#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2MP1	3	genome.wustl.edu	37	12	9413853	9413853	+	IGR	SNP	T	T	C	rs252031|rs386760161	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:9413853T>C								RP11-118B22.4 (3297 upstream) : SNORA75 (25415 downstream)																							GTTTCCTTGTTCAATGGATAA	0.313													T|||	3264	0.651757	0.5469	0.7075	5008	,	,		-128	0.624		0.66	False		,,,				2504	0.774					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.9413853T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		12																																																																																			A2MP1	-	-	ENSG00000256069	0	0.313					A2MP1	HGNC			32	0.00	0	T			9413853	9413853	-1	no_errors	ENST00000544183	ensembl	human	known	69_37n	rna	39	17.02	8	SNP	0.001	C
A2MP1	3	genome.wustl.edu	37	12	9413867	9413867	+	IGR	SNP	A	A	G	rs386760161|rs252032	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:9413867A>G								RP11-118B22.4 (3311 upstream) : SNORA75 (25401 downstream)																							TGGATAACACATGGATTCCTG	0.308													G|||	3263	0.651558	0.5469	0.7075	5008	,	,		-128	0.624		0.659	False		,,,				2504	0.774					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.9413867A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		12																																																																																			A2MP1	-	-	ENSG00000256069	0	0.308					A2MP1	HGNC			29	0.00	0	A			9413867	9413867	-1	no_errors	ENST00000544183	ensembl	human	known	69_37n	rna	39	18.75	9	SNP	0.000	G
AACSP1	729522	genome.wustl.edu	37	5	178199558	178199558	+	RNA	SNP	C	C	G	rs13354485	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr5:178199558C>G	ENST00000503486.2	-	0	977					NR_024035.1				acetoacetyl-CoA synthetase pseudogene 1																		TTCAGGAAGACGATCACCCTC	0.582													G|||	1776	0.354633	0.472	0.317	5008	,	,		19395	0.2986		0.333	False		,,,				2504	0.3027					dbGAP											0																																										-	-	-			0					5q35	2010-09-29	2010-09-29	2010-09-29	ENSG00000250420	ENSG00000250420			18226	pseudogene	pseudogene			"""acetoacetyl-CoA synthetase-like"""	AACSL			Standard	NR_024035		Approved		uc011dgl.2		OTTHUMG00000163584		5.37:g.178199558C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000503486.2	37	NULL		5																																																																																			AACSP1	-	-	ENSG00000250420		0.582	AACSP1-002	KNOWN	basic	processed_transcript	AACSP1	HGNC	pseudogene	OTTHUMT00000374392.2	33	0.00	0	C	NR_024035		178199558	178199558	-1	no_errors	ENST00000503486	ensembl	human	known	69_37n	rna	41	14.58	7	SNP	1.000	G
ACE	1636	genome.wustl.edu	37	17	61584720	61584720	+	Missense_Mutation	SNP	A	A	T	rs4459610	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:61584720A>T	ENST00000577647.1	+	15	2190	c.2145A>T	c.(2143-2145)aaA>aaT	p.K715N	ACE_ENST00000490216.2_Missense_Mutation_p.K715N			P12821	ACE_HUMAN	angiotensin I converting enzyme	0	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GAAGCCCTAAACTTCCTCCAG	0.517													a|||	2267	0.452676	0.5847	0.4179	5008	,	,		21051	0.255		0.5895	False		,,,				2504	0.362					dbGAP											0																																										-	-	-	SO:0001583	missense	0			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000577647.1:c.2145A>T	17.37:g.61584720A>T	ENSP00000464149:p.Lys715Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.K715N	ENST00000577647.1	37	c.2145		17																																																																																			ACE	-	NULL	ENSG00000159640		0.517	ACE-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	ACE	HGNC	protein_coding	OTTHUMT00000443848.1	48	0.00	0	A			61584720	61584720	+1	no_errors	ENST00000490216	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	0.000	T
AGAP1	116987	genome.wustl.edu	37	2	236761396	236761396	+	Intron	SNP	C	C	T	rs13006916	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:236761396C>T	ENST00000304032.8	+	10	1630				AGAP1_ENST00000409457.1_Missense_Mutation_p.R373C|AGAP1_ENST00000409538.1_Intron|AGAP1_ENST00000428334.2_Intron|AGAP1_ENST00000336665.5_Intron	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1						protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AGCCCGTGCCCGTCAGTCCTC	0.587													C|||	2402	0.479633	0.0968	0.6499	5008	,	,		15278	0.7688		0.5179	False		,,,				2504	0.5389					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1051-30593C>T	2.37:g.236761396C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	pfam_MIRO-like,pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.R373C	ENST00000304032.8	37	c.1117	CCDS33408.1	2	1127	0.5160256410256411	65	0.13211382113821138	217	0.5994475138121547	445	0.777972027972028	400	0.5277044854881267	C	10.78	1.447041	0.25987	.	.	ENSG00000157985	ENST00000409457	D	0.87491	-2.26	5.28	3.43	0.39272	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999999999	.	.	.	.	.	.	T	0.46119	-0.9214	5	0.87932	D	0	.	10.554	0.45105	0.1506:0.7048:0.1446:0.0	rs13006916;rs13006916	.	.	.	C	373	ENSP00000387174:R373C	ENSP00000387174:R373C	R	+	1	0	AGAP1	236426135	0.462000	0.25791	0.379000	0.26080	0.855000	0.48748	0.726000	0.25984	0.587000	0.29643	0.655000	0.94253	CGT	AGAP1	-	NULL	ENSG00000157985		0.587	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	35	0.00	0	C	NM_014914		236761396	236761396	+1	no_errors	ENST00000409457	ensembl	human	novel	69_37n	missense	36	10.00	4	SNP	0.903	T
AKAP3	10566	genome.wustl.edu	37	12	4758188	4758188	+	5'UTR	SNP	G	G	C	rs714621	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:4758188G>C	ENST00000545990.2	-	0	25				AKAP3_ENST00000544636.1_5'Flank|NDUFA9_ENST00000266544.5_5'Flank|RP11-500M8.7_ENST00000536588.1_Intron|RP11-500M8.4_ENST00000544380.1_RNA	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3						acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						CGAAACCGTCGTTTCTTGGTT	0.507													C|||	2004	0.40016	0.1982	0.5908	5008	,	,		19793	0.3671		0.5537	False		,,,				2504	0.4141					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.-500C>G	12.37:g.4758188G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O75945|Q86X01|Q9UM61	RNA	SNP	-	NULL	ENST00000545990.2	37	NULL	CCDS8531.1	12																																																																																			AKAP3	-	-	ENSG00000111254		0.507	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	27	0.00	0	G	NM_006422		4758188	4758188	-1	no_errors	ENST00000541484	ensembl	human	known	69_37n	rna	39	11.36	5	SNP	0.000	C
ANAPC1	64682	genome.wustl.edu	37	2	112552427	112552427	+	Silent	SNP	C	C	T	rs56780932	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:112552427C>T	ENST00000341068.3	-	35	5113	c.4341G>A	c.(4339-4341)ccG>ccA	p.P1447P		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1447					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						CCTCTGAGCACGGCAATTCGA	0.303													C|||	726	0.144968	0.0325	0.1643	5008	,	,		19157	0.1587		0.2256	False		,,,				2504	0.1861					dbGAP											0													8.0	7.0	7.0					2																	112552427		2039	4110	6149	-	-	-	SO:0001819	synonymous_variant	0			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.4341G>A	2.37:g.112552427C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NULL	p.V982M	ENST00000341068.3	37	c.2944	CCDS2093.1	2	321	0.14697802197802198	16	0.032520325203252036	71	0.19613259668508287	81	0.14160839160839161	153	0.20184696569920843	C	9.971	1.225490	0.22457	.	.	ENSG00000153107	ENST00000427997	.	.	.	5.39	-2.11	0.07187	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.09310	P	0.9999999999999463	.	.	.	.	.	.	T	0.31138	-0.9954	3	.	.	.	-18.994	2.2553	0.04053	0.4591:0.2782:0.1426:0.1201	.	.	.	.	M	982	.	.	V	-	1	0	ANAPC1	112268898	0.981000	0.34729	0.997000	0.53966	0.985000	0.73830	0.104000	0.15313	-0.188000	0.10499	-0.363000	0.07495	GTG	ANAPC1	-	NULL	ENSG00000153107		0.303	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	HGNC	protein_coding	OTTHUMT00000254045.2	32	0.00	0	C	NM_022662		112552427	112552427	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427997	ensembl	human	novel	69_37n	missense	32	13.51	5	SNP	0.951	T
ANKRD61	100310846	genome.wustl.edu	37	7	6071115	6071115	+	Missense_Mutation	SNP	A	A	G	rs12334093	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr7:6071115A>G	ENST00000409061.1	+	1	109	c.109A>G	c.(109-111)Atg>Gtg	p.M37V	EIF2AK1_ENST00000536084.1_Intron|EIF2AK1_ENST00000199389.6_Intron	NM_001271700.1	NP_001258629.1	A6NGH8	ANR61_HUMAN	ankyrin repeat domain 61	37																	TGAAGCCATCATGAGAGAAGA	0.507													A|||	574	0.114617	0.2413	0.1138	5008	,	,		18893	0.0268		0.0984	False		,,,				2504	0.0511					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS64590.1	7p22	2013-01-10			ENSG00000157999	ENSG00000157999		"""Ankyrin repeat domain containing"""	22467	protein-coding gene	gene with protein product							Standard	NM_001271700		Approved		uc031swn.1	A6NGH8	OTTHUMG00000154561	ENST00000409061.1:c.109A>G	7.37:g.6071115A>G	ENSP00000386502:p.Met37Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M37V	ENST00000409061.1	37	c.109		7	223	0.1021062271062271	107	0.21747967479674796	37	0.10220994475138122	10	0.017482517482517484	69	0.09102902374670185	A	5.583	0.292429	0.10567	.	.	ENSG00000157999	ENST00000409061	T	0.53423	0.62	5.69	0.268	0.15626	.	0.298325	0.29119	N	0.013091	T	0.00039	0.0001	.	.	.	0.29275	P	0.870392	.	.	.	.	.	.	T	0.18524	-1.0334	6	0.22109	T	0.4	-13.9545	6.9436	0.24506	0.4099:0.4344:0.0:0.1558	rs12334093;rs52791415;rs58280047;rs12334093	.	.	.	V	37	ENSP00000386502:M37V	ENSP00000386502:M37V	M	+	1	0	ANKRD61	6037641	0.884000	0.30299	0.150000	0.22450	0.058000	0.15608	0.142000	0.16096	-0.174000	0.10743	0.533000	0.62120	ATG	ANKRD61	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000157999		0.507	ANKRD61-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	ANKRD61	HGNC	protein_coding	OTTHUMT00000335991.1	31	0.00	0	A			6071115	6071115	+1	no_errors	ENST00000409061	ensembl	human	novel	69_37n	missense	24	14.29	4	SNP	0.482	G
ANTXRL	195977	genome.wustl.edu	37	10	47669277	47669277	+	Missense_Mutation	SNP	C	C	G	rs61845226	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr10:47669277C>G	ENST00000447511.2	+	9	1040	c.775C>G	c.(775-777)Cct>Gct	p.P259A	ANTXRL_ENST00000537271.1_Missense_Mutation_p.P259A	NM_001278688.1	NP_001265617.1	A6NF34	ANTRL_HUMAN	anthrax toxin receptor-like	259						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)										ATCGGTGGAGCCTTCCTCTGA	0.577													c|||	1717	0.342851	0.2859	0.4712	5008	,	,		22026	0.1597		0.4751	False		,,,				2504	0.3814					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS60524.1	10q11.22	2014-04-11			ENSG00000198250	ENSG00000274209			27277	protein-coding gene	gene with protein product							Standard	NM_001278688		Approved			A6NF34	OTTHUMG00000188318	ENST00000447511.2:c.775C>G	10.37:g.47669277C>G	ENSP00000455449:p.Pro259Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	H3BPS2	Missense_Mutation	SNP	pfam_Anthrax_toxin_rcpt_extracel,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.P259A	ENST00000447511.2	37	c.775		10																																																																																			ANTXRL	-	pfam_Anthrax_toxin_rcpt_extracel	ENSG00000198250		0.577	ANTXRL-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	ANTXRL	HGNC	protein_coding	OTTHUMT00000047862.2	36	0.00	0	C	XM_113625		47669277	47669277	+1	no_errors	ENST00000537271	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.000	G
AOX2P	344454	genome.wustl.edu	37	2	201610584	201610584	+	IGR	SNP	T	T	C	rs2348121	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:201610584T>C								AC007163.3 (10684 upstream) : AOX2P (16446 downstream)																							CAAATTCTACTTAGAGGTTCT	0.547													C|||	2847	0.56849	0.4395	0.6282	5008	,	,		19595	0.5268		0.7266	False		,,,				2504	0.5808					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															2.37:g.201610584T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		2																																																																																			AOX2P	-	-	ENSG00000243478	0	0.547					AOX2P	HGNC			26	0.00	0	T			201610584	201610584	+1	no_errors	ENST00000472376	ensembl	human	known	69_37n	rna	23	17.86	5	SNP	1.000	C
ARMCX4	100131755	genome.wustl.edu	37	X	100743826	100743826	+	Missense_Mutation	SNP	A	A	G	rs5951332	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chrX:100743826A>G	ENST00000423738.3	+	2	452	c.250A>G	c.(250-252)Agg>Ggg	p.R84G		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	188				PLS -> RLC (in Ref. 2; CAI45960). {ECO:0000305}.		integral component of membrane (GO:0016021)				lung(1)	1						AAGTGGGCCTAGGGCTGAAGT	0.522													G|||	2338	0.619338	0.5537	0.4798	3775	,	,		16106	0.3631		0.5417	False		,,,				2504	0.3701					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.250A>G	X.37:g.100743826A>G	ENSP00000404304:p.Arg84Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	NULL	p.R188G	ENST00000423738.3	37	c.562	CCDS59170.1	X	1022	0.6160337552742616	181	0.5552147239263804	123	0.46946564885496184	128	0.28699551569506726	272	0.5291828793774319	G	2.316	-0.356754	0.05138	.	.	ENSG00000196440	ENST00000423738	.	.	.	4.86	-0.997	0.10215	.	0.818611	0.10415	N	0.677405	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.44003	-0.9356	5	0.02654	T	1	.	4.1572	0.10266	0.5051:0.0:0.2104:0.2844	rs5951332;rs6523505;rs60122377;rs5951332	.	.	.	G	188	.	ENSP00000423927:R176G	R	+	1	2	ARMCX4	100630482	0.891000	0.30450	0.001000	0.08648	0.407000	0.30961	0.393000	0.20817	-0.407000	0.07576	-0.838000	0.03060	AGG	ARMCX4	-	NULL	ENSG00000196440		0.522	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	22	0.00	0	A	NM_001256155		100743826	100743826	+1	no_errors	ENST00000433011	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.002	G
AXDND1	126859	genome.wustl.edu	37	1	179504026	179504028	+	In_Frame_Del	DEL	AAG	AAG	-	rs551573109|rs141228272	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:179504026_179504028delAAG	ENST00000367618.3	+	25	3347_3349	c.2960_2962delAAG	c.(2959-2964)aaagaa>aaa	p.E991del		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	991	Glu-rich.		E -> Q (in dbSNP:rs6425573).							NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						agagaagtaaaagaagaagaaga	0.325																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2960_2962delAAG	1.37:g.179504035_179504037delAAG	ENSP00000356590:p.Glu991del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AWB2|Q96LJ3|Q96M01	In_Frame_Del	DEL	pfam_Axonemal_dynein_light_chain	p.E991in_frame_del	ENST00000367618.3	37	c.2960_2962	CCDS30948.1	1																																																																																			AXDND1	-	NULL	ENSG00000162779		0.325	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AXDND1	HGNC	protein_coding	OTTHUMT00000085312.1	30	0.00	0	AAG	NM_144696		179504026	179504028	+1	no_errors	ENST00000367618	ensembl	human	known	69_37n	in_frame_del	33	13.16	5	DEL	0.004:0.002:0.015	-
MALRD1	340895	genome.wustl.edu	37	10	19676553	19676553	+	Missense_Mutation	SNP	A	A	G	rs12773592	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr10:19676553A>G	ENST00000454679.2	+	12	2426	c.2426A>G	c.(2425-2427)gAt>gGt	p.D809G				Q5VYJ5	MALR1_HUMAN		809	LDL-receptor class A 4. {ECO:0000255|PROSITE-ProRule:PRU00124}.		D -> G (in dbSNP:rs12773592).		cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						GATAATACTGATGAAAATGAG	0.433													A|||	642	0.128195	0.0605	0.0836	5008	,	,		17357	0.1558		0.1521	False		,,,				2504	0.1984					dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000454679.2:c.2426A>G	10.37:g.19676553A>G	ENSP00000412763:p.Asp809Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_MAM_dom	p.D809G	ENST00000454679.2	37	c.2426		10	260	0.11904761904761904	32	0.06504065040650407	35	0.09668508287292818	73	0.12762237762237763	120	0.158311345646438	A	17.05	3.289396	0.59976	.	.	ENSG00000204740	ENST00000377266;ENST00000454679;ENST00000441070	D;D;D	0.97186	-4.28;-4.28;-4.28	5.01	3.86	0.44501	.	.	.	.	.	T	0.13841	0.0335	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.38415	-0.9662	4	.	.	.	.	12.0662	0.53590	0.8558:0.1442:0.0:0.0	rs12773592;rs12773592	.	.	.	G	822;809;76	ENSP00000366477:D822G;ENSP00000412763:D809G;ENSP00000404330:D76G	.	D	+	2	0	C10orf112	19716559	1.000000	0.71417	0.419000	0.26584	0.711000	0.40976	6.618000	0.74214	0.901000	0.36495	0.460000	0.39030	GAT	C10orf112	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000204740		0.433	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		58	0.00	0	A			19676553	19676553	+1	no_errors	ENST00000454679	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	1.000	G
