#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABI3BP	25890	genome.wustl.edu	37	3	100548484	100548484	+	Intron	SNP	T	T	C	rs36077176	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr3:100548484T>C	ENST00000284322.5	-	18	1707				ABI3BP_ENST00000383691.4_Intron|ABI3BP_ENST00000495063.1_Intron|ABI3BP_ENST00000471714.1_Missense_Mutation_p.H835R	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						ATGTGGACGATGAGTTCGTTG	0.438													C|||	579	0.115615	0.0098	0.0994	5008	,	,		18785	0.0486		0.175	False		,,,				2504	0.2781					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1597+16731A>G	3.37:g.100548484T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.H835R	ENST00000284322.5	37	c.2504	CCDS46880.1	3	216|216	0.0989010989010989|0.0989010989010989	11|11	0.022357723577235773|0.022357723577235773	41|41	0.1132596685082873|0.1132596685082873	30|30	0.05244755244755245|0.05244755244755245	134|134	0.17678100263852242|0.17678100263852242	C|C	0|0	-2.674062|-2.674062	0.00104|0.00104	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000471714;ENST00000383692|ENST00000478235;ENST00000528490	T|.	0.54479|.	0.57|.	4.47|4.47	-6.0|-6.0	0.02206|0.02206	.|.	.|.	.|.	.|.	.|.	T|T	0.00073|0.00073	0.0002|0.0002	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.14643|0.14643	-1.0465|-1.0465	7|3	0.20519|.	T|.	0.43|.	.|.	6.9946|6.9946	0.24774|0.24774	0.2098:0.1779:0.0:0.6123|0.2098:0.1779:0.0:0.6123	rs36077176|rs36077176	102|.	D3YTD6|.	.|.	R|V	835;102|23;148	ENSP00000420524:H835R|.	ENSP00000373190:H102R|.	H|I	-|-	2|1	0|0	ABI3BP|ABI3BP	102031174|102031174	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.010000|0.010000	0.07245|0.07245	-4.788000|-4.788000	0.00185|0.00185	-1.940000|-1.940000	0.01043|0.01043	-1.615000|-1.615000	0.00797|0.00797	CAT|ATC	ABI3BP	-	NULL	ENSG00000154175		0.438	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	30	0.00	0	T			100548484	100548484	-1	no_errors	ENST00000471714	ensembl	human	novel	69_37n	missense	28	15.15	5	SNP	0.000	C
ACSF2	80221	genome.wustl.edu	37	17	48549940	48549940	+	Splice_Site	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:48549940G>T	ENST00000300441.4	+	12	1579	c.1475G>T	c.(1474-1476)gGa>gTa	p.G492V	ACSF2_ENST00000506085.1_Intron|ACSF2_ENST00000541920.1_Splice_Site_p.G332V|ACSF2_ENST00000427954.2_Splice_Site_p.G517V|ACSF2_ENST00000502667.1_Splice_Site_p.G479V|ACSF2_ENST00000504392.1_Splice_Site_p.G449V	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	492					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TATTGGACAGGGTGAGAAGGC	0.622																																						dbGAP											0													109.0	88.0	95.0					17																	48549940		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1475+1G>T	17.37:g.48549940G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.G492V	ENST00000300441.4	37	c.1475	CCDS11567.1	17	.	.	.	.	.	.	.	.	.	.	G	28.1	4.891470	0.91889	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74	5.39	5.39	0.77823	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.95664	0.8590	H	0.99404	4.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.97802	1.0245	10	0.87932	D	0	-6.9513	19.1602	0.93527	0.0:0.0:1.0:0.0	.	479;517;449;492	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	V	492;332;449;517;479	ENSP00000300441:G492V;ENSP00000437987:G332V;ENSP00000425964:G449V;ENSP00000401831:G517V;ENSP00000421884:G479V	ENSP00000300441:G492V	G	+	2	0	ACSF2	45904939	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.457000	0.97630	2.527000	0.85204	0.555000	0.69702	GGA	ACSF2	-	pfam_AMP-dep_Synth/Lig	ENSG00000167107		0.622	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	31	0.00	0	G	NM_025149	Missense_Mutation	48549940	48549940	+1	no_errors	ENST00000300441	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	1.000	T
ADAM21	8747	genome.wustl.edu	37	14	70924335	70924335	+	Missense_Mutation	SNP	C	C	T	rs199920662	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr14:70924335C>T	ENST00000603540.1	+	2	377	c.119C>T	c.(118-120)cCg>cTg	p.P40L	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.P40L	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	40					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TTCACTTCCCCGGAAGTGGTG	0.547																																						dbGAP											0													97.0	102.0	100.0					14																	70924335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.119C>T	14.37:g.70924335C>T	ENSP00000474385:p.Pro40Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.P40L	ENST00000603540.1	37	c.119	CCDS9804.1	14	.	.	.	.	.	.	.	.	.	.	C	7.541	0.660648	0.14645	.	.	ENSG00000139985	ENST00000267499	T	0.01051	5.4	3.77	2.87	0.33458	.	0.239499	0.21690	U	0.070593	T	0.01870	0.0059	M	0.79343	2.45	0.29294	N	0.869135	P	0.36412	0.552	B	0.34652	0.187	T	0.20706	-1.0267	10	0.32370	T	0.25	.	7.3425	0.26646	0.0:0.8757:0.0:0.1243	.	40	Q9UKJ8	ADA21_HUMAN	L	40	ENSP00000267499:P40L	ENSP00000267499:P40L	P	+	2	0	ADAM21	69994088	0.007000	0.16637	0.766000	0.31476	0.269000	0.26545	0.312000	0.19397	0.924000	0.37069	0.563000	0.77884	CCG	ADAM21	-	pfam_Peptidase_M12B_N	ENSG00000139985		0.547	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3	36	0.00	0	C			70924335	70924335	+1	no_errors	ENST00000267499	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.493	T
ADAM5	255926	genome.wustl.edu	37	8	39250888	39250888	+	RNA	SNP	A	A	G	rs12544471	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr8:39250888A>G	ENST00000505455.1	+	0	1602							Q6NVV9	ADAM5_HUMAN	ADAM metallopeptidase domain 5, pseudogene								metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)										GATGATGGACACTTAGTACCA	0.348													A|||	2650	0.529153	0.3578	0.5245	5008	,	,		9699	0.4514		0.6869	False		,,,				2504	0.682					dbGAP											0																																										-	-	-			0			BC047448		8p11.23	2012-08-22	2010-03-12	2012-08-22	ENSG00000196115	ENSG00000196115		"""ADAM metallopeptidase domain containing"""	212	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 5"""	ADAM5P		8786143, 10417343	Standard	NR_001448		Approved	tMDCII	uc003xnb.3	Q6NVV9	OTTHUMG00000154982		8.37:g.39250888A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MW71|Q4G196	RNA	SNP	-	NULL	ENST00000505455.1	37	NULL		8																																																																																			ADAM5	-	-	ENSG00000196115		0.348	ADAM5-006	KNOWN	basic	processed_transcript	ADAM5	HGNC	pseudogene	OTTHUMT00000337882.1	30	0.00	0	A	NR_001448		39250888	39250888	+1	no_errors	ENST00000359790	ensembl	human	known	69_37n	rna	22	24.14	7	SNP	0.185	G
