSP00000375957:S262F;ENSP00000375958:S262F;ENSP00000375959:S262F;ENSP00000406494:S262F;ENSP00000404999:S262F;ENSP00000413908:S262F	ENSP00000352219:S262F	S	+	2	0	BCS1L	219235542	1.000000	0.71417	0.964000	0.40570	0.960000	0.62799	7.617000	0.83032	2.705000	0.92388	0.555000	0.69702	TCT	BCS1L	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000074582		0.607	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCS1L	HGNC	protein_coding	OTTHUMT00000336756.1	11	0.00	0	C	NM_004328		219527298	219527298	+1	no_errors	ENST00000359273	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	1.000	T
CADM2	253559	genome.wustl.edu	37	3	85984959	85984959	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr3:85984959A>C	ENST00000407528.2	+	6	778	c.716A>C	c.(715-717)cAa>cCa	p.Q239P	CADM2_ENST00000405615.2_Missense_Mutation_p.Q241P|CADM2_ENST00000383699.3_Missense_Mutation_p.Q248P	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	239	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CCTTTTCCACAAGAAGGACAG	0.294																																						dbGAP											0													105.0	111.0	109.0					3																	85984959		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.716A>C	3.37:g.85984959A>C	ENSP00000384575:p.Gln239Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.Q241P	ENST00000407528.2	37	c.722	CCDS54614.1	3	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967896	0.74131	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.68479	-0.33;-0.33;-0.33	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.100520	0.64402	D	0.000001	T	0.66086	0.2754	N	0.17901	0.54	0.58432	D	0.99999	P;P;P	0.51933	0.831;0.874;0.949	P;P;P	0.54815	0.602;0.466;0.761	T	0.70110	-0.4962	10	0.56958	D	0.05	.	16.0828	0.81017	1.0:0.0:0.0:0.0	.	241;248;239	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	P	248;239;241	ENSP00000373200:Q248P;ENSP00000384575:Q239P;ENSP00000384193:Q241P	ENSP00000373200:Q248P	Q	+	2	0	CADM2	86067649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.414000	0.73318	2.199000	0.70637	0.528000	0.53228	CAA	CADM2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000175161		0.294	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM2	HGNC	protein_coding	OTTHUMT00000352822.1	68	0.00	0	A	NM_153184		85984959	85984959	+1	no_errors	ENST00000405615	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	C
CDK14	5218	genome.wustl.edu	37	7	90355956	90355956	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr7:90355956G>A	ENST00000380050.3	+	3	330	c.199G>A	c.(199-201)Gag>Aag	p.E67K	CDK14_ENST00000265741.3_Missense_Mutation_p.E49K|CDK14_ENST00000436577.2_5'UTR|CDK14_ENST00000496279.1_3'UTR|CDK14_ENST00000406263.1_Missense_Mutation_p.E21K			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	67					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						CACAATTCCTGAGGATAAAAA	0.413																																					GBM(83;1228 1256 8311 16577 31299)	dbGAP											0													105.0	94.0	98.0					7																	90355956		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.199G>A	7.37:g.90355956G>A	ENSP00000369390:p.Glu67Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E67K	ENST00000380050.3	37	c.199		7	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009647	0.75046	.	.	ENSG00000058091	ENST00000449528;ENST00000446224;ENST00000430760;ENST00000456689;ENST00000380050;ENST00000446790;ENST00000265741;ENST00000406263	T;T;T;T;T;T;T	0.70164	2.28;2.28;2.28;2.28;-0.46;-0.44;-0.42	5.93	5.05	0.67936	.	0.117488	0.53938	D	0.000042	T	0.54062	0.1835	L	0.27053	0.805	0.80722	D	1	B;B	0.26147	0.143;0.037	B;B	0.24006	0.05;0.02	T	0.50127	-0.8864	10	0.32370	T	0.25	-17.9402	14.8535	0.70316	0.0686:0.0:0.9314:0.0	.	49;67	O94921-2;O94921	.;CDK14_HUMAN	K	21;21;21;21;67;21;49;21	ENSP00000393616:E21K;ENSP00000410770:E21K;ENSP00000394570:E21K;ENSP00000406848:E21K;ENSP00000369390:E67K;ENSP00000265741:E49K;ENSP00000385034:E21K	ENSP00000265741:E49K	E	+	1	0	CDK14	90193892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.998000	0.93550	1.510000	0.48803	0.563000	0.77884	GAG	CDK14	-	NULL	ENSG00000058091		0.413	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	45	0.00	0	G	NM_012395		90355956	90355956	+1	no_errors	ENST00000380050	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	1.000	A
CENPF	1063	genome.wustl.edu	37	1	214816025	214816025	+	Silent	SNP	C	C	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:214816025C>A	ENST00000366955.3	+	12	4512	c.4344C>A	c.(4342-4344)gtC>gtA	p.V1448V		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1544	2 X 96 AA approximate tandem repeats.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAAATTTGGTCTTGTCAACGA	0.453																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													59.0	62.0	61.0					1																	214816025		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4344C>A	1.37:g.214816025C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13171|Q13246|Q5VVM7	Silent	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.V1448	ENST00000366955.3	37	c.4344	CCDS31023.1	1																																																																																			CENPF	-	NULL	ENSG00000117724		0.453	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	38	0.00	0	C	NM_016343		214816025	214816025	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	silent	52	11.86	7	SNP	0.151	A
CHD6	84181	genome.wustl.edu	37	20	40049605	40049605	+	Silent	SNP	T	T	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr20:40049605T>G	ENST00000373233.3	-	31	5847	c.5670A>C	c.(5668-5670)gtA>gtC	p.V1890V		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1890					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGAGATGCAATACCTCTGGCC	0.483																																						dbGAP											0													133.0	134.0	133.0					20																	40049605		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.5670A>C	20.37:g.40049605T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V1890	ENST00000373233.3	37	c.5670	CCDS13317.1	20																																																																																			CHD6	-	NULL	ENSG00000124177		0.483	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	88	0.00	0	T			40049605	40049605	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	silent	76	11.63	10	SNP	0.000	G
COL6A6	131873	genome.wustl.edu	37	3	130318623	130318623	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr3:130318623C>A	ENST00000358511.6	+	19	4653	c.4622C>A	c.(4621-4623)cCc>cAc	p.P1541H	COL6A6_ENST00000453409.2_Missense_Mutation_p.P1541H	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1541	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TGGCCAGGCCCCCCCGGGACA	0.493																																						dbGAP											0													48.0	51.0	50.0					3																	130318623		1857	4102	5959	-	-	-	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4622C>A	3.37:g.130318623C>A	ENSP00000351310:p.Pro1541His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.P1541H	ENST00000358511.6	37	c.4622	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	C	15.13	2.743028	0.49151	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.96774	-4.12;-4.12	5.79	2.67	0.31697	.	.	.	.	.	D	0.95284	0.8470	M	0.77103	2.36	0.09310	N	1	B	0.33379	0.41	B	0.40901	0.343	D	0.90265	0.4303	9	0.44086	T	0.13	.	3.949	0.09361	0.1879:0.6155:0.0:0.1966	.	1541	A6NMZ7	CO6A6_HUMAN	H	1541	ENSP00000351310:P1541H;ENSP00000399236:P1541H	ENSP00000351310:P1541H	P	+	2	0	COL6A6	131801313	0.000000	0.05858	0.422000	0.26621	0.896000	0.52359	-0.086000	0.11233	1.449000	0.47699	0.655000	0.94253	CCC	COL6A6	-	NULL	ENSG00000206384		0.493	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	45	0.00	0	C	NM_001102608		130318623	130318623	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	0.013	A
CLSTN2	64084	genome.wustl.edu	37	3	140275475	140275475	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr3:140275475C>T	ENST00000458420.3	+	11	1985	c.1795C>T	c.(1795-1797)Cgg>Tgg	p.R599W		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	599					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.R599W(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GGCGGGTGTGCGGCGCCTCAA	0.577										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	dbGAP											1	Substitution - Missense(1)	lung(1)											87.0	78.0	81.0					3																	140275475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1795C>T	3.37:g.140275475C>T	ENSP00000402460:p.Arg599Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R599W	ENST00000458420.3	37	c.1795	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971896	0.74246	.	.	ENSG00000158258	ENST00000458420	T	0.36699	1.24	5.39	3.47	0.39725	.	0.000000	0.85682	D	0.000000	T	0.61400	0.2344	M	0.85630	2.765	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.66736	-0.5848	9	.	.	.	-27.9673	12.0457	0.53479	0.4075:0.5925:0.0:0.0	.	599	Q9H4D0	CSTN2_HUMAN	W	599	ENSP00000402460:R599W	.	R	+	1	2	CLSTN2	141758165	0.995000	0.38212	1.000000	0.80357	0.935000	0.57460	1.830000	0.39131	1.389000	0.46526	0.563000	0.77884	CGG	CLSTN2	-	NULL	ENSG00000158258		0.577	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	25	0.00	0	C	NM_022131		140275475	140275475	+1	no_errors	ENST00000458420	ensembl	human	known	69_37n	missense	21	18.52	5	SNP	0.943	T
DCUN1D1	54165	genome.wustl.edu	37	3	182683349	182683349	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr3:182683349C>A	ENST00000292782.4	-	2	349	c.196G>T	c.(196-198)Gaa>Taa	p.E66*	DCUN1D1_ENST00000469954.1_Nonsense_Mutation_p.E51*	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	66	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					ubiquitin ligase complex (GO:0000151)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TACAGCTGTTCTAACTTCTTC	0.343																																						dbGAP											0													82.0	78.0	80.0					3																	182683349		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.196G>T	3.37:g.182683349C>A	ENSP00000292782:p.Glu66*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Nonsense_Mutation	SNP	pfam_PONY_dom,superfamily_UBA-like	p.E66*	ENST00000292782.4	37	c.196	CCDS3240.1	3	.	.	.	.	.	.	.	.	.	.	C	37	6.173110	0.97348	.	.	ENSG00000043093	ENST00000292782;ENST00000458486;ENST00000469954;ENST00000497606;ENST00000460412;ENST00000487822;ENST00000466812	.	.	.	5.84	5.84	0.93424	.	0.049347	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-27.2373	20.1295	0.97995	0.0:1.0:0.0:0.0	.	.	.	.	X	66;66;51;51;51;51;51	.	ENSP00000292782:E66X	E	-	1	0	DCUN1D1	184166043	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.758000	0.94735	0.591000	0.81541	GAA	DCUN1D1	-	NULL	ENSG00000043093		0.343	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D1	HGNC	protein_coding	OTTHUMT00000350658.1	44	0.00	0	C	NM_020640		182683349	182683349	-1	no_errors	ENST00000292782	ensembl	human	known	69_37n	nonsense	50	18.03	11	SNP	1.000	A
DGKQ	1609	genome.wustl.edu	37	4	961414	961414	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr4:961414C>G	ENST00000273814.3	-	8	983	c.910G>C	c.(910-912)Gat>Cat	p.D304H	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	304					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			TCGTCGCCATCAAAGATCTTC	0.667																																					Esophageal Squamous(17;537 645 4447 26373)	dbGAP											0													62.0	62.0	62.0					4																	961414		2202	4300	6502	-	-	-	SO:0001583	missense	0			L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.910G>C	4.37:g.961414C>G	ENSP00000273814:p.Asp304His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P3W4	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ras-assoc,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.D304H	ENST00000273814.3	37	c.910	CCDS3342.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	17.65|17.65	3.443076|3.443076	0.63067|0.63067	.|.	.|.	ENSG00000145214|ENSG00000145214	ENST00000273814|ENST00000509465	D|.	0.88586|.	-2.4|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.140695|.	0.51477|.	D|.	0.000090|.	T|T	0.59838|0.59838	0.2223|0.2223	L|L	0.45352|0.45352	1.415|1.415	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|T	0.56968|0.56968	-0.7891|-0.7891	10|5	0.87932|.	D|.	0|.	.|.	13.8024|13.8024	0.63208|0.63208	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	304;304|.	E9KL49;P52824|.	.;DGKQ_HUMAN|.	H|F	304|250	ENSP00000273814:D304H|.	ENSP00000273814:D304H|.	D|L	-|-	1|3	0|2	DGKQ|DGKQ	951414|951414	0.484000|0.484000	0.25964|0.25964	0.932000|0.932000	0.37286|0.37286	0.057000|0.057000	0.15508|0.15508	2.748000|2.748000	0.47483|0.47483	2.326000|2.326000	0.78906|0.78906	0.544000|0.544000	0.68410|0.68410	GAT|TTG	DGKQ	-	NULL	ENSG00000145214		0.667	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKQ	HGNC	protein_coding	OTTHUMT00000200888.1	22	0.00	0	C			961414	961414	-1	no_errors	ENST00000273814	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	1.000	G
DNAJC14	85406	genome.wustl.edu	37	12	56222324	56222325	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr12:56222324_56222325delCT	ENST00000357606.3	-	3	407_408	c.118_119delAG	c.(118-120)aggfs	p.R40fs	DNAJC14_ENST00000317269.3_Frame_Shift_Del_p.R40fs|DNAJC14_ENST00000317287.5_Frame_Shift_Del_p.R40fs|RP11-762I7.5_ENST00000546837.1_5'Flank|TMEM198B_ENST00000478241.1_RNA			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	40					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						TGCTGAGTCCCTGAGTCCTGAG	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.118_119delAG	12.37:g.56222324_56222325delCT	ENSP00000350223:p.Arg40fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Frame_Shift_Del	DEL	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.R40fs	ENST00000357606.3	37	c.119_118	CCDS8894.1	12																																																																																			DNAJC14	-	NULL	ENSG00000135392		0.574	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJC14	HGNC	protein_coding	OTTHUMT00000409095.1	80	0.00	0	CT	NM_032364		56222324	56222325	-1	no_errors	ENST00000317269	ensembl	human	known	69_37n	frame_shift_del	67	13.75	11	DEL	1.000:1.000	-
DNAH10	196385	genome.wustl.edu	37	12	124356102	124356102	+	Missense_Mutation	SNP	A	A	C	rs200284346		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr12:124356102A>C	ENST00000409039.3	+	44	7409	c.7384A>C	c.(7384-7386)Aca>Cca	p.T2462P		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2462	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CACTTCTAAGACAGCCACTAC	0.358																																						dbGAP											0													42.0	43.0	43.0					12																	124356102		1800	3974	5774	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7384A>C	12.37:g.124356102A>C	ENSP00000386770:p.Thr2462Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.T2462P	ENST00000409039.3	37	c.7384	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	A	24.9	4.580010	0.86645	.	.	ENSG00000197653	ENST00000409039	T	0.65549	-0.16	5.06	5.06	0.68205	ATPase, AAA+ type, core (1);	0.000000	0.64402	U	0.000001	D	0.87838	0.6278	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92880	0.6322	10	0.87932	D	0	.	14.8582	0.70359	1.0:0.0:0.0:0.0	.	2462	Q8IVF4	DYH10_HUMAN	P	2462	ENSP00000386770:T2462P	ENSP00000386770:T2462P	T	+	1	0	DNAH10	122922055	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.283000	0.95860	1.901000	0.55032	0.528000	0.53228	ACA	DNAH10	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	ENSG00000197653		0.358	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	76	0.00	0	A			124356102	124356102	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	52	32.47	25	SNP	1.000	C
DNMBP	23268	genome.wustl.edu	37	10	101715245	101715245	+	Silent	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr10:101715245G>C	ENST00000324109.4	-	4	2077	c.1986C>G	c.(1984-1986)ctC>ctG	p.L662L	DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Silent_p.L662L	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	662					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GTCGAGATAGGAGCTTGGGGG	0.592																																						dbGAP											0													55.0	48.0	51.0					10																	101715245		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.1986C>G	10.37:g.101715245G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVY3|Q9Y2L3	Silent	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,prints_p67phox,prints_Spectrin_alpha_SH3,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.L662	ENST00000324109.4	37	c.1986	CCDS7485.1	10																																																																																			DNMBP	-	NULL	ENSG00000107554		0.592	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	29	0.00	0	G	NM_015221		101715245	101715245	-1	no_errors	ENST00000342239	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.000	C
DOCK2	1794	genome.wustl.edu	37	5	169141180	169141180	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr5:169141180C>T	ENST00000256935.8	+	18	1888	c.1808C>T	c.(1807-1809)tCc>tTc	p.S603F	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.S95F	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	603	DHR-1.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCTCCATTTCCACCCTGGTG	0.542																																						dbGAP											0													67.0	63.0	64.0					5																	169141180		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1808C>T	5.37:g.169141180C>T	ENSP00000256935:p.Ser603Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.S603F	ENST00000256935.8	37	c.1808	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.149645	0.94645	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908	T;T	0.20200	2.09;2.09	5.9	5.9	0.94986	.	0.101413	0.64402	D	0.000001	T	0.52419	0.1733	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.81914	0.99;0.995;0.995	T	0.52540	-0.8562	10	0.66056	D	0.02	.	20.2768	0.98488	0.0:1.0:0.0:0.0	.	95;603;603	E7ERW7;E5RFJ0;Q92608	.;.;DOCK2_HUMAN	F	603;121;95	ENSP00000256935:S603F;ENSP00000429283:S95F	ENSP00000256935:S603F	S	+	2	0	DOCK2	169073758	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	4.950000	0.63603	2.797000	0.96272	0.655000	0.94253	TCC	DOCK2	-	NULL	ENSG00000134516		0.542	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	30	0.00	0	C	NM_004946		169141180	169141180	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	T