MALRD1	340895	genome.wustl.edu	37	10	19676561	19676561	+	Missense_Mutation	SNP	G	G	A	rs12771333	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr10:19676561G>A	ENST00000454679.2	+	12	2434	c.2434G>A	c.(2434-2436)Gag>Aag	p.E812K				Q5VYJ5	MALR1_HUMAN		812	LDL-receptor class A 4. {ECO:0000255|PROSITE-ProRule:PRU00124}.		E -> K (in dbSNP:rs12771333).		cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						TGATGAAAATGAGTGTGGTAG	0.438													G|||	643	0.128395	0.0605	0.0836	5008	,	,		17231	0.1558		0.1521	False		,,,				2504	0.1994					dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000454679.2:c.2434G>A	10.37:g.19676561G>A	ENSP00000412763:p.Glu812Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_MAM_dom	p.E812K	ENST00000454679.2	37	c.2434		10	260	0.11904761904761904	32	0.06504065040650407	35	0.09668508287292818	73	0.12762237762237763	120	0.158311345646438	G	12.38	1.920186	0.33908	.	.	ENSG00000204740	ENST00000377266;ENST00000454679;ENST00000441070	D;D;D	0.91237	-2.81;-2.81;-2.81	5.01	3.15	0.36227	.	.	.	.	.	T	0.03477	0.0100	.	.	.	0.09310	P	0.9999999999999878	.	.	.	.	.	.	T	0.46247	-0.9205	4	.	.	.	.	11.5065	0.50471	0.1471:0.0:0.8529:0.0	rs12771333;rs52823724;rs12771333	.	.	.	K	825;812;79	ENSP00000366477:E825K;ENSP00000412763:E812K;ENSP00000404330:E79K	.	E	+	1	0	C10orf112	19716567	1.000000	0.71417	0.136000	0.22124	0.878000	0.50629	4.109000	0.57824	0.674000	0.31244	0.563000	0.77884	GAG	C10orf112	-	superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000204740		0.438	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		61	0.00	0	G			19676561	19676561	+1	no_errors	ENST00000454679	ensembl	human	known	69_37n	missense	50	12.07	7	SNP	0.978	A
MALRD1	340895	genome.wustl.edu	37	10	19778056	19778056	+	Silent	SNP	G	G	A	rs2151234	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr10:19778056G>A	ENST00000454679.2	+	15	3081	c.3081G>A	c.(3079-3081)aaG>aaA	p.K1027K	C10orf112_ENST00000455457.2_5'UTR|C10orf112_ENST00000492202.1_Intron			Q5VYJ5	MALR1_HUMAN		1027					cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						CTCTGCTGAAGGGGCCGCCAC	0.632													G|||	2247	0.448682	0.4644	0.4193	5008	,	,		15564	0.3353		0.5924	False		,,,				2504	0.4172					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0																														ENST00000454679.2:c.3081G>A	10.37:g.19778056G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,smart_EGF-like,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_MAM_dom	p.G12R	ENST00000454679.2	37	c.34		10	1015	0.46474358974358976	227	0.4613821138211382	151	0.4171270718232044	185	0.32342657342657344	452	0.5963060686015831	G	4.062	0.009321	0.07912	.	.	ENSG00000204740	ENST00000377265	.	.	.	0.505	0.505	0.16953	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	9.99999999995449E-6	.	.	.	.	.	.	T	0.47861	-0.9084	2	.	.	.	.	.	.	.	rs2151234;rs59723151;rs2151234	.	.	.	R	12	.	.	G	+	1	0	C10orf112	19818062	0.068000	0.21057	0.006000	0.13384	0.018000	0.09664	1.310000	0.33551	0.508000	0.28173	0.313000	0.20887	GGG	C10orf112	-	NULL	ENSG00000204740		0.632	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		23	0.00	0	G			19778056	19778056	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000377265	ensembl	human	novel	69_37n	missense	25	16.67	5	SNP	0.007	A
C1orf167	284498	genome.wustl.edu	37	1	11832289	11832289	+	Missense_Mutation	SNP	C	C	A	rs61773952	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:11832289C>A	ENST00000433342.1	+	8	2033	c.2033C>A	c.(2032-2034)cCc>cAc	p.P678H	C1orf167_ENST00000484153.1_3'UTR			Q5SNV9	CA167_HUMAN	chromosome 1 open reading frame 167	678										central_nervous_system(1)	1						CCACTGAGCCCCCAGCACCAG	0.602													C|||	611	0.122005	0.0113	0.0793	5008	,	,		20376	0.1052		0.1799	False		,,,				2504	0.2597					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL834308		1p36.22	2012-04-20			ENSG00000215910	ENSG00000215910			25262	protein-coding gene	gene with protein product						12370778	Standard	XM_006710065		Approved	DKFZp434E1410, RP11-56N19.2	uc001asy.1	Q5SNV9	OTTHUMG00000002228	ENST00000433342.1:c.2033C>A	1.37:g.11832289C>A	ENSP00000414909:p.Pro678His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDA9|Q8NDF3	Missense_Mutation	SNP	NULL	p.P678H	ENST00000433342.1	37	c.2033		1	242	0.1108058608058608	9	0.018292682926829267	37	0.10220994475138122	52	0.09090909090909091	144	0.18997361477572558	C	12.37	1.918757	0.33908	.	.	ENSG00000215910	ENST00000433342	T	0.11063	2.81	3.73	1.83	0.25207	.	.	.	.	.	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	.	.	.	.	.	.	T	0.42464	-0.9450	6	0.44086	T	0.13	.	5.9673	0.19332	0.0:0.7554:0.0:0.2446	rs61773952	.	.	.	H	678	ENSP00000414909:P678H	ENSP00000414909:P678H	P	+	2	0	C1orf167	11754876	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.809000	0.38922	0.376000	0.24707	-0.251000	0.11542	CCC	C1orf167	-	NULL	ENSG00000215910		0.602	C1orf167-201	KNOWN	basic|appris_principal	protein_coding	C1orf167	HGNC	protein_coding		23	0.00	0	C			11832289	11832289	+1	no_errors	ENST00000433342	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.000	A
C2orf43	60526	genome.wustl.edu	37	2	20885321	20885321	+	3'UTR	SNP	C	C	A	rs17663874	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:20885321C>A	ENST00000237822.3	-	0	2399				C2orf43_ENST00000381090.3_Missense_Mutation_p.L357F|C2orf43_ENST00000403006.2_Missense_Mutation_p.L227F	NM_001282721.1|NM_021925.2	NP_001269650.1|NP_068744.1	Q9H6V9	CB043_HUMAN	chromosome 2 open reading frame 43											endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGTTGGCAGCAAATCAGAGC	0.458													C|||	696	0.138978	0.2277	0.0908	5008	,	,		22019	0.0635		0.1531	False		,,,				2504	0.1166					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK025473	CCDS1702.1, CCDS62864.1, CCDS74488.1, CCDS74489.1	2p24.1	2014-02-07			ENSG00000118961	ENSG00000118961			26145	protein-coding gene	gene with protein product		613570				17135363, 24357060	Standard	NM_001282723		Approved	FLJ21820	uc002rec.3	Q9H6V9	OTTHUMG00000122097	ENST00000237822.3:c.*1342G>T	2.37:g.20885321C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZA47|B7ZAJ5|D6W530|E7ESN0|Q53T37|Q53T58	Missense_Mutation	SNP	pfam_DUF2305	p.L227F	ENST00000237822.3	37	c.681	CCDS1702.1	2	308	0.14102564102564102	120	0.24390243902439024	35	0.09668508287292818	35	0.06118881118881119	118	0.15567282321899736	C	11.49	1.653901	0.29425	.	.	ENSG00000118961	ENST00000403006;ENST00000381090	.	.	.	3.81	2.93	0.34026	.	1.617550	0.04063	N	0.306729	T	0.00012	0.0000	.	.	.	0.37096	P	0.10034699999999996	B	0.32653	0.379	B	0.25405	0.06	T	0.11891	-1.0569	7	0.87932	D	0	-0.5171	7.2023	0.25887	0.0:0.8811:0.0:0.1189	rs17663874;rs61631900;rs17663874	357	B5MDU6	.	F	227;357	.	ENSP00000370480:L357F	L	-	3	2	C2orf43	20748802	0.131000	0.22433	0.217000	0.23759	0.034000	0.12701	0.527000	0.22987	1.200000	0.43188	0.655000	0.94253	TTG	C2orf43	-	NULL	ENSG00000118961		0.458	C2orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf43	HGNC	protein_coding	OTTHUMT00000242861.1	30	0.00	0	C	NM_021925		20885321	20885321	-1	no_errors	ENST00000403006	ensembl	human	putative	69_37n	missense	56	12.50	8	SNP	0.234	A
CCDC108	255101	genome.wustl.edu	37	2	219892233	219892233	+	Intron	SNP	T	T	A	rs61749573	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:219892233T>A	ENST00000341552.5	-	13	2295				CCDC108_ENST00000409865.3_Missense_Mutation_p.T773S|CCDC108_ENST00000453220.1_Intron|CCDC108_ENST00000441968.1_Intron|CCDC108_ENST00000410037.1_Missense_Mutation_p.T719S	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108							integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCATAGGGGTCACTGTCCAG	0.567													T|||	280	0.0559105	0.0083	0.0807	5008	,	,		16926	0.001		0.1769	False		,,,				2504	0.0348					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2211+138A>T	2.37:g.219892233T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	superfamily_PapD-like	p.T773S	ENST00000341552.5	37	c.2317	CCDS2430.2	2	171	0.0782967032967033	7	0.014227642276422764	32	0.08839779005524862	1	0.0017482517482517483	131	0.17282321899736147	T	6.782	0.513161	0.12944	.	.	ENSG00000181378	ENST00000545086;ENST00000409865;ENST00000410037;ENST00000441164	T;T	0.08282	3.11;3.18	3.65	-5.62	0.02481	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46735	-0.9170	7	0.87932	D	0	.	0.143	0.00085	0.3556:0.1836:0.1771:0.2837	rs61749573	773;718	E9PG25;B4DYZ8	.;.	S	260;773;719;718	ENSP00000386945:T773S;ENSP00000386258:T719S	ENSP00000386945:T773S	T	-	1	0	CCDC108	219600477	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.919000	0.04017	-1.421000	0.02007	-0.890000	0.02929	ACC	CCDC108	-	NULL	ENSG00000181378		0.567	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	HGNC	protein_coding	OTTHUMT00000256598.4	26	0.00	0	T	NM_194302		219892233	219892233	-1	no_errors	ENST00000409865	ensembl	human	putative	69_37n	missense	48	11.11	6	SNP	0.000	A
CCDC40	55036	genome.wustl.edu	37	17	78063957	78063957	+	Intron	SNP	A	A	G	rs7210658|rs375858249	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:78063957A>G	ENST00000397545.4	+	17	2859				CCDC40_ENST00000573903.1_Intron|CCDC40_ENST00000374877.3_Missense_Mutation_p.Q951R	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			AGAACAACACAGGacgcacac	0.587													A|||	824	0.164537	0.034	0.268	5008	,	,		20105	0.1091		0.2873	False		,,,				2504	0.1984					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2832+274A>G	17.37:g.78063957A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	pfam_E3_ubiquit_lig_BRE1	p.Q951R	ENST00000397545.4	37	c.2852	CCDS42395.1	17	332	0.152014652014652	18	0.036585365853658534	88	0.2430939226519337	34	0.05944055944055944	192	0.2532981530343008	A	3.307	-0.141571	0.06669	.	.	ENSG00000141519	ENST00000374877	T	0.43294	0.95	0.831	-0.588	0.11687	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.26744	-1.0094	5	0.37606	T	0.19	.	3.0009	0.06014	0.6657:0.0:0.3343:0.0	rs7210658	.	.	.	R	951	ENSP00000364011:Q951R	ENSP00000364011:Q951R	Q	+	2	0	CCDC40	75678552	0.000000	0.05858	0.005000	0.12908	0.044000	0.14063	-1.210000	0.02999	-0.158000	0.11040	0.311000	0.20440	CAG	CCDC40	-	NULL	ENSG00000141519		0.587	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	25	0.00	0	A	XM_371082		78063957	78063957	+1	no_errors	ENST00000374877	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	0.005	G
CCDC40	55036	genome.wustl.edu	37	17	78063964	78063964	+	Intron	SNP	A	A	G	rs7210664|rs375858249	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:78063964A>G	ENST00000397545.4	+	17	2859				CCDC40_ENST00000573903.1_Intron|CCDC40_ENST00000374877.3_Silent_p.A953A	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CACAGGacgcacacaggcacg	0.602													A|||	821	0.163938	0.034	0.2651	5008	,	,		19715	0.1091		0.2863	False		,,,				2504	0.1984					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2832+281A>G	17.37:g.78063964A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Silent	SNP	pfam_E3_ubiquit_lig_BRE1	p.A953	ENST00000397545.4	37	c.2859	CCDS42395.1	17																																																																																			CCDC40	-	NULL	ENSG00000141519		0.602	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	25	0.00	0	A	XM_371082		78063964	78063964	+1	no_errors	ENST00000374877	ensembl	human	known	69_37n	silent	40	12.77	6	SNP	0.003	G
CCDC40	55036	genome.wustl.edu	37	17	78063966	78063966	+	Intron	SNP	A	A	G	rs7210665|rs375858249	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:78063966A>G	ENST00000397545.4	+	17	2859				CCDC40_ENST00000573903.1_Intron|CCDC40_ENST00000374877.3_Missense_Mutation_p.H954R	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CAGGacgcacacaggcacgtg	0.607													A|||	822	0.164137	0.034	0.2651	5008	,	,		19698	0.1091		0.2873	False		,,,				2504	0.1984					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2832+283A>G	17.37:g.78063966A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	pfam_E3_ubiquit_lig_BRE1	p.H954R	ENST00000397545.4	37	c.2861	CCDS42395.1	17	314	0.14377289377289376	18	0.036585365853658534	83	0.2292817679558011	32	0.055944055944055944	181	0.23878627968337732	A	5.245	0.230643	0.09969	.	.	ENSG00000141519	ENST00000374877	T	0.42131	0.98	0.979	-0.265	0.12946	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.24368	-1.0162	5	0.38643	T	0.18	.	3.0468	0.06157	0.6971:0.0:0.3029:0.0	rs7210665	.	.	.	R	954	ENSP00000364011:H954R	ENSP00000364011:H954R	H	+	2	0	CCDC40	75678561	0.004000	0.15560	0.005000	0.12908	0.032000	0.12392	0.154000	0.16343	-0.070000	0.12908	0.076000	0.15429	CAC	CCDC40	-	NULL	ENSG00000141519		0.607	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	25	0.00	0	A	XM_371082		78063966	78063966	+1	no_errors	ENST00000374877	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.005	G
CHFR	55743	genome.wustl.edu	37	12	133417908	133417908	+	3'UTR	SNP	C	C	T	rs3741490	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:133417908C>T	ENST00000432561.2	-	0	2300				CHFR_ENST00000537522.1_3'UTR|CHFR_ENST00000315585.7_3'UTR|CHFR_ENST00000266880.7_3'UTR|CHFR_ENST00000541341.1_Intron|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000443047.2_3'UTR|CHFR_ENST00000450056.2_3'UTR			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase						mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		GATGCCACCACGAGCCCTGCC	0.612													T|||	1282	0.25599	0.1868	0.2781	5008	,	,		15127	0.1925		0.2813	False		,,,				2504	0.3732					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.*232G>A	12.37:g.133417908C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	RNA	SNP	-	NULL	ENST00000432561.2	37	NULL	CCDS53849.1	12																																																																																			CHFR	-	-	ENSG00000072609		0.612	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CHFR	HGNC	protein_coding	OTTHUMT00000397130.2	16	0.00	0	C			133417908	133417908	-1	no_errors	ENST00000544093	ensembl	human	known	69_37n	rna	8	30.77	4	SNP	0.000	T
DNM1P51	0	genome.wustl.edu	37	15	84954258	84954258	+	RNA	SNP	A	A	G	rs386785906|rs62029589	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr15:84954258A>G	ENST00000558801.1	-	0	7507									DNM1 pseudogene 51																		CTCCTTCAGCACGTGGTGCAT	0.622													.|||	485	0.096845	0.0416	0.0735	5008	,	,		18077	0.1815		0.1193	False		,,,				2504	0.0777					dbGAP											0																																										-	-	-			0					15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84954258A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000558801.1	37	NULL		15																																																																																			CSPG4P5	-	-	ENSG00000235370		0.622	DNM1P51-001	KNOWN	basic	processed_transcript	CSPG4P5	HGNC	pseudogene	OTTHUMT00000471721.1	64	0.00	0	A			84954258	84954258	-1	no_errors	ENST00000456932	ensembl	human	known	69_37n	rna	60	10.45	7	SNP	1.000	G
CYBRD1	79901	genome.wustl.edu	37	2	172379781	172379781	+	Intron	SNP	G	G	A	rs960749	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:172379781G>A	ENST00000321348.4	+	1	391				CYBRD1_ENST00000409484.1_Intron|CYBRD1_ENST00000375252.3_Intron|CYBRD1_ENST00000468308.1_Intron	NM_024843.3	NP_079119.3	Q53TN4	CYBR1_HUMAN	cytochrome b reductase 1						cellular iron ion homeostasis (GO:0006879)|response to iron ion (GO:0010039)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|oxidoreductase activity, oxidizing metal ions (GO:0016722)			endometrium(1)|kidney(1)|large_intestine(3)|liver(2)|lung(3)	10						AAAGATTGCCGGAGCGAGAAT	0.602													G|||	3534	0.705671	0.7935	0.6297	5008	,	,		15740	0.8383		0.5219	False		,,,				2504	0.6933					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK027115	CCDS2244.1, CCDS46449.1, CCDS58736.1	2q31	2013-03-14			ENSG00000071967	ENSG00000071967		"""Cytochrome b genes"""	20797	protein-coding gene	gene with protein product	"""ferric-chelate reductase 3"", ""cytochrome b561 family, member A2"""	605745				11230685	Standard	NM_001127383		Approved	DCYTB, FLJ23462, FRRS3, CYB561A2	uc002ugy.4	Q53TN4	OTTHUMG00000132260	ENST00000321348.4:c.193+533G>A	2.37:g.172379781G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE79|B4DWD7|Q6KC16|Q6KC17|Q6P147|Q6ZR51|Q9H0Q8|Q9H5G5	Missense_Mutation	SNP	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM	p.R12Q	ENST00000321348.4	37	c.35	CCDS2244.1	2	1454	0.6657509157509157	364	0.7398373983739838	227	0.6270718232044199	467	0.8164335664335665	396	0.5224274406332454	G	8.391	0.839713	0.16891	.	.	ENSG00000071967	ENST00000445146	T	0.46063	0.88	2.94	1.12	0.20585	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	5.000000000032756E-6	.	.	.	.	.	.	T	0.38222	-0.9671	5	0.05721	T	0.95	.	5.0004	0.14262	0.2895:0.0:0.7105:0.0	rs960749	.	.	.	Q	12	ENSP00000402242:R12Q	ENSP00000402242:R12Q	R	+	2	0	CYBRD1	172088027	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.165000	0.16564	0.289000	0.22422	0.563000	0.77884	CGG	CYBRD1	-	pfscan_Cyt_b561/ferric_Rdtase_TM	ENSG00000071967		0.602	CYBRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBRD1	HGNC	protein_coding	OTTHUMT00000255344.2	70	0.00	0	G	NM_024843		172379781	172379781	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000445146	ensembl	human	putative	69_37n	missense	59	13.24	9	SNP	0.000	A