AIF1L	83543	genome.wustl.edu	37	9	133981629	133981629	+	Intron	SNP	T	T	C	rs2315075	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:133981629T>C	ENST00000247291.3	+	3	181				AIF1L_ENST00000472942.1_Intron|AIF1L_ENST00000372297.2_Intron|AIF1L_ENST00000372312.3_Intron|AIF1L_ENST00000372298.1_Intron|AIF1L_ENST00000372309.3_Missense_Mutation_p.C50R|AIF1L_ENST00000372302.1_Intron|AIF1L_ENST00000372300.1_Intron	NM_031426.3	NP_113614.1	Q9BQI0	AIF1L_HUMAN	allograft inflammatory factor 1-like							actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.C50R(1)		lung(2)	2						ccagcacagctgcttgctggc	0.542													C|||	1305	0.260583	0.3033	0.3429	5008	,	,		19440	0.3323		0.16	False		,,,				2504	0.1738				Esophageal Squamous(95;611 1423 5044 34794 42333)	dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001627	intron_variant	0			AL136566	CCDS6939.1, CCDS55348.1, CCDS55349.1	9q34.13-q34.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000126878	ENSG00000126878		"""EF-hand domain containing"""	28904	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 58"""	C9orf58		11230166	Standard	NM_001185095		Approved	IBA2, FLJ12783	uc004cad.2	Q9BQI0	OTTHUMG00000020817	ENST00000247291.3:c.94-5355T>C	9.37:g.133981629T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBC4|Q6ZR40|Q8NAX7|Q8WU47|Q9H9G0	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.C50R	ENST00000247291.3	37	c.148	CCDS6939.1	9	538	0.24633699633699635	125	0.2540650406504065	107	0.2955801104972376	175	0.30594405594405594	131	0.17282321899736147	C	6.295	0.422609	0.11928	.	.	ENSG00000126878	ENST00000372309	T	0.57436	0.4	2.54	0.507	0.16967	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35051	-0.9804	7	0.23891	T	0.37	.	5.1727	0.15118	0.0:0.4944:0.0:0.5056	rs2315075;rs2315075	50	Q9BQI0-2	.	R	50	ENSP00000361383:C50R	ENSP00000361383:C50R	C	+	1	0	AIF1L	132971450	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	0.212000	0.17497	-0.122000	0.11766	-1.153000	0.01818	TGC	AIF1L	-	NULL	ENSG00000126878		0.542	AIF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIF1L	HGNC	protein_coding	OTTHUMT00000054703.2	58	0.00	0	T	NM_031426		133981629	133981629	+1	no_errors	ENST00000372309	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.001	C
GMPPB	29925	genome.wustl.edu	37	3	49756562	49756562	+	3'UTR	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr3:49756562G>T	ENST00000480687.1	-	0	3822				RNF123_ENST00000327697.6_Intron|AMIGO3_ENST00000535833.1_Missense_Mutation_p.L113M|RNF123_ENST00000433785.1_Intron|AMIGO3_ENST00000320431.7_Missense_Mutation_p.L113M|RNF123_ENST00000497099.1_Intron			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGATCGAGCAGCCTCAGGCCG	0.637											OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													57.0	66.0	63.0					3																	49756562		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*2623C>A	3.37:g.49756562G>T		Somatic	964	WXS	Illumina GAIIx	Phase_IV	A8K6N5|Q9H7U3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L113M	ENST00000480687.1	37	c.337	CCDS2803.1	3	.	.	.	.	.	.	.	.	.	.	G	11.71	1.719094	0.30503	.	.	ENSG00000176020	ENST00000320431;ENST00000535833	T;T	0.57752	0.38;0.38	5.62	2.76	0.32466	.	0.713418	0.13063	N	0.416699	T	0.44307	0.1287	N	0.26130	0.795	0.53005	D	0.999964	P	0.39022	0.655	P	0.45998	0.5	T	0.15665	-1.0429	10	0.33940	T	0.23	-1.0024	7.5881	0.28004	0.1444:0.0:0.7193:0.1362	.	113	Q86WK7	AMGO3_HUMAN	M	113	ENSP00000323096:L113M;ENSP00000439268:L113M	ENSP00000323096:L113M	L	-	1	2	AMIGO3	49731566	1.000000	0.71417	0.096000	0.21009	0.361000	0.29550	4.701000	0.61810	0.689000	0.31550	0.655000	0.94253	CTG	AMIGO3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000176020		0.637	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	HGNC	protein_coding	OTTHUMT00000350291.1	50	0.00	0	G	NM_013334		49756562	49756562	-1	no_errors	ENST00000320431	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.141	T
ANGEL2	90806	genome.wustl.edu	37	1	213174137	213174137	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:213174137C>T	ENST00000366962.3	-	6	1406	c.1252G>A	c.(1252-1254)Gaa>Aaa	p.E418K	ANGEL2_ENST00000544555.1_Missense_Mutation_p.E249K|ANGEL2_ENST00000535388.1_Intron|ANGEL2_ENST00000473303.1_5'UTR|ANGEL2_ENST00000540642.1_Missense_Mutation_p.E292K|ANGEL2_ENST00000360506.2_Missense_Mutation_p.E249K	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	418										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		CCTGTCTTTTCTACTTTTGGT	0.373																																						dbGAP											0													81.0	74.0	76.0					1																	213174137		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.1252G>A	1.37:g.213174137C>T	ENSP00000355929:p.Glu418Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.E418K	ENST00000366962.3	37	c.1252	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342345	0.24339	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642	T;T;T;T	0.42131	1.93;0.98;0.98;1.55	5.5	5.5	0.81552	Endonuclease/exonuclease/phosphatase (2);	0.503939	0.20885	N	0.083930	T	0.25827	0.0629	N	0.22421	0.69	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.13407	0.004;0.009	T	0.09228	-1.0684	10	0.09084	T	0.74	-12.6465	9.9657	0.41723	0.0:0.8496:0.0:0.1504	.	292;418	F5H476;Q5VTE6	.;ANGE2_HUMAN	K	418;249;249;292	ENSP00000355929:E418K;ENSP00000353696:E249K;ENSP00000443193:E249K;ENSP00000446124:E292K	ENSP00000353696:E249K	E	-	1	0	ANGEL2	211240760	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.431000	0.44775	2.571000	0.86741	0.650000	0.86243	GAA	ANGEL2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000174606		0.373	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	38	0.00	0	C	NM_144567		213174137	213174137	-1	no_errors	ENST00000366962	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	1.000	T
ANKRD19P	138649	genome.wustl.edu	37	9	95599282	95599282	+	RNA	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:95599282C>T	ENST00000473204.1	+	0	1363							Q9H560	ANR19_HUMAN	ankyrin repeat domain 19, pseudogene							extracellular vesicular exosome (GO:0070062)											CCAGCTCTTCCAGCTGGATGG	0.592																																						dbGAP											0																																										-	-	-			0			BC038951		9q22.32	2011-04-27	2011-04-27	2011-04-27	ENSG00000187984	ENSG00000187984			22567	pseudogene	pseudogene			"""ankyrin repeat domain 19"", ""ankyrin repeat domain 19 pseudogene"""	ANKRD19			Standard	NR_026868		Approved	FLJ36178	uc011lua.1	Q9H560	OTTHUMG00000020237		9.37:g.95599282C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K853|Q17RD3	RNA	SNP	-	NULL	ENST00000473204.1	37	NULL		9																																																																																			ANKRD19P	-	-	ENSG00000187984		0.592	ANKRD19P-004	KNOWN	basic	processed_transcript	ANKRD19P	HGNC	pseudogene	OTTHUMT00000053116.3	27	0.00	0	C	NR_026868		95599282	95599282	+1	no_errors	ENST00000464387	ensembl	human	known	69_37n	rna	44	16.98	9	SNP	0.993	T