DOCK4	9732	genome.wustl.edu	37	7	111398727	111398727	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr7:111398727C>T	ENST00000437633.1	-	40	4511	c.4255G>A	c.(4255-4257)Gac>Aac	p.D1419N	DOCK4_ENST00000494651.2_Missense_Mutation_p.D302N|DOCK4_ENST00000428084.1_Missense_Mutation_p.D1428N	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1419	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				AATGGTCGGTCATAGCGGAAT	0.448																																						dbGAP											0													120.0	113.0	115.0					7																	111398727		1871	4114	5985	-	-	-	SO:0001583	missense	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.4255G>A	7.37:g.111398727C>T	ENSP00000404179:p.Asp1419Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_SH3_domain,pfscan_SH3_domain	p.D1428N	ENST00000437633.1	37	c.4282	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.174130|5.174130	0.94807|0.94807	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288|ENST00000423057;ENST00000445943	T;T;T|.	0.18960|.	2.18;2.18;2.18|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74831|0.74831	0.3768|0.3768	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.71674|.	0.988;0.985;0.998;0.988;0.997|.	D;D;D;D;D|.	0.69824|.	0.966;0.943;0.951;0.919;0.919|.	T|T	0.73180|0.73180	-0.4064|-0.4064	10|5	0.66056|.	D|.	0.02|.	.|.	18.8729|18.8729	0.92324|0.92324	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	326;302;1464;1419;1428|.	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2|.	.;.;.;DOCK4_HUMAN;.|.	N|I	1407;1428;302;1419;1416|879;1451	ENSP00000410746:D1428N;ENSP00000440944:D302N;ENSP00000404179:D1419N|.	ENSP00000345432:D1416N|.	D|M	-|-	1|3	0|0	DOCK4|DOCK4	111185963|111185963	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.609000|7.609000	0.82925|0.82925	2.763000|2.763000	0.94921|0.94921	0.650000|0.650000	0.86243|0.86243	GAC|ATG	DOCK4	-	pfam_DOCK	ENSG00000128512		0.448	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	68	0.00	0	C	NM_014705		111398727	111398727	-1	no_errors	ENST00000428084	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	1.000	T
EDA2R	60401	genome.wustl.edu	37	X	65824309	65824309	+	Silent	SNP	T	T	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:65824309T>C	ENST00000374719.3	-	4	362	c.306A>G	c.(304-306)caA>caG	p.Q102Q	EDA2R_ENST00000396050.1_Silent_p.Q102Q|EDA2R_ENST00000253392.5_Silent_p.Q102Q|EDA2R_ENST00000451436.2_Intron|EDA2R_ENST00000450752.1_Silent_p.Q102Q|EDA2R_ENST00000456230.2_Silent_p.Q102Q	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	102					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GGATGCACTCTTGGTCCTGCA	0.522																																						dbGAP											0													248.0	164.0	192.0					X																	65824309		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.306A>G	X.37:g.65824309T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_27,pfscan_TNFR/NGFR_Cys_rich_reg	p.Q102	ENST00000374719.3	37	c.306	CCDS14386.1	X																																																																																			EDA2R	-	NULL	ENSG00000131080		0.522	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDA2R	HGNC	protein_coding	OTTHUMT00000057002.1	52	0.00	0	T	NM_021783		65824309	65824309	-1	no_errors	ENST00000253392	ensembl	human	known	69_37n	silent	27	28.95	11	SNP	1.000	C
EIF4H	7458	genome.wustl.edu	37	7	73588716	73588718	+	Start_Codon_Del	DEL	GGC	GGC	-			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr7:73588716_73588718delGGC	ENST00000265753.8	+	0	142_144				EIF4H_ENST00000353999.6_Start_Codon_Del	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H						cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						GACGGCAAATGGCGGACTTCGAC	0.739																																						dbGAP											0																																										-	-	-	SO:0001582	initiator_codon_variant	0				CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025		7.37:g.73588716_73588718delGGC		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3R1|D3DXF6|D3DXF8	In_Frame_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A2in_frame_del	ENST00000265753.8	37	c.3_5	CCDS5564.1	7																																																																																			EIF4H	-	NULL	ENSG00000106682		0.739	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4H	HGNC	protein_coding	OTTHUMT00000252375.2	16	0.00	0	GGC	NM_022170		73588716	73588718	+1	no_errors	ENST00000265753	ensembl	human	known	69_37n	in_frame_del	5	37.50	3	DEL	1.000:1.000:1.000	-
EP400	57634	genome.wustl.edu	37	12	132475210	132475212	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr12:132475210_132475212delAGA	ENST00000333577.4	+	10	2797_2799	c.2688_2690delAGA	c.(2686-2691)ttagaa>tta	p.E898del	EP400_ENST00000332482.4_In_Frame_Del_p.E825del|EP400_ENST00000389562.2_In_Frame_Del_p.E861del|EP400_ENST00000330386.6_In_Frame_Del_p.E862del|EP400_ENST00000389561.2_In_Frame_Del_p.E862del			Q96L91	EP400_HUMAN	E1A binding protein p400	898					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GAGTAGAATTAGAAGAAAAAAGG	0.369																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2688_2690delAGA	12.37:g.132475213_132475215delAGA	ENSP00000333602:p.Glu898del	Somatic		WXS	Illumina GAIIx	Phase_IV	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	In_Frame_Del	DEL	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E898in_frame_del	ENST00000333577.4	37	c.2688_2690		12																																																																																			EP400	-	NULL	ENSG00000183495		0.369	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		40	0.00	0	AGA	NM_015409		132475210	132475212	+1	no_errors	ENST00000333577	ensembl	human	known	69_37n	in_frame_del	22	26.67	8	DEL	0.995:0.999:1.000	-
ETS1	2113	genome.wustl.edu	37	11	128426192	128426192	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr11:128426192C>A	ENST00000392668.4	-	3	292	c.208G>T	c.(208-210)Gtc>Ttc	p.V70F	ETS1_ENST00000525404.1_5'UTR	NM_001143820.1	NP_001137292.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	170	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		CTACCTGAGACACAGTGTTCA	0.448																																						dbGAP											0													176.0	149.0	158.0					11																	128426192		1566	3579	5145	-	-	-	SO:0001583	missense	0				CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000392668.4:c.208G>T	11.37:g.128426192C>A	ENSP00000376436:p.Val70Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	p.V70F	ENST00000392668.4	37	c.208	CCDS44767.1	11	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210166	0.39003	.	.	ENSG00000134954	ENST00000392668	T	0.11604	2.76	6.06	5.15	0.70609	.	2.649080	0.05379	U	0.536862	T	0.12178	0.0296	.	.	.	0.80722	D	1	B	0.15141	0.012	B	0.16289	0.015	T	0.12785	-1.0534	9	0.59425	D	0.04	.	8.3031	0.32025	0.0:0.7935:0.0:0.2065	.	70	Q6N087	.	F	70	ENSP00000376436:V70F	ENSP00000376436:V70F	V	-	1	0	ETS1	127931402	0.870000	0.30015	1.000000	0.80357	0.991000	0.79684	0.627000	0.24506	1.572000	0.49736	0.655000	0.94253	GTC	ETS1	-	pirsf_Transforming_factor_C-ets	ENSG00000134954		0.448	ETS1-002	KNOWN	basic|CCDS	protein_coding	ETS1	HGNC	protein_coding	OTTHUMT00000386267.2	58	0.00	0	C	NM_005238		128426192	128426192	-1	no_errors	ENST00000392668	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	0.998	A
FAM47A	158724	genome.wustl.edu	37	X	34149096	34149096	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:34149096A>G	ENST00000346193.3	-	1	1351	c.1300T>C	c.(1300-1302)Tct>Cct	p.S434P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	434										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GTCCTCCCAGAATCCAGCACT	0.552																																						dbGAP											0													43.0	44.0	44.0					X																	34149096		2131	4248	6379	-	-	-	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1300T>C	X.37:g.34149096A>G	ENSP00000345029:p.Ser434Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.S434P	ENST00000346193.3	37	c.1300	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	a	0.406	-0.915890	0.02415	.	.	ENSG00000185448	ENST00000346193	T	0.07327	3.2	0.866	-0.783	0.10958	.	.	.	.	.	T	0.06005	0.0156	L	0.50333	1.59	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.48375	-0.9041	8	0.02654	T	1	.	.	.	.	.	434	Q5JRC9	FA47A_HUMAN	P	434	ENSP00000345029:S434P	ENSP00000345029:S434P	S	-	1	0	FAM47A	34059017	0.016000	0.18221	0.006000	0.13384	0.014000	0.08584	0.086000	0.14935	-0.298000	0.08921	0.237000	0.17872	TCT	FAM47A	-	NULL	ENSG00000185448		0.552	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	24	0.00	0	A	NM_203408		34149096	34149096	-1	no_errors	ENST00000346193	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	0.005	G
FER1L6	654463	genome.wustl.edu	37	8	125029949	125029949	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr8:125029949G>C	ENST00000522917.1	+	16	2210	c.2004G>C	c.(2002-2004)tgG>tgC	p.W668C	FER1L6_ENST00000399018.1_Missense_Mutation_p.W668C|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	668						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CGCTCTGCTGGCAGGAGCTGG	0.393																																						dbGAP											0													73.0	72.0	73.0					8																	125029949		1824	4080	5904	-	-	-	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2004G>C	8.37:g.125029949G>C	ENSP00000428280:p.Trp668Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ABC_transptrTM_dom_typ1,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.W668C	ENST00000522917.1	37	c.2004	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	G	9.146	1.015030	0.19355	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.80738	-1.41;-1.41	5.56	5.56	0.83823	.	0.520028	0.18103	U	0.151612	T	0.78748	0.4332	L	0.51422	1.61	0.50813	D	0.999896	B	0.20988	0.05	B	0.18263	0.021	T	0.73733	-0.3890	10	0.54805	T	0.06	-5.1078	18.6756	0.91528	0.0:0.0:1.0:0.0	.	668	Q2WGJ9	FR1L6_HUMAN	C	668	ENSP00000428280:W668C;ENSP00000381982:W668C	ENSP00000381982:W668C	W	+	3	0	FER1L6	125099130	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	3.232000	0.51302	2.776000	0.95493	0.655000	0.94253	TGG	FER1L6	-	NULL	ENSG00000214814		0.393	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	52	0.00	0	G	NM_001039112		125029949	125029949	+1	no_errors	ENST00000399018	ensembl	human	known	69_37n	missense	40	28.57	16	SNP	1.000	C
FMR1	2332	genome.wustl.edu	37	X	147007128	147007128	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:147007128A>C	ENST00000370475.4	+	3	303	c.175A>C	c.(175-177)Ata>Cta	p.I59L	FMR1_ENST00000334557.6_Missense_Mutation_p.I59L|FMR1_ENST00000439526.2_Missense_Mutation_p.I59L|FMR1_ENST00000370470.1_Missense_Mutation_p.I59L|FMR1_ENST00000370477.1_Missense_Mutation_p.I59L|FMR1_ENST00000218200.8_Missense_Mutation_p.I59L|FMR1_ENST00000370471.3_Missense_Mutation_p.I59L	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	59					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					TAATAAAGATATAAATGAAAG	0.338									Fragile X syndrome																													dbGAP											0													74.0	72.0	73.0					X																	147007128		2203	4299	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.175A>C	X.37:g.147007128A>C	ENSP00000359506:p.Ile59Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.I59L	ENST00000370475.4	37	c.175	CCDS14682.1	X	.	.	.	.	.	.	.	.	.	.	A	11.16	1.557951	0.27827	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.56275	1.24;0.47;1.26;1.25;1.56;1.26;1.27	5.93	5.93	0.95920	.	0.041869	0.85682	D	0.000000	T	0.58424	0.2121	L	0.42686	1.345	0.80722	D	1	B;B;B;B	0.21309	0.0;0.0;0.054;0.011	B;B;B;B	0.43386	0.021;0.027;0.418;0.119	T	0.56673	-0.7940	10	0.34782	T	0.22	-50.2944	14.4199	0.67175	1.0:0.0:0.0:0.0	.	59;59;59;59	Q8IXW7;Q06787;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.	L	59	ENSP00000218200:I59L;ENSP00000359502:I59L;ENSP00000359508:I59L;ENSP00000359506:I59L;ENSP00000355115:I59L;ENSP00000395923:I59L;ENSP00000359501:I59L	ENSP00000218200:I59L	I	+	1	0	FMR1	146814820	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	7.238000	0.78173	2.004000	0.58718	0.483000	0.47432	ATA	FMR1	-	NULL	ENSG00000102081		0.338	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	HGNC	protein_coding	OTTHUMT00000058655.1	55	0.00	0	A	NM_002024		147007128	147007128	+1	no_errors	ENST00000370475	ensembl	human	known	69_37n	missense	32	30.43	14	SNP	1.000	C
FOPNL	123811	genome.wustl.edu	37	16	15961319	15961319	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr16:15961319A>C	ENST00000255759.6	-	5	532	c.503T>G	c.(502-504)gTt>gGt	p.V168G	FOPNL_ENST00000573396.1_3'UTR|FOPNL_ENST00000573429.1_Missense_Mutation_p.V192G|FOPNL_ENST00000575073.1_3'UTR|FOPNL_ENST00000575744.1_Missense_Mutation_p.V102G|FOPNL_ENST00000573968.1_Missense_Mutation_p.V94G	NM_144600.2	NP_653201.1	Q96NB1	FOPNL_HUMAN	FGFR1OP N-terminal like	168					cilium assembly (GO:0042384)|microtubule anchoring (GO:0034453)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(5)|stomach(4)	11						TGCCTGAGAAACATGAAGATC	0.318																																						dbGAP											0													160.0	134.0	142.0					16																	15961319		2197	4300	6497	-	-	-	SO:0001583	missense	0			AL832498	CCDS10567.1	16p13.11	2011-03-18	2011-03-18	2011-03-18	ENSG00000133393	ENSG00000133393			26435	protein-coding gene	gene with protein product	"""pluripotent embryonic stem cell-related protein"", ""FOP-related protein of 20 kDa"""		"""chromosome 16 open reading frame 63"""	C16orf63		12477932	Standard	NM_144600		Approved	DKFZp686N1651, FLJ31153, PHSECRG2, FOR20	uc002dec.1	Q96NB1	OTTHUMG00000129923	ENST00000255759.6:c.503T>G	16.37:g.15961319A>C	ENSP00000255759:p.Val168Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPU9	Missense_Mutation	SNP	pfam_FOP_dimerisation-dom_N,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.V168G	ENST00000255759.6	37	c.503	CCDS10567.1	16	.	.	.	.	.	.	.	.	.	.	A	10.76	1.441220	0.25900	.	.	ENSG00000133393	ENST00000255759	.	.	.	5.37	1.94	0.25998	.	0.954936	0.08667	N	0.911484	T	0.30355	0.0762	N	0.24115	0.695	0.09310	N	0.999997	B;B	0.24186	0.085;0.099	B;B	0.28553	0.091;0.04	T	0.35450	-0.9788	9	0.87932	D	0	-7.7898	6.4339	0.21813	0.679:0.0:0.321:0.0	.	94;168	B3KPU9;Q96NB1	.;FOPNL_HUMAN	G	168	.	ENSP00000255759:V168G	V	-	2	0	FOPNL	15868820	0.001000	0.12720	0.001000	0.08648	0.030000	0.12068	0.334000	0.19787	0.132000	0.18615	-0.262000	0.10625	GTT	FOPNL	-	NULL	ENSG00000133393		0.318	FOPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOPNL	HGNC	protein_coding	OTTHUMT00000252177.2	103	0.00	0	A	NM_144600		15961319	15961319	-1	no_errors	ENST00000255759	ensembl	human	known	69_37n	missense	56	34.12	29	SNP	0.005	C
GLG1	2734	genome.wustl.edu	37	16	74501683	74501684	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr16:74501683_74501684delAG	ENST00000422840.2	-	18	2498_2499	c.2499_2500delCT	c.(2497-2502)ttctgtfs	p.FC833fs	GLG1_ENST00000205061.5_Frame_Shift_Del_p.FC833fs|GLG1_ENST00000447066.2_Frame_Shift_Del_p.FC822fs	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	833					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						ACAGCGGAACAGAAGTTTTTGA	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2499_2500delCT	16.37:g.74501683_74501684delAG	ENSP00000405984:p.Phe833fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Frame_Shift_Del	DEL	pfam_Cys-rich_GLG1_repeat	p.F833fs	ENST00000422840.2	37	c.2500_2499	CCDS45527.1	16																																																																																			GLG1	-	pfam_Cys-rich_GLG1_repeat	ENSG00000090863		0.421	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	HGNC	protein_coding	OTTHUMT00000435750.1	68	0.00	0	AG	NM_012201		74501683	74501684	-1	no_errors	ENST00000205061	ensembl	human	known	69_37n	frame_shift_del	57	19.72	14	DEL	1.000:1.000	-
GPAM	57678	genome.wustl.edu	37	10	113920522	113920522	+	Silent	SNP	T	T	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr10:113920522T>G	ENST00000348367.4	-	16	1796	c.1599A>C	c.(1597-1599)gtA>gtC	p.V533V	GPAM_ENST00000423155.1_Silent_p.V533V|GPAM_ENST00000369425.1_Silent_p.V533V			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	533					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		TGGCATGCATTACTACATCTT	0.458																																					Ovarian(161;1017 2606 18293 52943)	dbGAP											0													123.0	102.0	109.0					10																	113920522		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1599A>C	10.37:g.113920522T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW51|Q86TA3	Silent	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.V533	ENST00000348367.4	37	c.1599	CCDS7570.1	10																																																																																			GPAM	-	NULL	ENSG00000119927		0.458	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	73	0.00	0	T	NM_020918		113920522	113920522	-1	no_errors	ENST00000348367	ensembl	human	known	69_37n	silent	28	37.78	17	SNP	1.000	G