DHRS4	10901	genome.wustl.edu	37	14	24436602	24436602	+	Intron	SNP	C	C	A			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr14:24436602C>A	ENST00000313250.5	+	7	925				DHRS4_ENST00000558263.1_Intron|DHRS4L2_ENST00000543805.1_5'Flank|DHRS4_ENST00000397073.2_Intron|DHRS4_ENST00000558581.1_Intron|DHRS4_ENST00000421831.1_Intron|DHRS4_ENST00000382761.3_Intron|DHRS4_ENST00000397074.3_Intron|DHRS4_ENST00000559632.1_Intron|DHRS4_ENST00000543741.2_3'UTR|DHRS4_ENST00000308178.8_Intron|DHRS4L2_ENST00000534993.1_5'Flank|DHRS4_ENST00000397075.3_Intron	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4						alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)			central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CCTCACAGACCACGAATTCAT	0.507																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.722+127C>A	14.37:g.24436602C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Missense_Mutation	SNP	NULL	p.P40Q	ENST00000313250.5	37	c.119	CCDS9605.1	14																																																																																			DHRS4	-	NULL	ENSG00000157326		0.507	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS4	HGNC	protein_coding	OTTHUMT00000071857.3	14	0.00	0	C			24436602	24436602	+1	no_start_codon	ENST00000559975	ensembl	human	putative	69_37n	missense	15	28.57	6	SNP	0.010	A
LINC01011	401232	genome.wustl.edu	37	6	2990894	2990894	+	lincRNA	SNP	G	G	T	rs1054132	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr6:2990894G>T	ENST00000445000.1	+	0	2298				RP1-90J20.8_ENST00000429319.1_RNA|RP1-90J20.8_ENST00000456189.1_RNA	NR_026855.1				long intergenic non-protein coding RNA 1011																		GCTTCTAGtgggataccctac	0.473													T|||	2274	0.454073	0.5749	0.438	5008	,	,		18602	0.369		0.4324	False		,,,				2504	0.4121					dbGAP											0																																										-	-	-			0					6p25.2	2013-07-24			ENSG00000244041	ENSG00000244041		"""Long non-coding RNAs"""	33812	non-coding RNA	RNA, long non-coding							Standard	NR_026855		Approved	DKFZp686I15217			OTTHUMG00000014128		6.37:g.2990894G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000445000.1	37	NULL		6																																																																																			RP1-90J20.7	-	-	ENSG00000244041		0.473	LINC01011-004	KNOWN	basic|exp_conf	lincRNA	DKFZP686I15217	Clone_based_vega_gene	lincRNA	OTTHUMT00000255317.1	23	0.00	0	G			2990894	2990894	+1	no_errors	ENST00000445000	ensembl	human	putative	69_37n	rna	22	18.52	5	SNP	0.013	T
DNAJC11	55735	genome.wustl.edu	37	1	6694980	6694980	+	3'UTR	SNP	G	G	A	rs1043683	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:6694980G>A	ENST00000377577.5	-	0	2558				DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000465508.1_5'UTR|THAP3_ENST00000377627.3_3'UTR	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11							extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGCAGGCGGTGGAGGGAC	0.647											OREG0013046	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	3408	0.680511	0.7012	0.6138	5008	,	,		15204	0.5764		0.6948	False		,,,				2504	0.7924					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.*755C>T	1.37:g.6694980G>A		Somatic	636	WXS	Illumina GAIIx	Phase_IV	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	RNA	SNP	-	NULL	ENST00000377577.5	37	NULL	CCDS87.1	1																																																																																			DNAJC11	-	-	ENSG00000007923		0.647	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	HGNC	protein_coding	OTTHUMT00000004216.3	27	0.00	0	G	NM_018198		6694980	6694980	-1	no_errors	ENST00000465508	ensembl	human	known	69_37n	rna	18	18.18	4	SNP	0.001	A
EFCAB8	388795	genome.wustl.edu	37	20	31486206	31486206	+	Intron	SNP	A	A	G	rs6058948	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr20:31486206A>G	ENST00000400522.4	+	11	1051							A8MWE9	EFCB8_HUMAN	EF-hand calcium binding domain 8								calcium ion binding (GO:0005509)			endometrium(2)	2						ATCTCTGGGCACCTCCAGTCC	0.572													G|||	2632	0.525559	0.5492	0.4625	5008	,	,		17629	0.2946		0.7376	False		,,,				2504	0.5583					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					20q11.21	2013-01-10			ENSG00000215529	ENSG00000215529		"""WD repeat domain containing"", ""EF-hand domain containing"""	34532	protein-coding gene	gene with protein product							Standard	XM_006710086		Approved			A8MWE9	OTTHUMG00000153693	ENST00000400522.4:c.958-93A>G	20.37:g.31486206A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000400522.4	37	NULL		20																																																																																			EFCAB8	-	-	ENSG00000215529		0.572	EFCAB8-001	PUTATIVE	mRNA_end_NF|cds_end_NF|basic|exp_conf	protein_coding	EFCAB8	HGNC	protein_coding	OTTHUMT00000332144.2	21	0.00	0	A	XM_371397		31486206	31486206	+1	no_errors	ENST00000533479	ensembl	human	known	69_37n	rna	23	14.29	4	SNP	0.000	G
ERGIC1	57222	genome.wustl.edu	37	5	172347440	172347440	+	Intron	SNP	G	G	A	rs13187960	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr5:172347440G>A	ENST00000393784.3	+	6	514				ERGIC1_ENST00000523291.1_3'UTR	NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1						ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GAGACCCCACGGTGACCTCGT	0.577													G|||	1073	0.214257	0.1959	0.2176	5008	,	,		17263	0.0853		0.335	False		,,,				2504	0.2454					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.376-3568G>A	5.37:g.172347440G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0L0|Q9H2J2|Q9ULN9	RNA	SNP	-	NULL	ENST00000393784.3	37	NULL	CCDS34292.1	5																																																																																			ERGIC1	-	-	ENSG00000113719		0.577	ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC1	HGNC	protein_coding	OTTHUMT00000252938.3	31	0.00	0	G	NM_020462		172347440	172347440	+1	no_errors	ENST00000523650	ensembl	human	known	69_37n	rna	43	12.24	6	SNP	0.000	A
FAAH2	158584	genome.wustl.edu	37	X	57515439	57515439	+	3'UTR	SNP	T	T	C	rs1048358	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chrX:57515439T>C	ENST00000374900.4	+	0	1793				FAAH2_ENST00000491179.1_3'UTR	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						TTGGGTGAAATCAAGCACCAG	0.403										HNSCC(52;0.14)			T|||	1782	0.472053	0.0318	0.4049	3775	,	,		12987	0.4663		0.5467	False		,,,				2504	0.4489					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.*74T>C	X.37:g.57515439T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VT2|Q96N98	RNA	SNP	-	NULL	ENST00000374900.4	37	NULL	CCDS14375.1	X																																																																																			FAAH2	-	-	ENSG00000165591		0.403	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	17	0.00	0	T	NM_174912		57515439	57515439	+1	no_errors	ENST00000491179	ensembl	human	known	69_37n	rna	29	17.14	6	SNP	0.001	C
FAM188B2	646951	genome.wustl.edu	37	3	150608785	150608785	+	Silent	SNP	G	G	A			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr3:150608785G>A	ENST00000397891.3	-	3	314	c.315C>T	c.(313-315)gtC>gtT	p.V105V	CLRN1-AS1_ENST00000476886.1_RNA|RP11-166N6.2_ENST00000469268.1_RNA|RP11-166N6.3_ENST00000569170.1_3'UTR			A8MYZ0	F1882_HUMAN	family with sequence similarity 188, member B2	109																	TGTCCTCAGTGACAAGACAGA	0.557																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					3q25.1	2009-07-14	2009-07-14	2009-07-14		ENSG00000214237			35475	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 76"""	C3orf76			Standard			Approved			A8MYZ0		ENST00000397891.3:c.315C>T	3.37:g.150608785G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.V105	ENST00000397891.3	37	c.315		3																																																																																			FAM188B2	-	NULL	ENSG00000214237		0.557	FAM188B2-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM188B2	HGNC	protein_coding		27	0.00	0	G	XM_001717355		150608785	150608785	-1	no_errors	ENST00000397891	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	0.732	A
FAM86C2P	645332	genome.wustl.edu	37	11	67564162	67564162	+	RNA	SNP	A	A	G	rs75324740	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr11:67564162A>G	ENST00000528089.1	-	0	978							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		CACATAGCTCAGTGGTGAACA	0.647													.|||	1678	0.335064	0.4879	0.2421	5008	,	,		13699	0.1835		0.3986	False		,,,				2504	0.2853					dbGAP											0																																										-	-	-			0					11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67564162A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000528089.1	37	NULL		11																																																																																			FAM86C2P	-	-	ENSG00000160172		0.647	FAM86C2P-004	KNOWN	basic	processed_transcript	FAM86C2P	HGNC	pseudogene	OTTHUMT00000393796.1	79	0.00	0	A			67564162	67564162	-1	no_errors	ENST00000525180	ensembl	human	known	69_37n	rna	88	11.11	11	SNP	0.002	G
FAM92A1P2	403315	genome.wustl.edu	37	4	183959226	183959226	+	RNA	SNP	T	T	G	rs2016910	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr4:183959226T>G	ENST00000502308.1	+	0	409					NR_003612.1				family with sequence similarity 92, member A1 pseudogene 2																		AAAGCTTATGTAACCATTGTA	0.418													G|||	1796	0.358626	0.2421	0.4207	5008	,	,		17642	0.3373		0.3539	False		,,,				2504	0.499					dbGAP											0																																										-	-	-			0			BC022019		4q35.1	2012-04-19	2012-04-19	2012-04-19	ENSG00000230219	ENSG00000230219			32287	pseudogene	pseudogene			"""family with sequence similarity 92, member A3"""	FAM92A3		12477932	Standard	NR_003612		Approved	MGC71735, MGC102964	uc003ivi.4		OTTHUMG00000160675		4.37:g.183959226T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000502308.1	37	NULL		4																																																																																			FAM92A1P2	-	-	ENSG00000230219		0.418	FAM92A1P2-002	KNOWN	basic	processed_transcript	FAM92A1P2	HGNC	pseudogene	OTTHUMT00000361814.1	19	0.00	0	T			183959226	183959226	+1	no_errors	ENST00000502308	ensembl	human	known	69_37n	rna	22	15.38	4	SNP	0.985	G
FAM92A1P2	403315	genome.wustl.edu	37	4	183959891	183959891	+	RNA	SNP	A	A	T	rs1075694	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr4:183959891A>T	ENST00000502308.1	+	0	1074					NR_003612.1				family with sequence similarity 92, member A1 pseudogene 2																		CAATGGATGCAACCCGAACAA	0.428													T|||	1800	0.359425	0.2421	0.4207	5008	,	,		18131	0.3403		0.3559	False		,,,				2504	0.498					dbGAP											0																																										-	-	-			0			BC022019		4q35.1	2012-04-19	2012-04-19	2012-04-19	ENSG00000230219	ENSG00000230219			32287	pseudogene	pseudogene			"""family with sequence similarity 92, member A3"""	FAM92A3		12477932	Standard	NR_003612		Approved	MGC71735, MGC102964	uc003ivi.4		OTTHUMG00000160675		4.37:g.183959891A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000502308.1	37	NULL		4																																																																																			FAM92A1P2	-	-	ENSG00000230219		0.428	FAM92A1P2-002	KNOWN	basic	processed_transcript	FAM92A1P2	HGNC	pseudogene	OTTHUMT00000361814.1	28	0.00	0	A			183959891	183959891	+1	no_errors	ENST00000502308	ensembl	human	known	69_37n	rna	23	14.29	4	SNP	0.950	T
FANCD2	2177	genome.wustl.edu	37	3	10108898	10108898	+	Silent	SNP	A	A	G	rs77246387		TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr3:10108898A>G	ENST00000419585.1	+	26	2552	c.2391A>G	c.(2389-2391)gtA>gtG	p.V797V	FANCD2_ENST00000383807.1_Silent_p.V797V|FANCD2_ENST00000383806.1_Silent_p.V797V|FANCD2_ENST00000287647.3_Silent_p.V797V			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	797					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.V797V(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGCAGATTGTAAATGCCTTCT	0.368			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	1	Substitution - coding silent(1)	prostate(1)											72.0	63.0	66.0					3																	10108898		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2391A>G	3.37:g.10108898A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	superfamily_ARM-type_fold	p.V797	ENST00000419585.1	37	c.2391	CCDS33696.1	3																																																																																			FANCD2	-	NULL	ENSG00000144554		0.368	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	20	0.00	0	A			10108898	10108898	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	silent	23	14.81	4	SNP	0.998	G
FANCD2	2177	genome.wustl.edu	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	G	T	rs80258959		TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr3:10108913G>T	ENST00000419585.1	+	26	2567	c.2406G>T	c.(2404-2406)caG>caT	p.Q802H	FANCD2_ENST00000383807.1_Missense_Mutation_p.Q802H|FANCD2_ENST00000383806.1_Missense_Mutation_p.Q802H|FANCD2_ENST00000287647.3_Missense_Mutation_p.Q802H			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	802					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.Q802H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	2	Substitution - Missense(2)	prostate(2)											82.0	72.0	75.0					3																	10108913		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2406G>T	3.37:g.10108913G>T	ENSP00000398754:p.Gln802His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q802H	ENST00000419585.1	37	c.2406	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373535	0.61624	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.44	1.83	0.25207	.	0.551240	0.20789	N	0.085651	T	0.50240	0.1604	M	0.63428	1.95	0.30837	N	0.736052	P;P	0.50710	0.938;0.938	P;P	0.53988	0.739;0.739	T	0.53229	-0.8468	10	0.54805	T	0.06	.	3.6289	0.08124	0.3156:0.0:0.4962:0.1881	.	802;802	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	H	802	ENSP00000287647:Q802H;ENSP00000373318:Q802H;ENSP00000373317:Q802H;ENSP00000398754:Q802H	ENSP00000287647:Q802H	Q	+	3	2	FANCD2	10083913	0.804000	0.28969	0.409000	0.26459	0.904000	0.53231	1.055000	0.30467	0.519000	0.28406	0.585000	0.79938	CAG	FANCD2	-	NULL	ENSG00000144554		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	23	0.00	0	G			10108913	10108913	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.852	T
FCRLB	127943	genome.wustl.edu	37	1	161696088	161696088	+	Intron	SNP	T	T	C	rs1417582	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:161696088T>C	ENST00000367948.2	+	6	789				FCRLB_ENST00000367946.3_Intron|FCRLB_ENST00000392158.1_Intron|FCRLB_ENST00000336830.5_Intron|FCRLB_ENST00000367945.1_Intron|FCRLB_ENST00000367944.3_Intron|FCRLB_ENST00000495397.1_3'UTR			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B						negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CCGACGCACATCCTGGCTTCT	0.632											OREG0013944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2914	0.581869	0.379	0.5202	5008	,	,		16420	0.8026		0.6968	False		,,,				2504	0.5542					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.574+211T>C	1.37:g.161696088T>C		Somatic	1818	WXS	Illumina GAIIx	Phase_IV	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	RNA	SNP	-	NULL	ENST00000367948.2	37	NULL	CCDS30927.1	1																																																																																			FCRLB	-	-	ENSG00000162746		0.632	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRLB	HGNC	protein_coding	OTTHUMT00000083585.1	23	0.00	0	T	NM_152378		161696088	161696088	+1	no_errors	ENST00000495397	ensembl	human	known	69_37n	rna	24	14.29	4	SNP	0.000	C
MIR7162	102466227	genome.wustl.edu	37	15	62538092	62538092	+	RNA	SNP	G	G	T	rs2955808	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr15:62538092G>T	ENST00000570077.1	-	0	1124				AC126323.1_ENST00000408214.1_RNA																							CTTGGTTCAGGCGACTCAAGC	0.552													.|||	1597	0.31889	0.2179	0.4597	5008	,	,		19293	0.246		0.4443	False		,,,				2504	0.3016					dbGAP											0																																										-	-	-			0																															15.37:g.62538092G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000570077.1	37	NULL		15																																																																																			RP11-299H22.3	-	-	ENSG00000166104		0.552	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	FLJ38723	Clone_based_vega_gene	pseudogene	OTTHUMT00000422143.1	66	0.00	0	G			62538092	62538092	-1	no_errors	ENST00000570077	ensembl	human	known	69_37n	rna	54	10.00	6	SNP	0.990	T