ANKRD30B	374860	genome.wustl.edu	37	18	14848820	14848820	+	Missense_Mutation	SNP	C	C	T	rs4090319	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr18:14848820C>T	ENST00000358984.4	+	34	3110	c.2930C>T	c.(2929-2931)aCg>aTg	p.T977M		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	977				T -> M (in Ref. 3; AAK27326 and 4; BAG57852). {ECO:0000305}.				p.T977M(1)		breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						ATGGAACAAACGAAAAATAAG	0.348													C|||	2007	0.400759	0.0257	0.5173	5008	,	,		15920	0.5685		0.4801	False		,,,				2504	0.5706					dbGAP											1	Substitution - Missense(1)	kidney(1)											76.0	56.0	62.0					18																	14848820		692	1587	2279	-	-	-	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2930C>T	18.37:g.14848820C>T	ENSP00000351875:p.Thr977Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T977M	ENST00000358984.4	37	c.2930	CCDS54182.1	18	777	0.3557692307692308	21	0.042682926829268296	165	0.4558011049723757	281	0.49125874125874125	310	0.40897097625329815	C	0.001	-3.829587	0.00004	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.15952	2.38	1.48	0.0525	0.14302	.	.	.	.	.	T	0.00012	0.0000	N	0.01048	-1.04	0.09310	P	0.999999854054	B;B	0.12630	0.0;0.006	B;B	0.04013	0.0;0.001	T	0.45469	-0.9259	8	0.02654	T	1	.	4.8651	0.13604	0.0:0.1894:0.0:0.8106	rs4090319	1062;977	Q9BXX2;F8WAG3	AN30B_HUMAN;.	M	977;371;397	ENSP00000351875:T977M	ENSP00000277669:T397M	T	+	2	0	ANKRD30B	14838820	0.992000	0.36948	0.027000	0.17364	0.012000	0.07955	2.178000	0.42519	0.068000	0.16574	-1.169000	0.01745	ACG	ANKRD30B	-	NULL	ENSG00000180777		0.348	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	35	0.00	0	C	NM_001145029		14848820	14848820	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.957	T
ANO9	338440	genome.wustl.edu	37	11	428823	428823	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:428823C>T	ENST00000332826.6	-	12	1003	c.919G>A	c.(919-921)Gaa>Aaa	p.E307K		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	307					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						AGTGCCATTTCCTCCTGGGGA	0.597																																						dbGAP											0													203.0	148.0	167.0					11																	428823		2199	4296	6495	-	-	-	SO:0001583	missense	0			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.919G>A	11.37:g.428823C>T	ENSP00000332788:p.Glu307Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	pfam_Anoctamin	p.E307K	ENST00000332826.6	37	c.919	CCDS31326.1	11	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589106	0.46110	.	.	ENSG00000185101	ENST00000332826	T	0.65732	-0.17	3.62	3.62	0.41486	.	18.544900	0.00357	N	0.000033	T	0.77844	0.4191	M	0.62016	1.91	0.41615	D	0.988936	D;P	0.76494	0.999;0.854	D;P	0.67382	0.951;0.479	T	0.67952	-0.5537	10	0.12103	T	0.63	.	15.8162	0.78604	0.0:1.0:0.0:0.0	.	8;307	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	K	307	ENSP00000332788:E307K	ENSP00000332788:E307K	E	-	1	0	ANO9	418823	1.000000	0.71417	0.757000	0.31301	0.056000	0.15407	2.756000	0.47549	2.032000	0.59987	0.462000	0.41574	GAA	ANO9	-	pfam_Anoctamin	ENSG00000185101		0.597	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO9	HGNC	protein_coding	OTTHUMT00000384116.1	50	0.00	0	C	NM_001012302		428823	428823	-1	no_errors	ENST00000332826	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	T
AP1G2	8906	genome.wustl.edu	37	14	24035577	24035577	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr14:24035577C>G	ENST00000308724.5	-	3	1136	c.381G>C	c.(379-381)ttG>ttC	p.L127F	AP1G2_ENST00000556277.1_5'UTR|AP1G2_ENST00000397120.3_Missense_Mutation_p.L127F|RP11-66N24.3_ENST00000555968.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	127					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CCATGGTGCTCAAAGTGCACA	0.587																																						dbGAP											0													67.0	64.0	65.0					14																	24035577		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.381G>C	14.37:g.24035577C>G	ENSP00000312442:p.Leu127Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS51|O75504	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.L127F	ENST00000308724.5	37	c.381	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341262	0.60963	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000557189;ENST00000556843	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.01	4.05	0.47172	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69178	0.3082	M	0.80508	2.5	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.69529	-0.5121	10	0.44086	T	0.13	-4.3663	10.1973	0.43062	0.0:0.8951:0.0:0.1049	.	127	O75843	AP1G2_HUMAN	F	127	ENSP00000312442:L127F;ENSP00000380309:L127F;ENSP00000452153:L127F;ENSP00000451504:L127F	ENSP00000312442:L127F	L	-	3	2	AP1G2	23105417	0.928000	0.31464	1.000000	0.80357	0.987000	0.75469	-0.036000	0.12185	2.595000	0.87683	0.561000	0.74099	TTG	AP1G2	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP1_complex_gsu	ENSG00000213983		0.587	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	HGNC	protein_coding	OTTHUMT00000071812.4	35	0.00	0	C	NM_003917		24035577	24035577	-1	no_errors	ENST00000308724	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	G
AP4M1	9179	genome.wustl.edu	37	7	99702514	99702514	+	Silent	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr7:99702514G>T	ENST00000359593.4	+	8	782	c.624G>T	c.(622-624)gtG>gtT	p.V208V	MCM7_ENST00000303887.5_5'Flank|MCM7_ENST00000343023.6_5'Flank|AP4M1_ENST00000422582.1_Silent_p.V80V|AP4M1_ENST00000421755.1_Silent_p.V208V|AP4M1_ENST00000429084.1_Silent_p.V215V	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	208	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGCTGAAGGTGGATGTGCAGG	0.567																																					Pancreas(174;1182 2812 29595 49511)	dbGAP											0													120.0	116.0	117.0					7																	99702514		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.624G>T	7.37:g.99702514G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5U1|Q8WV65|Q9UHK9	Silent	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.V208	ENST00000359593.4	37	c.624	CCDS5685.1	7																																																																																			AP4M1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C	ENSG00000221838		0.567	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP4M1	HGNC	protein_coding	OTTHUMT00000336772.4	58	0.00	0	G	NM_004722		99702514	99702514	+1	no_errors	ENST00000359593	ensembl	human	known	69_37n	silent	50	12.28	7	SNP	1.000	T