HDHD2	84064	genome.wustl.edu	37	18	44660972	44660972	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr18:44660972C>G	ENST00000300605.6	-	3	357	c.205G>C	c.(205-207)Gaa>Caa	p.E69Q	HDHD2_ENST00000587841.1_Intron	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	69						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						ATTTCATCTTCAGAGATATCA	0.413																																						dbGAP											0													154.0	153.0	153.0					18																	44660972		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.205G>C	18.37:g.44660972C>G	ENSP00000300605:p.Glu69Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7T3|Q96NV4	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA	p.E69Q	ENST00000300605.6	37	c.205	CCDS32829.1	18	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563357	0.45694	.	.	ENSG00000167220	ENST00000300605	T	0.35048	1.33	5.85	5.85	0.93711	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	L	0.61218	1.895	0.80722	D	1	B	0.21381	0.055	B	0.21546	0.035	T	0.15521	-1.0434	10	0.27785	T	0.31	-0.9715	20.1542	0.98100	0.0:1.0:0.0:0.0	.	69	Q9H0R4	HDHD2_HUMAN	Q	69	ENSP00000300605:E69Q	ENSP00000300605:E69Q	E	-	1	0	HDHD2	42914970	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.848000	0.75409	2.767000	0.95098	0.563000	0.77884	GAA	HDHD2	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA	ENSG00000167220		0.413	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HDHD2	HGNC	protein_coding	OTTHUMT00000450668.2	91	0.00	0	C	NM_032124		44660972	44660972	-1	no_errors	ENST00000300605	ensembl	human	known	69_37n	missense	82	11.83	11	SNP	1.000	G
HEATR1	55127	genome.wustl.edu	37	1	236766623	236766623	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:236766623C>G	ENST00000366582.3	-	3	310	c.196G>C	c.(196-198)Gaa>Caa	p.E66Q	HEATR1_ENST00000366579.1_Missense_Mutation_p.E66Q|HEATR1_ENST00000366581.2_Missense_Mutation_p.E66Q	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	66					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AACGGTGCTTCAAACTGCTCA	0.383																																						dbGAP											0													136.0	133.0	134.0					1																	236766623		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.196G>C	1.37:g.236766623C>G	ENSP00000355541:p.Glu66Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.E66Q	ENST00000366582.3	37	c.196	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.931234	0.73327	.	.	ENSG00000119285	ENST00000366582;ENST00000366581;ENST00000366579	T;T;T	0.44881	0.91;0.91;0.91	5.39	5.39	0.77823	.	0.055170	0.64402	D	0.000001	T	0.21347	0.0514	N	0.05280	-0.08	0.46678	D	0.999155	B	0.22851	0.076	B	0.19391	0.025	T	0.11991	-1.0565	10	0.10111	T	0.7	.	13.7742	0.63044	0.0:0.7203:0.2797:0.0	.	66	Q9H583	HEAT1_HUMAN	Q	66	ENSP00000355541:E66Q;ENSP00000355540:E66Q;ENSP00000355538:E66Q	ENSP00000355538:E66Q	E	-	1	0	HEATR1	234833246	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.692000	0.74578	2.533000	0.85409	0.563000	0.77884	GAA	HEATR1	-	NULL	ENSG00000119285		0.383	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	69	0.00	0	C	XM_375853		236766623	236766623	-1	no_errors	ENST00000366582	ensembl	human	known	69_37n	missense	104	13.33	16	SNP	1.000	G
HIST1H2BN	8341	genome.wustl.edu	37	6	27806523	27806523	+	Silent	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr6:27806523G>A	ENST00000396980.3	+	1	84	c.84G>A	c.(82-84)aaG>aaA	p.K28K	HIST1H2BN_ENST00000606613.1_Silent_p.K28K|HIST1H2AK_ENST00000330180.2_5'Flank	NM_003520.3	NP_003511.1	Q99877	H2B1N_HUMAN	histone cluster 1, H2bn	28					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(3)|lung(3)|prostate(1)	8						AGGACGGCAAGAAGCGCAAGC	0.602																																						dbGAP											0													167.0	156.0	159.0					6																	27806523		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z83336	CCDS4633.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000233822	ENSG00000233822		"""Histones / Replication-dependent"""	4749	protein-coding gene	gene with protein product		602801	"""H2B histone family, member D"", ""histone 1, H2bn"""	H2BFD		9439656, 12408966	Standard	NM_003520		Approved	H2B/d	uc003njv.3	Q99877	OTTHUMG00000016397	ENST00000396980.3:c.84G>A	6.37:g.27806523G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5L4|Q494S8|Q96FB7	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.K28	ENST00000396980.3	37	c.84	CCDS4633.1	6																																																																																			HIST1H2BN	-	superfamily_Histone-fold,smart_Histone_H2B	ENSG00000233822		0.602	HIST1H2BN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BN	HGNC	protein_coding	OTTHUMT00000043840.2	69	0.00	0	G	NM_003520		27806523	27806523	+1	no_errors	ENST00000396980	ensembl	human	known	69_37n	silent	74	13.95	12	SNP	1.000	A
HLA-DQB2	3120	genome.wustl.edu	37	6	32726803	32726803	+	Missense_Mutation	SNP	C	C	T	rs1049110	byFrequency	TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr6:32726803C>T	ENST00000437316.2	-	3	533	c.470G>A	c.(469-471)cGg>cAg	p.R157Q	HLA-DQB2_ENST00000411527.1_Missense_Mutation_p.R157Q|HLA-DQB2_ENST00000435145.2_Missense_Mutation_p.R157Q			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	161	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						CCGAAACCACCGGACTTTGAT	0.547																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.470G>A	6.37:g.32726803C>T	ENSP00000396330:p.Arg157Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.R157Q	ENST00000437316.2	37	c.470		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.106|9.106	1.005354|1.005354	0.19199|0.19199	.|.	.|.	ENSG00000232629|ENSG00000232629	ENST00000427449|ENST00000437316;ENST00000435145;ENST00000411527	.|T;T;T	.|0.02709	.|4.19;4.19;4.19	3.43|3.43	-2.23|-2.23	0.06930|0.06930	.|.	.|1.315740	.|0.05325	.|N	.|0.527239	T|T	0.01029|0.01029	0.0034|0.0034	M|M	0.69185|0.69185	2.1|2.1	0.80722|0.80722	P|P	0.0|0.0	.|B;P	.|0.39282	.|0.227;0.666	.|B;B	.|0.24974	.|0.021;0.057	T|T	0.45629|0.45629	-0.9248|-0.9248	4|9	.|0.66056	.|D	.|0.02	.|.	4.6583|4.6583	0.12630|0.12630	0.0:0.2967:0.2518:0.4515|0.0:0.2967:0.2518:0.4515	rs1049110;rs3189204;rs3213482;rs17840145;rs17853002;rs34594032;rs58630299;rs1049110|rs1049110;rs3189204;rs3213482;rs17840145;rs17853002;rs34594032;rs58630299;rs1049110	.|157;157	.|A2ADX3;Q5SR06	.|.;.	S|Q	156|157	.|ENSP00000396330:R157Q;ENSP00000410512:R157Q;ENSP00000390431:R157Q	.|ENSP00000390431:R157Q	G|R	-|-	1|2	0|0	HLA-DQB2|HLA-DQB2	32834781|32834781	0.000000|0.000000	0.05858|0.05858	0.721000|0.721000	0.30653|0.30653	0.360000|0.360000	0.29518|0.29518	-0.503000|-0.503000	0.06383|0.06383	-0.273000|-0.273000	0.09246|0.09246	-1.174000|-1.174000	0.01732|0.01732	GGT|CGG	HLA-DQB2	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000232629		0.547	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	HLA-DQB2	HGNC	protein_coding	OTTHUMT00000076216.2	9	0.00	0	C			32726803	32726803	-1	no_errors	ENST00000435145	ensembl	human	known	69_37n	missense	4	75.00	12	SNP	0.142	T
INPPL1	3636	genome.wustl.edu	37	11	71942144	71942144	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr11:71942144G>C	ENST00000298229.2	+	12	1612	c.1408G>C	c.(1408-1410)Ggg>Cgg	p.G470R	INPPL1_ENST00000541756.1_Missense_Mutation_p.G228R|INPPL1_ENST00000538751.1_Missense_Mutation_p.G228R	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	470					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTATGTCTTTGGGACCCAGGA	0.597																																						dbGAP											0													181.0	181.0	181.0					11																	71942144		2200	4293	6493	-	-	-	SO:0001583	missense	0			Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.1408G>C	11.37:g.71942144G>C	ENSP00000298229:p.Gly470Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,pfam_SAM_2,pfam_SAM_type1,superfamily_Endo/exonuclease/phosphatase,superfamily_SAM/pointed,smart_SH2,smart_IPPc,smart_SAM,pfscan_SAM,pfscan_SH2,prints_SH2	p.G470R	ENST00000298229.2	37	c.1408	CCDS8213.1	11	.	.	.	.	.	.	.	.	.	.	g	28.1	4.886924	0.91814	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751	D;D;D	0.96041	-3.89;-3.89;-3.89	5.81	5.81	0.92471	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.98871	0.9618	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99334	1.0910	10	0.87932	D	0	.	18.6606	0.91470	0.0:0.0:1.0:0.0	.	470	O15357	SHIP2_HUMAN	R	470;228;228	ENSP00000298229:G470R;ENSP00000446360:G228R;ENSP00000444619:G228R	ENSP00000298229:G470R	G	+	1	0	INPPL1	71619792	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.527000	0.81931	2.746000	0.94184	0.655000	0.94253	GGG	INPPL1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000165458		0.597	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPPL1	HGNC	protein_coding	OTTHUMT00000396789.1	24	0.00	0	G	NM_001567		71942144	71942144	+1	no_errors	ENST00000298229	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	1.000	C
KCNS3	3790	genome.wustl.edu	37	2	18112363	18112363	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr2:18112363C>G	ENST00000403915.1	+	3	539	c.88C>G	c.(88-90)Caa>Gaa	p.Q30E	KCNS3_ENST00000465292.1_Intron|KCNS3_ENST00000304101.4_Missense_Mutation_p.Q30E	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	30					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GTCTGTTGACCAAAGCACCCT	0.512																																						dbGAP											0													110.0	105.0	106.0					2																	18112363		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.88C>G	2.37:g.18112363C>G	ENSP00000385968:p.Gln30Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv2	p.Q30E	ENST00000403915.1	37	c.88	CCDS1692.1	2	.	.	.	.	.	.	.	.	.	.	C	12.41	1.930797	0.34096	.	.	ENSG00000170745	ENST00000403915;ENST00000304101;ENST00000419802	T;T;T	0.75938	-0.98;-0.98;-0.98	5.79	5.79	0.91817	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.245473	0.42821	D	0.000653	T	0.63965	0.2556	N	0.11341	0.13	0.46061	D	0.99884	B	0.34372	0.451	B	0.38921	0.285	T	0.63655	-0.6588	10	0.37606	T	0.19	.	20.0914	0.97820	0.0:1.0:0.0:0.0	.	30	Q9BQ31	KCNS3_HUMAN	E	30	ENSP00000385968:Q30E;ENSP00000305824:Q30E;ENSP00000400098:Q30E	ENSP00000305824:Q30E	Q	+	1	0	KCNS3	17975844	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.035000	0.70940	2.758000	0.94735	0.558000	0.71614	CAA	KCNS3	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv9	ENSG00000170745		0.512	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS3	HGNC	protein_coding	OTTHUMT00000323808.1	35	0.00	0	C	NM_002252		18112363	18112363	+1	no_errors	ENST00000304101	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	1.000	G
KCNT2	343450	genome.wustl.edu	37	1	196394988	196394988	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:196394988C>T	ENST00000294725.9	-	11	2030	c.1115G>A	c.(1114-1116)aGa>aAa	p.R372K	KCNT2_ENST00000609185.1_Missense_Mutation_p.R372K|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000367433.5_Missense_Mutation_p.R372K|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000367431.4_Missense_Mutation_p.R372K			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	372					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CTACTTTGCTCTCAATAGGTC	0.403																																						dbGAP											0													174.0	159.0	164.0					1																	196394988		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1115G>A	1.37:g.196394988C>T	ENSP00000294725:p.Arg372Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.R372K	ENST00000294725.9	37	c.1115	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.327221	0.95708	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000294725	T;T;T	0.69040	-0.37;-0.37;-0.37	5.64	5.64	0.86602	NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000001	D	0.84302	0.5442	M	0.82323	2.585	0.80722	D	1	D;D;P;D	0.89917	1.0;1.0;0.908;1.0	D;D;P;D	0.85130	0.992;0.997;0.839;0.992	D	0.85570	0.1233	10	0.87932	D	0	-21.9975	20.0769	0.97748	0.0:1.0:0.0:0.0	.	372;372;372;372	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	K	372;372;193;372	ENSP00000356403:R372K;ENSP00000356401:R372K;ENSP00000294725:R372K	ENSP00000294725:R372K	R	-	2	0	KCNT2	194661611	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.776000	0.85560	2.820000	0.97059	0.650000	0.86243	AGA	KCNT2	-	NULL	ENSG00000162687		0.403	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	55	0.00	0	C	NM_198503		196394988	196394988	-1	no_errors	ENST00000294725	ensembl	human	known	69_37n	missense	53	41.11	37	SNP	1.000	T
CEP162	22832	genome.wustl.edu	37	6	84881431	84881431	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr6:84881431C>T	ENST00000403245.3	-	17	2287	c.2173G>A	c.(2173-2175)Gaa>Aaa	p.E725K	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.E649K	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TATAATCGTTCATTTTCCTTT	0.279																																						dbGAP											0													74.0	69.0	71.0					6																	84881431		2194	4277	6471	-	-	-	SO:0001583	missense	0																														ENST00000403245.3:c.2173G>A	6.37:g.84881431C>T	ENSP00000385215:p.Glu725Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E725K	ENST00000403245.3	37	c.2173	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	C	20.0	3.929777	0.73327	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.37235	1.21;1.21	5.43	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.36496	0.0969	L	0.56199	1.76	0.42077	D	0.991239	D	0.59767	0.986	P	0.56163	0.793	T	0.21861	-1.0233	10	0.49607	T	0.09	-14.1732	13.6652	0.62391	0.0:0.9251:0.0:0.0748	.	725	Q5TB80	QN1_HUMAN	K	649;725	ENSP00000257766:E649K;ENSP00000385215:E725K	ENSP00000257766:E649K	E	-	1	0	KIAA1009	84938150	1.000000	0.71417	0.998000	0.56505	0.808000	0.45660	5.698000	0.68302	1.438000	0.47492	0.467000	0.42956	GAA	KIAA1009	-	NULL	ENSG00000135315		0.279	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	97	0.00	0	C			84881431	84881431	-1	no_errors	ENST00000403245	ensembl	human	known	69_37n	missense	74	12.94	11	SNP	1.000	T
KIAA1467	57613	genome.wustl.edu	37	12	13208573	13208573	+	Silent	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr12:13208573G>A	ENST00000197268.8	+	2	246	c.126G>A	c.(124-126)caG>caA	p.Q42Q		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	42						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TTAACCTGCAGAAGAATGGAG	0.517																																						dbGAP											0													77.0	77.0	77.0					12																	13208573		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.126G>A	12.37:g.13208573G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Silent	SNP	superfamily_Quinonprotein_ADH-like	p.Q42	ENST00000197268.8	37	c.126	CCDS31750.1	12																																																																																			KIAA1467	-	NULL	ENSG00000084444		0.517	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1467	HGNC	protein_coding	OTTHUMT00000401007.1	32	0.00	0	G	NM_020853		13208573	13208573	+1	no_errors	ENST00000197268	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	1.000	A
LNX1	84708	genome.wustl.edu	37	4	54343119	54343119	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr4:54343119C>T	ENST00000263925.7	-	9	2007	c.1693G>A	c.(1693-1695)Gaa>Aaa	p.E565K	LNX1_ENST00000306888.2_Missense_Mutation_p.E469K|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	565	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TCTGTCAGTTCGACCCCATCC	0.468																																						dbGAP											0													132.0	133.0	133.0					4																	54343119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1693G>A	4.37:g.54343119C>T	ENSP00000263925:p.Glu565Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.E565K	ENST00000263925.7	37	c.1693	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079130	0.36662	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.26067	1.76;1.76	5.16	5.16	0.70880	PDZ/DHR/GLGF (4);	0.258891	0.43260	D	0.000583	T	0.23014	0.0556	L	0.49640	1.575	0.52099	D	0.999942	B;B	0.33826	0.427;0.213	B;B	0.30782	0.12;0.016	T	0.02196	-1.1197	10	0.34782	T	0.22	.	12.1904	0.54268	0.0:0.9226:0.0:0.0774	.	565;469	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	K	469;403;565	ENSP00000302879:E469K;ENSP00000263925:E565K	ENSP00000263925:E565K	E	-	1	0	LNX1	54037876	1.000000	0.71417	0.084000	0.20598	0.009000	0.06853	5.086000	0.64474	2.687000	0.91594	0.561000	0.74099	GAA	LNX1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000072201		0.468	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	56	0.00	0	C			54343119	54343119	-1	no_errors	ENST00000263925	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	0.975	T
LRRIQ4	344657	genome.wustl.edu	37	3	169550895	169550895	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr3:169550895A>G	ENST00000340806.6	+	4	1454	c.1454A>G	c.(1453-1455)gAa>gGa	p.E485G		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	485										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						CCCCCAAAAGAAGTGTGTGCT	0.428																																						dbGAP											0													74.0	69.0	71.0					3																	169550895		1860	4117	5977	-	-	-	SO:0001583	missense	0				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.1454A>G	3.37:g.169550895A>G	ENSP00000342188:p.Glu485Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E485G	ENST00000340806.6	37	c.1454	CCDS46951.1	3	.	.	.	.	.	.	.	.	.	.	A	13.93	2.384383	0.42308	.	.	ENSG00000188306	ENST00000340806	T	0.36157	1.27	5.41	2.96	0.34315	.	0.564713	0.17345	N	0.177613	T	0.42245	0.1194	M	0.82823	2.61	0.09310	N	1	P	0.40144	0.704	B	0.38378	0.272	T	0.28299	-1.0048	10	0.45353	T	0.12	.	12.1921	0.54277	0.7127:0.2873:0.0:0.0	.	485	A6NIV6	LRIQ4_HUMAN	G	485	ENSP00000342188:E485G	ENSP00000342188:E485G	E	+	2	0	LRRIQ4	171033589	0.025000	0.19082	0.004000	0.12327	0.258000	0.26162	1.097000	0.30988	0.321000	0.23259	0.459000	0.35465	GAA	LRRIQ4	-	NULL	ENSG00000188306		0.428	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	HGNC	protein_coding	OTTHUMT00000378698.1	33	0.00	0	A	NM_001080460		169550895	169550895	+1	no_errors	ENST00000340806	ensembl	human	known	69_37n	missense	28	30.00	12	SNP	0.039	G