FLJ42102	399923	genome.wustl.edu	37	11	71118788	71118788	+	RNA	SNP	C	C	A	rs4944042	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr11:71118788C>A	ENST00000331301.4	-	0	165					NR_038862.1																						AAGCCAGAGCCGTAGTCACAG	0.597													C|||	1943	0.387979	0.2602	0.5043	5008	,	,		20656	0.4583		0.6123	False		,,,				2504	0.1748					dbGAP											0																																										-	-	-			0																															11.37:g.71118788C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000331301.4	37	NULL		11																																																																																			AP002387.1	-	-	ENSG00000172900		0.597	AP002387.1-002	KNOWN	basic	processed_transcript	FLJ42102	Clone_based_vega_gene	pseudogene	OTTHUMT00000342268.1	21	0.00	0	C			71118788	71118788	-1	no_errors	ENST00000331301	ensembl	human	known	69_37n	rna	24	22.58	7	SNP	0.997	A
FRMPD2	143162	genome.wustl.edu	37	10	49389016	49389016	+	Missense_Mutation	SNP	T	T	C	rs1346694		TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr10:49389016T>C	ENST00000374201.3	-	21	2922	c.2620A>G	c.(2620-2622)Agc>Ggc	p.S874G	FRMPD2_ENST00000407470.4_Missense_Mutation_p.S842G|FRMPD2_ENST00000463706.1_5'Flank|FRMPD2_ENST00000305531.3_Missense_Mutation_p.S849G	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	874				S -> G (in Ref. 2; BAC85520). {ECO:0000305}.	tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TTGGCTGTGCTATTCTTTTCT	0.438																																						dbGAP											0													1.0	1.0	1.0					10																	49389016		112	179	291	-	-	-	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2620A>G	10.37:g.49389016T>C	ENSP00000363317:p.Ser874Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.S874G	ENST00000374201.3	37	c.2620	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	T	5.595	0.294626	0.10567	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.66995	-0.2;-0.24;-0.23	5.13	1.29	0.21616	.	.	.	.	.	T	0.49966	0.1588	L	0.27053	0.805	0.80722	P	0.0	B;B;B	0.11235	0.004;0.002;0.004	B;B;B	0.09377	0.004;0.002;0.004	T	0.51505	-0.8697	8	0.59425	D	0.04	.	7.5279	0.27666	0.0:0.3176:0.0:0.6824	.	849;874;842	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	G	874;849;842	ENSP00000363317:S874G;ENSP00000307079:S849G;ENSP00000384339:S842G	ENSP00000307079:S849G	S	-	1	0	FRMPD2	49059022	0.002000	0.14202	0.011000	0.14972	0.271000	0.26615	0.662000	0.25038	0.288000	0.22398	0.528000	0.53228	AGC	FRMPD2	-	NULL	ENSG00000170324		0.438	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	61	0.00	0	T	NM_152428		49389016	49389016	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	0.017	C
GAS2L3	283431	genome.wustl.edu	37	12	100994239	100994239	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:100994239G>T	ENST00000539410.1	+	3	484	c.98G>T	c.(97-99)tGt>tTt	p.C33F	GAS2L3_ENST00000547754.1_Missense_Mutation_p.C33F|GAS2L3_ENST00000266754.5_Missense_Mutation_p.C33F|GAS2L3_ENST00000537247.1_5'UTR			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	33					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GCTAATGTTTGTCAGTACGAT	0.443																																						dbGAP											0													182.0	163.0	169.0					12																	100994239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.98G>T	12.37:g.100994239G>T	ENSP00000439672:p.Cys33Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCN2	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.C33F	ENST00000539410.1	37	c.98	CCDS9079.1	12	.	.	.	.	.	.	.	.	.	.	G	4.172	0.030560	0.08101	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000550295;ENST00000539410	T;T;T	0.22336	1.96;1.96;1.96	5.74	4.84	0.62591	.	0.207232	0.52532	D	0.000070	T	0.09686	0.0238	N	0.13043	0.29	0.36768	D	0.883622	B	0.22683	0.073	B	0.20184	0.028	T	0.24083	-1.0170	10	0.09843	T	0.71	-13.9897	6.385	0.21556	0.1447:0.0:0.702:0.1533	.	33	Q86XJ1	GA2L3_HUMAN	F	33	ENSP00000266754:C33F;ENSP00000448955:C33F;ENSP00000439672:C33F	ENSP00000266754:C33F	C	+	2	0	GAS2L3	99518370	1.000000	0.71417	0.998000	0.56505	0.508000	0.34012	3.244000	0.51399	2.709000	0.92574	0.655000	0.94253	TGT	GAS2L3	-	NULL	ENSG00000139354		0.443	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L3	HGNC	protein_coding	OTTHUMT00000409143.1	36	0.00	0	G	NM_174942		100994239	100994239	+1	no_errors	ENST00000266754	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
GDPD4	220032	genome.wustl.edu	37	11	76928025	76928025	+	Missense_Mutation	SNP	A	A	G	rs12363944	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr11:76928025A>G	ENST00000376217.2	-	17	2079	c.1829T>C	c.(1828-1830)gTg>gCg	p.V610A	GDPD4_ENST00000315938.4_3'UTR			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	610					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						TGGCTTATCCACCTTCAGGGT	0.502													A|||	565	0.112819	0.0197	0.1628	5008	,	,		19131	0.0665		0.2883	False		,,,				2504	0.0706					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.1829T>C	11.37:g.76928025A>G	ENSP00000365390:p.Val610Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5B0	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.V610A	ENST00000376217.2	37	c.1829		11	332	0.152014652014652	14	0.028455284552845527	64	0.17679558011049723	24	0.04195804195804196	230	0.3034300791556728	A	0.009	-1.842902	0.00568	.	.	ENSG00000178795	ENST00000376217	T	0.12361	2.69	3.8	-7.6	0.01303	.	4.140840	0.00678	N	0.000671	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.36866	-0.9730	6	0.11794	T	0.64	3.1569	5.7254	0.18010	0.4999:0.0:0.2329:0.2672	rs12363944;rs17751140;rs12363944	.	.	.	A	610	ENSP00000365390:V610A	ENSP00000365390:V610A	V	-	2	0	GDPD4	76605673	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.420000	0.02457	-2.582000	0.00461	-1.054000	0.02325	GTG	GDPD4	-	NULL	ENSG00000178795		0.502	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	GDPD4	HGNC	protein_coding	OTTHUMT00000382075.1	65	0.00	0	A	NM_182833		76928025	76928025	-1	no_errors	ENST00000376217	ensembl	human	known	69_37n	missense	76	11.63	10	SNP	0.000	G
TTC41P	253724	genome.wustl.edu	37	12	104260287	104260287	+	IGR	SNP	T	T	C	rs10778292	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:104260287T>C								RP11-650K20.3 (21845 upstream) : RP11-642P15.1 (47517 downstream)																							AGTTCTCCAATAGCATTCTGT	0.433													T|||	881	0.175919	0.2769	0.1023	5008	,	,		19211	0.0427		0.1501	False		,,,				2504	0.2556					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.104260287T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		12																																																																																			RP11-642P15.1	-	-	ENSG00000214198	0	0.433					GNN	Clone_based_vega_gene			32	0.00	0	T			104260287	104260287	-1	no_errors	ENST00000548527	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	0.000	C
GPATCH4	54865	genome.wustl.edu	37	1	156567712	156567712	+	Missense_Mutation	SNP	C	C	T	rs111439860	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:156567712C>T	ENST00000334588.7	-	4	495	c.310G>A	c.(310-312)Gga>Aga	p.G104R	GPATCH4_ENST00000438976.2_Intron|GPATCH4_ENST00000497287.1_Intron|GPATCH4_ENST00000368232.4_Intron			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	0							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCACAGGATCCCACTATGTTA	0.493													C|||	17	0.00339457	0.0008	0.0058	5008	,	,		20804	0.0		0.006	False		,,,				2504	0.0061					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000334588.7:c.310G>A	1.37:g.156567712C>T	ENSP00000334793:p.Gly104Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Nonsense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.W112*	ENST00000334588.7	37	c.336		1	7	0.003205128205128205	0	0.0	3	0.008287292817679558	0	0.0	4	0.005277044854881266	C	13.56	2.272759	0.40194	.	.	ENSG00000160818	ENST00000334588	.	.	.	3.61	2.6	0.31112	.	.	.	.	.	T	0.21801	0.0525	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25012	-1.0144	5	0.87932	D	0	.	4.402	0.11392	0.0:0.7624:0.0:0.2376	.	.	.	.	R	104	.	ENSP00000334793:G104R	G	-	1	0	GPATCH4	154834336	0.001000	0.12720	0.002000	0.10522	0.105000	0.19272	-0.095000	0.11077	0.918000	0.36919	0.655000	0.94253	GGA	GPATCH4	-	NULL	ENSG00000160818		0.493	GPATCH4-201	KNOWN	basic	protein_coding	GPATCH4	HGNC	protein_coding		31	0.00	0	C	NM_017725		156567712	156567712	-1	no_errors	ENST00000474904	ensembl	human	known	69_37n	nonsense	32	11.11	4	SNP	0.003	T
GPR111	222611	genome.wustl.edu	37	6	47624299	47624299	+	Missense_Mutation	SNP	A	A	G	rs9369730	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr6:47624299A>G	ENST00000296862.1	+	1	77	c.77A>G	c.(76-78)cAt>cGt	p.H26R	GPR111_ENST00000507065.1_5'UTR			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	26					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						ACTCTCATCCATACAAGAGCC	0.567													G|||	2743	0.547724	0.5393	0.4697	5008	,	,		18689	0.3046		0.6759	False		,,,				2504	0.7331					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.77A>G	6.37:g.47624299A>G	ENSP00000296862:p.His26Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.H26R	ENST00000296862.1	37	c.77		6	1121	0.5132783882783882	253	0.5142276422764228	192	0.5303867403314917	170	0.2972027972027972	506	0.6675461741424802	G	8.781	0.928178	0.18131	.	.	ENSG00000164393	ENST00000296862	T	0.23147	1.92	4.01	-0.83	0.10792	.	1.236460	0.06244	N	0.690923	T	0.05960	0.0155	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42413	-0.9453	8	0.87932	D	0	.	3.6906	0.08344	0.4585:0.0:0.3323:0.2092	rs9369730;rs61226971;rs9369730	26	Q8IZF7	GP111_HUMAN	R	26	ENSP00000296862:H26R	ENSP00000296862:H26R	H	+	2	0	GPR111	47732258	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.769000	0.04710	-0.439000	0.07222	-0.119000	0.15052	CAT	GPR111	-	NULL	ENSG00000164393		0.567	GPR111-001	KNOWN	basic	protein_coding	GPR111	HGNC	protein_coding	OTTHUMT00000106423.2	35	0.00	0	A	NM_153839		47624299	47624299	+1	no_errors	ENST00000296862	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.000	G
GPR55	9290	genome.wustl.edu	37	2	231775277	231775277	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:231775277G>T	ENST00000392040.1	-	2	593	c.401C>A	c.(400-402)tCc>tAc	p.S134Y	GPR55_ENST00000392039.2_Missense_Mutation_p.S134Y|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	134					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		CTTCCTGGGGGACCGGAGGTG	0.537																																						dbGAP											0													50.0	49.0	49.0					2																	231775277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.401C>A	2.37:g.231775277G>T	ENSP00000375894:p.Ser134Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N580	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.S134Y	ENST00000392040.1	37	c.401	CCDS2480.1	2	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751956	0.89753	.	.	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	T;T;T	0.42513	0.97;0.97;0.97	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.055625	0.85682	D	0.000000	T	0.70176	0.3194	M	0.86864	2.845	0.53005	D	0.999964	D	0.89917	1.0	D	0.87578	0.998	T	0.74785	-0.3547	10	0.66056	D	0.02	-54.5581	17.2336	0.86991	0.0:0.0:1.0:0.0	.	134	Q9Y2T6	GPR55_HUMAN	Y	134	ENSP00000375894:S134Y;ENSP00000375893:S134Y;ENSP00000412768:S134Y	ENSP00000375893:S134Y	S	-	2	0	GPR55	231483521	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.727000	0.74764	2.660000	0.90430	0.655000	0.94253	TCC	GPR55	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000135898		0.537	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR55	HGNC	protein_coding	OTTHUMT00000332618.1	38	0.00	0	G	NM_005683		231775277	231775277	-1	no_errors	ENST00000392039	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
GRIN3A	116443	genome.wustl.edu	37	9	104375789	104375789	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr9:104375789G>T	ENST00000361820.3	-	6	3235	c.2635C>A	c.(2635-2637)Ccc>Acc	p.P879T	GRIN3A_ENST00000479772.1_5'UTR	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	879					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GGAGAGTTGGGTGGGAGGCCA	0.448																																						dbGAP											0													174.0	145.0	155.0					9																	104375789		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2635C>A	9.37:g.104375789G>T	ENSP00000355155:p.Pro879Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.P879T	ENST00000361820.3	37	c.2635	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797752	0.70567	.	.	ENSG00000198785	ENST00000361820	T	0.28069	1.63	5.14	4.25	0.50352	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.067420	0.64402	D	0.000008	T	0.22205	0.0535	N	0.19112	0.55	0.51012	D	0.999906	P	0.44986	0.847	B	0.40477	0.33	T	0.04693	-1.0933	10	0.62326	D	0.03	.	13.9075	0.63845	0.0741:0.0:0.9259:0.0	.	879	Q8TCU5	NMD3A_HUMAN	T	879	ENSP00000355155:P879T	ENSP00000355155:P879T	P	-	1	0	GRIN3A	103415610	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.602000	0.82796	1.297000	0.44761	-0.136000	0.14681	CCC	GRIN3A	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000198785		0.448	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	42	0.00	0	G			104375789	104375789	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
HILPDA	29923	genome.wustl.edu	37	7	128096678	128096678	+	Intron	SNP	T	T	C	rs2732394	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr7:128096678T>C	ENST00000257696.4	+	2	133				RP11-212P7.3_ENST00000462662.1_RNA|RP11-155G14.6_ENST00000493710.1_RNA|HILPDA_ENST00000481454.1_3'UTR|HILPDA_ENST00000435296.2_Intron	NM_001098786.1|NM_013332.3	NP_001092256.1|NP_037464.1	Q9Y5L2	HLPDA_HUMAN	hypoxia inducible lipid droplet-associated						autocrine signaling (GO:0035425)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of lipid storage (GO:0010884)|response to stress (GO:0006950)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|secretory granule (GO:0030141)	receptor binding (GO:0005102)										AGGGGTTGTGTATTGTGCCTT	0.448													C|||	4225	0.84365	0.8396	0.8084	5008	,	,		20475	0.9504		0.7535	False		,,,				2504	0.8569					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF144755	CCDS5802.1	7q32.1	2011-11-02	2011-11-02	2011-11-02	ENSG00000135245	ENSG00000135245			28859	protein-coding gene	gene with protein product	"""hypoxia inducible gene 2"""		"""chromosome 7 open reading frame 68"""	C7orf68		10690527, 15930302	Standard	NM_001098786		Approved	FLJ21076, HIG-2, HIG2	uc010lli.3	Q9Y5L2	OTTHUMG00000157712	ENST00000257696.4:c.-68-577T>C	7.37:g.128096678T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Z5|Q52LY5|Q53HJ7	RNA	SNP	-	NULL	ENST00000257696.4	37	NULL	CCDS5802.1	7																																																																																			HILPDA	-	-	ENSG00000135245		0.448	HILPDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HILPDA	HGNC	protein_coding	OTTHUMT00000349450.1	43	0.00	0	T	NM_013332		128096678	128096678	+1	no_errors	ENST00000466473	ensembl	human	known	69_37n	rna	58	12.12	8	SNP	0.157	C
HLA-F-AS1	285830	genome.wustl.edu	37	6	29713465	29713465	+	RNA	SNP	T	T	C	rs1633089	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr6:29713465T>C	ENST00000458236.1	-	0	133									HLA-F antisense RNA 1																		AGATCCATCCTGGGACAGCAC	0.532													C|||	3090	0.617013	0.553	0.6527	5008	,	,		21363	0.5893		0.5408	False		,,,				2504	0.7853					dbGAP											0																																										-	-	-			0			AK092748		6p22.1	2013-06-03	2012-08-15		ENSG00000214922	ENSG00000214922		"""Long non-coding RNAs"""	26645	non-coding RNA	RNA, long non-coding			"""HLA-F antisense RNA 1 (non-protein coding)"""				Standard	NR_026972		Approved		uc003nnp.2		OTTHUMG00000185970		6.37:g.29713465T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000458236.1	37	NULL		6																																																																																			HLA-F-AS1	-	-	ENSG00000214922		0.532	HLA-F-AS1-002	KNOWN	basic	processed_transcript	HLA-F-AS1	HGNC	processed_transcript	OTTHUMT00000471862.1	23	0.00	0	T	NR_026972		29713465	29713465	-1	no_errors	ENST00000458236	ensembl	human	known	69_37n	rna	29	14.71	5	SNP	0.000	C
HSD17B7	51478	genome.wustl.edu	37	1	162760551	162760551	+	5'UTR	SNP	C	C	T	rs1704754	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:162760551C>T	ENST00000254521.3	+	0	16				HSD17B7_ENST00000485405.1_3'UTR|HSD17B7_ENST00000367913.1_5'Flank|HSD17B7_ENST00000367915.1_5'UTR|HSD17B7_ENST00000367917.3_5'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7						cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					AAAGCAGCGGCGGTGTTTGCT	0.602													C|||	2661	0.53135	0.1944	0.562	5008	,	,		12025	0.5764		0.7813	False		,,,				2504	0.6616					dbGAP											0													22.0	19.0	20.0					1																	162760551		2201	4278	6479	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.-40C>T	1.37:g.162760551C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	RNA	SNP	-	NULL	ENST00000254521.3	37	NULL	CCDS1242.1	1																																																																																			HSD17B7	-	-	ENSG00000132196		0.602	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B7	HGNC	protein_coding	OTTHUMT00000083207.1	40	0.00	0	C	NM_016371		162760551	162760551	+1	no_errors	ENST00000463037	ensembl	human	known	69_37n	rna	41	16.33	8	SNP	0.000	T