APBB2	323	genome.wustl.edu	37	4	41015823	41015823	+	Silent	SNP	G	G	T	rs2292234	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr4:41015823G>T	ENST00000295974.8	-	6	1241	c.612C>A	c.(610-612)ggC>ggA	p.G204G	APBB2_ENST00000508593.1_Silent_p.G204G|APBB2_ENST00000513140.1_Silent_p.G204G|APBB2_ENST00000506352.1_Silent_p.G204G	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	204					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						GCAGCAAATCGCCATTCCCAA	0.562													G|||	664	0.132588	0.084	0.1124	5008	,	,		17107	0.1786		0.1869	False		,,,				2504	0.1094				Ovarian(3;20 75 16686 49997)	dbGAP											0													285.0	273.0	277.0					4																	41015823		2000	4167	6167	-	-	-	SO:0001819	synonymous_variant	0			U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.612C>A	4.37:g.41015823G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSL4|E9PG87|Q8IUI6	Silent	SNP	pfam_PTyr_interaction_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom,pfscan_WW_Rsp5_WWP	p.G204	ENST00000295974.8	37	c.612	CCDS54761.1	4																																																																																			APBB2	-	NULL	ENSG00000163697		0.562	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	APBB2	HGNC	protein_coding	OTTHUMT00000360523.3	53	0.00	0	G	NM_173075		41015823	41015823	-1	no_errors	ENST00000295974	ensembl	human	known	69_37n	silent	71	12.79	11	SNP	0.016	T
ARHGAP30	257106	genome.wustl.edu	37	1	161018356	161018356	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:161018356C>T	ENST00000368013.3	-	12	2775	c.2455G>A	c.(2455-2457)Gac>Aac	p.D819N	USF1_ENST00000368021.3_5'Flank|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.D642N|ARHGAP30_ENST00000368016.3_Intron	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	819	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CTTCTGCTGTCTTCACCATCT	0.557																																						dbGAP											0													196.0	184.0	188.0					1																	161018356		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2455G>A	1.37:g.161018356C>T	ENSP00000356992:p.Asp819Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.D819N	ENST00000368013.3	37	c.2455	CCDS30918.1	1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300276	0.40694	.	.	ENSG00000186517	ENST00000368013;ENST00000368015	T;T	0.38077	2.68;1.16	4.43	3.5	0.40072	.	0.699524	0.12458	N	0.467133	T	0.18467	0.0443	M	0.64997	1.995	0.09310	N	1	P	0.38195	0.622	B	0.34346	0.18	T	0.06232	-1.0838	10	0.52906	T	0.07	.	9.3878	0.38354	0.0:0.8935:0.0:0.1065	.	819	Q7Z6I6	RHG30_HUMAN	N	819;642	ENSP00000356992:D819N;ENSP00000356994:D642N	ENSP00000356992:D819N	D	-	1	0	ARHGAP30	159284980	0.079000	0.21365	0.254000	0.24359	0.955000	0.61496	3.596000	0.54024	1.999000	0.58509	0.455000	0.32223	GAC	ARHGAP30	-	NULL	ENSG00000186517		0.557	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	HGNC	protein_coding	OTTHUMT00000077090.2	143	0.00	0	C	NM_181720		161018356	161018356	-1	no_errors	ENST00000368013	ensembl	human	known	69_37n	missense	151	12.21	21	SNP	0.006	T
ARHGAP39	80728	genome.wustl.edu	37	8	145758691	145758691	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr8:145758691C>T	ENST00000276826.5	-	7	2815	c.2614G>A	c.(2614-2616)Gtg>Atg	p.V872M	ARHGAP39_ENST00000377307.2_Missense_Mutation_p.V903M|ARHGAP39_ENST00000540274.1_Missense_Mutation_p.V872M			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	872	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						ATCTCCTCCACGTTGGGCTTC	0.637																																						dbGAP											0													66.0	57.0	60.0					8																	145758691		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2614G>A	8.37:g.145758691C>T	ENSP00000276826:p.Val872Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1I1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_MyTH4_dom,superfamily_Rho_GTPase_activation_prot,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_MyTH4_dom,smart_RhoGAP_dom,pfscan_MyTH4_dom,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.V903M	ENST00000276826.5	37	c.2707		8	.	.	.	.	.	.	.	.	.	.	c	13.63	2.295219	0.40594	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	D;T;D	0.92099	-2.97;-0.15;-2.97	5.06	3.94	0.45596	MyTH4 domain (2);	0.324544	0.29684	N	0.011471	D	0.84311	0.5444	L	0.39245	1.2	0.35996	D	0.837055	B;P	0.34780	0.177;0.468	B;B	0.27380	0.079;0.052	D	0.84896	0.0839	10	0.51188	T	0.08	-37.1658	5.2814	0.15678	0.0:0.7516:0.0:0.2484	.	872;903	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	M	872;903;872	ENSP00000276826:V872M;ENSP00000366522:V903M;ENSP00000445075:V872M	ENSP00000276826:V872M	V	-	1	0	ARHGAP39	145729499	0.004000	0.15560	1.000000	0.80357	0.986000	0.74619	-0.038000	0.12144	2.513000	0.84729	0.651000	0.88453	GTG	ARHGAP39	-	NULL	ENSG00000147799		0.637	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	ARHGAP39	HGNC	protein_coding	OTTHUMT00000382509.1	53	0.00	0	C			145758691	145758691	-1	no_errors	ENST00000377307	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	0.948	T
ARHGEF38	54848	genome.wustl.edu	37	4	106588724	106588724	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr4:106588724C>T	ENST00000420470.2	+	13	2156	c.2012C>T	c.(2011-2013)tCa>tTa	p.S671L		NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	671						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						TTCGTGTCTTCACGGCCAGCT	0.458																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.2012C>T	4.37:g.106588724C>T	ENSP00000416125:p.Ser671Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JIB4	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.S671L	ENST00000420470.2	37	c.2012	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469560	0.26423	.	.	ENSG00000236699	ENST00000420470	T	0.56275	0.47	5.73	4.88	0.63580	.	.	.	.	.	T	0.36358	0.0964	N	0.14661	0.345	0.22240	N	0.99927	B	0.09022	0.002	B	0.08055	0.003	T	0.25328	-1.0135	9	0.49607	T	0.09	.	10.7452	0.46177	0.0:0.7911:0.1375:0.0714	.	671	C9JIB4	.	L	671	ENSP00000416125:S671L	ENSP00000416125:S671L	S	+	2	0	ARHGEF38	106808173	0.980000	0.34600	0.828000	0.32881	0.288000	0.27193	2.105000	0.41825	1.378000	0.46305	0.650000	0.86243	TCA	ARHGEF38	-	NULL	ENSG00000236699		0.458	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	24	0.00	0	C	NM_017700		106588724	106588724	+1	no_errors	ENST00000420470	ensembl	human	putative	69_37n	missense	25	19.35	6	SNP	0.991	T
ARHGEF4	50649	genome.wustl.edu	37	2	131674285	131674285	+	5'UTR	SNP	A	A	G	rs3739127	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:131674285A>G	ENST00000326016.5	+	0	62				ARHGEF4_ENST00000428230.2_5'Flank|ARHGEF4_ENST00000525839.1_5'Flank|ARHGEF4_ENST00000392953.3_5'UTR|ARHGEF4_ENST00000409359.1_Silent_p.S592S	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		TTATTGAGTCAATAGTTCTAG	0.502													A|||	2677	0.534545	0.0779	0.6931	5008	,	,		17048	0.8284		0.6531	False		,,,				2504	0.6145					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.-458A>G	2.37:g.131674285A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HDC6|Q9UPP0	Silent	SNP	NULL	p.S592	ENST00000326016.5	37	c.1776	CCDS2165.1	2																																																																																			ARHGEF4	-	NULL	ENSG00000136002		0.502	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	11	0.00	0	A			131674285	131674285	+1	no_errors	ENST00000409359	ensembl	human	putative	69_37n	silent	16	27.27	6	SNP	0.034	G