LYZL2	119180	genome.wustl.edu	37	10	30915760	30915760	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr10:30915760T>C	ENST00000375318.2	-	2	279	c.223A>G	c.(223-225)Aaa>Gaa	p.K75E		NM_183058.2	NP_898881.2	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	29					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			NS(2)|central_nervous_system(1)|large_intestine(1)|lung(14)|prostate(1)	19		Prostate(175;0.151)				GAGAATATTTTTGCCAGTTTG	0.522																																						dbGAP											0													92.0	110.0	104.0					10																	30915760		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF139543	CCDS7167.2	10p11.23	2009-12-04			ENSG00000151033	ENSG00000151033			29613	protein-coding gene	gene with protein product		612748					Standard	NM_183058		Approved		uc001ivk.3	Q7Z4W2	OTTHUMG00000017898	ENST00000375318.2:c.223A>G	10.37:g.30915760T>C	ENSP00000364467:p.Lys75Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NZ69	Missense_Mutation	SNP	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	p.K75E	ENST00000375318.2	37	c.223	CCDS7167.2	10	.	.	.	.	.	.	.	.	.	.	T	15.49	2.849301	0.51270	.	.	ENSG00000151033	ENST00000375318	T	0.75589	-0.95	2.01	2.01	0.26516	.	0.127033	0.49305	D	0.000152	T	0.80171	0.4574	M	0.77103	2.36	0.28711	N	0.903563	D	0.54772	0.968	P	0.59115	0.852	T	0.72640	-0.4232	10	0.87932	D	0	-29.2891	6.0734	0.19901	0.0:0.0:0.0:1.0	.	75	Q7Z4W2-2	.	E	75	ENSP00000364467:K75E	ENSP00000364467:K75E	K	-	1	0	LYZL2	30955766	1.000000	0.71417	0.998000	0.56505	0.675000	0.39556	0.893000	0.28336	1.175000	0.42826	0.254000	0.18369	AAA	LYZL2	-	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	ENSG00000151033		0.522	LYZL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYZL2	HGNC	protein_coding	OTTHUMT00000047434.1	113	0.00	0	T	NM_183058		30915760	30915760	-1	no_errors	ENST00000375318	ensembl	human	known	69_37n	missense	101	13.68	16	SNP	1.000	C
MED12	9968	genome.wustl.edu	37	X	70351944	70351944	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:70351944A>T	ENST00000374080.3	+	30	4173	c.4141A>T	c.(4141-4143)Aac>Tac	p.N1381Y	MED12_ENST00000374102.1_Missense_Mutation_p.N1381Y|MED12_ENST00000333646.6_Missense_Mutation_p.N1381Y			Q93074	MED12_HUMAN	mediator complex subunit 12	1381					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CCTCTTGGAGAACATCGCCAA	0.507			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													85.0	78.0	80.0					X																	70351944		2058	4179	6237	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4141A>T	X.37:g.70351944A>T	ENSP00000363193:p.Asn1381Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.N1381Y	ENST00000374080.3	37	c.4141	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003079	0.74932	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	D;D;D;D;T	0.84223	-1.82;-1.82;-1.82;-1.82;1.37	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	D	0.86879	0.6039	M	0.62723	1.935	0.58432	D	0.999999	P;D;P;P	0.58268	0.829;0.982;0.829;0.737	P;P;P;P	0.52710	0.583;0.707;0.46;0.476	D	0.85570	0.1233	10	0.31617	T	0.26	-19.7727	13.1751	0.59621	1.0:0.0:0.0:0.0	.	1381;1228;1381;1381	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	Y	1381;1381;1381;1381;1349;126	ENSP00000333125:N1381Y;ENSP00000363215:N1381Y;ENSP00000363193:N1381Y;ENSP00000414203:N1349Y;ENSP00000408388:N126Y	ENSP00000333125:N1381Y	N	+	1	0	MED12	70268669	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.841000	0.92131	1.750000	0.51863	0.425000	0.28330	AAC	MED12	-	NULL	ENSG00000184634		0.507	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	38	0.00	0	A	NM_005120		70351944	70351944	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
MTMR10	54893	genome.wustl.edu	37	15	31233955	31233955	+	Silent	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr15:31233955G>C	ENST00000435680.1	-	16	2149	c.2052C>G	c.(2050-2052)ctC>ctG	p.L684L	MTMR10_ENST00000314404.8_Intron|MTMR10_ENST00000425768.1_3'UTR|FAN1_ENST00000362065.4_3'UTR	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	684							phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		CATCAGCCAGGAGGGAGAGCT	0.592																																						dbGAP											0													47.0	49.0	48.0					15																	31233955		2027	4185	6212	-	-	-	SO:0001819	synonymous_variant	0			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.2052C>G	15.37:g.31233955G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4Q6	Silent	SNP	pfam_Myotubularin_assoc,pfam_Myotub-related	p.L684	ENST00000435680.1	37	c.2052	CCDS45204.1	15																																																																																			MTMR10	-	pfam_Myotubularin_assoc	ENSG00000166912		0.592	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1	30	0.00	0	G	NM_017762		31233955	31233955	-1	no_errors	ENST00000435680	ensembl	human	known	69_37n	silent	32	15.79	6	SNP	0.024	C
MUC2	4583	genome.wustl.edu	37	11	1096456	1096456	+	Missense_Mutation	SNP	G	G	C	rs569670287		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr11:1096456G>C	ENST00000441003.2	+	34	6508	c.6481G>C	c.(6481-6483)Gac>Cac	p.D2161H	MUC2_ENST00000361558.6_Missense_Mutation_p.D299H	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4523					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AGTTTACATCGACAACTACCA	0.572																																						dbGAP											0													113.0	125.0	121.0					11																	1096456		2176	4264	6440	-	-	-	SO:0001583	missense	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6481G>C	11.37:g.1096456G>C	ENSP00000415183:p.Asp2161His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.D2161H	ENST00000441003.2	37	c.6481		11	.	.	.	.	.	.	.	.	.	.	g	12.27	1.886358	0.33348	.	.	ENSG00000198788	ENST00000441003;ENST00000361558	T;T	0.60040	0.22;0.22	3.95	0.963	0.19649	.	.	.	.	.	T	0.54791	0.1880	L	0.37507	1.11	0.29167	N	0.877407	D	0.52996	0.957	P	0.53954	0.738	T	0.50533	-0.8817	9	0.49607	T	0.09	.	7.1852	0.25795	0.1612:0.1395:0.6993:0.0	.	2161	E7EUV1	.	H	2161;299	ENSP00000415183:D2161H;ENSP00000354885:D299H	ENSP00000354885:D299H	D	+	1	0	MUC2	1086456	1.000000	0.71417	0.147000	0.22382	0.126000	0.20510	5.245000	0.65405	0.016000	0.14998	0.479000	0.44913	GAC	MUC2	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000198788		0.572	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	22	0.00	0	G	NM_002457		1096456	1096456	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	C
N4BP1	9683	genome.wustl.edu	37	16	48595832	48595832	+	Missense_Mutation	SNP	C	C	T	rs374516858		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr16:48595832C>T	ENST00000262384.3	-	2	958	c.722G>A	c.(721-723)gGg>gAg	p.G241E	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	241					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				AACAGGAGTCCCAGCTTTATT	0.413																																						dbGAP											0													75.0	72.0	73.0					16																	48595832		1871	4083	5954	-	-	-	SO:0001583	missense	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.722G>A	16.37:g.48595832C>T	ENSP00000262384:p.Gly241Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD49|Q2YDX1	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.G241E	ENST00000262384.3	37	c.722	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070324	0.76301	.	.	ENSG00000102921	ENST00000262384	T	0.52295	0.67	5.61	5.61	0.85477	.	0.388030	0.26871	N	0.022074	T	0.53384	0.1793	L	0.29908	0.895	0.39529	D	0.968636	D	0.65815	0.995	P	0.54856	0.762	T	0.57539	-0.7794	10	0.66056	D	0.02	-6.7919	19.6397	0.95753	0.0:1.0:0.0:0.0	.	241	O75113	N4BP1_HUMAN	E	241	ENSP00000262384:G241E	ENSP00000262384:G241E	G	-	2	0	N4BP1	47153333	0.756000	0.28383	0.997000	0.53966	0.959000	0.62525	4.141000	0.58038	2.632000	0.89209	0.655000	0.94253	GGG	N4BP1	-	NULL	ENSG00000102921		0.413	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	HGNC	protein_coding	OTTHUMT00000429920.1	36	0.00	0	C	NM_014664		48595832	48595832	-1	no_errors	ENST00000262384	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	0.999	T
NCOR1	9611	genome.wustl.edu	37	17	15965432	15965432	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:15965432G>A	ENST00000268712.3	-	36	5631	c.5374C>T	c.(5374-5376)Cag>Tag	p.Q1792*	NCOR1_ENST00000395851.1_Nonsense_Mutation_p.Q1808*|NCOR1_ENST00000395857.3_Nonsense_Mutation_p.Q376*	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1792	Interaction with C1D. {ECO:0000250}.|Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ATTCGTAGCTGAGCAGTTGGA	0.388																																						dbGAP											0													159.0	139.0	146.0					17																	15965432		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.5374C>T	17.37:g.15965432G>A	ENSP00000268712:p.Gln1792*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Nonsense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q1792*	ENST00000268712.3	37	c.5374	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.961763	0.97151	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	.	.	.	5.74	5.74	0.90152	.	0.133611	0.52532	D	0.000068	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-8.4798	18.9133	0.92494	0.0:0.0:1.0:0.0	.	.	.	.	X	1792;1808;1696;376	.	ENSP00000268712:Q1792X	Q	-	1	0	NCOR1	15906157	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.487000	0.66863	2.715000	0.92844	0.650000	0.86243	CAG	NCOR1	-	NULL	ENSG00000141027		0.388	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	45	0.00	0	G	NM_006311		15965432	15965432	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	nonsense	21	40.00	14	SNP	1.000	A
NF1	4763	genome.wustl.edu	37	17	29553598	29553598	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:29553598A>T	ENST00000358273.4	+	18	2530	c.2147A>T	c.(2146-2148)gAa>gTa	p.E716V	NF1_ENST00000356175.3_Missense_Mutation_p.E716V	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	716					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTCTGTGAGGAAGCAGATATC	0.498			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)											109.0	102.0	105.0					17																	29553598		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2147A>T	17.37:g.29553598A>T	ENSP00000351015:p.Glu716Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.E716V	ENST00000358273.4	37	c.2147	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	A	24.3	4.510822	0.85389	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.64991	-0.13;-0.13;2.14	5.57	5.57	0.84162	Armadillo-type fold (1);	0.106561	0.64402	D	0.000006	T	0.74527	0.3728	L	0.52126	1.63	0.80722	D	1	D;D;D	0.89917	0.997;0.989;1.0	D;D;D	0.75020	0.928;0.985;0.983	T	0.77202	-0.2674	10	0.87932	D	0	.	15.7515	0.77989	1.0:0.0:0.0:0.0	.	716;716;716	E1P657;P21359-2;P21359	.;.;NF1_HUMAN	V	716;716;382	ENSP00000351015:E716V;ENSP00000348498:E716V;ENSP00000389907:E382V	ENSP00000348498:E716V	E	+	2	0	NF1	26577724	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.785000	0.91822	2.108000	0.64289	0.528000	0.53228	GAA	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.498	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	53	0.00	0	A	NM_000267		29553598	29553598	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	T
NPY1R	4886	genome.wustl.edu	37	4	164247139	164247139	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr4:164247139C>T	ENST00000296533.2	-	2	1099	c.568G>A	c.(568-570)Gat>Aat	p.D190N	NPY1R_ENST00000509586.1_Intron	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	190					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TTGTACGCATCAAGTGTTACA	0.433																																						dbGAP											0													122.0	108.0	113.0					4																	164247139		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.568G>A	4.37:g.164247139C>T	ENSP00000354652:p.Asp190Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6H5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_Glucose_rcpt_Git3_N,pfscan_GPCR_Rhodpsn_supfam,prints_NPY1_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.D190N	ENST00000296533.2	37	c.568	CCDS34089.1	4	.	.	.	.	.	.	.	.	.	.	C	5.649	0.304454	0.10678	.	.	ENSG00000164128	ENST00000296533;ENST00000512819	T;T	0.71817	1.21;-0.6	5.84	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.509670	0.19234	N	0.119339	T	0.57446	0.2054	N	0.14661	0.345	0.09310	N	0.999992	P	0.36837	0.571	B	0.38458	0.274	T	0.48614	-0.9020	10	0.21014	T	0.42	.	18.6015	0.91249	0.0:0.8735:0.1265:0.0	.	190	P25929	NPY1R_HUMAN	N	190;12	ENSP00000354652:D190N;ENSP00000421618:D12N	ENSP00000354652:D190N	D	-	1	0	NPY1R	164466589	0.027000	0.19231	0.041000	0.18516	0.489000	0.33432	2.050000	0.41297	2.771000	0.95319	0.655000	0.94253	GAT	NPY1R	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_Glucose_rcpt_Git3_N,pfscan_GPCR_Rhodpsn_supfam,prints_NPY1_rcpt	ENSG00000164128		0.433	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY1R	HGNC	protein_coding	OTTHUMT00000364685.1	46	0.00	0	C			164247139	164247139	-1	no_errors	ENST00000296533	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	0.001	T
OR6C76	390326	genome.wustl.edu	37	12	55820676	55820676	+	Silent	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr12:55820676C>G	ENST00000328314.3	+	1	639	c.639C>G	c.(637-639)ctC>ctG	p.L213L		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TAGTAATTCTCTCCTATACTT	0.378																																						dbGAP											0													98.0	90.0	93.0					12																	55820676		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.639C>G	12.37:g.55820676C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L213	ENST00000328314.3	37	c.639	CCDS31823.1	12																																																																																			OR6C76	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000185821		0.378	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	HGNC	protein_coding	OTTHUMT00000406675.1	64	0.00	0	C	NM_001005183		55820676	55820676	+1	no_errors	ENST00000328314	ensembl	human	known	69_37n	silent	49	20.97	13	SNP	0.000	G
AKAP2	11217	genome.wustl.edu	37	9	112930764	112930764	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr9:112930764A>G	ENST00000259318.7	+	4	2774	c.2567A>G	c.(2566-2568)gAa>gGa	p.E856G	AKAP2_ENST00000434623.2_Missense_Mutation_p.E958G|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.E1100G|AKAP2_ENST00000555236.1_Missense_Mutation_p.E1100G|AKAP2_ENST00000482335.1_3'UTR|AKAP2_ENST00000510514.5_Missense_Mutation_p.E1087G|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.E1087G|AKAP2_ENST00000374525.1_Missense_Mutation_p.E945G	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	856										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CAGGAGGAAGAAGACAACGAA	0.478																																						dbGAP											0													84.0	82.0	83.0					9																	112930764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.2567A>G	9.37:g.112930764A>G	ENSP00000259318:p.Glu856Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.E1100G	ENST00000259318.7	37	c.3299	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	A	16.35	3.098514	0.56183	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000259318	T;T;T;T;T;T;T	0.50277	2.08;2.08;2.08;2.08;1.34;0.75;1.35	5.49	5.49	0.81192	.	0.186868	0.44902	D	0.000406	T	0.55242	0.1908	N	0.22421	0.69	0.37839	D	0.929003	B;P;P;D;D	0.76494	0.435;0.952;0.919;0.999;0.999	B;B;B;D;D	0.78314	0.057;0.385;0.214;0.991;0.991	T	0.63567	-0.6608	10	0.62326	D	0.03	-30.3773	14.7944	0.69868	1.0:0.0:0.0:0.0	.	856;958;946;1087;1100	Q9Y2D5;Q9Y2D5-7;B1ALY1;Q9Y2D5-6;Q9Y2D5-4	AKAP2_HUMAN;.;.;.;.	G	1100;1087;1100;1087;958;945;856	ENSP00000363654:E1100G;ENSP00000305861:E1087G;ENSP00000451476:E1100G;ENSP00000421522:E1087G;ENSP00000404782:E958G;ENSP00000363649:E945G;ENSP00000259318:E856G	ENSP00000259318:E856G	E	+	2	0	PALM2-AKAP2;AKAP2	111970585	0.999000	0.42202	0.999000	0.59377	0.928000	0.56348	4.052000	0.57420	2.076000	0.62316	0.533000	0.62120	GAA	PALM2-AKAP2	-	NULL	ENSG00000157654		0.478	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	41	0.00	0	A	NM_001004065		112930764	112930764	+1	no_errors	ENST00000374530	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	1.000	G
PDE10A	10846	genome.wustl.edu	37	6	165756912	165756912	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr6:165756912C>T	ENST00000366882.1	-	20	2189	c.2035G>A	c.(2035-2037)Gca>Aca	p.A679T	PDE10A_ENST00000354448.4_Missense_Mutation_p.A679T|PDE10A_ENST00000539869.2_Missense_Mutation_p.A689T			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	679					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	ATATCATTTGCCGTCAATTTT	0.378																																					Esophageal Squamous(22;308 615 5753 12038 40624)	dbGAP											0													123.0	118.0	120.0					6																	165756912		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.2035G>A	6.37:g.165756912C>T	ENSP00000355847:p.Ala679Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.A689T	ENST00000366882.1	37	c.2065		6	.	.	.	.	.	.	.	.	.	.	C	33	5.244860	0.95272	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.82984	-1.67;-1.67	5.67	5.67	0.87782	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.84014	0.5379	N	0.25144	0.715	0.80722	D	1	D;P	0.76494	0.999;0.524	D;B	0.85130	0.997;0.302	D	0.86269	0.1660	10	0.66056	D	0.02	.	19.3597	0.94432	0.0:1.0:0.0:0.0	.	689;679	Q9ULW9;Q9Y233	.;PDE10_HUMAN	T	679;707;689;679;678	ENSP00000355847:A679T;ENSP00000346435:A679T	ENSP00000341187:A689T	A	-	1	0	PDE10A	165676902	1.000000	0.71417	0.689000	0.30133	0.982000	0.71751	5.419000	0.66435	2.671000	0.90904	0.585000	0.79938	GCA	PDE10A	-	pfam_PDEase_catalytic_dom,prints_PDEase	ENSG00000112541		0.378	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	45	0.00	0	C			165756912	165756912	-1	no_errors	ENST00000539869	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	0.765	T