IQCA1P1	392843	genome.wustl.edu	37	7	150893629	150893629	+	RNA	SNP	T	T	C	rs310586	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr7:150893629T>C	ENST00000602518.1	-	0	0							A6NCM1	IQCAL_HUMAN	IQ motif containing with AAA domain 1 pseudogene 1								ATP binding (GO:0005524)										TCACACCGGTTCTTCCATGTA	0.537													T|||	1841	0.367612	0.3185	0.3718	5008	,	,		21618	0.1538		0.5298	False		,,,				2504	0.4847					dbGAP											0																																										-	-	-			0					7q36.1	2014-04-09	2011-04-28	2011-04-28	ENSG00000183016	ENSG00000278685			22831	other	unknown			"""IQ motif containing with AAA domain 1-like"""	IQCA1L			Standard	XR_426269		Approved	TCAG_9762		A6NCM1	OTTHUMG00000156140		7.37:g.150893629T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000602518.1	37	NULL		7																																																																																			IQCA1P1	-	-	ENSG00000183016		0.537	IQCA1P1-004	KNOWN	basic	processed_transcript	IQCA1P1	HGNC	pseudogene	OTTHUMT00000467767.1	40	0.00	0	T			150893629	150893629	-1	no_errors	ENST00000453127	ensembl	human	known	69_37n	rna	53	11.67	7	SNP	0.871	C
ITGAX	3687	genome.wustl.edu	37	16	31367254	31367254	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr16:31367254G>T	ENST00000268296.4	+	2	199	c.78G>T	c.(76-78)gaG>gaT	p.E26D	ITGAX_ENST00000562918.1_3'UTR|ITGAX_ENST00000562522.1_Missense_Mutation_p.E26D	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	26					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						ACACAGAGGAGCTGACAGCCT	0.577																																						dbGAP											0													182.0	173.0	176.0					16																	31367254		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.78G>T	16.37:g.31367254G>T	ENSP00000268296:p.Glu26Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVA6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.E26D	ENST00000268296.4	37	c.78	CCDS10711.1	16	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926566	0.34002	.	.	ENSG00000140678	ENST00000268296	T	0.71698	-0.59	4.42	3.39	0.38822	.	.	.	.	.	T	0.61085	0.2319	N	0.25485	0.75	0.09310	N	1	B;B	0.33826	0.427;0.005	B;B	0.42282	0.382;0.005	T	0.50389	-0.8834	9	0.25106	T	0.35	.	9.1254	0.36812	0.0:0.0:0.7821:0.2179	.	26;26	B4DKQ1;P20702	.;ITAX_HUMAN	D	26	ENSP00000268296:E26D	ENSP00000268296:E26D	E	+	3	2	ITGAX	31274755	0.004000	0.15560	0.020000	0.16555	0.445000	0.32107	0.806000	0.27126	2.469000	0.83416	0.485000	0.47835	GAG	ITGAX	-	NULL	ENSG00000140678		0.577	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	28	0.00	0	G	NM_000887		31367254	31367254	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.043	T
IVNS1ABP	10625	genome.wustl.edu	37	1	185267114	185267114	+	3'UTR	SNP	A	A	G	rs10174	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:185267114A>G	ENST00000367498.3	-	0	2604				IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_3'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein						negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						GTGTACCTCTACTAACCATAA	0.363													A|||	2195	0.438299	0.621	0.3314	5008	,	,		19602	0.247		0.4225	False		,,,				2504	0.4806					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.*53T>C	1.37:g.185267114A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	RNA	SNP	-	NULL	ENST00000367498.3	37	NULL	CCDS1368.1	1																																																																																			IVNS1ABP	-	-	ENSG00000116679		0.363	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	57	0.00	0	A	NM_006469		185267114	185267114	-1	no_errors	ENST00000459929	ensembl	human	known	69_37n	rna	74	11.90	10	SNP	1.000	G
KIAA1328	57536	genome.wustl.edu	37	18	34664093	34664093	+	Intron	SNP	A	A	G	rs323295	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr18:34664093A>G	ENST00000280020.5	+	7	1254				KIAA1328_ENST00000435985.2_Missense_Mutation_p.K129R|KIAA1328_ENST00000586135.1_Missense_Mutation_p.K129R|KIAA1328_ENST00000543923.1_Intron|KIAA1328_ENST00000591619.1_Intron	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328											central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		taCAGGTTAAAAGCTCAGGCT	0.373													G|||	1745	0.348442	0.6611	0.3098	5008	,	,		13281	0.1111		0.34	False		,,,				2504	0.2065					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.1232+16585A>G	18.37:g.34664093A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	NULL	p.K129R	ENST00000280020.5	37	c.386	CCDS45855.1	18	732	0.33516483516483514	305	0.6199186991869918	112	0.30939226519337015	68	0.11888111888111888	247	0.3258575197889182	G	1.840	-0.467563	0.04476	.	.	ENSG00000150477	ENST00000435985	T	0.41400	1.0	5.6	2.69	0.31865	.	0.233835	0.25878	N	0.027709	T	0.00012	0.0000	.	.	.	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.04013	0.001	T	0.46638	-0.9177	8	0.02654	T	1	.	7.7304	0.28783	0.3952:0.0:0.6048:0.0	rs323295;rs1683495;rs52830212;rs323295	129	Q86T90-3	.	R	129	ENSP00000390515:K129R	ENSP00000390515:K129R	K	+	2	0	KIAA1328	32918091	0.999000	0.42202	1.000000	0.80357	0.787000	0.44495	0.253000	0.18296	0.371000	0.24564	-0.227000	0.12334	AAA	KIAA1328	-	NULL	ENSG00000150477		0.373	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	HGNC	protein_coding	OTTHUMT00000440455.1	16	0.00	0	A	NM_020776		34664093	34664093	+1	no_errors	ENST00000435985	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.998	G
KRBA1	84626	genome.wustl.edu	37	7	149418856	149418856	+	Intron	SNP	C	C	T	rs68139633	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr7:149418856C>T	ENST00000485033.2	+	4	466				KRBA1_ENST00000255992.10_Intron|KRBA1_ENST00000319551.8_Intron|KRBA1_ENST00000479560.1_Intron			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1											breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCTGTCATCCCGCCCCGATCA	0.547													C|||	742	0.148163	0.1778	0.1066	5008	,	,		17254	0.1379		0.1501	False		,,,				2504	0.1462					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.466+230C>T	7.37:g.149418856C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	NULL	p.R142C	ENST00000485033.2	37	c.424		7	298	0.13644688644688643	85	0.17276422764227642	37	0.10220994475138122	60	0.1048951048951049	116	0.15303430079155672	C	2.358	-0.347209	0.05208	.	.	ENSG00000133619	ENST00000467333	.	.	.	2.96	-2.38	0.06622	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.25847	-1.0120	3	.	.	.	.	0.3988	0.00422	0.3877:0.1945:0.2375:0.1804	.	.	.	.	C	142	.	.	R	+	1	0	KRBA1	149049789	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.742000	0.01835	-0.496000	0.06650	-1.072000	0.02254	CGC	KRBA1	-	NULL	ENSG00000133619		0.547	KRBA1-004	PUTATIVE	basic	protein_coding	KRBA1	HGNC	protein_coding	OTTHUMT00000349841.3	24	0.00	0	C	NM_032534		149418856	149418856	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000467333	ensembl	human	putative	69_37n	missense	21	16.00	4	SNP	0.000	T
KPNA4	3840	genome.wustl.edu	37	3	160285898	160285898	+	5'Flank	SNP	C	C	T	rs4679895	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr3:160285898C>T	ENST00000334256.4	-	0	0				KPNA4_ENST00000469804.1_5'Flank|KRT8P12_ENST00000468527.1_RNA	NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)						cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			ACTCCAACATCCAGGCTGTAT	0.562													c|||	1434	0.286342	0.1725	0.3732	5008	,	,		21214	0.1825		0.4443	False		,,,				2504	0.3231					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033		3.37:g.160285898C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S6|D3DNM2|O00190	RNA	SNP	-	NULL	ENST00000334256.4	37	NULL	CCDS3191.1	3																																																																																			KRT8P12	-	-	ENSG00000229320		0.562	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT8P12	HGNC	protein_coding	OTTHUMT00000352960.1	34	0.00	0	C	NM_002268		160285898	160285898	+1	no_errors	ENST00000468527	ensembl	human	putative	69_37n	rna	31	13.89	5	SNP	1.000	T
LA16c-380H5.4	0	genome.wustl.edu	37	16	3050133	3050133	+	lincRNA	SNP	G	G	C	rs2524315	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr16:3050133G>C	ENST00000573315.1	+	0	0				LA16c-380H5.3_ENST00000572086.2_lincRNA																							AGTCCTCCTGGGCCCCCGACC	0.597													G|||	3032	0.605431	0.6483	0.5677	5008	,	,		18136	0.5079		0.6113	False		,,,				2504	0.6687					dbGAP											0																																										-	-	-			0																															16.37:g.3050133G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000573315.1	37	NULL		16																																																																																			LINC00514	-	-	ENSG00000262152		0.597	LA16c-380H5.4-001	KNOWN	basic	lincRNA	LINC00514	HGNC	lincRNA	OTTHUMT00000436959.1	34	0.00	0	G			3050133	3050133	+1	no_errors	ENST00000572086	ensembl	human	known	69_37n	rna	41	17.65	9	SNP	0.000	C
LINC00634	339674	genome.wustl.edu	37	22	42354488	42354489	+	RNA	DEL	GA	GA	-	rs376900632		TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr22:42354488_42354489delGA	ENST00000381348.4	+	0	1061_1062					NR_024355.1				long intergenic non-protein coding RNA 634																		GGTTGGTGAGgagagagagaga	0.619																																						dbGAP											0																																										-	-	-			0					22q13.2	2012-10-12			ENSG00000205704	ENSG00000205704		"""Long non-coding RNAs"""	27930	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_024355		Approved				OTTHUMG00000151274		22.37:g.42354498_42354499delGA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000381348.4	37	NULL		22																																																																																			LINC00634	-	-	ENSG00000205704		0.619	LINC00634-002	KNOWN	basic|exp_conf	processed_transcript	LINC00634	HGNC	pseudogene	OTTHUMT00000322049.1	13	0.00	0	GA	NR_024355		42354488	42354489	+1	no_errors	ENST00000381348	ensembl	human	known	69_37n	rna	7	38.46	5	DEL	0.088:0.090	-
MARCH10	162333	genome.wustl.edu	37	17	60827660	60827660	+	Intron	SNP	A	A	G	rs2286567	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:60827660A>G	ENST00000311269.5	-	5	657				MARCH10_ENST00000583600.1_Intron|MARCH10_ENST00000544856.2_Intron|MARCH10_ENST00000456609.2_Intron	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase						protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						GTAGCACAGCACGGCGGGGGA	0.637													G|||	3688	0.736422	0.9372	0.6369	5008	,	,		15710	0.7808		0.5865	False		,,,				2504	0.6442					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.383-5771T>C	17.37:g.60827660A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU09|Q8IYS7|Q8N7Z7	Missense_Mutation	SNP	NULL	p.V132A	ENST00000311269.5	37	c.395	CCDS11635.1	17																																																																																			MARCH10	-	NULL	ENSG00000173838		0.637	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MARCH10	HGNC	protein_coding	OTTHUMT00000445252.1	28	0.00	0	A	NM_152598		60827660	60827660	-1	no_start_codon	ENST00000582568	ensembl	human	putative	69_37n	missense	18	25.00	6	SNP	0.067	G
MGST3	4259	genome.wustl.edu	37	1	165630698	165630698	+	Missense_Mutation	SNP	A	A	G	rs6667681	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:165630698A>G	ENST00000367888.4	+	6	443	c.355A>G	c.(355-357)Act>Gct	p.T119A	Y_RNA_ENST00000384263.1_RNA			O14880	MGST3_HUMAN	microsomal glutathione S-transferase 3	0					glutathione derivative biosynthetic process (GO:1901687)|lipid metabolic process (GO:0006629)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|peroxidase activity (GO:0004601)			endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	6	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Glutathione(DB00143)	cctgggccacactggaagaag	0.398													A|||	4125	0.823682	0.8079	0.7738	5008	,	,		17283	0.994		0.6918	False		,,,				2504	0.8405					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF026977	CCDS1249.1	1q23	2012-06-21			ENSG00000143198	ENSG00000143198	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7064	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase III"", ""microsomal GST-3"", ""microsomal GST-III"""	604564				9278457	Standard	NM_004528		Approved	GST-III	uc001gdf.3	O14880	OTTHUMG00000034627	ENST00000367888.4:c.355A>G	1.37:g.165630698A>G	ENSP00000356863:p.Thr119Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R592|Q6ICN4	Missense_Mutation	SNP	pfam_Membr-assoc_MAPEG	p.T119A	ENST00000367888.4	37	c.355		1	1740	0.7967032967032966	391	0.7947154471544715	259	0.7154696132596685	568	0.993006993006993	522	0.6886543535620053	A	6.897	0.535058	0.13188	.	.	ENSG00000143198	ENST00000367888	T	0.62639	0.01	0.566	0.566	0.17317	.	.	.	.	.	T	0.47875	0.1469	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	T	0.45190	-0.9278	4	0.51188	T	0.08	.	.	.	.	rs6667681;rs60199455	.	.	.	A	119	ENSP00000356863:T119A	ENSP00000356863:T119A	T	+	1	0	MGST3	163897322	.	.	0.101000	0.21167	0.123000	0.20343	.	.	0.466000	0.27193	0.254000	0.18369	ACT	MGST3	-	NULL	ENSG00000143198		0.398	MGST3-005	PUTATIVE	basic	protein_coding	MGST3	HGNC	protein_coding	OTTHUMT00000083877.1	25	0.00	0	A	NM_004528		165630698	165630698	+1	no_errors	ENST00000367888	ensembl	human	putative	69_37n	missense	51	15.00	9	SNP	0.136	G
MON2	23041	genome.wustl.edu	37	12	62902420	62902420	+	Intron	SNP	C	C	T	rs7294404	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:62902420C>T	ENST00000393632.2	+	8	1375				MON2_ENST00000280379.6_Intron|MON2_ENST00000549378.1_3'UTR|MON2_ENST00000552115.1_Intron|MON2_ENST00000393630.3_Intron|MON2_ENST00000552738.1_Intron|MON2_ENST00000546600.1_Intron|MON2_ENST00000393629.2_Intron	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)						actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTGTTCTATCCTTTCTTGAAT	0.363													C|||	1810	0.361422	0.4077	0.3112	5008	,	,		19393	0.3423		0.3598	False		,,,				2504	0.3558					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.984+160C>T	12.37:g.62902420C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	RNA	SNP	-	NULL	ENST00000393632.2	37	NULL	CCDS31849.1	12																																																																																			MON2	-	-	ENSG00000061987		0.363	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	34	0.00	0	C	NM_015026		62902420	62902420	+1	no_errors	ENST00000549378	ensembl	human	known	69_37n	rna	31	16.22	6	SNP	0.006	T
MUC4	4585	genome.wustl.edu	37	3	195492238	195492238	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr3:195492238G>T	ENST00000346145.4	-	8	1032	c.993C>A	c.(991-993)agC>agA	p.S331R	MUC4_ENST00000475231.1_Missense_Mutation_p.S4515R|MUC4_ENST00000349607.4_Missense_Mutation_p.S280R|MUC4_ENST00000463781.3_Missense_Mutation_p.S4567R	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1324					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCGAGGCTGGCTCTTCAGCC	0.632																																						dbGAP											0													42.0	40.0	41.0					3																	195492238		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.993C>A	3.37:g.195492238G>T	ENSP00000304207:p.Ser331Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S4567R	ENST00000346145.4	37	c.13701	CCDS3310.1	3	.	.	.	.	.	.	.	.	.	.	.	7.903	0.734731	0.15574	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.38401	1.14;1.5;1.47;1.45	3.93	-3.8	0.04307	AMOP (2);	1.912540	0.02870	N	0.131518	T	0.16727	0.0402	N	0.16307	0.4	0.09310	N	1	B;B;B;B;B;B;B	0.30709	0.062;0.178;0.013;0.013;0.001;0.001;0.291	B;B;B;B;B;B;B	0.28709	0.053;0.093;0.014;0.009;0.003;0.003;0.061	T	0.06643	-1.0815	10	0.14252	T	0.57	0.016	1.0793	0.01639	0.3775:0.0944:0.2567:0.2714	.	4439;1324;280;331;4567;4515;1272	E7ESK3;Q99102;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;MUC4_HUMAN;.;.;.;.;.	R	280;331;4567;4515;1293	ENSP00000338109:S280R;ENSP00000304207:S331R;ENSP00000417498:S4567R;ENSP00000420243:S4515R	ENSP00000304207:S331R	S	-	3	2	MUC4	196977909	0.185000	0.23213	0.049000	0.19019	0.196000	0.23810	0.013000	0.13310	-0.346000	0.08312	0.461000	0.40582	AGC	MUC4	-	pfam_AMOP,smart_AMOP,pfscan_AMOP	ENSG00000145113		0.632	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1	31	0.00	0	G	NM_018406		195492238	195492238	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.000	T
NBPF22P	285622	genome.wustl.edu	37	5	85583507	85583507	+	RNA	SNP	T	T	G	rs71580744	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr5:85583507T>G	ENST00000590707.1	+	0	773					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		AGCCAGGAGCTGCCAGAGGTG	0.532													t|||	2797	0.558506	0.5303	0.451	5008	,	,		20955	0.8185		0.5	False		,,,				2504	0.4652					dbGAP											0																																										-	-	-			0			BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85583507T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			NBPF22P	-	-	ENSG00000205449		0.532	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	HGNC	pseudogene	OTTHUMT00000453100.1	108	0.92	1	T	XM_208333		85583507	85583507	+1	no_errors	ENST00000590707	ensembl	human	known	69_37n	rna	102	13.56	16	SNP	0.001	G