ARHGEF40	55701	genome.wustl.edu	37	14	21543675	21543675	+	Intron	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr14:21543675G>T	ENST00000298694.4	+	4	1745				ARHGEF40_ENST00000298693.3_Intron			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40							cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GGGCATCAGTGGGTGAAGGGA	0.577																																						dbGAP											0													93.0	90.0	91.0					14																	21543675		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1618+17G>T	14.37:g.21543675G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	NULL	p.V545	ENST00000298694.4	37	c.1635	CCDS32041.1	14																																																																																			ARHGEF40	-	NULL	ENSG00000165801		0.577	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	HGNC	protein_coding	OTTHUMT00000413122.1	20	0.00	0	G			21543675	21543675	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000555038	ensembl	human	novel	69_37n	silent	21	16.00	4	SNP	0.073	T
ARIH1	25820	genome.wustl.edu	37	15	72875842	72875842	+	3'UTR	SNP	A	A	G	rs4777517	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr15:72875842A>G	ENST00000379887.4	+	0	2197				ARIH1_ENST00000562891.1_3'UTR	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1						cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						ATTCTAGGCCACCAACAAAAG	0.338													G|||	3664	0.731629	0.1921	0.8242	5008	,	,		19667	0.9484		0.9443	False		,,,				2504	0.953					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.*209A>G	15.37:g.72875842A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	RNA	SNP	-	NULL	ENST00000379887.4	37	NULL	CCDS10244.1	15																																																																																			ARIH1	-	-	ENSG00000166233		0.338	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH1	HGNC	protein_coding	OTTHUMT00000257350.1	12	0.00	0	A	NM_005744		72875842	72875842	+1	no_errors	ENST00000562891	ensembl	human	putative	69_37n	rna	11	35.29	6	SNP	0.997	G
ARMCX1	51309	genome.wustl.edu	37	X	100808302	100808302	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:100808302G>T	ENST00000372829.3	+	4	760	c.389G>T	c.(388-390)gGt>gTt	p.G130V		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	130						integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						GCTAGGGTGGGTACCATCTCT	0.637																																						dbGAP											0													81.0	73.0	76.0					X																	100808302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.389G>T	X.37:g.100808302G>T	ENSP00000361917:p.Gly130Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.G130V	ENST00000372829.3	37	c.389	CCDS14487.1	X	.	.	.	.	.	.	.	.	.	.	g	4.961	0.178565	0.09443	.	.	ENSG00000126947	ENST00000372829	T	0.28069	1.63	3.77	2.88	0.33553	.	1.272650	0.05862	N	0.623169	T	0.20901	0.0503	N	0.19112	0.55	0.09310	N	1	B	0.32968	0.392	B	0.31290	0.127	T	0.24835	-1.0149	10	0.30854	T	0.27	-0.2412	8.0168	0.30385	0.0:0.257:0.7429:0.0	.	130	Q9P291	ARMX1_HUMAN	V	130	ENSP00000361917:G130V	ENSP00000361917:G130V	G	+	2	0	ARMCX1	100694958	0.246000	0.23909	0.003000	0.11579	0.566000	0.35808	1.514000	0.35834	0.907000	0.36646	0.499000	0.49734	GGT	ARMCX1	-	NULL	ENSG00000126947		0.637	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX1	HGNC	protein_coding	OTTHUMT00000057561.1	50	0.00	0	G	NM_016608		100808302	100808302	+1	no_errors	ENST00000372829	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.002	T
ASPH	444	genome.wustl.edu	37	8	62475413	62475413	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr8:62475413G>T	ENST00000379454.4	-	18	1514	c.1327C>A	c.(1327-1329)Ctg>Atg	p.L443M	ASPH_ENST00000541428.1_Missense_Mutation_p.L414M	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	443					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	AATCTCTGCAGGGTAAGCAGG	0.353																																						dbGAP											0													94.0	92.0	93.0					8																	62475413		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.1327C>A	8.37:g.62475413G>T	ENSP00000368767:p.Leu443Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L443M	ENST00000379454.4	37	c.1327	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156470	0.57259	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454	T;T	0.45276	0.9;0.9	5.45	4.55	0.56014	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000002	T	0.55816	0.1944	L	0.50919	1.6	0.80722	D	1	D;D;D	0.89917	0.995;1.0;0.991	P;D;P	0.91635	0.85;0.999;0.712	T	0.54873	-0.8228	10	0.46703	T	0.11	-12.4342	10.9793	0.47483	0.1556:0.0:0.8444:0.0	.	414;424;443	F5H667;F8W7A9;Q12797	.;.;ASPH_HUMAN	M	424;414;443	ENSP00000437864:L414M;ENSP00000368767:L443M	ENSP00000368767:L443M	L	-	1	2	ASPH	62637967	1.000000	0.71417	0.980000	0.43619	0.988000	0.76386	3.113000	0.50376	1.356000	0.45884	0.650000	0.86243	CTG	ASPH	-	pfscan_TPR-contain_dom	ENSG00000198363		0.353	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	38	0.00	0	G	NM_004318		62475413	62475413	-1	no_errors	ENST00000379454	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.998	T
ATP7A	538	genome.wustl.edu	37	X	77271371	77271371	+	Silent	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:77271371C>T	ENST00000341514.6	+	12	2774	c.2619C>T	c.(2617-2619)ctC>ctT	p.L873L	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Silent_p.L795L	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	873			L -> R (in MNKD). {ECO:0000269|PubMed:10319589}.		blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	ATGAGTCCCTCATCACAGGTA	0.353																																						dbGAP											0													149.0	126.0	134.0					X																	77271371		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.2619C>T	X.37:g.77271371C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AT72|O00227|O00745|Q9BYY8	Silent	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_HG_scavenger,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.L873	ENST00000341514.6	37	c.2619	CCDS35339.1	X																																																																																			ATP7A	-	pfam_ATPase_P-typ_ATPase-assoc-dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000165240		0.353	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7A	HGNC	protein_coding	OTTHUMT00000057306.1	38	0.00	0	C	NM_000052		77271371	77271371	+1	no_errors	ENST00000341514	ensembl	human	known	69_37n	silent	40	16.67	8	SNP	1.000	T