PIK3CA	5290	genome.wustl.edu	37	3	178936095	178936095	+	Missense_Mutation	SNP	A	A	G	rs397517201		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr3:178936095A>G	ENST00000263967.3	+	10	1794	c.1637A>G	c.(1636-1638)cAg>cGg	p.Q546R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	546	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		Q -> E (in BC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> K (in OC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> P (found in an anaplastic astrocytoma sample; unknown pathological significance). {ECO:0000269|PubMed:15289301}.|Q -> R (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.Q546R(30)|p.Q546P(18)|p.Q546L(5)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ATCACTGAGCAGGAGAAAGAT	0.363		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	53	Substitution - Missense(53)	endometrium(18)|breast(17)|large_intestine(10)|central_nervous_system(3)|prostate(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)											61.0	61.0	61.0					3																	178936095		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1637A>G	3.37:g.178936095A>G	ENSP00000263967:p.Gln546Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q546R	ENST00000263967.3	37	c.1637	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	22.8	4.332178	0.81801	.	.	ENSG00000121879	ENST00000263967	T	0.63417	-0.04	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75657	0.3879	M	0.64404	1.975	0.80722	D	1	D	0.63046	0.992	D	0.65323	0.934	T	0.76782	-0.2832	10	0.52906	T	0.07	-14.2064	16.1026	0.81194	1.0:0.0:0.0:0.0	.	546	P42336	PK3CA_HUMAN	R	546	ENSP00000263967:Q546R	ENSP00000263967:Q546R	Q	+	2	0	PIK3CA	180418789	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	8.962000	0.93254	2.198000	0.70561	0.383000	0.25322	CAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.363	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	59	0.00	0	A			178936095	178936095	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	1.000	G
POF1B	79983	genome.wustl.edu	37	X	84601036	84601036	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:84601036G>C	ENST00000262753.4	-	6	698	c.553C>G	c.(553-555)Cag>Gag	p.Q185E	POF1B_ENST00000373145.3_Missense_Mutation_p.Q185E	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	185						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						CATTGAGCCTGAGGATGGCAC	0.428																																						dbGAP											0													129.0	102.0	111.0					X																	84601036		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.553C>G	X.37:g.84601036G>C	ENSP00000262753:p.Gln185Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	NULL	p.Q185E	ENST00000262753.4	37	c.553	CCDS14452.1	X	.	.	.	.	.	.	.	.	.	.	G	6.458	0.452746	0.12283	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.12879	2.65;2.64	4.47	3.6	0.41247	.	0.135912	0.33813	N	0.004531	T	0.12987	0.0315	L	0.43152	1.355	0.23616	N	0.997285	B;B	0.15930	0.015;0.0	B;B	0.21917	0.037;0.002	T	0.19224	-1.0312	10	0.72032	D	0.01	.	9.483	0.38913	0.0:0.2101:0.7899:0.0	.	185;185	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	E	185	ENSP00000262753:Q185E;ENSP00000362238:Q185E	ENSP00000262753:Q185E	Q	-	1	0	POF1B	84487692	1.000000	0.71417	0.991000	0.47740	0.140000	0.21249	3.983000	0.56916	0.982000	0.38575	-0.225000	0.12378	CAG	POF1B	-	NULL	ENSG00000124429		0.428	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	HGNC	protein_coding	OTTHUMT00000057391.2	105	0.00	0	G	NM_024921		84601036	84601036	-1	no_errors	ENST00000373145	ensembl	human	known	69_37n	missense	63	16.00	12	SNP	0.997	C
PPM1D	8493	genome.wustl.edu	37	17	58740529	58740529	+	Nonsense_Mutation	SNP	C	C	A	rs146477590	byFrequency	TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:58740529C>A	ENST00000305921.3	+	6	1666	c.1434C>A	c.(1432-1434)tgC>tgA	p.C478*	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	478					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.C478C(1)|p.C478*(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			AAGAAAATTGCGCTAAAGCCC	0.393											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										dbGAP											2	Substitution - Nonsense(1)|Substitution - coding silent(1)	upper_aerodigestive_tract(1)|prostate(1)											103.0	96.0	99.0					17																	58740529		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1434C>A	17.37:g.58740529C>A	ENSP00000306682:p.Cys478*	Somatic	1033	WXS	Illumina GAIIx	Phase_IV	Q53XP4|Q6P991|Q8IVR6	Nonsense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.C478*	ENST00000305921.3	37	c.1434	CCDS11625.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.870206	0.97901	.	.	ENSG00000170836	ENST00000305921	.	.	.	6.08	2.16	0.27623	.	0.130398	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-11.4438	11.9983	0.53216	0.0:0.8312:0.0:0.1688	.	.	.	.	X	478	.	ENSP00000306682:C478X	C	+	3	2	PPM1D	56095311	0.977000	0.34250	0.999000	0.59377	0.943000	0.58893	0.187000	0.16998	0.247000	0.21414	-0.423000	0.05987	TGC	PPM1D	-	NULL	ENSG00000170836		0.393	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1D	HGNC	protein_coding	OTTHUMT00000449474.1	35	0.00	0	C	NM_003620		58740529	58740529	+1	no_errors	ENST00000305921	ensembl	human	known	69_37n	nonsense	30	21.05	8	SNP	0.999	A
PPP5C	5536	genome.wustl.edu	37	19	46893337	46893337	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr19:46893337T>C	ENST00000012443.4	+	12	1488	c.1385T>C	c.(1384-1386)aTc>aCc	p.I462T	PPP5C_ENST00000391919.1_Missense_Mutation_p.I334T|AC007193.8_ENST00000598616.1_RNA	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	462	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		GCCTCCTACATCCACCTCCAG	0.627																																						dbGAP											0													165.0	134.0	145.0					19																	46893337		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.1385T>C	19.37:g.46893337T>C	ENSP00000012443:p.Ile462Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16722|Q53XV2	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_PPP_dom,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ser/Thr-sp_prot-phosphatase	p.I462T	ENST00000012443.4	37	c.1385	CCDS12684.1	19	.	.	.	.	.	.	.	.	.	.	T	17.04	3.287686	0.59976	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	T;T	0.06849	3.25;3.25	5.46	4.45	0.53987	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.231162	0.41938	D	0.000791	T	0.40719	0.1128	H	0.97587	4.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.988	T	0.52087	-0.8622	10	0.87932	D	0	-21.0877	9.4775	0.38880	0.0:0.0841:0.0:0.9159	.	462;462	B2R6R6;P53041	.;PPP5_HUMAN	T	462;449;334	ENSP00000012443:I462T;ENSP00000375786:I334T	ENSP00000012443:I462T	I	+	2	0	PPP5C	51585177	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	7.440000	0.80464	0.918000	0.36919	-0.376000	0.06991	ATC	PPP5C	-	smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5	ENSG00000011485		0.627	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP5C	HGNC	protein_coding	OTTHUMT00000258969.2	30	0.00	0	T	NM_006247		46893337	46893337	+1	no_errors	ENST00000012443	ensembl	human	known	69_37n	missense	28	34.88	15	SNP	1.000	C
PTEN	5728	genome.wustl.edu	37	10	89711928	89711929	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr10:89711928_89711929delAA	ENST00000371953.3	+	6	1903_1904	c.546_547delAA	c.(544-549)ttaaagfs	p.K183fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	183	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(4)|p.V166fs*17(3)|p.G165fs*9(3)|p.L182fs*16(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.K183fs*7(1)|p.L182F(1)|p.V175fs*3(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GCTACCTGTTAAAGAATCATCT	0.386		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	60	Whole gene deletion(37)|Deletion - Frameshift(13)|Unknown(4)|Complex - frameshift(3)|Deletion - In frame(1)|Insertion - Frameshift(1)|Substitution - Missense(1)	prostate(16)|central_nervous_system(15)|skin(10)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)|pancreas(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.546_547delAA	10.37:g.89711928_89711929delAA	ENSP00000361021:p.Lys183fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.K183fs	ENST00000371953.3	37	c.546_547	CCDS31238.1	10																																																																																			PTEN	-	smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Phosphatase_tensin-typ	ENSG00000171862		0.386	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	53	0.00	0	AA	NM_000314		89711928	89711929	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	frame_shift_del	39	29.09	16	DEL	1.000:1.000	-
PTPRO	5800	genome.wustl.edu	37	12	15636960	15636960	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr12:15636960C>T	ENST00000281171.4	+	2	458	c.128C>T	c.(127-129)tCa>tTa	p.S43L	PTPRO_ENST00000543886.1_Missense_Mutation_p.S43L|PTPRO_ENST00000348962.2_Missense_Mutation_p.S43L	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	43					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				ATCGTTGTCTCATTAGAAGCT	0.353																																						dbGAP											0													94.0	94.0	94.0					12																	15636960		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.128C>T	12.37:g.15636960C>T	ENSP00000281171:p.Ser43Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S43L	ENST00000281171.4	37	c.128	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620127	0.87460	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.04360	3.65;3.64	5.48	5.48	0.80851	Fibronectin, type III (1);	0.000000	0.51477	D	0.000100	T	0.13756	0.0333	L	0.27053	0.805	0.80722	D	1	D;P;D	0.57899	0.975;0.919;0.981	P;P;D	0.69824	0.657;0.456;0.966	T	0.02728	-1.1118	10	0.87932	D	0	.	19.3636	0.94453	0.0:1.0:0.0:0.0	.	43;43;43	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	L	43	ENSP00000281171:S43L;ENSP00000343434:S43L	ENSP00000281171:S43L	S	+	2	0	PTPRO	15528227	1.000000	0.71417	0.993000	0.49108	0.833000	0.47200	4.038000	0.57318	2.573000	0.86826	0.655000	0.94253	TCA	PTPRO	-	superfamily_Fibronectin_type3	ENSG00000151490		0.353	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	45	0.00	0	C			15636960	15636960	+1	no_errors	ENST00000281171	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	0.998	T
RAB3IL1	5866	genome.wustl.edu	37	11	61674931	61674931	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr11:61674931C>G	ENST00000394836.2	-	4	529	c.372G>C	c.(370-372)aaG>aaC	p.K124N	RAB3IL1_ENST00000301773.5_Missense_Mutation_p.K171N	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	124					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						CTCGAACCATCTTGTGAGCTT	0.627																																						dbGAP											0													104.0	81.0	89.0					11																	61674931		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.372G>C	11.37:g.61674931C>G	ENSP00000378313:p.Lys124Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V32|Q9P1Q8	Missense_Mutation	SNP	pfam_Sec2p	p.K124N	ENST00000394836.2	37	c.372	CCDS8014.1	11	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521426	0.64747	.	.	ENSG00000167994	ENST00000394836;ENST00000301773;ENST00000531922	T;T;T	0.50001	0.76;0.76;0.76	5.02	3.15	0.36227	.	0.047664	0.85682	D	0.000000	T	0.53012	0.1770	L	0.49640	1.575	0.21697	N	0.999581	B;D	0.58620	0.011;0.983	B;P	0.60541	0.061;0.876	T	0.40384	-0.9566	10	0.23891	T	0.37	-15.0261	8.8522	0.35206	0.0:0.7657:0.0:0.2343	.	171;124	Q8TBN0-2;Q8TBN0	.;R3GEF_HUMAN	N	124;171;171	ENSP00000378313:K124N;ENSP00000301773:K171N;ENSP00000435444:K171N	ENSP00000301773:K171N	K	-	3	2	RAB3IL1	61431507	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.668000	0.46816	0.643000	0.30638	0.655000	0.94253	AAG	RAB3IL1	-	pfam_Sec2p	ENSG00000167994		0.627	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3IL1	HGNC	protein_coding	OTTHUMT00000394917.1	42	0.00	0	C	NM_013401		61674931	61674931	-1	no_errors	ENST00000394836	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	G
RBBP7	5931	genome.wustl.edu	37	X	16863950	16863950	+	Splice_Site	SNP	C	C	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:16863950C>A	ENST00000380087.2	-	11	1570		c.e11+1		RBBP7_ENST00000404022.1_Splice_Site|RBBP7_ENST00000380084.4_Splice_Site			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7						cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					TTTTAACTCACCATTTGCCAT	0.358																																						dbGAP											0													72.0	64.0	67.0					X																	16863950		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.1209+1G>T	X.37:g.16863950C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JP00	Splice_Site	SNP	-	e11+1	ENST00000380087.2	37	c.1209+1	CCDS14179.1	X	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097269	0.76870	.	.	ENSG00000102054	ENST00000425696;ENST00000380087;ENST00000380084;ENST00000404022	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6929	0.85326	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RBBP7	16773871	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.718000	0.84743	2.231000	0.72958	0.600000	0.82982	.	RBBP7	-	-	ENSG00000102054		0.358	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP7	HGNC	protein_coding	OTTHUMT00000055920.2	54	0.00	0	C	NM_002893	Intron	16863950	16863950	-1	no_errors	ENST00000380087	ensembl	human	known	69_37n	splice_site	40	25.93	14	SNP	1.000	A
SIX4	51804	genome.wustl.edu	37	14	61180171	61180171	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr14:61180171G>A	ENST00000216513.4	-	3	2359	c.2300C>T	c.(2299-2301)gCc>gTc	p.A767V		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	767					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		CTGGAGCTTGGCAAGCTCTTT	0.418																																						dbGAP											0													109.0	101.0	104.0					14																	61180171		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.2300C>T	14.37:g.61180171G>A	ENSP00000216513:p.Ala767Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QQH5|Q4V764	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.A767V	ENST00000216513.4	37	c.2300	CCDS9749.2	14	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385989	0.82902	.	.	ENSG00000100625	ENST00000216513;ENST00000554079	D;T	0.95238	-3.65;0.03	5.63	5.63	0.86233	.	0.065388	0.64402	D	0.000009	D	0.94434	0.8209	N	0.19112	0.55	0.80722	D	1	D	0.67145	0.996	P	0.61070	0.883	D	0.95225	0.8337	10	0.87932	D	0	.	20.0396	0.97574	0.0:0.0:1.0:0.0	.	767	Q9UIU6	SIX4_HUMAN	V	767;440	ENSP00000216513:A767V;ENSP00000451537:A440V	ENSP00000216513:A767V	A	-	2	0	SIX4	60249924	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.123000	0.94387	2.814000	0.96858	0.563000	0.77884	GCC	SIX4	-	NULL	ENSG00000100625		0.418	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX4	HGNC	protein_coding	OTTHUMT00000072397.2	58	0.00	0	G			61180171	61180171	-1	no_errors	ENST00000216513	ensembl	human	known	69_37n	missense	38	22.45	11	SNP	1.000	A
SLC24A4	123041	genome.wustl.edu	37	14	92909751	92909751	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr14:92909751G>A	ENST00000532405.1	+	7	816	c.590G>A	c.(589-591)cGt>cAt	p.R197H	SLC24A4_ENST00000298877.1_Missense_Mutation_p.R180H|SLC24A4_ENST00000351924.5_Missense_Mutation_p.R180H|SLC24A4_ENST00000531433.1_Missense_Mutation_p.R197H|SLC24A4_ENST00000393265.2_Missense_Mutation_p.R133H			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	197					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CAGGTGGTCCGTCTGACGTGG	0.657																																					NSCLC(10;315 435 10383 28450 38798)	dbGAP											0													149.0	106.0	120.0					14																	92909751		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.590G>A	14.37:g.92909751G>A	ENSP00000431840:p.Arg197His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.R197H	ENST00000532405.1	37	c.590	CCDS9903.2	14	.	.	.	.	.	.	.	.	.	.	G	6.791	0.514922	0.12944	.	.	ENSG00000140090	ENST00000393265;ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	4.89	1.46	0.22682	Sodium/calcium exchanger membrane region (1);	0.573016	0.19313	N	0.117344	T	0.38214	0.1032	N	0.12611	0.24	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.10450	0.002;0.002;0.005	T	0.18681	-1.0329	10	0.28530	T	0.3	.	7.6125	0.28139	0.175:0.1392:0.6858:0.0	.	197;133;197	Q8NFF2-3;Q8NFF2-2;Q8NFF2	.;.;NCKX4_HUMAN	H	133;197;197;180;180	ENSP00000376948:R133H;ENSP00000433302:R197H;ENSP00000431840:R197H;ENSP00000298877:R180H;ENSP00000337789:R180H	ENSP00000298877:R180H	R	+	2	0	SLC24A4	91979504	0.837000	0.29446	0.110000	0.21437	0.929000	0.56500	1.395000	0.34520	0.459000	0.27016	0.462000	0.41574	CGT	SLC24A4	-	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	ENSG00000140090		0.657	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	HGNC	protein_coding	OTTHUMT00000395240.1	33	0.00	0	G	NM_153646		92909751	92909751	+1	no_errors	ENST00000532405	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	0.001	A
SLC35E2	9906	genome.wustl.edu	37	1	1666251	1666251	+	Missense_Mutation	SNP	G	G	A	rs77655487		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:1666251G>A	ENST00000246421.4	-	5	1025	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	SLC35E2_ENST00000355439.2_Missense_Mutation_p.R204W|RP1-283E3.8_ENST00000598846.1_RNA|SLC35E2_ENST00000400924.1_Missense_Mutation_p.R204W|RP1-283E3.4_ENST00000417099.1_RNA|SLC35E2_ENST00000475229.1_5'UTR	NM_182838.2	NP_878258.1	P0CK97	S35E2_HUMAN	solute carrier family 35, member E2	204				R -> W (in Ref. 3; BC062371). {ECO:0000305}.		integral component of membrane (GO:0016021)				endometrium(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGCTCTTCCCGCTCCTCCCGA	0.547																																						dbGAP											0													137.0	75.0	96.0					1																	1666251		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB007916	CCDS33.1, CCDS55560.1	1p36.33	2013-05-22			ENSG00000215790	ENSG00000215790		"""Solute carriers"""	20863	protein-coding gene	gene with protein product							Standard	NM_182838		Approved	KIAA0447	uc001aia.2	P0CK97	OTTHUMG00000000823	ENST00000246421.4:c.610C>T	1.37:g.1666251G>A	ENSP00000246421:p.Arg204Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWR0|O75035|Q2TAY8|Q569F8|Q5CZA4|Q5QPR8|Q9Y3J8	Missense_Mutation	SNP	pfam_DMT	p.R204W	ENST00000246421.4	37	c.610	CCDS33.1	1	.	.	.	.	.	.	.	.	.	.	g	6.785	0.513782	0.12944	.	.	ENSG00000215790	ENST00000355439;ENST00000400924;ENST00000246421	.	.	.	3.0	-6.01	0.02199	.	0.147280	0.46145	U	0.000310	T	0.22244	0.0536	N	0.04880	-0.145	0.43377	P	0.0045239999999999725	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.01617	-1.1311	8	0.59425	D	0.04	.	13.6186	0.62123	0.8574:0.0:0.1426:0.0	.	204;204	P0CK97;P0CK97-2	S35E2_HUMAN;.	W	204	.	ENSP00000246421:R204W	R	-	1	2	SLC35E2	1656111	0.206000	0.23470	0.529000	0.27951	0.213000	0.24496	-0.354000	0.07681	-1.496000	0.01828	-0.465000	0.05216	CGG	SLC35E2	-	NULL	ENSG00000215790		0.547	SLC35E2-001	KNOWN	basic|CCDS	protein_coding	SLC35E2	HGNC	protein_coding	OTTHUMT00000002210.3	19	0.00	0	G	XM_049733		1666251	1666251	-1	no_errors	ENST00000246421	ensembl	human	known	69_37n	missense	5	61.54	8	SNP	0.979	A