NOMO1	23420	genome.wustl.edu	37	16	14988868	14988868	+	Missense_Mutation	SNP	A	A	G	rs62038492		TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr16:14988868A>G	ENST00000287667.7	+	30	3629	c.3458A>G	c.(3457-3459)gAa>gGa	p.E1153G		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	1153						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						AAGCTGCCTGAACAGGACATC	0.567																																						dbGAP											0													130.0	127.0	128.0					16																	14988868		2196	4297	6493	-	-	-	SO:0001583	missense	0			X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.3458A>G	16.37:g.14988868A>G	ENSP00000287667:p.Glu1153Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	P78421|Q8IW21|Q96DG0	Missense_Mutation	SNP	pfam_DUF2012,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,superfamily_Collagen-bd_Cna_B-typ_dom	p.E1153G	ENST00000287667.7	37	c.3458	CCDS10556.1	16	742	0.33974358974358976	190	0.3861788617886179	131	0.36187845303867405	99	0.17307692307692307	322	0.42480211081794195	A	15.18	2.756343	0.49362	.	.	ENSG00000103512	ENST00000287667;ENST00000456867;ENST00000536948	T	0.53206	0.63	3.17	3.17	0.36434	.	0.059270	0.64402	D	0.000003	T	0.00012	0.0000	L	0.46157	1.445	0.09310	P	0.999999183453	P	0.38922	0.651	B	0.30401	0.115	T	0.45833	-0.9234	9	0.66056	D	0.02	-25.6144	9.7488	0.40464	1.0:0.0:0.0:0.0	.	1153	Q15155	NOMO1_HUMAN	G	1153;1153;986	ENSP00000287667:E1153G	ENSP00000287667:E1153G	E	+	2	0	NOMO1	14896369	1.000000	0.71417	0.961000	0.40146	0.882000	0.50991	8.098000	0.89540	1.440000	0.47531	0.315000	0.21342	GAA	NOMO1	-	NULL	ENSG00000103512		0.567	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO1	HGNC	protein_coding	OTTHUMT00000207065.1	60	0.00	0	A			14988868	14988868	+1	no_errors	ENST00000287667	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	1.000	G
OTOG	340990	genome.wustl.edu	37	11	17631751	17631751	+	Missense_Mutation	SNP	C	C	T	rs2041028	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr11:17631751C>T	ENST00000399391.2	+	35	4940	c.4940C>T	c.(4939-4941)cCa>cTa	p.P1647L	OTOG_ENST00000342528.2_Missense_Mutation_p.P653L|OTOG_ENST00000399397.1_Missense_Mutation_p.P1574L	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1647	Pro-rich.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						ACGACACCCCCACAGCCCTCC	0.652													T|||	2177	0.434704	0.649	0.2695	5008	,	,		16761	0.2222		0.3767	False		,,,				2504	0.5409					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.4940C>T	11.37:g.17631751C>T	ENSP00000382323:p.Pro1647Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.P1647L	ENST00000399391.2	37	c.4940	CCDS59225.1	11	791	0.36217948717948717	307	0.6239837398373984	98	0.27071823204419887	95	0.1660839160839161	291	0.3839050131926121	T	5.784	0.328982	0.10956	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	T;T;T	0.14640	2.49;2.61;2.93	5.25	4.13	0.48395	.	0.108148	0.36703	N	0.002460	T	0.00012	0.0000	N	0.01168	-0.975	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37361	-0.9709	9	0.06625	T	0.88	.	6.2849	0.21027	0.0:0.1928:0.0:0.8072	rs2041028;rs61262367;rs2041028	653	Q6ZRI0-2	.	L	1647;1574;653	ENSP00000382323:P1647L;ENSP00000382329:P1574L;ENSP00000341666:P653L	ENSP00000341666:P653L	P	+	2	0	OTOG	17588327	0.000000	0.05858	0.024000	0.17045	0.095000	0.18619	0.105000	0.15333	0.841000	0.35020	-0.254000	0.11334	CCA	OTOG	-	NULL	ENSG00000188162		0.652	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		25	0.00	0	C			17631751	17631751	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.002	T
PDZK1P1	728939	genome.wustl.edu	37	1	145931852	145931852	+	RNA	SNP	A	A	C	rs202245677	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:145931852A>C	ENST00000401011.2	-	0	2545					NR_003377.2		A8MUH7	PDZ1P_HUMAN	PDZ domain containing 1 pseudogene 1																		ACCAGTCTGTACATGTTGTCC	0.438													a|||	1474	0.294329	0.118	0.3473	5008	,	,		11122	0.5159		0.3241	False		,,,				2504	0.2362					dbGAP											0																																										-	-	-			0			AL390725		1q21.1	2008-09-08			ENSG00000215860				31974	pseudogene	pseudogene							Standard			Approved	OTTHUMT00000038524	uc010ozf.2	A8MUH7	OTTHUMG00000013746		1.37:g.145931852A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000401011.2	37	NULL		1																																																																																			PDZK1P1	-	-	ENSG00000215860		0.438	PDZK1P1-002	KNOWN	basic	processed_transcript	PDZK1P1	HGNC	pseudogene	OTTHUMT00000038525.1	96	0.00	0	A			145931852	145931852	-1	no_errors	ENST00000401011	ensembl	human	known	69_37n	rna	111	11.20	14	SNP	0.981	C
PIK3C2G	5288	genome.wustl.edu	37	12	18435399	18435401	+	In_Frame_Del	DEL	CCC	CCC	-	rs398055356|rs35277916	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	CCC	CCC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:18435399_18435401delCCC	ENST00000266497.5	+	1	422_424	c.384_386delCCC	c.(382-387)agcccc>agc	p.P129del	PIK3C2G_ENST00000538779.1_In_Frame_Del_p.P129del|PIK3C2G_ENST00000535651.1_In_Frame_Del_p.P129del|RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000433979.1_In_Frame_Del_p.P129del			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	129				Missing (in Ref. 3; EAW96387 and 4; AAI30278). {ECO:0000305}.	chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CCTGGGGAAGCCCCATAGGAAAA	0.374														1544	0.308307	0.1989	0.3934	5008	,	,		18294	0.3046		0.3917	False		,,,				2504	0.3139					dbGAP											0										763,2763		88,587,1088						0.4	0.1		dbSNP_126	65	3123,4701		610,1903,1399	no	coding	PIK3C2G	NM_004570.4		698,2490,2487	A1A1,A1R,RR		39.9156,21.6393,34.2379				3886,7464				-	-	-	SO:0001651	inframe_deletion	0			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.384_386delCCC	12.37:g.18435399_18435401delCCC	ENSP00000266497:p.Pro129del	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U0	In_Frame_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.P129in_frame_del	ENST00000266497.5	37	c.384_386	CCDS44839.1	12																																																																																			PIK3C2G	-	NULL	ENSG00000139144		0.374	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	36	0.00	0	CCC	NM_004570		18435399	18435401	+1	no_errors	ENST00000538779	ensembl	human	known	69_37n	in_frame_del	50	12.28	7	DEL	0.001:0.000:0.000	-
PDXDC1	23042	genome.wustl.edu	37	16	15226880	15226880	+	Intron	SNP	G	G	A	rs151262004	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr16:15226880G>A	ENST00000535621.2	+	17	1587				RP11-1186N24.5_ENST00000605794.1_RNA|PKD1P6_ENST00000424133.2_RNA			Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTCTTCATGGGCAAAACAGGG	0.627													.|||	840	0.167732	0.1082	0.1153	5008	,	,		18382	0.2232		0.1272	False		,,,				2504	0.2699					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-5856G>A	16.37:g.15226880G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	RNA	SNP	-	NULL	ENST00000535621.2	37	NULL		16																																																																																			PKD1P6	-	-	ENSG00000250251		0.627	PDXDC1-016	PUTATIVE	basic	protein_coding	PKD1P6	HGNC	protein_coding	OTTHUMT00000422421.1	30	0.00	0	G	NM_015027		15226880	15226880	-1	no_errors	ENST00000540075	ensembl	human	known	69_37n	rna	37	11.90	5	SNP	0.274	A
PLD5	200150	genome.wustl.edu	37	1	242687390	242687390	+	Splice_Site	SNP	G	G	A	rs2810008	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:242687390G>A	ENST00000536534.2	-	1	430	c.189C>T	c.(187-189)caC>caT	p.H63H	PLD5_ENST00000442594.2_5'UTR			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	63						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TCGCCCTTACGTGCTCCAGCT	0.706													G|||	1449	0.289337	0.3684	0.3141	5008	,	,		12087	0.1577		0.33	False		,,,				2504	0.2587					dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.189+1C>T	1.37:g.242687390G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	smart_PLipase_D/transphosphatidylase	p.H63	ENST00000536534.2	37	c.189	CCDS1621.2	1																																																																																			PLD5	-	NULL	ENSG00000180287		0.706	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	29	0.00	0	G	NM_152666	Silent	242687390	242687390	-1	no_errors	ENST00000536534	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	1.000	A
PLEKHA3	65977	genome.wustl.edu	37	2	179367086	179367086	+	Intron	SNP	A	A	G	rs967507	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:179367086A>G	ENST00000234453.5	+	7	1177					NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			aatgaaggaaagaaaccggga	0.378													G|||	2040	0.407348	0.5613	0.2233	5008	,	,		15540	0.6696		0.166	False		,,,				2504	0.3078					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.775+1183A>G	2.37:g.179367086A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG69|Q86TQ1|Q9NXT3	Missense_Mutation	SNP	NULL	p.R76G	ENST00000234453.5	37	c.226	CCDS33336.1	2	830	0.38003663003663	271	0.5508130081300813	73	0.20165745856353592	363	0.6346153846153846	123	0.16226912928759896	G	8.870	0.949125	0.18356	.	.	ENSG00000116095	ENST00000421187	.	.	.	2.86	-4.7	0.03288	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.39820	-0.9595	4	0.19590	T	0.45	.	5.6448	0.17584	0.4021:0.0:0.4377:0.1602	rs967507;rs58560516;rs967507	.	.	.	G	76	.	ENSP00000396136:R76G	R	+	1	2	PLEKHA3	179075332	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.268000	0.08607	-1.669000	0.01470	-1.145000	0.01858	AGA	PLEKHA3	-	NULL	ENSG00000116095		0.378	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA3	HGNC	protein_coding	OTTHUMT00000335241.2	34	0.00	0	A	NM_019091		179367086	179367086	+1	no_start_codon	ENST00000421187	ensembl	human	putative	69_37n	missense	28	15.15	5	SNP	0.000	G
PRAMEF2	65122	genome.wustl.edu	37	1	12921333	12921333	+	Missense_Mutation	SNP	G	G	A	rs56145411	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:12921333G>A	ENST00000240189.2	+	4	1211	c.1124G>A	c.(1123-1125)tGc>tAc	p.C375Y		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	375			C -> R (in dbSNP:rs17039307).		negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGCCTGAGCTGCTGCTCCCAG	0.562													.|||	1359	0.271366	0.3858	0.1844	5008	,	,		27344	0.2857		0.2157	False		,,,				2504	0.2209					dbGAP											0													111.0	118.0	116.0					1																	12921333		2201	4294	6495	-	-	-	SO:0001583	missense	0				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.1124G>A	1.37:g.12921333G>A	ENSP00000240189:p.Cys375Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C375Y	ENST00000240189.2	37	c.1124	CCDS149.1	1	357	0.16346153846153846	115	0.23373983739837398	63	0.17403314917127072	80	0.13986013986013987	99	0.13060686015831136	g	3.142	-0.176022	0.06380	.	.	ENSG00000120952	ENST00000240189	T	0.09163	3.01	0.824	-0.682	0.11339	.	1.330770	0.04798	N	0.433017	T	0.00012	0.0000	L	0.34521	1.04	0.58432	P	1.999999999946489E-6	B	0.09022	0.002	B	0.29440	0.102	T	0.47114	-0.9142	9	0.72032	D	0.01	.	5.1225	0.14867	0.5904:0.0:0.4096:0.0	rs56145411	375	O60811	PRAM2_HUMAN	Y	375	ENSP00000240189:C375Y	ENSP00000240189:C375Y	C	+	2	0	PRAMEF2	12843920	0.000000	0.05858	0.596000	0.28811	0.002000	0.02628	-0.801000	0.04550	-2.179000	0.00767	-2.900000	0.00093	TGC	PRAMEF2	-	NULL	ENSG00000120952		0.562	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	HGNC	protein_coding	OTTHUMT00000005517.1	97	0.00	0	G	NM_023014		12921333	12921333	+1	no_errors	ENST00000240189	ensembl	human	known	69_37n	missense	94	10.48	11	SNP	0.676	A
PRAMEF4	400735	genome.wustl.edu	37	1	12943200	12943200	+	Missense_Mutation	SNP	A	A	G	rs3121079		TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:12943200A>G	ENST00000235349.5	-	2	86	c.16T>C	c.(16-18)Tgg>Cgg	p.W6R		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	6					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGGAGTCCAGATGCTCATC	0.557																																						dbGAP											0													125.0	135.0	132.0					1																	12943200		2179	4285	6464	-	-	-	SO:0001583	missense	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.16T>C	1.37:g.12943200A>G	ENSP00000235349:p.Trp6Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Missense_Mutation	SNP	NULL	p.W6R	ENST00000235349.5	37	c.16	CCDS30592.1	1	.	.	.	.	.	.	.	.	.	.	N	0.003	-2.577187	0.00131	.	.	ENSG00000243073	ENST00000235349	T	0.04406	3.63	1.48	0.538	0.17150	.	2.863710	0.01212	N	0.007864	T	0.01870	0.0059	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40572	-0.9556	10	0.11794	T	0.64	.	4.0418	0.09755	0.4291:0.0:0.5709:0.0	rs3121079	6	O60810	PRAM4_HUMAN	R	6	ENSP00000235349:W6R	ENSP00000235349:W6R	W	-	1	0	PRAMEF4	12865787	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.845000	0.01677	-0.151000	0.11176	-0.498000	0.04607	TGG	PRAMEF4	-	NULL	ENSG00000243073		0.557	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	63	0.00	0	A	NM_001009611		12943200	12943200	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	0.000	G
PRSS51	346702	genome.wustl.edu	37	8	10356187	10356187	+	RNA	SNP	C	C	T	rs12675153	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr8:10356187C>T	ENST00000523024.1	-	0	287				PRSS51_ENST00000521149.1_RNA					protease, serine, 51																		ATTGAGCCTCCACAGAGGTGT	0.488													C|||	1676	0.334665	0.2163	0.3487	5008	,	,		21412	0.3423		0.3171	False		,,,				2504	0.4949					dbGAP											0																																										-	-	-			0					8p23.1	2013-01-16			ENSG00000253649	ENSG00000253649			37321	other	unknown							Standard			Approved				OTTHUMG00000163805		8.37:g.10356187C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000523024.1	37	NULL		8																																																																																			PRSS51	-	-	ENSG00000253649		0.488	PRSS51-002	KNOWN	basic	antisense	PRSS51	HGNC	antisense	OTTHUMT00000375669.1	35	0.00	0	C			10356187	10356187	-1	no_errors	ENST00000523024	ensembl	human	known	69_37n	rna	29	14.71	5	SNP	0.999	T
PTPRVP	148713	genome.wustl.edu	37	1	202140436	202140436	+	RNA	SNP	A	A	T	rs10920348	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:202140436A>T	ENST00000482597.1	+	0	1167					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		GTGGAGAAGAATATCACTCTA	0.592													A|||	878	0.175319	0.3434	0.1369	5008	,	,		18928	0.1012		0.161	False		,,,				2504	0.0665					dbGAP											0																																										-	-	-			0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202140436A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.592	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	45	0.00	0	A	XM_086287		202140436	202140436	+1	no_errors	ENST00000482597	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.000	T
RNF126P1	376412	genome.wustl.edu	37	17	55123297	55123297	+	RNA	SNP	G	G	A	rs7214370	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:55123297G>A	ENST00000567452.1	+	0	459					NR_002818.2				ring finger protein 126 pseudogene 1																		CGGCCGGCACGAAGGCCTCCC	0.706													g|||	1075	0.214657	0.3109	0.1844	5008	,	,		12680	0.1687		0.1909	False		,,,				2504	0.1779					dbGAP											0																																										-	-	-			0			BC033555		17q23.2	2004-04-22				ENSG00000261192		"""RING-type (C3HC4) zinc fingers"""	30340	pseudogene	pseudogene						12477932	Standard	NR_002818		Approved		uc002iuw.3				17.37:g.55123297G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567452.1	37	NULL		17																																																																																			RNF126P1	-	-	ENSG00000261192		0.706	RNF126P1-002	KNOWN	basic	processed_transcript	RNF126P1	HGNC	pseudogene	OTTHUMT00000431453.1	57	0.00	0	G			55123297	55123297	+1	no_errors	ENST00000567452	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	0.916	A
RBAK-RBAKDN	100533952	genome.wustl.edu	37	7	5036758	5036758	+	Intron	SNP	A	A	C	rs9639895	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr7:5036758A>C	ENST00000407184.1	+	2	222				RNF216P1_ENST00000471244.1_RNA					RBAK-RBAKDN readthrough																		ACCCTAGCTGATGCTGGGAGC	0.577													C|||	3718	0.742412	0.8971	0.6859	5008	,	,		16617	0.6637		0.7555	False		,,,				2504	0.6411					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.-45+12052A>C	7.37:g.5036758A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000407184.1	37	NULL		7																																																																																			RNF216P1	-	-	ENSG00000196204		0.577	RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	RNF216P1	HGNC	protein_coding	OTTHUMT00000472007.1	54	0.00	0	A			5036758	5036758	+1	no_errors	ENST00000403969	ensembl	human	known	69_37n	rna	40	16.67	8	SNP	0.920	C