BIRC7	79444	genome.wustl.edu	37	20	61869661	61869661	+	Intron	SNP	G	G	A	rs75064873	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr20:61869661G>A	ENST00000217169.3	+	3	663				BIRC7_ENST00000395306.1_Silent_p.G34G|MIR3196_ENST00000579556.1_RNA|NKAIN4_ENST00000466885.1_5'Flank|BIRC7_ENST00000342412.6_Intron	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7						activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					GGAGGAGGGGGCCCAACCCTG	0.667													G|||	166	0.033147	0.1188	0.013	5008	,	,		14891	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.450-87G>A	20.37:g.61869661G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQV0|Q9H2A8|Q9HAP7	Silent	SNP	smart_Znf_RING,pfscan_Znf_RING	p.G34	ENST00000217169.3	37	c.102	CCDS13513.1	20																																																																																			BIRC7	-	NULL	ENSG00000101197		0.667	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIRC7	HGNC	protein_coding	OTTHUMT00000080114.2	9	0.00	0	G	NM_139317		61869661	61869661	+1	no_errors	ENST00000395306	ensembl	human	putative	69_37n	silent	9	60.87	14	SNP	0.000	A
BRAP	8315	genome.wustl.edu	37	12	112103450	112103450	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:112103450C>T	ENST00000327551.6	-	6	939	c.799G>A	c.(799-801)Gat>Aat	p.D267N	BRAP_ENST00000419234.4_Missense_Mutation_p.D297N|BRAP_ENST00000539060.1_Missense_Mutation_p.D118N			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						CACGTGGTATCGTCCCAGCGC	0.532																																					Pancreas(146;846 1904 7830 25130 26065)	dbGAP											0													118.0	86.0	97.0					12																	112103450		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.799G>A	12.37:g.112103450C>T	ENSP00000330813:p.Asp267Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	pfam_BRAP2,pfam_Znf_UBP,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_UBP,pfscan_Znf_RING,pfscan_Znf_UBP	p.D297N	ENST00000327551.6	37	c.889		12	.	.	.	.	.	.	.	.	.	.	C	28.7	4.944933	0.92593	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	T;T;T	0.66280	-0.2;1.04;-0.2	5.22	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.094525	0.64402	D	0.000001	T	0.62097	0.2400	N	0.04018	-0.295	0.80722	D	1	D;D	0.76494	0.999;0.99	D;P	0.77004	0.989;0.58	T	0.70880	-0.4752	10	0.44086	T	0.13	-24.3166	18.7631	0.91860	0.0:1.0:0.0:0.0	.	118;297	B4DRM1;Q7Z569	.;BRAP_HUMAN	N	297;118;267;79	ENSP00000403524:D297N;ENSP00000441659:D118N;ENSP00000330813:D267N	ENSP00000330813:D267N	D	-	1	0	BRAP	110587833	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	7.332000	0.79203	2.431000	0.82371	0.305000	0.20034	GAT	BRAP	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000089234		0.532	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	BRAP	HGNC	protein_coding	OTTHUMT00000404994.2	57	0.00	0	C			112103450	112103450	-1	no_errors	ENST00000419234	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	1.000	T
PRR26	414235	genome.wustl.edu	37	10	696237	696237	+	Silent	SNP	G	G	A	rs10904535	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr10:696237G>A	ENST00000441152.2	+	2	238	c.75G>A	c.(73-75)agG>agA	p.R25R	DIP2C_ENST00000280886.6_Intron|PRR26_ENST00000381489.5_Missense_Mutation_p.G63R			Q8N8Z3	PRR26_HUMAN	proline rich 26	25																	TCAGGGCCAGGGACCATGGTG	0.687													G|||	3240	0.646965	0.143	0.7767	5008	,	,		15695	0.7133		0.9046	False		,,,				2504	0.9029					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK096000		10p15.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000180525	ENSG00000180525			30724	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 108"""	C10orf108			Standard	NR_027151		Approved	FLJ38681	uc001ifr.3	Q8N8Z3	OTTHUMG00000017529	ENST00000441152.2:c.75G>A	10.37:g.696237G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G63R	ENST00000441152.2	37	c.187		10	1478	0.6767399267399268	84	0.17073170731707318	278	0.7679558011049724	431	0.7534965034965035	685	0.9036939313984169	-	1.773	-0.483767	0.04383	.	.	ENSG00000180525	ENST00000381489	.	.	.	1.16	0.21	0.15231	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.14699	-1.0463	6	0.87932	D	0	.	3.6864	0.08329	0.2629:0.0:0.7371:0.0	rs10904535;rs10904535	63	Q5VXK3	.	R	63	.	ENSP00000370899:G63R	G	+	1	0	C10orf108	686237	0.000000	0.05858	0.006000	0.13384	0.004000	0.04260	-0.761000	0.04751	0.091000	0.17302	-1.121000	0.02013	GGA	C10orf108	-	NULL	ENSG00000180525		0.687	PRR26-002	KNOWN	basic|appris_principal	protein_coding	C10orf108	HGNC	protein_coding	OTTHUMT00000046386.1	55	0.00	0	G			696237	696237	+1	no_errors	ENST00000381489	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.006	A
C19orf81	342918	genome.wustl.edu	37	19	51159359	51159359	+	Silent	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr19:51159359G>T	ENST00000425202.1	+	2	120	c.120G>T	c.(118-120)ctG>ctT	p.L40L	SYT3_ENST00000544769.1_Intron	NM_001195076.1	NP_001182005.1	C9J6K1	CS081_HUMAN	chromosome 19 open reading frame 81	40																	CTCGGAGCCTGGGCAGGCCCA	0.612																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS54296.1	19q13.33	2011-08-15			ENSG00000235034	ENSG00000235034			40041	protein-coding gene	gene with protein product							Standard	NM_001195076		Approved		uc021uyf.1	C9J6K1	OTTHUMG00000154593	ENST00000425202.1:c.120G>T	19.37:g.51159359G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L40	ENST00000425202.1	37	c.120	CCDS54296.1	19																																																																																			C19orf81	-	NULL	ENSG00000235034		0.612	C19orf81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf81	HGNC	protein_coding	OTTHUMT00000336224.2	43	0.00	0	G	NM_001195076		51159359	51159359	+1	no_errors	ENST00000425202	ensembl	human	novel	69_37n	silent	32	11.11	4	SNP	0.921	T
C1orf105	92346	genome.wustl.edu	37	1	172422209	172422209	+	Intron	SNP	C	C	T	rs2285175	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:172422209C>T	ENST00000367727.4	+	4	396				C1orf105_ENST00000367725.4_Silent_p.V16V|C1orf105_ENST00000367726.1_Intron	NM_139240.3	NP_640333.3	O95561	CA105_HUMAN	chromosome 1 open reading frame 105											large_intestine(1)|lung(12)|prostate(1)|skin(1)	15						ATGTTTGCGTCGCCTTTAAAG	0.502													C|||	1534	0.30631	0.3343	0.2795	5008	,	,		21401	0.3413		0.2068	False		,,,				2504	0.3538					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL035295	CCDS1301.1, CCDS72983.1	1q24.3	2012-06-26			ENSG00000180999	ENSG00000180999			29591	protein-coding gene	gene with protein product						12477932	Standard	NM_139240		Approved		uc001gik.3	O95561	OTTHUMG00000034750	ENST00000367727.4:c.199-3346C>T	1.37:g.172422209C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IY02	Silent	SNP	NULL	p.V16	ENST00000367727.4	37	c.48	CCDS1301.1	1																																																																																			C1orf105	-	NULL	ENSG00000180999		0.502	C1orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf105	HGNC	protein_coding	OTTHUMT00000084062.2	52	0.00	0	C	NM_139240		172422209	172422209	+1	no_errors	ENST00000367725	ensembl	human	putative	69_37n	silent	63	11.27	8	SNP	0.000	T