SLC9A8	23315	genome.wustl.edu	37	20	48479578	48479578	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr20:48479578A>T	ENST00000361573.2	+	9	868	c.826A>T	c.(826-828)Act>Tct	p.T276S	SLC9A8_ENST00000539601.1_Missense_Mutation_p.T57S|SLC9A8_ENST00000541138.1_Intron|SLC9A8_ENST00000417961.1_Missense_Mutation_p.T292S			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	276					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			AGCGCTCGGCACTCTCACTGG	0.388																																						dbGAP											0													88.0	84.0	85.0					20																	48479578		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.826A>T	20.37:g.48479578A>T	ENSP00000354966:p.Thr276Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.T292S	ENST00000361573.2	37	c.874	CCDS13421.1	20	.	.	.	.	.	.	.	.	.	.	A	16.70	3.195653	0.58126	.	.	ENSG00000197818	ENST00000417961;ENST00000361573;ENST00000539601	T;T;T	0.15139	2.45;2.45;2.45	5.52	5.52	0.82312	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.14141	0.0342	N	0.20401	0.57	0.80722	D	1	B	0.19445	0.036	B	0.25759	0.063	T	0.05784	-1.0864	10	0.44086	T	0.13	.	15.646	0.77049	1.0:0.0:0.0:0.0	.	276	Q9Y2E8	SL9A8_HUMAN	S	292;276;57	ENSP00000416418:T292S;ENSP00000354966:T276S;ENSP00000441716:T57S	ENSP00000354966:T276S	T	+	1	0	SLC9A8	47912985	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	8.744000	0.91596	2.077000	0.62373	0.533000	0.62120	ACT	SLC9A8	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000197818		0.388	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	HGNC	protein_coding	OTTHUMT00000106483.3	63	0.00	0	A	XM_030524		48479578	48479578	+1	no_errors	ENST00000417961	ensembl	human	known	69_37n	missense	81	10.99	10	SNP	1.000	T
SLFN11	91607	genome.wustl.edu	37	17	33679925	33679925	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:33679925G>C	ENST00000394566.1	-	7	2428	c.2156C>G	c.(2155-2157)tCa>tGa	p.S719*	SLFN11_ENST00000308377.4_Nonsense_Mutation_p.S719*	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	719					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATATTGGTCTGAGAGAGGAGG	0.453																																						dbGAP											0													125.0	129.0	128.0					17																	33679925		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2156C>G	17.37:g.33679925G>C	ENSP00000378067:p.Ser719*	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P643|Q8N3S8|Q8N762|Q8TEE0	Nonsense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.S719*	ENST00000394566.1	37	c.2156	CCDS11294.1	17	.	.	.	.	.	.	.	.	.	.	g	36	5.940874	0.97128	.	.	ENSG00000172716	ENST00000308377;ENST00000394566	.	.	.	4.0	-2.59	0.06209	.	3.567570	0.00649	N	0.000542	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	3.7544	0.08579	0.1996:0.0:0.3211:0.4793	.	.	.	.	X	719	.	ENSP00000312402:S719X	S	-	2	0	SLFN11	30704038	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.915000	0.04033	-0.178000	0.10672	0.655000	0.94253	TCA	SLFN11	-	NULL	ENSG00000172716		0.453	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN11	HGNC	protein_coding	OTTHUMT00000256480.1	45	0.00	0	G	NM_152270		33679925	33679925	-1	no_errors	ENST00000308377	ensembl	human	known	69_37n	nonsense	34	26.09	12	SNP	0.000	C
SMC3	9126	genome.wustl.edu	37	10	112362317	112362317	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr10:112362317G>A	ENST00000361804.4	+	26	3317	c.3191G>A	c.(3190-3192)gGc>gAc	p.G1064D		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	1064					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GATGTGGAGGGCAGTCAGTCT	0.458																																						dbGAP											0													97.0	90.0	93.0					10																	112362317		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.3191G>A	10.37:g.112362317G>A	ENSP00000354720:p.Gly1064Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K156|O60464|Q5T482	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	p.G1064D	ENST00000361804.4	37	c.3191	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	G	9.917	1.211141	0.22289	.	.	ENSG00000108055	ENST00000361804	T	0.75589	-0.95	5.62	5.62	0.85841	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.46814	0.1412	N	0.01048	-1.04	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.53913	-0.8371	10	0.07482	T	0.82	.	19.6696	0.95907	0.0:0.0:1.0:0.0	.	1064	Q9UQE7	SMC3_HUMAN	D	1064	ENSP00000354720:G1064D	ENSP00000354720:G1064D	G	+	2	0	SMC3	112352307	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.459000	0.97638	2.665000	0.90641	0.585000	0.79938	GGC	SMC3	-	pfam_RecF/RecN/SMC	ENSG00000108055		0.458	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	HGNC	protein_coding	OTTHUMT00000050337.1	63	0.00	0	G	NM_005445		112362317	112362317	+1	no_errors	ENST00000361804	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	A
SS18	6760	genome.wustl.edu	37	18	23658072	23658072	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr18:23658072A>T	ENST00000415083.2	-	3	254	c.199T>A	c.(199-201)Tct>Act	p.S67T	SS18_ENST00000539849.1_Intron|SS18_ENST00000269137.7_Missense_Mutation_p.S67T|SS18_ENST00000545952.1_Missense_Mutation_p.S15T|SS18_ENST00000585241.1_5'UTR|SS18_ENST00000542743.1_Missense_Mutation_p.S15T|SS18_ENST00000542420.2_Missense_Mutation_p.S44T	NM_001007559.1|NM_005637.2	NP_001007560.1|NP_005628.2	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	67	Transcriptional activation.				cell morphogenesis (GO:0000902)|ephrin receptor signaling pathway (GO:0048013)|intracellular signal transduction (GO:0035556)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)		SS18/SSX2(706)|SS18/SSX1(1169)|SS18/SSX4(12)	endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(1)	19	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					TTTTGATTAGAATCTGCTATT	0.299			T	"""SSX1,  SSX2"""	synovial sarcoma																																	dbGAP		Dom	yes		18	18q11.2	6760	"""synovial sarcoma translocation, chromosome 18"""		M	0													133.0	127.0	129.0					18																	23658072		2203	4297	6500	-	-	-	SO:0001583	missense	0			X79201	CCDS32807.1, CCDS54183.1	18q11.2	2008-07-28				ENSG00000141380			11340	protein-coding gene	gene with protein product		600192		SSXT		8152806, 7951320, 16484776	Standard	XM_005258334		Approved	SYT	uc002kvm.3	Q15532		ENST00000415083.2:c.199T>A	18.37:g.23658072A>T	ENSP00000414516:p.Ser67Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ95|Q16404|Q4VAX1|Q9BXC6	Missense_Mutation	SNP	pfam_SSXT	p.S67T	ENST00000415083.2	37	c.199	CCDS32807.1	18	.	.	.	.	.	.	.	.	.	.	A	16.36	3.101288	0.56183	.	.	ENSG00000141380	ENST00000415083;ENST00000269138;ENST00000269137;ENST00000542420;ENST00000542743;ENST00000545952	T;T;T;T	0.48201	1.36;1.36;0.82;0.82	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.65417	0.2689	M	0.61703	1.905	0.80722	D	1	D;D;D	0.67145	0.979;0.979;0.996	D;D;D	0.77557	0.973;0.982;0.99	T	0.64521	-0.6388	10	0.40728	T	0.16	-9.2489	15.0533	0.71891	1.0:0.0:0.0:0.0	.	15;67;67	B4E2J6;Q4VAX0;Q15532	.;.;SSXT_HUMAN	T	70;67;67;44;15;15	ENSP00000269137:S67T;ENSP00000438066:S44T;ENSP00000444551:S15T;ENSP00000443097:S15T	ENSP00000269137:S67T	S	-	1	0	SS18	21912070	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.526000	0.90588	2.194000	0.70268	0.533000	0.62120	TCT	SS18	-	pfam_SSXT	ENSG00000141380		0.299	SS18-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SS18	HGNC	protein_coding	OTTHUMT00000446226.1	104	0.00	0	A			23658072	23658072	-1	no_errors	ENST00000415083	ensembl	human	known	69_37n	missense	42	34.38	22	SNP	1.000	T
TAB3	257397	genome.wustl.edu	37	X	30873374	30873374	+	Silent	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:30873374G>A	ENST00000378933.1	-	3	585	c.408C>T	c.(406-408)aaC>aaT	p.N136N	TAB3_ENST00000378928.1_5'Flank|TAB3_ENST00000378932.2_Silent_p.N136N|TAB3_ENST00000288422.2_Silent_p.N136N|TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378930.3_Silent_p.N136N	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	136					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						ATGGATTGTAGTTGGGAGTAG	0.448																																					Pancreas(164;1598 1985 29022 43301 49529)	dbGAP											0													174.0	126.0	142.0					X																	30873374		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.408C>T	X.37:g.30873374G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDD9|Q6VQR0	Silent	SNP	pfam_CUE,pfam_Znf_RanBP2,superfamily_UBA-like,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.N136	ENST00000378933.1	37	c.408	CCDS14226.1	X																																																																																			TAB3	-	NULL	ENSG00000157625		0.448	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB3	HGNC	protein_coding	OTTHUMT00000056173.1	51	0.00	0	G	NM_152787		30873374	30873374	-1	no_errors	ENST00000288422	ensembl	human	known	69_37n	silent	48	26.15	17	SNP	0.999	A
TACC3	10460	genome.wustl.edu	37	4	1742588	1742588	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr4:1742588G>T	ENST00000313288.4	+	13	2204	c.2098G>T	c.(2098-2100)Gaa>Taa	p.E700*		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	700					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TTCCAAAGCTGAAATCCAGAA	0.438																																					Ovarian(120;482 2294 11894 35824)	dbGAP											0													77.0	78.0	78.0					4																	1742588		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.2098G>T	4.37:g.1742588G>T	ENSP00000326550:p.Glu700*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK4|Q3KQS5|Q9UMQ1	Nonsense_Mutation	SNP	pfam_TACC	p.E700*	ENST00000313288.4	37	c.2098	CCDS3352.1	4	.	.	.	.	.	.	.	.	.	.	G	38	6.922280	0.97936	.	.	ENSG00000013810	ENST00000313288	.	.	.	4.85	0.0212	0.14128	.	0.481373	0.18054	N	0.153182	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-6.8563	8.8321	0.35091	0.4167:0.0:0.5833:0.0	.	.	.	.	X	700	.	ENSP00000326550:E700X	E	+	1	0	TACC3	1712386	0.904000	0.30761	0.000000	0.03702	0.635000	0.38103	2.158000	0.42329	0.041000	0.15688	0.650000	0.86243	GAA	TACC3	-	pfam_TACC	ENSG00000013810		0.438	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACC3	HGNC	protein_coding	OTTHUMT00000203730.2	26	0.00	0	G			1742588	1742588	+1	no_errors	ENST00000313288	ensembl	human	known	69_37n	nonsense	16	27.27	6	SNP	0.000	T
TAOK1	57551	genome.wustl.edu	37	17	27778590	27778590	+	Silent	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:27778590C>T	ENST00000261716.3	+	2	543	c.24C>T	c.(22-24)ggC>ggT	p.G8G	TAOK1_ENST00000536202.1_Silent_p.G8G	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	8					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			ACAGAGCAGGCAGCCTGAAGG	0.453																																						dbGAP											0													70.0	69.0	69.0					17																	27778590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.24C>T	17.37:g.27778590C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G8	ENST00000261716.3	37	c.24	CCDS32601.1	17																																																																																			TAOK1	-	NULL	ENSG00000160551		0.453	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	HGNC	protein_coding	OTTHUMT00000447790.1	29	0.00	0	C	NM_020791		27778590	27778590	+1	no_errors	ENST00000261716	ensembl	human	known	69_37n	silent	29	17.14	6	SNP	1.000	T
TBC1D4	9882	genome.wustl.edu	37	13	75900540	75900540	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr13:75900540G>A	ENST00000377636.3	-	10	2172	c.1826C>T	c.(1825-1827)tCt>tTt	p.S609F	TBC1D4_ENST00000377625.2_Missense_Mutation_p.S609F|TBC1D4_ENST00000431480.2_Missense_Mutation_p.S609F|TBC1D4_ENST00000425511.1_5'UTR	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	609					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		CCCTGGTGGAGAATCCCCTGG	0.577																																						dbGAP											0													66.0	70.0	69.0					13																	75900540		2009	4170	6179	-	-	-	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1826C>T	13.37:g.75900540G>A	ENSP00000366863:p.Ser609Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.S609F	ENST00000377636.3	37	c.1826	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	G	17.41	3.381719	0.61845	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000413735	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.39	4.53	0.55603	.	0.178358	0.39759	N	0.001274	T	0.44244	0.1284	L	0.33485	1.01	0.80722	D	1	B;B;B	0.22909	0.077;0.019;0.024	B;B;B	0.21708	0.036;0.033;0.02	T	0.41106	-0.9527	10	0.66056	D	0.02	-8.0839	14.7801	0.69760	0.0709:0.0:0.9291:0.0	.	609;609;609	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	F	609;609;609;121	ENSP00000366863:S609F;ENSP00000395986:S609F;ENSP00000366852:S609F;ENSP00000396932:S121F	ENSP00000366852:S609F	S	-	2	0	TBC1D4	74798541	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	7.168000	0.77570	1.370000	0.46153	0.591000	0.81541	TCT	TBC1D4	-	NULL	ENSG00000136111		0.577	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	42	0.00	0	G	NM_014832		75900540	75900540	-1	no_errors	ENST00000377636	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	A
TBC1D8	11138	genome.wustl.edu	37	2	101638182	101638182	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr2:101638182C>G	ENST00000376840.4	-	17	2742	c.2743G>C	c.(2743-2745)Gag>Cag	p.E915Q	TBC1D8_ENST00000409318.1_Missense_Mutation_p.E930Q			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	915					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TTAATCTTCTCATTCATTTCT	0.373																																						dbGAP											0													87.0	82.0	84.0					2																	101638182		1851	4092	5943	-	-	-	SO:0001583	missense	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.2743G>C	2.37:g.101638182C>G	ENSP00000366036:p.Glu915Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E930Q	ENST00000376840.4	37	c.2788	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117663	0.56505	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.53423	0.62;0.62	5.74	5.74	0.90152	EF-hand-like domain (1);	0.000000	0.64402	D	0.000010	T	0.44603	0.1301	L	0.42744	1.35	0.51012	D	0.999904	P	0.42785	0.79	B	0.38327	0.271	T	0.39860	-0.9593	10	0.45353	T	0.12	-39.2797	19.9317	0.97122	0.0:1.0:0.0:0.0	.	915	O95759	TBCD8_HUMAN	Q	915;930	ENSP00000366036:E915Q;ENSP00000386856:E930Q	ENSP00000366036:E915Q	E	-	1	0	TBC1D8	101004614	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.391000	0.66266	2.716000	0.92895	0.591000	0.81541	GAG	TBC1D8	-	NULL	ENSG00000204634		0.373	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	HGNC	protein_coding	OTTHUMT00000376092.1	64	0.00	0	C	NM_007063		101638182	101638182	-1	no_errors	ENST00000409318	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	1.000	G
TBX22	50945	genome.wustl.edu	37	X	79279656	79279656	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:79279656C>T	ENST00000373294.5	+	3	479	c.451C>T	c.(451-453)Cgc>Tgc	p.R151C	TBX22_ENST00000373291.1_Missense_Mutation_p.R31C|TBX22_ENST00000373296.3_Missense_Mutation_p.R151C|TBX22_ENST00000442340.1_Missense_Mutation_p.R31C	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	151					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						GGATTCCAAACGCTATAGGTA	0.527																																						dbGAP											0													151.0	117.0	129.0					X																	79279656		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.451C>T	X.37:g.79279656C>T	ENSP00000362390:p.Arg151Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.R151C	ENST00000373294.5	37	c.451	CCDS14445.1	X	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632670	0.47049	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.92495	-3.05;-3.05;-3.05;-3.05	4.71	3.74	0.42951	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96642	0.8904	H	0.94658	3.565	0.58432	D	0.999999	D	0.89917	1.0	D	0.69824	0.966	D	0.97146	0.9828	10	0.87932	D	0	.	11.8576	0.52446	0.2724:0.7276:0.0:0.0	.	151	Q9Y458	TBX22_HUMAN	C	151;31;151;31	ENSP00000362393:R151C;ENSP00000396394:R31C;ENSP00000362390:R151C;ENSP00000362388:R31C	ENSP00000362388:R31C	R	+	1	0	TBX22	79166312	0.995000	0.38212	1.000000	0.80357	0.441000	0.31987	0.907000	0.28531	1.922000	0.55676	0.594000	0.82650	CGC	TBX22	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000122145		0.527	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	66	0.00	0	C	NM_016954		79279656	79279656	+1	no_errors	ENST00000373294	ensembl	human	known	69_37n	missense	47	27.69	18	SNP	1.000	T
TCP10	6953	genome.wustl.edu	37	6	167796310	167796310	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr6:167796310C>T	ENST00000397829.4	-	2	219	c.52G>A	c.(52-54)Ggg>Agg	p.G18R	TCP10_ENST00000366827.2_Missense_Mutation_p.G18R|TCP10_ENST00000476779.2_Missense_Mutation_p.G18R	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	45						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GGCATCTCCCCGGCATTGCTG	0.642																																						dbGAP											0													29.0	38.0	35.0					6																	167796310		2161	4280	6441	-	-	-	SO:0001583	missense	0			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.52G>A	6.37:g.167796310C>T	ENSP00000380929:p.Gly18Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.G18R	ENST00000397829.4	37	c.52	CCDS43527.1	6	.	.	.	.	.	.	.	.	.	.	c	4.909	0.168831	0.09339	.	.	ENSG00000203690	ENST00000366827;ENST00000397829;ENST00000476779;ENST00000485157	T;T;T;T	0.34275	2.11;2.11;1.37;1.37	2.02	-4.04	0.04010	.	.	.	.	.	T	0.10165	0.0249	L	0.51422	1.61	0.09310	N	1	B;B	0.15719	0.006;0.014	B;B	0.12156	0.007;0.004	T	0.19811	-1.0294	9	0.49607	T	0.09	.	5.3854	0.16215	0.0:0.2708:0.1569:0.5723	.	45;45	Q12799;Q12799-2	TCP10_HUMAN;.	R	18	ENSP00000355792:G18R;ENSP00000380929:G18R;ENSP00000427675:G18R;ENSP00000423829:G18R	ENSP00000355792:G18R	G	-	1	0	TCP10	167716300	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-3.516000	0.00445	-2.218000	0.00730	-2.146000	0.00336	GGG	TCP10	-	NULL	ENSG00000203690		0.642	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	34	0.00	0	C	NM_004610		167796310	167796310	-1	no_errors	ENST00000397829	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.000	T