RPLP0P2	113157	genome.wustl.edu	37	11	61405104	61405104	+	RNA	SNP	T	T	G	rs12281961	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr11:61405104T>G	ENST00000496593.1	+	0	1708					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		ATTGGGTCTCTTTGACTAATC	0.428													T|||	715	0.142772	0.0567	0.2046	5008	,	,		16874	0.0208		0.2883	False		,,,				2504	0.1912					dbGAP											0																																										-	-	-			0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405104T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.428	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	51	0.00	0	T	NR_002775		61405104	61405104	+1	no_errors	ENST00000496593	ensembl	human	known	69_37n	rna	58	10.77	7	SNP	1.000	G
RPTOR	57521	genome.wustl.edu	37	17	78519122	78519122	+	5'UTR	SNP	C	C	T	rs8075710	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:78519122C>T	ENST00000306801.3	+	0	55				RPTOR_ENST00000544334.2_5'Flank|RPTOR_ENST00000570891.1_5'UTR|RPTOR_ENST00000537330.1_5'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1						cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CAGCTCCCCTCGCAGCCCCTC	0.627													C|||	533	0.10643	0.388	0.0288	5008	,	,		14662	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.-308C>T	17.37:g.78519122C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	RNA	SNP	-	NULL	ENST00000306801.3	37	NULL	CCDS11773.1	17																																																																																			RPTOR	-	-	ENSG00000141564		0.627	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	19	0.00	0	C	NM_020761		78519122	78519122	+1	no_errors	ENST00000577161	ensembl	human	known	69_37n	rna	15	21.05	4	SNP	0.215	T
SMAD5	4090	genome.wustl.edu	37	5	135469527	135469527	+	Intron	SNP	T	T	G	rs3764941	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr5:135469527T>G	ENST00000514641.2	+	1	118				SMAD5_ENST00000545279.1_Intron|SMAD5-AS1_ENST00000297163.3_RNA|SMAD5_ENST00000545620.1_Intron			Q99717	SMAD5_HUMAN	SMAD family member 5						BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCAAAACAGATTTTTGGTTGC	0.502													T|||	1843	0.368011	0.5862	0.2406	5008	,	,		12746	0.3819		0.328	False		,,,				2504	0.1902					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000514641.2:c.118+876T>G	5.37:g.135469527T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O14688|Q15798|Q9UQA1	RNA	SNP	-	NULL	ENST00000514641.2	37	NULL		5																																																																																			SMAD5-AS1	-	-	ENSG00000164621		0.502	SMAD5-001	KNOWN	basic	processed_transcript	SMAD5-AS1	HGNC	protein_coding	OTTHUMT00000372096.2	107	0.93	1	T	NM_005903		135469527	135469527	-1	no_errors	ENST00000297163	ensembl	human	known	69_37n	rna	121	12.32	17	SNP	0.086	G
SMYD2	56950	genome.wustl.edu	37	1	214500907	214500907	+	Intron	SNP	A	A	C	rs17022608	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:214500907A>C	ENST00000366957.5	+	7	624				SMYD2_ENST00000491455.1_Intron|SMYD2_ENST00000415093.2_Intron	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		GTAGTGAAGGAAGCTAAACAG	0.373													A|||	1037	0.207069	0.2958	0.2752	5008	,	,		20878	0.002		0.2992	False		,,,				2504	0.1554					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.603-58A>C	1.37:g.214500907A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	RNA	SNP	-	NULL	ENST00000366957.5	37	NULL	CCDS31022.1	1																																																																																			SMYD2	-	-	ENSG00000143499		0.373	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD2	HGNC	protein_coding	OTTHUMT00000089998.1	35	0.00	0	A	NM_020197		214500907	214500907	+1	no_errors	ENST00000484459	ensembl	human	putative	69_37n	rna	31	20.00	8	SNP	0.000	C
SSC5D	284297	genome.wustl.edu	37	19	56029188	56029188	+	Missense_Mutation	SNP	C	C	G	rs77400028	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr19:56029188C>G	ENST00000389623.6	+	14	3568	c.3545C>G	c.(3544-3546)aCc>aGc	p.T1182S		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1182	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						cctcaccccaccacgacccct	0.592													-|||	793	0.158347	0.2814	0.1859	5008	,	,		9379	0.2034		0.0736	False		,,,				2504	0.0133					dbGAP											0													228.0	215.0	219.0					19																	56029188		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3545C>G	19.37:g.56029188C>G	ENSP00000374274:p.Thr1182Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.T1182S	ENST00000389623.6	37	c.3545	CCDS46196.1	19	352	0.16117216117216118	130	0.26422764227642276	52	0.143646408839779	115	0.20104895104895104	55	0.07255936675461741	-	9.773	1.173262	0.21704	.	.	ENSG00000179954	ENST00000389623	T	0.01279	5.06	2.9	0.455	0.16649	.	.	.	.	.	T	0.00012	0.0000	L	0.52759	1.655	0.80722	P	0.0	P	0.40731	0.728	B	0.28991	0.097	T	0.50154	-0.8861	8	0.48119	T	0.1	.	4.1235	0.10116	0.0:0.6051:0.2425:0.1524	.	1182	A1L4H1	SRCRL_HUMAN	S	1182	ENSP00000374274:T1182S	ENSP00000374274:T1182S	T	+	2	0	SSC5D	60721000	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.136000	0.10405	-0.075000	0.12798	0.282000	0.19409	ACC	SSC5D	-	NULL	ENSG00000179954		0.592	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	HGNC	protein_coding	OTTHUMT00000453345.2	31	0.00	0	C	XM_001718392		56029188	56029188	+1	no_errors	ENST00000389623	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.002	G
SSC5D	284297	genome.wustl.edu	37	19	56029191	56029191	+	Missense_Mutation	SNP	C	C	T	rs76172483	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr19:56029191C>T	ENST00000389623.6	+	14	3571	c.3548C>T	c.(3547-3549)aCg>aTg	p.T1183M		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1183	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						caccccaccacgacccctcac	0.592													-|||	797	0.159145	0.2837	0.1859	5008	,	,		9314	0.2044		0.0736	False		,,,				2504	0.0133					dbGAP											0													231.0	217.0	221.0					19																	56029191		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3548C>T	19.37:g.56029191C>T	ENSP00000374274:p.Thr1183Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.T1183M	ENST00000389623.6	37	c.3548	CCDS46196.1	19	360	0.16483516483516483	138	0.2804878048780488	52	0.143646408839779	115	0.20104895104895104	55	0.07255936675461741	-	6.828	0.521990	0.13005	.	.	ENSG00000179954	ENST00000389623	T	0.01335	5.0	3.2	2.13	0.27403	.	.	.	.	.	T	0.00012	0.0000	L	0.54323	1.7	0.80722	P	0.0	D	0.56035	0.974	P	0.46362	0.514	T	0.54695	-0.8255	8	0.38643	T	0.18	.	6.8708	0.24119	0.0:0.856:0.0:0.144	.	1183	A1L4H1	SRCRL_HUMAN	M	1183	ENSP00000374274:T1183M	ENSP00000374274:T1183M	T	+	2	0	SSC5D	60721003	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-1.740000	0.01839	0.461000	0.27071	-0.760000	0.03462	ACG	SSC5D	-	NULL	ENSG00000179954		0.592	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	HGNC	protein_coding	OTTHUMT00000453345.2	29	0.00	0	C	XM_001718392		56029191	56029191	+1	no_errors	ENST00000389623	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	0.002	T
STAT2	6773	genome.wustl.edu	37	12	56742755	56742755	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr12:56742755C>T	ENST00000314128.4	-	17	1552	c.1529G>A	c.(1528-1530)cGa>cAa	p.R510Q	STAT2_ENST00000557235.1_Missense_Mutation_p.R506Q|STAT2_ENST00000556539.1_5'UTR			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	510					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						GTTGAGGCCTCGGCCAACATA	0.567																																						dbGAP											0													77.0	78.0	77.0					12																	56742755		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1529G>A	12.37:g.56742755C>T	ENSP00000315768:p.Arg510Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.R510Q	ENST00000314128.4	37	c.1529	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111633	0.56398	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000553337	D;D	0.90563	-2.69;-2.69	4.89	-0.111	0.13576	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	L	0.48877	1.53	0.80722	D	1	P;B	0.45715	0.865;0.164	B;B	0.38020	0.263;0.027	T	0.78940	-0.2006	10	0.59425	D	0.04	-1.83	9.7185	0.40289	0.0:0.5368:0.0:0.4632	.	506;510	G3V2M6;P52630	.;STAT2_HUMAN	Q	510;506;312	ENSP00000315768:R510Q;ENSP00000450751:R506Q	ENSP00000315768:R510Q	R	-	2	0	STAT2	55029022	0.869000	0.29996	0.074000	0.20217	0.218000	0.24690	1.631000	0.37092	-0.124000	0.11724	0.563000	0.77884	CGA	STAT2	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000170581		0.567	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	HGNC	protein_coding	OTTHUMT00000410277.1	20	0.00	0	C	NM_005419		56742755	56742755	-1	no_errors	ENST00000314128	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	0.909	T
SVOPL	136306	genome.wustl.edu	37	7	138279228	138279228	+	IGR	SNP	A	A	T	rs1439793|rs548460013	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr7:138279228A>T	ENST00000419765.3	-	0	1523				SVOPL_ENST00000463557.1_5'UTR|SVOPL_ENST00000436657.1_3'UTR|SVOPL_ENST00000421622.1_3'UTR|SVOPL_ENST00000288513.5_3'UTR	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like							integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						ATATGCCTTTAAAAAAAAAAT	0.284													A|||	3518	0.702476	0.9039	0.6009	5008	,	,		14689	0.5099		0.7087	False		,,,				2504	0.6943					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870		7.37:g.138279228A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000419765.3	37	NULL	CCDS47721.1	7																																																																																			SVOPL	-	-	ENSG00000157703		0.284	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SVOPL	HGNC	protein_coding	OTTHUMT00000342092.4	34	0.00	0	A	NM_174959		138279228	138279228	-1	no_errors	ENST00000463557	ensembl	human	known	69_37n	rna	33	29.79	14	SNP	0.000	T
SYNE1	23345	genome.wustl.edu	37	6	152472750	152472750	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr6:152472750G>T	ENST00000367255.5	-	135	24989	c.24388C>A	c.(24388-24390)Cag>Aag	p.Q8130K	SYNE1_ENST00000539504.1_Missense_Mutation_p.Q285K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q7742K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q8130K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q8059K|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000354674.4_Missense_Mutation_p.Q285K|SYNE1_ENST00000356820.4_Missense_Mutation_p.Q2654K|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q8059K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8130					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTAGTGAGCTGCAGATCCATC	0.408										HNSCC(10;0.0054)																												dbGAP											0													48.0	48.0	48.0					6																	152472750		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24388C>A	6.37:g.152472750G>T	ENSP00000356224:p.Gln8130Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q8130K	ENST00000367255.5	37	c.24388	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	35	5.461038	0.96240	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.97	5.97	0.96955	.	0.000000	0.53938	D	0.000050	T	0.63236	0.2494	M	0.68593	2.085	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999	T	0.55933	-0.8062	10	0.36615	T	0.2	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	8130;8130;8059;8059;332	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	K	8130;285;776;8059;8130;8059;7742;2654;292;287;1052;285	ENSP00000356224:Q8130K;ENSP00000441052:Q285K;ENSP00000356226:Q776K;ENSP00000396024:Q8059K;ENSP00000265368:Q8130K;ENSP00000390975:Q8059K;ENSP00000341887:Q7742K;ENSP00000349276:Q2654K;ENSP00000356220:Q1052K;ENSP00000346701:Q285K	ENSP00000265368:Q8130K	Q	-	1	0	SYNE1	152514443	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.624000	0.98398	2.836000	0.97738	0.655000	0.94253	CAG	SYNE1	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.408	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	28	0.00	0	G	NM_182961		152472750	152472750	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	28	12.12	4	SNP	1.000	T
SYS1	90196	genome.wustl.edu	37	20	43996012	43996012	+	3'UTR	SNP	G	G	T	rs2664543	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr20:43996012G>T	ENST00000243918.5	+	0	1019				SYS1_ENST00000479779.1_3'UTR|SYS1_ENST00000426004.1_Intron|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1-DBNDD2_ENST00000452133.1_Intron	NM_033542.3	NP_291020.1	Q8N2H4	SYS1_HUMAN	Sys1 golgi trafficking protein						protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|large_intestine(2)|prostate(1)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				GGTAATAACAGAATTGGAACC	0.458													G|||	2784	0.555911	0.7837	0.5216	5008	,	,		21003	0.2609		0.664	False		,,,				2504	0.4652					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AL021578	CCDS13351.1, CCDS56192.1	20q13.12	2014-05-07	2014-05-07	2006-11-06	ENSG00000204070	ENSG00000204070			16162	protein-coding gene	gene with protein product		612979	"""chromosome 20 open reading frame 169"", ""SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)"""	C20orf169		15077113	Standard	NM_001197129		Approved	dJ453C12.4	uc002xnv.3	Q8N2H4	OTTHUMG00000032579	ENST00000243918.5:c.*257G>T	20.37:g.43996012G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JFB3|E1P620|Q5QPU7|Q96SD8|Q9BQZ2|Q9BQZ4|Q9H1F7	RNA	SNP	-	NULL	ENST00000243918.5	37	NULL	CCDS13351.1	20																																																																																			SYS1	-	-	ENSG00000204070		0.458	SYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYS1	HGNC	protein_coding	OTTHUMT00000079453.2	20	0.00	0	G	NM_033542		43996012	43996012	+1	no_errors	ENST00000479779	ensembl	human	known	69_37n	rna	18	25.00	6	SNP	0.997	T
TBATA	219793	genome.wustl.edu	37	10	72532037	72532037	+	Intron	SNP	C	C	T	rs2253793	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr10:72532037C>T	ENST00000299290.1	-	10	1360				TBATA_ENST00000394982.2_5'UTR	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)											atgtaagttccgtgacagcag	0.423													C|||	1860	0.371406	0.4357	0.4885	5008	,	,		15441	0.2996		0.341	False		,,,				2504	0.3067					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.970+232G>A	10.37:g.72532037C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPA8|B2RPQ2|Q5T4G2	Missense_Mutation	SNP	NULL	p.R20Q	ENST00000299290.1	37	c.59	CCDS7308.1	10	791	0.36217948717948717	202	0.4105691056910569	169	0.46685082872928174	177	0.3094405594405594	243	0.32058047493403696	C	6.987	0.552276	0.13374	.	.	ENSG00000166220	ENST00000394982	.	.	.	2.8	-4.84	0.03151	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	2.9999999999752447E-6	.	.	.	.	.	.	T	0.39396	-0.9616	4	0.87932	D	0	.	5.5671	0.17177	0.0:0.2165:0.4518:0.3317	rs2253793;rs3740433;rs60203576;rs2253793	.	.	.	Q	20	.	ENSP00000378433:R20Q	R	-	2	0	C10orf27	72202043	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.424000	0.01029	-1.302000	0.02335	-1.263000	0.01449	CGG	TBATA	-	NULL	ENSG00000166220		0.423	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBATA	HGNC	protein_coding	OTTHUMT00000048519.1	50	0.00	0	C	NM_152710		72532037	72532037	-1	no_start_codon	ENST00000394982	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	0.000	T
TBC1D20	128637	genome.wustl.edu	37	20	417255	417255	+	3'UTR	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr20:417255G>T	ENST00000354200.4	-	0	3334				TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20						acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				GGCAGCTGGTGCCGCCCACTG	0.527																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.*1975C>A	20.37:g.417255G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	RNA	SNP	-	NULL	ENST00000354200.4	37	NULL	CCDS13002.1	20																																																																																			TBC1D20	-	-	ENSG00000125875		0.527	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2	31	0.00	0	G	NM_144628		417255	417255	-1	no_errors	ENST00000461188	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.000	T
TIMM17A	10440	genome.wustl.edu	37	1	201938995	201938995	+	3'UTR	SNP	C	C	T	rs7513	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:201938995C>T	ENST00000367287.4	+	0	865				TIMM17A_ENST00000482943.1_3'UTR	NM_006335.2	NP_006326.1	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17 homolog A (yeast)						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|lung(3)|stomach(1)	5						TGATCATCATCTCCTTGCGGA	0.348													C|||	1810	0.361422	0.2451	0.2666	5008	,	,		19982	0.3343		0.4672	False		,,,				2504	0.5051					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF106622	CCDS1417.1	1q32.1	2008-05-23			ENSG00000134375	ENSG00000134375			17315	protein-coding gene	gene with protein product		605057				8893850, 10339406	Standard	NM_006335		Approved	TIM17, TIM17A	uc001gxc.3	Q99595	OTTHUMG00000035806	ENST00000367287.4:c.*313C>T	1.37:g.201938995C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDM5|Q9BWF5	RNA	SNP	-	NULL	ENST00000367287.4	37	NULL	CCDS1417.1	1																																																																																			TIMM17A	-	-	ENSG00000134375		0.348	TIMM17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM17A	HGNC	protein_coding	OTTHUMT00000087092.1	43	0.00	0	C	NM_006335		201938995	201938995	+1	no_errors	ENST00000482943	ensembl	human	known	69_37n	rna	49	12.50	7	SNP	0.392	T