SMIM4	440957	genome.wustl.edu	37	3	52570843	52570843	+	Silent	SNP	G	G	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr3:52570843G>C	ENST00000477703.1	+	1	223	c.72G>C	c.(70-72)cgG>cgC	p.R24R	SMIM4_ENST00000307106.3_Intron|SMIM4_ENST00000476842.1_Silent_p.R24R|SMIM4_ENST00000482728.1_Intron|NT5DC2_ENST00000307076.4_5'Flank	NM_001124767.1	NP_001118239.1	Q8WVI0	SMIM4_HUMAN	small integral membrane protein 4	24						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											GCATCTACCGGTTCCTGCCCT	0.577																																						dbGAP											0													168.0	170.0	169.0					3																	52570843		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK095910	CCDS46844.1	3p21.1	2012-10-08	2012-10-08	2012-10-08	ENSG00000168273	ENSG00000168273			37257	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 78"""	C3orf78			Standard	NM_001124767		Approved		uc003dep.2	Q8WVI0	OTTHUMG00000158726	ENST00000477703.1:c.72G>C	3.37:g.52570843G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.R24	ENST00000477703.1	37	c.72	CCDS46844.1	3																																																																																			C3orf78	-	NULL	ENSG00000168273		0.577	SMIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf78	HGNC	protein_coding	OTTHUMT00000351920.1	60	0.00	0	G	NM_001124767		52570843	52570843	+1	no_errors	ENST00000477703	ensembl	human	known	69_37n	silent	70	13.58	11	SNP	1.000	C
CCDC57	284001	genome.wustl.edu	37	17	80092131	80092131	+	Intron	SNP	T	T	C	rs4789753|rs386799938	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:80092131T>C	ENST00000389641.4	-	16	2281				CCDC57_ENST00000392346.2_Intron|CCDC57_ENST00000392347.1_Intron			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			TCCTCTTGTGTTGAATGCAAA	0.507													C|||	4132	0.82508	0.7103	0.8631	5008	,	,		20263	0.9435		0.7992	False		,,,				2504	0.8579					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2245-5658A>G	17.37:g.80092131T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP51|A8MQC7|Q8IWG2|Q8TER3	RNA	SNP	-	NULL	ENST00000389641.4	37	NULL		17																																																																																			CCDC57	-	-	ENSG00000176155		0.507	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	HGNC	protein_coding	OTTHUMT00000277182.3	32	0.00	0	T	NM_198082		80092131	80092131	-1	no_errors	ENST00000483145	ensembl	human	putative	69_37n	rna	27	12.90	4	SNP	0.000	C
CD247	919	genome.wustl.edu	37	1	167403322	167403322	+	Intron	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:167403322G>A	ENST00000362089.5	-	6	409				CD247_ENST00000392122.3_Intron|CD247_ENST00000483825.1_5'UTR			P20963	CD3Z_HUMAN	CD247 molecule						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	alpha-beta T cell receptor complex (GO:0042105)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)	6			LUSC - Lung squamous cell carcinoma(543;0.236)		Muromonab(DB00075)	TCCTGCAGAAGAGGGCGTGGA	0.493																																					Ovarian(192;1815 2869 36877 43334)	dbGAP											0													164.0	156.0	159.0					1																	167403322		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC025703	CCDS1260.1, CCDS1261.1	1q24.2	2014-09-17	2006-03-28	2006-03-09	ENSG00000198821	ENSG00000198821		"""CD molecules"""	1677	protein-coding gene	gene with protein product		186780	"""CD3z antigen, zeta polypeptide (TiT3 complex)"", ""CD247 antigen"""	CD3Z		2974162	Standard	NM_198053		Approved	CD3H, CD3Q	uc001gei.4	P20963	OTTHUMG00000034593	ENST00000362089.5:c.337-9C>T	1.37:g.167403322G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK49|Q5VX13|Q8TAX4	RNA	SNP	-	NULL	ENST00000362089.5	37	NULL	CCDS1261.1	1																																																																																			CD247	-	-	ENSG00000198821		0.493	CD247-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD247	HGNC	protein_coding	OTTHUMT00000083707.1	33	0.00	0	G	NM_198053		167403322	167403322	-1	no_errors	ENST00000483825	ensembl	human	known	69_37n	rna	33	12.82	5	SNP	0.006	A
CDH1	999	genome.wustl.edu	37	16	68772218	68772218	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr16:68772218C>T	ENST00000261769.5	+	2	258	c.67C>T	c.(67-69)Cag>Tag	p.Q23*	CDH1_ENST00000422392.2_Nonsense_Mutation_p.Q23*	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	23					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.V17fs*1(3)|p.?(2)|p.W20fs*7(1)|p.Q23*(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TTGGCTCTGCCAGGAGCCGGA	0.677			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	7	Deletion - Frameshift(4)|Unknown(2)|Substitution - Nonsense(1)	breast(7)											14.0	17.0	16.0					16																	68772218		1763	3312	5075	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.67C>T	16.37:g.68772218C>T	ENSP00000261769:p.Gln23*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q23*	ENST00000261769.5	37	c.67	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175447	0.78564	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	4.76	1.47	0.22746	.	0.000000	0.34652	N	0.003783	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	13.0323	0.58848	0.0:0.551:0.449:0.0	.	.	.	.	X	23	.	ENSP00000261769:Q23X	Q	+	1	0	CDH1	67329719	0.998000	0.40836	0.961000	0.40146	0.242000	0.25591	0.719000	0.25881	0.574000	0.29417	0.563000	0.77884	CAG	CDH1	-	superfamily_Cadherin-like	ENSG00000039068		0.677	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	65	0.00	0	C	NM_004360		68772218	68772218	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	44	16.98	9	SNP	0.982	T