TLN1	7094	genome.wustl.edu	37	9	35713277	35713277	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr9:35713277C>T	ENST00000314888.9	-	26	3621	c.3268G>A	c.(3268-3270)Gac>Aac	p.D1090N	TLN1_ENST00000540444.1_Missense_Mutation_p.D1090N	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1090					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTGCCCAGGTCCTGGGTACAC	0.547																																						dbGAP											0													50.0	43.0	46.0					9																	35713277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.3268G>A	9.37:g.35713277C>T	ENSP00000316029:p.Asp1090Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.D1090N	ENST00000314888.9	37	c.3268	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546464	0.86022	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.15139	2.45;2.45	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.22399	0.0540	L	0.55834	1.745	0.80722	D	1	B	0.20780	0.048	B	0.19391	0.025	T	0.01874	-1.1256	10	0.33940	T	0.23	-25.4814	20.3214	0.98679	0.0:1.0:0.0:0.0	.	1090	Q9Y490	TLN1_HUMAN	N	1090	ENSP00000316029:D1090N;ENSP00000442981:D1090N	ENSP00000316029:D1090N	D	-	1	0	TLN1	35703277	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.804000	0.96469	0.655000	0.94253	GAC	TLN1	-	superfamily_Vinculin/catenin	ENSG00000137076		0.547	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	35	0.00	0	C	NM_006289		35713277	35713277	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	T
TMCO2	127391	genome.wustl.edu	37	1	40713810	40713810	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:40713810C>G	ENST00000372766.3	+	1	238	c.145C>G	c.(145-147)Cca>Gca	p.P49A	TMCO2_ENST00000468258.1_Intron	NM_001008740.3	NP_001008740.1	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	49						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)	6	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			TAATCTTGCTCCAGCTGTGCA	0.378																																						dbGAP											0													178.0	180.0	180.0					1																	40713810		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL050341	CCDS30684.1	1p34.2	2014-02-12			ENSG00000188800	ENSG00000188800			23312	protein-coding gene	gene with protein product							Standard	NM_001008740		Approved	dJ39G22.2	uc001cfe.2	Q7Z6W1	OTTHUMG00000005764	ENST00000372766.3:c.145C>G	1.37:g.40713810C>G	ENSP00000361852:p.Pro49Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P49A	ENST00000372766.3	37	c.145	CCDS30684.1	1	.	.	.	.	.	.	.	.	.	.	C	7.851	0.724062	0.15439	.	.	ENSG00000188800	ENST00000372766	.	.	.	5.34	4.41	0.53225	.	0.000000	0.49916	D	0.000136	T	0.41259	0.1151	L	0.29908	0.895	0.31962	N	0.608231	D	0.60160	0.987	P	0.53518	0.728	T	0.48115	-0.9063	9	0.31617	T	0.26	-10.0752	11.8116	0.52185	0.0:0.8239:0.1761:0.0	.	49	Q7Z6W1	TMCO2_HUMAN	A	49	.	ENSP00000361852:P49A	P	+	1	0	TMCO2	40486397	0.995000	0.38212	0.989000	0.46669	0.023000	0.10783	1.990000	0.40717	1.467000	0.48044	0.650000	0.86243	CCA	TMCO2	-	NULL	ENSG00000188800		0.378	TMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO2	HGNC	protein_coding	OTTHUMT00000015769.1	59	0.00	0	C	NM_001008740		40713810	40713810	+1	no_errors	ENST00000372766	ensembl	human	known	69_37n	missense	55	17.91	12	SNP	0.997	G
TMPRSS6	164656	genome.wustl.edu	37	22	37492106	37492106	+	Silent	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr22:37492106G>A	ENST00000346753.3	-	5	572	c.456C>T	c.(454-456)ttC>ttT	p.F152F	TMPRSS6_ENST00000381792.2_Silent_p.F143F|TMPRSS6_ENST00000442782.2_Silent_p.F152F|TMPRSS6_ENST00000406856.1_Silent_p.F143F|TMPRSS6_ENST00000406725.1_Silent_p.F143F	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	152	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GAATGAACCAGAAGAAGCAGG	0.617																																						dbGAP											0													45.0	49.0	48.0					22																	37492106		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.456C>T	22.37:g.37492106G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	pirsf_Pept_S1A_matriptase-2,pfam_Peptidase_S1_S6,pfam_LDrepeatLR_classA_rpt,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6	p.F143	ENST00000346753.3	37	c.429	CCDS13941.1	22																																																																																			TMPRSS6	-	pirsf_Pept_S1A_matriptase-2,pfam_SEA	ENSG00000187045		0.617	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	TMPRSS6	HGNC	protein_coding	OTTHUMT00000318822.1	17	0.00	0	G	NM_153609		37492106	37492106	-1	no_errors	ENST00000381792	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578408	7578408	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:7578408delC	ENST00000269305.4	-	5	711	c.522delG	c.(520-522)aggfs	p.R175fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.R175fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.R175fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.R175fs|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Frame_Shift_Del_p.R175fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.R175fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R174fs*24(3)|p.R174S(2)|p.V173fs*59(2)|p.R174R(2)|p.R174fs*73(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175fs*5(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.S149fs*72(1)|p.R174_E180>K(1)|p.R175_E180delRCPHHE(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGGCAGCGCCTCACAACCT	0.657		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	42	Deletion - Frameshift(20)|Whole gene deletion(8)|Deletion - In frame(7)|Complex - deletion inframe(2)|Substitution - Missense(2)|Substitution - coding silent(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(9)|breast(6)|haematopoietic_and_lymphoid_tissue(5)|oesophagus(5)|large_intestine(4)|bone(4)|central_nervous_system(2)|lung(2)|liver(2)|stomach(1)|skin(1)|ovary(1)											50.0	50.0	50.0					17																	7578408		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.522delG	17.37:g.7578408delC	ENSP00000269305:p.Arg175fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R174fs	ENST00000269305.4	37	c.522	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.657	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	34	0.00	0	C	NM_000546		7578408	7578408	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	18	21.74	5	DEL	0.992	-
TRIO	7204	genome.wustl.edu	37	5	14358362	14358362	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr5:14358362G>C	ENST00000344204.4	+	12	2146	c.2122G>C	c.(2122-2124)Gac>Cac	p.D708H	TRIO_ENST00000537187.1_Missense_Mutation_p.D708H|TRIO_ENST00000509967.2_Missense_Mutation_p.D659H	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	708					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GGCCGTGCAGGACCTCATCAA	0.637																																						dbGAP											0													117.0	93.0	102.0					5																	14358362		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2122G>C	5.37:g.14358362G>C	ENSP00000339299:p.Asp708His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.D708H	ENST00000344204.4	37	c.2122	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640082	0.67244	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.46451	0.93;0.93;0.87	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.43433	0.1247	N	0.14661	0.345	0.80722	D	1	P;P;P	0.51147	0.831;0.942;0.7	P;P;B	0.55824	0.694;0.785;0.264	T	0.49835	-0.8897	10	0.52906	T	0.07	.	17.7922	0.88555	0.0:0.0:1.0:0.0	.	659;708;708	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	H	708;708;659;395	ENSP00000339299:D708H;ENSP00000446348:D708H;ENSP00000445592:D659H	ENSP00000339299:D708H	D	+	1	0	TRIO	14411362	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.782000	0.99034	2.273000	0.75805	0.484000	0.47621	GAC	TRIO	-	smart_Spectrin/alpha-actinin	ENSG00000038382		0.637	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	24	0.00	0	G	NM_007118		14358362	14358362	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	C
TRIM23	373	genome.wustl.edu	37	5	64905155	64905155	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr5:64905155C>A	ENST00000231524.9	-	6	1330	c.959G>T	c.(958-960)tGg>tTg	p.W320L	TRIM23_ENST00000274327.7_Missense_Mutation_p.W320L|TRIM23_ENST00000381018.3_Missense_Mutation_p.W320L|TRIM23_ENST00000508808.1_5'UTR	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	320					GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CTGCCTGAGCCAAATCAATTT	0.393																																						dbGAP											0													122.0	112.0	115.0					5																	64905155		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.959G>T	5.37:g.64905155C>A	ENSP00000231524:p.Trp320Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZY4|Q9BZY5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_Znf_C2H2,tigrfam_Small_GTP-bd_dom	p.W320L	ENST00000231524.9	37	c.959	CCDS3987.1	5	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561947	0.65538	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	T;T;T	0.71934	-0.55;-0.53;-0.61	5.3	5.3	0.74995	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64972	0.2647	L	0.36672	1.1	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.60414	-0.7268	10	0.52906	T	0.07	.	19.3124	0.94195	0.0:1.0:0.0:0.0	.	320;320;320	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	L	320	ENSP00000231524:W320L;ENSP00000370406:W320L;ENSP00000274327:W320L	ENSP00000231524:W320L	W	-	2	0	TRIM23	64940911	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.445000	0.80570	2.650000	0.89964	0.655000	0.94253	TGG	TRIM23	-	smart_Bbox_C	ENSG00000113595		0.393	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM23	HGNC	protein_coding	OTTHUMT00000215058.2	63	0.00	0	C	NM_001656		64905155	64905155	-1	no_errors	ENST00000231524	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	1.000	A
TTC37	9652	genome.wustl.edu	37	5	94852114	94852114	+	Splice_Site	SNP	C	C	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr5:94852114C>A	ENST00000358746.2	-	25	2876		c.e25-1		TTC37_ENST00000515176.1_5'Flank	NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37							cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						CAACAGCATTCTAAAAAACAT	0.303																																						dbGAP											0													40.0	44.0	43.0					5																	94852114		2201	4294	6495	-	-	-	SO:0001630	splice_region_variant	0			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.2578-1G>T	5.37:g.94852114C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15077|Q6PJI3	Splice_Site	SNP	-	e22-1	ENST00000358746.2	37	c.2578-1	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935285	0.52866	.	.	ENSG00000198677	ENST00000358746	.	.	.	5.01	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1463	0.72653	0.1423:0.8577:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTC37	94877870	1.000000	0.71417	0.999000	0.59377	0.911000	0.54048	5.242000	0.65389	1.224000	0.43551	0.467000	0.42956	.	TTC37	-	-	ENSG00000198677		0.303	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	HGNC	protein_coding	OTTHUMT00000241651.1	39	0.00	0	C	NM_014639	Intron	94852114	94852114	-1	no_errors	ENST00000358746	ensembl	human	known	69_37n	splice_site	29	25.64	10	SNP	1.000	A
UHRF1BP1	54887	genome.wustl.edu	37	6	34803151	34803151	+	Silent	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr6:34803151C>T	ENST00000192788.5	+	7	921	c.750C>T	c.(748-750)ctC>ctT	p.L250L	UHRF1BP1_ENST00000452449.2_Silent_p.L250L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	250							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						ACTCACAGCTCAAGGCTATGA	0.498																																						dbGAP											0													122.0	123.0	123.0					6																	34803151		2091	4224	6315	-	-	-	SO:0001819	synonymous_variant	0			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.750C>T	6.37:g.34803151C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NXE0	Silent	SNP	NULL	p.L250	ENST00000192788.5	37	c.750	CCDS43455.1	6																																																																																			UHRF1BP1	-	NULL	ENSG00000065060		0.498	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	43	0.00	0	C	NM_017754		34803151	34803151	+1	no_errors	ENST00000192788	ensembl	human	known	69_37n	silent	48	14.29	8	SNP	1.000	T
USP33	23032	genome.wustl.edu	37	1	78205076	78205076	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr1:78205076G>T	ENST00000370793.1	-	6	664	c.318C>A	c.(316-318)aaC>aaA	p.N106K	USP33_ENST00000370792.3_Missense_Mutation_p.N106K|USP33_ENST00000528150.1_5'UTR|USP33_ENST00000357428.1_Missense_Mutation_p.N106K|USP33_ENST00000370794.3_Missense_Mutation_p.N75K	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	106					axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						GAGTGGTAAGGTTCACAGTTA	0.358																																					Melanoma(152;72 1870 11110 26780 42647)	dbGAP											0													148.0	138.0	142.0					1																	78205076		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.318C>A	1.37:g.78205076G>T	ENSP00000359829:p.Asn106Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.N106K	ENST00000370793.1	37	c.318	CCDS678.1	1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.594522	0.66219	.	.	ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792;ENST00000524536;ENST00000530709	T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02	5.15	1.11	0.20524	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (2);	1.227840	0.05528	N	0.563503	T	0.38214	0.1032	L	0.27053	0.805	0.53005	D	0.99996	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.37454	-0.9705	10	0.72032	D	0.01	.	9.6903	0.40125	0.426:0.0:0.574:0.0	.	106;106	Q8TEY7-3;Q8TEY7	.;UBP33_HUMAN	K	75;106;106;106;106;106	ENSP00000359830:N75K;ENSP00000359829:N106K;ENSP00000350009:N106K;ENSP00000359828:N106K;ENSP00000434441:N106K;ENSP00000433283:N106K	ENSP00000350009:N106K	N	-	3	2	USP33	77977664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.086000	0.30853	0.284000	0.22305	0.650000	0.86243	AAC	USP33	-	pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP	ENSG00000077254		0.358	USP33-002	KNOWN	basic|CCDS	protein_coding	USP33	HGNC	protein_coding	OTTHUMT00000026923.2	78	0.00	0	G	NM_015017		78205076	78205076	-1	no_errors	ENST00000357428	ensembl	human	known	69_37n	missense	58	15.94	11	SNP	0.996	T
USP51	158880	genome.wustl.edu	37	X	55513916	55513916	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chrX:55513916T>C	ENST00000500968.3	-	2	1539	c.1457A>G	c.(1456-1458)cAa>cGa	p.Q486R	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	486	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						TGTAAAGATTTGGTCTATGAT	0.463																																						dbGAP											0													145.0	103.0	117.0					X																	55513916		2203	4300	6503	-	-	-	SO:0001583	missense	0			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.1457A>G	X.37:g.55513916T>C	ENSP00000423333:p.Gln486Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWJ8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.Q486R	ENST00000500968.3	37	c.1457	CCDS14370.1	X	.	.	.	.	.	.	.	.	.	.	.	11.85	1.762262	0.31228	.	.	ENSG00000247746	ENST00000500968	T	0.02787	4.16	3.04	1.78	0.24846	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.189049	0.47455	U	0.000235	T	0.02418	0.0074	N	0.20401	0.57	0.49483	D	0.999794	B	0.27068	0.167	B	0.35114	0.196	T	0.56141	-0.8028	10	0.38643	T	0.18	.	6.0747	0.19909	0.2312:0.0:0.0:0.7688	.	486	Q70EK9	UBP51_HUMAN	R	486	ENSP00000423333:Q486R	ENSP00000423333:Q486R	Q	-	2	0	USP51	55530641	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.032000	0.64140	0.374000	0.24650	0.413000	0.27773	CAA	USP51	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000247746		0.463	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP51	HGNC	protein_coding	OTTHUMT00000056871.2	47	0.00	0	T	NM_201286		55513916	55513916	-1	no_errors	ENST00000500968	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	1.000	C
USP6NL	9712	genome.wustl.edu	37	10	11505403	11505403	+	Silent	SNP	A	A	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr10:11505403A>C	ENST00000609104.1	-	15	1918	c.1524T>G	c.(1522-1524)ggT>ggG	p.G508G	USP6NL_ENST00000379237.2_Silent_p.G531G|USP6NL_ENST00000277575.5_Silent_p.G525G	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	508					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						GCGCTGCTCGACCTTTGCCTT	0.562																																						dbGAP											0													158.0	158.0	158.0					10																	11505403		2044	4195	6239	-	-	-	SO:0001819	synonymous_variant	0			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1524T>G	10.37:g.11505403A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA79|Q15400|Q5VV10|Q7L0K9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.G525	ENST00000609104.1	37	c.1575	CCDS53492.1	10																																																																																			USP6NL	-	NULL	ENSG00000148429		0.562	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	HGNC	protein_coding	OTTHUMT00000046764.3	37	0.00	0	A	NM_014688		11505403	11505403	-1	no_errors	ENST00000277575	ensembl	human	known	69_37n	silent	48	14.29	8	SNP	0.000	C