TLK2	11011	genome.wustl.edu	37	17	60663562	60663562	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr17:60663562G>T	ENST00000326270.9	+	17	1769	c.1501G>T	c.(1501-1503)Gat>Tat	p.D501Y	TLK2_ENST00000542523.1_Missense_Mutation_p.D447Y|TLK2_ENST00000343388.7_Missense_Mutation_p.D447Y|TLK2_ENST00000346027.5_Missense_Mutation_p.D479Y|TLK2_ENST00000582809.1_Missense_Mutation_p.D330Y	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	501	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						AAACTGGAGAGATGAGAAAAA	0.308																																						dbGAP											0													37.0	38.0	37.0					17																	60663562		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1501G>T	17.37:g.60663562G>T	ENSP00000316512:p.Asp501Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D501Y	ENST00000326270.9	37	c.1501		17	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319614	0.81469	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045522	0.85682	D	0.000000	T	0.73806	0.3634	L	0.43923	1.385	0.80722	D	1	D;D;D;D	0.69078	0.993;0.96;0.98;0.997	D;P;P;D	0.72075	0.956;0.844;0.77;0.976	T	0.75986	-0.3124	10	0.87932	D	0	-6.333	17.8589	0.88775	0.0:0.0:1.0:0.0	.	501;447;479;479	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	Y	479;447;501;447	ENSP00000275780:D479Y;ENSP00000340800:D447Y;ENSP00000316512:D501Y;ENSP00000442311:D447Y	ENSP00000316512:D501Y	D	+	1	0	TLK2	58017294	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.489000	0.97949	2.556000	0.86216	0.563000	0.77884	GAT	TLK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000146872		0.308	TLK2-004	KNOWN	basic	protein_coding	TLK2	HGNC	protein_coding	OTTHUMT00000445140.1	23	0.00	0	G	NM_006852		60663562	60663562	+1	no_errors	ENST00000326270	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
TNFRSF1B	7133	genome.wustl.edu	37	1	12268499	12268499	+	3'UTR	SNP	G	G	A	rs1061631	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr1:12268499G>A	ENST00000376259.3	+	0	2897				TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B						aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GTTGCGTGTCGTGGGTGTGTG	0.582													G|||	578	0.115415	0.0295	0.0937	5008	,	,		19187	0.0923		0.2197	False		,,,				2504	0.1636					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.*1422G>A	1.37:g.12268499G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJZ3|Q16042|Q6YI29|Q9UIH1	RNA	SNP	-	NULL	ENST00000376259.3	37	NULL	CCDS145.1	1																																																																																			TNFRSF1B	-	-	ENSG00000028137		0.582	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF1B	HGNC	protein_coding	OTTHUMT00000005133.1	18	0.00	0	G	NM_001066		12268499	12268499	+1	no_errors	ENST00000492361	ensembl	human	known	69_37n	rna	9	25.00	3	SNP	0.015	A
TPO	7173	genome.wustl.edu	37	2	1544617	1544617	+	Intron	SNP	G	G	A	rs12615819	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr2:1544617G>A	ENST00000345913.4	+	16	2839				TPO_ENST00000382198.1_Intron|TPO_ENST00000329066.4_Intron|TPO_ENST00000497517.2_Intron|TPO_ENST00000346956.3_Intron|TPO_ENST00000382201.3_Intron|TPO_ENST00000337415.3_Intron|TPO_ENST00000349624.3_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase						cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TTCCTAGTCCGTTCTGCACCT	0.512													G|||	1692	0.337859	0.2632	0.3501	5008	,	,		18702	0.3224		0.3847	False		,,,				2504	0.3978					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2748+122G>A	2.37:g.1544617G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Sushi_SCR_CCP,superfamily_Haem_peroxidase,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,prints_Haem_peroxidase_animal_subgr,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal	p.R842H	ENST00000345913.4	37	c.2525	CCDS1643.1	2	748	0.3424908424908425	135	0.27439024390243905	128	0.35359116022099446	200	0.34965034965034963	285	0.3759894459102902	G	1.315	-0.601152	0.03744	.	.	ENSG00000115705	ENST00000422464	T	0.69175	-0.38	1.08	-2.16	0.07080	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29822	-0.9999	4	.	.	.	.	3.0877	0.06283	0.0:0.2455:0.4383:0.3161	rs12615819	.	.	.	H	842	ENSP00000405788:R842H	.	R	+	2	0	TPO	1523624	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.161000	0.03144	-1.360000	0.02172	-0.747000	0.03512	CGT	TPO	-	NULL	ENSG00000115705		0.512	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	39	0.00	0	G	NM_000547		1544617	1544617	+1	no_start_codon	ENST00000422464	ensembl	human	novel	69_37n	missense	37	11.90	5	SNP	0.000	A
TSEN2	80746	genome.wustl.edu	37	3	12560583	12560583	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr3:12560583G>T	ENST00000284995.6	+	8	1373	c.986G>T	c.(985-987)tGg>tTg	p.W329L	C3orf83_ENST00000567514.1_Intron|TSEN2_ENST00000314571.7_Missense_Mutation_p.W303L|TSEN2_ENST00000454502.2_Missense_Mutation_p.W270L|TSEN2_ENST00000402228.3_Missense_Mutation_p.W329L|TSEN2_ENST00000444864.1_Missense_Mutation_p.W303L|TSEN2_ENST00000383797.5_Missense_Mutation_p.W312L|TSEN2_ENST00000415684.1_Missense_Mutation_p.W303L	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	329					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						GTGAAGCTCTGGAAAGCTTTC	0.448																																						dbGAP											0													108.0	102.0	104.0					3																	12560583		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.986G>T	3.37:g.12560583G>T	ENSP00000284995:p.Trp329Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,pfam_tRNA_intron_Endonuc_N,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2	p.W329L	ENST00000284995.6	37	c.986	CCDS2611.1	3	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519471	0.85495	.	.	ENSG00000154743	ENST00000446004;ENST00000314571;ENST00000454502;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;0.38;-0.94;-0.94;-0.94;-0.94	5.39	5.39	0.77823	tRNA intron endonuclease, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87366	0.6159	M	0.85945	2.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.85413	0.1138	10	0.25751	T	0.34	-13.6704	18.7846	0.91949	0.0:0.0:1.0:0.0	.	303;329;303;270	G5E9Q3;Q8NCE0;Q8NCE0-3;C9IZI7	.;SEN2_HUMAN;.;.	L	329;303;270;312;329;329;303;302;303	ENSP00000406238:W329L;ENSP00000323188:W303L;ENSP00000392029:W270L;ENSP00000373307:W312L;ENSP00000385976:W329L;ENSP00000284995:W329L;ENSP00000407974:W303L;ENSP00000416510:W303L	ENSP00000284995:W329L	W	+	2	0	TSEN2	12535583	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	6.484000	0.73621	2.526000	0.85167	0.563000	0.77884	TGG	TSEN2	-	pfam_tRNA_intron_Endonuc_N,pirsf_tRNA_splic_SEN2	ENSG00000154743		0.448	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN2	HGNC	protein_coding	OTTHUMT00000251981.1	43	0.00	0	G	NM_025265		12560583	12560583	+1	no_errors	ENST00000284995	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	1.000	T
CFAP46	54777	genome.wustl.edu	37	10	134698626	134698626	+	Missense_Mutation	SNP	T	T	C	rs73393250	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr10:134698626T>C	ENST00000368586.5	-	27	3708	c.3608A>G	c.(3607-3609)aAc>aGc	p.N1203S	TTC40_ENST00000368582.2_Missense_Mutation_p.N1203S	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CTGGATGGCGTTGTTGTAGCA	0.572													C|||	672	0.134185	0.3608	0.0418	5008	,	,		15794	0.0198		0.0249	False		,,,				2504	0.1237					dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000368586.5:c.3608A>G	10.37:g.134698626T>C	ENSP00000357575:p.Asn1203Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.N1203S	ENST00000368586.5	37	c.3608	CCDS58101.1	10	220	0.10073260073260074	179	0.3638211382113821	13	0.03591160220994475	12	0.02097902097902098	16	0.021108179419525065	C	0.901	-0.722113	0.03182	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.45668	2.87;0.89	4.16	1.74	0.24563	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.38693	-0.9649	5	0.38643	T	0.18	.	9.5036	0.39033	0.0:0.1788:0.0:0.8212	.	.	.	.	S	1203	ENSP00000357575:N1203S;ENSP00000357571:N1203S	ENSP00000357571:N1203S	N	-	2	0	C10orf93	134548616	0.400000	0.25295	0.007000	0.13788	0.003000	0.03518	1.216000	0.32443	-0.245000	0.09625	-1.247000	0.01520	AAC	TTC40	-	NULL	ENSG00000171811		0.572	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	26	0.00	0	T			134698626	134698626	-1	no_errors	ENST00000368582	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.109	C
TYRO3	7301	genome.wustl.edu	37	15	41865525	41865525	+	Missense_Mutation	SNP	G	G	T	rs62001448	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr15:41865525G>T	ENST00000263798.3	+	17	2229	c.2005G>T	c.(2005-2007)Gtg>Ttg	p.V669L	TYRO3_ENST00000559066.1_Missense_Mutation_p.V624L	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	669	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGACATGACAGTGTGTGTGGC	0.562																																						dbGAP											0													209.0	211.0	211.0					15																	41865525		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2005G>T	15.37:g.41865525G>T	ENSP00000263798:p.Val669Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O14953|Q86VR3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V669L	ENST00000263798.3	37	c.2005	CCDS10080.1	15	177	0.08104395604395605	12	0.024390243902439025	34	0.09392265193370165	11	0.019230769230769232	120	0.158311345646438	G	28.2	4.901936	0.92035	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	D	0.85861	-2.04	5.55	5.55	0.83447	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.436224	0.16821	N	0.198144	T	0.03136	0.0092	L	0.41027	1.25	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.54715	-0.8252	10	0.87932	D	0	-8.3883	19.5084	0.95130	0.0:0.0:1.0:0.0	rs62001448	669	Q06418	TYRO3_HUMAN	L	601;669	ENSP00000263798:V669L	ENSP00000263798:V669L	V	+	1	0	TYRO3	39652817	1.000000	0.71417	0.964000	0.40570	0.975000	0.68041	9.869000	0.99810	2.612000	0.88384	0.655000	0.94253	GTG	TYRO3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000092445		0.562	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2	25	0.00	0	G			41865525	41865525	+1	no_errors	ENST00000263798	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	T
UBE3D	90025	genome.wustl.edu	37	6	83732240	83732240	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr6:83732240G>T	ENST00000369747.3	-	7	900	c.778C>A	c.(778-780)Cag>Aag	p.Q260K		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	260					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										GAGGAGAGCTGCACCAGACAC	0.393																																						dbGAP											0													64.0	62.0	63.0					6																	83732240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.778C>A	6.37:g.83732240G>T	ENSP00000358762:p.Gln260Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	pfam_UBQ-conj_enz_E2-bd_prot	p.Q260K	ENST00000369747.3	37	c.778	CCDS34491.1	6	.	.	.	.	.	.	.	.	.	.	G	12.21	1.871080	0.33069	.	.	ENSG00000118420	ENST00000369747	T	0.28666	1.6	5.72	4.86	0.63082	.	0.195439	0.52532	D	0.000075	T	0.08802	0.0218	N	0.08118	0	0.80722	D	1	B;B	0.17465	0.015;0.022	B;B	0.21708	0.036;0.026	T	0.07214	-1.0784	10	0.41790	T	0.15	-11.0067	14.6027	0.68453	0.0:0.8474:0.1526:0.0	.	239;260	C9JRS1;Q7Z6J8	.;UB2CB_HUMAN	K	260	ENSP00000358762:Q260K	ENSP00000358762:Q260K	Q	-	1	0	UBE2CBP	83788959	1.000000	0.71417	0.975000	0.42487	0.321000	0.28281	2.076000	0.41548	1.416000	0.47057	-0.344000	0.07964	CAG	UBE3D	-	pfam_UBQ-conj_enz_E2-bd_prot	ENSG00000118420		0.393	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3D	HGNC	protein_coding	OTTHUMT00000041347.7	17	0.00	0	G	NM_198920		83732240	83732240	-1	no_errors	ENST00000369747	ensembl	human	known	69_37n	missense	11	25.00	4	SNP	1.000	T
ZNF860	344787	genome.wustl.edu	37	3	32031615	32031615	+	Missense_Mutation	SNP	A	A	C	rs13064905	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr3:32031615A>C	ENST00000360311.4	+	2	1593	c.1044A>C	c.(1042-1044)gaA>gaC	p.E348D		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						AGGTTTGTGAAAAGGCTTTCA	0.393													C|||	2356	0.470447	0.7988	0.3602	5008	,	,		21648	0.4524		0.1968	False		,,,				2504	0.4049					dbGAP											0													45.0	47.0	46.0					3																	32031615		692	1591	2283	-	-	-	SO:0001583	missense	0			AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.1044A>C	3.37:g.32031615A>C	ENSP00000373274:p.Glu348Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFA4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E348D	ENST00000360311.4	37	c.1044	CCDS46784.1	3	911	0.41712454212454214	385	0.782520325203252	126	0.34806629834254144	248	0.43356643356643354	152	0.20052770448548812	C	3.265	-0.150374	0.06585	.	.	ENSG00000197385	ENST00000360311	T	0.01185	5.21	0.345	0.345	0.16011	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	N	0.04148	-0.265	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.02411	-1.1163	7	.	.	.	.	2.5267	0.04693	0.3212:0.3574:0.3213:0.0	rs13064905;rs61529855;rs13064905	348	A6NHJ4	ZN860_HUMAN	D	348	ENSP00000373274:E348D	.	E	+	3	2	ZNF860	32006619	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-1.684000	0.01932	-0.518000	0.06452	-0.525000	0.04345	GAA	ZNF860	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197385		0.393	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF860	HGNC	protein_coding	OTTHUMT00000341957.1	51	0.00	0	A			32031615	32031615	+1	no_errors	ENST00000360311	ensembl	human	known	69_37n	missense	62	11.43	8	SNP	0.632	C
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30025179	30025179	+	RNA	SNP	G	G	A	rs6911724	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr6:30025179G>A	ENST00000431012.1	-	0	492				ZNRD1-AS1_ENST00000376797.3_RNA|ZNRD1-AS1_ENST00000452229.1_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		TGTCTAAATGGTTTGTTCTTA	0.398													A|||	837	0.167133	0.2943	0.1081	5008	,	,		19870	0.1548		0.0805	False		,,,				2504	0.1391					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30025179G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000431012.1	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.398	ZNRD1-AS1-005	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253082.1	40	0.00	0	G	NR_026751		30025179	30025179	-1	no_errors	ENST00000421692	ensembl	human	known	69_37n	rna	47	12.73	7	SNP	0.000	A
ZRSR1	7310	genome.wustl.edu	37	5	112228667	112228667	+	Missense_Mutation	SNP	G	G	A	rs430665	byFrequency	TCGA-AC-A2QJ-01A-12D-A19Y-09	TCGA-AC-A2QJ-11A-12D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	140d1805-5e93-4c7f-8492-adbfec23b0bb	d32c7909-42f1-4654-aa3e-0bff663b42de	g.chr5:112228667G>A	ENST00000391338.1	+	1	1355	c.1331G>A	c.(1330-1332)aGc>aAc	p.S444N	REEP5_ENST00000379638.4_Intron|CTC-487M23.8_ENST00000512790.1_3'UTR|REEP5_ENST00000474542.2_Intron|REEP5_ENST00000513339.1_Intron|REEP5_ENST00000545426.1_Intron|CTC-487M23.5_ENST00000602872.1_RNA|REEP5_ENST00000504247.1_Intron	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	444						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						CGGAGCCAGAGCCGCAGGAGC	0.577													G|||	1881	0.375599	0.6831	0.2867	5008	,	,		13177	0.1815		0.3638	False		,,,				2504	0.2352					dbGAP											0																																										-	-	-	SO:0001583	missense	0			D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.1331G>A	5.37:g.112228667G>A	ENSP00000375133:p.Ser444Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R901|Q13570|Q2M3R8	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.S444N	ENST00000391338.1	37	c.1331		5	797	0.3649267399267399	315	0.6402439024390244	109	0.3011049723756906	109	0.19055944055944055	264	0.3482849604221636	G	10.86	1.469605	0.26423	.	.	ENSG00000212643	ENST00000391338	T	0.02498	4.27	1.67	1.67	0.24075	.	0.559088	0.18117	N	0.151180	T	0.00012	0.0000	.	.	.	0.49051	P	2.550000000000052E-4	P	0.45531	0.86	B	0.35607	0.206	T	0.00883	-1.1528	8	0.17369	T	0.5	.	4.0966	0.09993	0.218:0.0:0.782:0.0	rs430665;rs1643690;rs3193241;rs58047899;rs430665	444	Q15695	U2AFL_HUMAN	N	444	ENSP00000375133:S444N	ENSP00000375133:S444N	S	+	2	0	ZRSR1	112256566	0.277000	0.24220	0.071000	0.20095	0.053000	0.15095	1.161000	0.31773	1.225000	0.43566	0.467000	0.42956	AGC	ZRSR1	-	NULL	ENSG00000212643		0.577	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	ZRSR1	HGNC	protein_coding	OTTHUMT00000371801.1	64	0.00	0	G	NM_005083		112228667	112228667	+1	no_errors	ENST00000391338	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	0.204	A