VWCE	220001	genome.wustl.edu	37	11	61026260	61026260	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr11:61026260G>A	ENST00000335613.5	-	20	3141	c.2755C>T	c.(2755-2757)Cgc>Tgc	p.R919C	VWCE_ENST00000535710.1_Missense_Mutation_p.R384C	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	919						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R919C(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GAAAGCACGCGAGGCCCGAGG	0.667																																						dbGAP											1	Substitution - Missense(1)	lung(1)											58.0	65.0	63.0					11																	61026260		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2755C>T	11.37:g.61026260G>A	ENSP00000334186:p.Arg919Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.R919C	ENST00000335613.5	37	c.2755	CCDS8002.1	11	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925261	0.52759	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.70045	-0.45;3.4	4.81	2.78	0.32641	.	0.792777	0.10541	N	0.662673	T	0.61689	0.2367	L	0.58101	1.795	0.09310	N	1	D	0.63880	0.993	B	0.44315	0.446	T	0.55224	-0.8174	10	0.62326	D	0.03	.	5.3999	0.16291	0.1037:0.0:0.6979:0.1983	.	919	Q96DN2	VWCE_HUMAN	C	919;384	ENSP00000334186:R919C;ENSP00000442570:R384C	ENSP00000334186:R919C	R	-	1	0	VWCE	60782836	0.326000	0.24669	0.049000	0.19019	0.002000	0.02628	1.374000	0.34283	1.133000	0.42147	0.561000	0.74099	CGC	VWCE	-	NULL	ENSG00000167992		0.667	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	19	0.00	0	G	NM_152718		61026260	61026260	-1	no_errors	ENST00000335613	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	0.033	A
XKR7	343702	genome.wustl.edu	37	20	30585069	30585069	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr20:30585069C>T	ENST00000562532.2	+	3	1723	c.1549C>T	c.(1549-1551)Cgg>Tgg	p.R517W		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	517						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCGCACCTTGCGGACAGAGGG	0.667																																						dbGAP											0													38.0	44.0	42.0					20																	30585069		2199	4298	6497	-	-	-	SO:0001583	missense	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1549C>T	20.37:g.30585069C>T	ENSP00000477059:p.Arg517Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NUG5	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.R517W	ENST00000562532.2	37	c.1549	CCDS33459.1	20	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557452	0.65425	.	.	ENSG00000101321	ENST00000217299	.	.	.	4.85	4.85	0.62838	.	0.129548	0.51477	D	0.000090	T	0.76821	0.4041	M	0.67397	2.05	0.47905	D	0.999549	D	0.89917	1.0	D	0.72075	0.976	T	0.79482	-0.1785	9	0.87932	D	0	-0.6307	15.5085	0.75760	0.0:1.0:0.0:0.0	.	517	Q5GH72	XKR7_HUMAN	W	517	.	ENSP00000217299:R517W	R	+	1	2	XKR7	30048730	0.783000	0.28701	1.000000	0.80357	0.971000	0.66376	1.542000	0.36137	2.518000	0.84900	0.561000	0.74099	CGG	XKR7	-	NULL	ENSG00000101321		0.667	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3	13	0.00	0	C	NM_001011718		30585069	30585069	+1	no_errors	ENST00000217299	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	T
ZFYVE19	84936	genome.wustl.edu	37	15	41100005	41100005	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr15:41100005G>C	ENST00000355341.4	+	1	719	c.218G>C	c.(217-219)gGa>gCa	p.G73A	ZFYVE19_ENST00000299173.10_Missense_Mutation_p.G73A|ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000570108.1_Missense_Mutation_p.G50A|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000563530.1_3'UTR	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	73					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GCGGTGCTGGGAGCCACCATG	0.672																																						dbGAP											0													38.0	47.0	44.0					15																	41100005		2073	4204	6277	-	-	-	SO:0001583	missense	0			AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.218G>C	15.37:g.41100005G>C	ENSP00000347498:p.Gly73Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.G73A	ENST00000355341.4	37	c.218	CCDS42025.1	15	.	.	.	.	.	.	.	.	.	.	G	9.945	1.218438	0.22373	.	.	ENSG00000166140	ENST00000355341;ENST00000299173	T;T	0.35421	1.32;1.31	4.98	-1.8	0.07907	Zinc finger, FYVE-type (1);Zinc finger, FYVE/PHD-type (1);	.	.	.	.	T	0.14743	0.0356	N	0.14661	0.345	0.09310	N	1	B;B	0.13594	0.008;0.006	B;B	0.14023	0.006;0.01	T	0.33979	-0.9847	9	0.02654	T	1	0.6366	5.8726	0.18812	0.2541:0.4411:0.3048:0.0	.	73;73	Q96K21-3;Q96K21	.;ZFY19_HUMAN	A	73	ENSP00000347498:G73A;ENSP00000299173:G73A	ENSP00000299173:G73A	G	+	2	0	ZFYVE19	38887297	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.380000	0.20602	-0.098000	0.12285	-0.156000	0.13503	GGA	ZFYVE19	-	superfamily_Znf_FYVE_PHD,smart_Znf_FYVE	ENSG00000166140		0.672	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	HGNC	protein_coding	OTTHUMT00000418996.1	27	0.00	0	G	NM_032850		41100005	41100005	+1	no_errors	ENST00000355341	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.000	C
ZMYM5	9205	genome.wustl.edu	37	13	20398780	20398780	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr13:20398780G>A	ENST00000337963.4	-	8	2111	c.1847C>T	c.(1846-1848)tCa>tTa	p.S616L		NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	616						nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S616L(1)		kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		aagaatatgtgataaatgttg	0.299																																						dbGAP											1	Substitution - Missense(1)	skin(1)											57.0	43.0	47.0					13																	20398780		1563	3572	5135	-	-	-	SO:0001583	missense	0			AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.1847C>T	13.37:g.20398780G>A	ENSP00000337034:p.Ser616Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	SNP	pfam_Znf_MYM,smart_TRASH	p.S616L	ENST00000337963.4	37	c.1847		13	.	.	.	.	.	.	.	.	.	.	G	14.71	2.616609	0.46736	.	.	ENSG00000132950	ENST00000337963;ENST00000502168	T;T	0.19806	2.12;2.12	3.03	3.03	0.35002	Zinc finger, TTF-type (1);	0.278058	0.32503	N	0.006014	T	0.25005	0.0607	L	0.27053	0.805	0.30070	N	0.810105	D	0.71674	0.998	D	0.73708	0.981	T	0.03008	-1.1083	10	0.10111	T	0.7	.	9.7844	0.40666	0.0:0.0:1.0:0.0	.	616	Q9UJ78	ZMYM5_HUMAN	L	616;606	ENSP00000337034:S616L;ENSP00000445779:S606L	ENSP00000337034:S616L	S	-	2	0	ZMYM5	19296780	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.495000	0.53280	1.978000	0.57642	0.557000	0.71058	TCA	ZMYM5	-	NULL	ENSG00000132950		0.299	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	ZMYM5	HGNC	protein_coding		56	0.00	0	G	NM_014242		20398780	20398780	-1	no_errors	ENST00000337963	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	1.000	A
ZNF274	10782	genome.wustl.edu	37	19	58724135	58724135	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr19:58724135A>G	ENST00000326804.4	+	9	2044	c.1585A>G	c.(1585-1587)Acc>Gcc	p.T529A	ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000345813.3_Missense_Mutation_p.T497A|ZNF274_ENST00000424679.2_Missense_Mutation_p.T424A	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		GAAAATCCATACCGGAGAGAG	0.443																																						dbGAP											0													103.0	110.0	108.0					19																	58724135		1949	4153	6102	-	-	-	SO:0001583	missense	0			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.1585A>G	19.37:g.58724135A>G	ENSP00000321209:p.Thr529Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T529A	ENST00000326804.4	37	c.1585		19	.	.	.	.	.	.	.	.	.	.	A	15.50	2.853291	0.51270	.	.	ENSG00000171606	ENST00000326804;ENST00000345813;ENST00000424679	T;T;T	0.26518	1.73;1.73;1.73	5.27	5.27	0.74061	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.195677	0.25327	N	0.031478	T	0.26955	0.0660	.	.	.	0.36217	D	0.851766	B;B;P	0.34522	0.4;0.4;0.455	B;B;B	0.36845	0.15;0.15;0.234	T	0.36040	-0.9764	9	0.87932	D	0	-4.9972	13.1748	0.59619	1.0:0.0:0.0:0.0	.	425;498;530	Q96GC6-3;Q96GC6-2;Q96GC6	.;.;ZN274_HUMAN	A	529;497;424	ENSP00000321209:T529A;ENSP00000321187:T497A;ENSP00000409872:T424A	ENSP00000321209:T529A	T	+	1	0	ZNF274	63415947	0.808000	0.29022	0.994000	0.49952	0.793000	0.44817	2.582000	0.46085	2.209000	0.71365	0.533000	0.62120	ACC	ZNF274	-	pfscan_Znf_C2H2	ENSG00000171606		0.443	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF274	HGNC	protein_coding		42	0.00	0	A	NM_133502		58724135	58724135	+1	no_errors	ENST00000326804	ensembl	human	known	69_37n	missense	31	45.61	26	SNP	1.000	G
ZNF462	58499	genome.wustl.edu	37	9	109746549	109746552	+	Frame_Shift_Del	DEL	TACC	TACC	-	rs139091268		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	TACC	TACC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr9:109746549_109746552delTACC	ENST00000277225.5	+	10	7204_7207	c.6915_6918delTACC	c.(6913-6918)tgtaccfs	p.CT2305fs	ZNF462_ENST00000441147.2_Frame_Shift_Del_p.CT1211fs|RP11-508N12.2_ENST00000439901.1_RNA|ZNF462_ENST00000542028.1_Frame_Shift_Del_p.CT262fs|ZNF462_ENST00000457913.1_Frame_Shift_Del_p.CT2365fs			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2305					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T2306A(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTGATAAGTGTACCTTCACCTGCT	0.451																																						dbGAP											1	Substitution - Missense(1)	skin(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.6915_6918delTACC	9.37:g.109746549_109746552delTACC	ENSP00000277225:p.Cys2305fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0T4|Q8N408	Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T2366fs	ENST00000277225.5	37	c.7095_7098	CCDS35096.1	9																																																																																			ZNF462	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000148143		0.451	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	35	0.00	0	TACC	NM_021224		109746549	109746552	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	frame_shift_del	32	15.79	6	DEL	0.998:1.000:1.000:1.000	-
ZNF544	27300	genome.wustl.edu	37	19	58774007	58774007	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr19:58774007C>T	ENST00000596652.1	+	6	2269	c.2035C>T	c.(2035-2037)Cac>Tac	p.H679Y	CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000599953.1_Missense_Mutation_p.H537Y|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000415203.2_Missense_Mutation_p.H651Y|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000600220.1_Missense_Mutation_p.H651Y|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000269829.4_Missense_Mutation_p.H679Y|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000600044.1_Missense_Mutation_p.H651Y			Q6NX49	ZN544_HUMAN	zinc finger protein 544	679					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TCTTTCCCATCACAGAATTCA	0.468																																						dbGAP											0													125.0	131.0	129.0					19																	58774007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.2035C>T	19.37:g.58774007C>T	ENSP00000469635:p.His679Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J1|Q9UEX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H679Y	ENST00000596652.1	37	c.2035	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	C	8.781	0.928219	0.18131	.	.	ENSG00000198131	ENST00000269829;ENST00000415203;ENST00000441758	T;T	0.35973	1.28;1.28	3.27	-4.17	0.03857	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18718	0.0449	N	0.12637	0.245	0.54753	D	0.999982	B;P;B	0.39737	0.019;0.685;0.088	B;P;B	0.44359	0.041;0.447;0.067	T	0.30208	-0.9986	9	0.59425	D	0.04	.	1.9561	0.03376	0.1453:0.3882:0.2843:0.1821	.	651;651;679	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	Y	679;651;231	ENSP00000269829:H679Y;ENSP00000394341:H651Y	ENSP00000269829:H679Y	H	+	1	0	ZNF544	63465819	0.000000	0.05858	0.000000	0.03702	0.389000	0.30415	-0.934000	0.03955	-0.890000	0.03945	0.563000	0.77884	CAC	ZNF544	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198131		0.468	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	38	0.00	0	C	NM_014480		58774007	58774007	+1	no_errors	ENST00000269829	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	0.843	T
ZNF786	136051	genome.wustl.edu	37	7	148767947	148767947	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr7:148767947G>T	ENST00000491431.1	-	4	1981	c.1917C>A	c.(1915-1917)caC>caA	p.H639Q	ZNF786_ENST00000316286.9_Missense_Mutation_p.H553Q|ZNF786_ENST00000451334.3_Missense_Mutation_p.H602Q	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	639					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GCAGCAGCTGGTGGGCCTTCA	0.612																																						dbGAP											0													52.0	56.0	55.0					7																	148767947		2158	4276	6434	-	-	-	SO:0001583	missense	0			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.1917C>A	7.37:g.148767947G>T	ENSP00000417470:p.His639Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A568|B4DMI1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H639Q	ENST00000491431.1	37	c.1917	CCDS47738.1	7	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939615	0.52972	.	.	ENSG00000197362	ENST00000316286;ENST00000491431;ENST00000451334	T;T;T	0.16324	2.35;2.35;2.35	4.56	4.56	0.56223	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38492	N	0.001668	T	0.53174	0.1780	H	0.96301	3.8	0.44247	D	0.997091	D	0.89917	1.0	D	0.72075	0.976	T	0.67639	-0.5619	10	0.87932	D	0	-24.1893	12.7337	0.57212	0.0:0.0:1.0:0.0	.	639	Q8N393	ZN786_HUMAN	Q	553;639;602	ENSP00000313516:H553Q;ENSP00000417470:H639Q;ENSP00000404984:H602Q	ENSP00000313516:H553Q	H	-	3	2	ZNF786	148398880	1.000000	0.71417	0.992000	0.48379	0.008000	0.06430	5.073000	0.64395	2.378000	0.81104	0.655000	0.94253	CAC	ZNF786	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197362		0.612	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	HGNC	protein_coding	OTTHUMT00000352751.1	24	0.00	0	G	NM_152411		148767947	148767947	-1	no_errors	ENST00000491431	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	T
ZNF883	169834	genome.wustl.edu	37	9	115760106	115760106	+	lincRNA	SNP	C	C	G			TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr9:115760106C>G	ENST00000427548.1	-	0	1707							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AGTATGAATTCTATGATGTTG	0.393																																						dbGAP											0													79.0	80.0	79.0					9																	115760106		2159	4276	6435	-	-	-			0			AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115760106C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427548.1	37	NULL		9																																																																																			ZNF883	-	-	ENSG00000228623		0.393	ZNF883-001	KNOWN	basic	lincRNA	ZNF883	HGNC	lincRNA	OTTHUMT00000053704.1	76	0.00	0	C	NM_001101338		115760106	115760106	-1	no_errors	ENST00000427548	ensembl	human	known	69_37n	rna	65	10.96	8	SNP	0.967	G
ZPBP2	124626	genome.wustl.edu	37	17	38032947	38032947	+	Missense_Mutation	SNP	C	C	T	rs569519813		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:38032947C>T	ENST00000348931.4	+	8	1093	c.902C>T	c.(901-903)cCt>cTt	p.P301L	ZPBP2_ENST00000377940.3_Missense_Mutation_p.P279L|ZPBP2_ENST00000584588.1_Missense_Mutation_p.P228L	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	301					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			GTTTGTAGTCCTGCGACTTTT	0.373																																						dbGAP											0													185.0	176.0	179.0					17																	38032947		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.902C>T	17.37:g.38032947C>T	ENSP00000335384:p.Pro301Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8L8|Q6X783|Q86XL5	Missense_Mutation	SNP	pfam_Sp38-bd,pfscan_Ig-like	p.P301L	ENST00000348931.4	37	c.902	CCDS11352.1	17	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547997	0.45383	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	T;T	0.68181	-0.31;-0.31	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000006	D	0.82884	0.5134	M	0.77313	2.365	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83960	0.0321	10	0.87932	D	0	-15.2584	18.189	0.89800	0.0:1.0:0.0:0.0	.	279;301	Q6X784-2;Q6X784	.;ZPBP2_HUMAN	L	301;279	ENSP00000335384:P301L;ENSP00000367174:P279L	ENSP00000335384:P301L	P	+	2	0	ZPBP2	35286473	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.583000	0.60964	2.826000	0.97356	0.655000	0.94253	CCT	ZPBP2	-	pfam_Sp38-bd	ENSG00000186075		0.373	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP2	HGNC	protein_coding	OTTHUMT00000256609.2	67	0.00	0	C	NM_198844		38032947	38032947	+1	no_errors	ENST00000348931	ensembl	human	known	69_37n	missense	72	75.09	217	SNP	1.000	T
ZPBP2	124626	genome.wustl.edu	37	17	38033019	38033019	+	Missense_Mutation	SNP	C	C	G	rs548838743		TCGA-AC-A23C-01A-12D-A167-09	TCGA-AC-A23C-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91766158-e175-4270-bc01-8e853fc9f391	8d3b655a-a7d1-4a2d-90e6-a8b6aef059e2	g.chr17:38033019C>G	ENST00000348931.4	+	8	1165	c.974C>G	c.(973-975)tCt>tGt	p.S325C	ZPBP2_ENST00000377940.3_Missense_Mutation_p.S303C|ZPBP2_ENST00000584588.1_Missense_Mutation_p.S252C	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	325					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			GGAGCTAAATCTTGCCCACAA	0.403																																						dbGAP											0													194.0	181.0	185.0					17																	38033019		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.974C>G	17.37:g.38033019C>G	ENSP00000335384:p.Ser325Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8L8|Q6X783|Q86XL5	Missense_Mutation	SNP	pfam_Sp38-bd,pfscan_Ig-like	p.S325C	ENST00000348931.4	37	c.974	CCDS11352.1	17	.	.	.	.	.	.	.	.	.	.	C	10.18	1.280183	0.23392	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	T;T	0.56444	0.46;0.46	5.81	1.62	0.23740	.	0.447542	0.21268	N	0.077367	T	0.59622	0.2207	L	0.53249	1.67	0.23113	N	0.998277	D;D	0.69078	0.996;0.997	P;P	0.60173	0.639;0.87	T	0.51317	-0.8721	10	0.66056	D	0.02	-6.7423	9.296	0.37815	0.0:0.7138:0.0:0.2862	.	303;325	Q6X784-2;Q6X784	.;ZPBP2_HUMAN	C	325;303	ENSP00000335384:S325C;ENSP00000367174:S303C	ENSP00000335384:S325C	S	+	2	0	ZPBP2	35286545	0.998000	0.40836	0.962000	0.40283	0.941000	0.58515	1.581000	0.36558	0.396000	0.25283	-0.136000	0.14681	TCT	ZPBP2	-	pfam_Sp38-bd	ENSG00000186075		0.403	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP2	HGNC	protein_coding	OTTHUMT00000256609.2	80	0.00	0	C	NM_198844		38033019	38033019	+1	no_errors	ENST00000348931	ensembl	human	known	69_37n	missense	84	71.91	215	SNP	0.740	G