CEP89	84902	genome.wustl.edu	37	19	33422404	33422404	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr19:33422404C>G	ENST00000305768.5	-	9	1048	c.960G>C	c.(958-960)atG>atC	p.M320I	CEP89_ENST00000590597.2_Missense_Mutation_p.M320I	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	320					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						GATGGACAGTCATTTTCAATC	0.358																																						dbGAP											0													101.0	86.0	91.0					19																	33422404		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.960G>C	19.37:g.33422404C>G	ENSP00000306105:p.Met320Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGA6|Q8N5J8	Missense_Mutation	SNP	NULL	p.M320I	ENST00000305768.5	37	c.960	CCDS32987.1	19	.	.	.	.	.	.	.	.	.	.	C	18.67	3.672950	0.67928	.	.	ENSG00000121289	ENST00000305768	T	0.31247	1.5	5.51	3.38	0.38709	.	0.305252	0.43110	N	0.000613	T	0.33876	0.0878	M	0.63428	1.95	0.30306	N	0.788967	B;P;P	0.49783	0.041;0.928;0.922	B;B;P	0.48840	0.011;0.441;0.592	T	0.28138	-1.0053	10	0.37606	T	0.19	-9.3662	6.1105	0.20097	0.1508:0.6897:0.0:0.1596	.	320;73;320	Q96ST8-3;Q96ST8-2;Q96ST8	.;.;CEP89_HUMAN	I	320	ENSP00000306105:M320I	ENSP00000306105:M320I	M	-	3	0	CEP89	38114244	1.000000	0.71417	0.653000	0.29593	0.988000	0.76386	2.329000	0.43876	0.685000	0.31468	0.585000	0.79938	ATG	CEP89	-	NULL	ENSG00000121289		0.358	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	22	0.00	0	C	NM_032816		33422404	33422404	-1	no_errors	ENST00000305768	ensembl	human	known	69_37n	missense	28	17.14	6	SNP	0.999	G
CNTNAP2	26047	genome.wustl.edu	37	7	148113895	148113895	+	3'UTR	SNP	G	G	A	rs2530312	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr7:148113895G>A	ENST00000361727.3	+	0	5699				CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2						adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTTCTTCTAAGACGGACACAT	0.408										HNSCC(39;0.1)			G|||	1876	0.374601	0.0635	0.598	5008	,	,		17455	0.622		0.4006	False		,,,				2504	0.3548					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.*1187G>A	7.37:g.148113895G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	RNA	SNP	-	NULL	ENST00000361727.3	37	NULL	CCDS5889.1	7																																																																																			CNTNAP2	-	-	ENSG00000174469		0.408	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	23	0.00	0	G			148113895	148113895	+1	no_errors	ENST00000463592	ensembl	human	known	69_37n	rna	31	13.89	5	SNP	0.003	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43685298	43685298	+	Missense_Mutation	SNP	G	G	T	rs62558062	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:43685298G>T	ENST00000377564.3	+	1	397	c.4G>T	c.(4-6)Gct>Tct	p.A2S	CNTNAP3B_ENST00000276974.6_Missense_Mutation_p.A2S	NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	2					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						AGTGAGCATGGCTTCAGTGGC	0.642													g|||	1577	0.314896	0.27	0.33	5008	,	,		17099	0.3839		0.3519	False		,,,				2504	0.2556					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.4G>T	9.37:g.43685298G>T	ENSP00000366787:p.Ala2Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.A2S	ENST00000377564.3	37	c.4	CCDS55312.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.33|11.33	1.606990|1.606990	0.28623|0.28623	.|.	.|.	ENSG00000154529|ENSG00000154529	ENST00000377564;ENST00000276974;ENST00000341990;ENST00000403166|ENST00000377561	D;D|.	0.95069|.	-2.53;-3.6|.	1.69|1.69	1.69|1.69	0.24217|0.24217	.|.	.|.	.|.	.|.	.|.	T|T	0.21962|0.21962	0.0529|0.0529	N|N	0.08118|0.08118	0|0	0.52099|0.52099	P|P	5.500000000002725E-5|5.500000000002725E-5	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.31110|0.31110	-0.9955|-0.9955	6|4	0.34782|.	T|.	0.22|.	.|.	8.2934|8.2934	0.31971|0.31971	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs62558062|rs62558062	.|.	.|.	.|.	S|C	2|50	ENSP00000366787:A2S;ENSP00000276974:A2S|.	ENSP00000276974:A2S|.	A|W	+|+	1|3	0|0	CNTNAP3B|CNTNAP3B	43625294|43625294	1.000000|1.000000	0.71417|0.71417	0.373000|0.373000	0.26003|0.26003	0.031000|0.031000	0.12232|0.12232	3.824000|3.824000	0.55723|0.55723	0.914000|0.914000	0.36822|0.36822	0.184000|0.184000	0.17185|0.17185	GCT|TGG	CNTNAP3B	-	NULL	ENSG00000154529		0.642	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	24	0.00	0	G			43685298	43685298	+1	no_errors	ENST00000377564	ensembl	human	known	69_37n	missense	29	18.92	7	SNP	0.925	T
CNTRL	11064	genome.wustl.edu	37	9	123888047	123888047	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:123888047G>T	ENST00000373855.1	+	14	2118	c.1858G>T	c.(1858-1860)Ggg>Tgg	p.G620W	CNTRL_ENST00000238341.5_Missense_Mutation_p.G620W|CNTRL_ENST00000373847.1_Missense_Mutation_p.G68W|CNTRL_ENST00000373850.1_Missense_Mutation_p.G68W			Q7Z7A1	CNTRL_HUMAN	centriolin	620					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TGTTATCAGTGGGTTGCAAGA	0.438																																						dbGAP											0													124.0	126.0	126.0					9																	123888047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1858G>T	9.37:g.123888047G>T	ENSP00000362962:p.Gly620Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.G620W	ENST00000373855.1	37	c.1858	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149007	0.78001	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.76839	-0.58;-0.58;-1.05;-0.72	5.44	5.44	0.79542	.	.	.	.	.	D	0.83408	0.5248	L	0.34521	1.04	0.50813	D	0.999898	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85137	0.0978	9	0.72032	D	0.01	.	18.2527	0.90009	0.0:0.0:1.0:0.0	.	620;620;620	B2RP65;F5GZN0;Q7Z7A1	.;.;CNTRL_HUMAN	W	620;620;620;102;68;68	ENSP00000362962:G620W;ENSP00000238341:G620W;ENSP00000362956:G68W;ENSP00000362953:G68W	ENSP00000238341:G620W	G	+	1	0	CNTRL	122927868	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	7.838000	0.86804	2.531000	0.85337	0.650000	0.86243	GGG	CNTRL	-	NULL	ENSG00000119397		0.438	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	34	0.00	0	G	NM_007018		123888047	123888047	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	1.000	T
CRYGA	1418	genome.wustl.edu	37	2	209027930	209027930	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:209027930G>A	ENST00000304502.4	-	2	269	c.250C>T	c.(250-252)Cat>Tat	p.H84Y		NM_014617.3	NP_055432.2	P11844	CRGA_HUMAN	crystallin, gamma A	84	Connecting peptide.				lens development in camera-type eye (GO:0002088)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			endometrium(1)|kidney(3)|large_intestine(1)|lung(7)	12				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		AGACTCACATGAGGAATTATA	0.488																																						dbGAP											0													70.0	75.0	73.0					2																	209027930		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33367.1	2q34	2013-02-14			ENSG00000168582	ENSG00000168582			2408	protein-coding gene	gene with protein product	"""gamma crystallin 5"""	123660		CRYG1			Standard	NM_014617		Approved	CRYG5, CRY-g-A		P11844	OTTHUMG00000154796	ENST00000304502.4:c.250C>T	2.37:g.209027930G>A	ENSP00000302105:p.His84Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53ST5	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.H84Y	ENST00000304502.4	37	c.250	CCDS33367.1	2	.	.	.	.	.	.	.	.	.	.	G	6.055	0.378528	0.11466	.	.	ENSG00000168582	ENST00000304502	T	0.74632	-0.86	4.64	0.481	0.16809	Beta/gamma crystallin (1);Gamma-crystallin-related (1);	0.625587	0.12436	N	0.469115	T	0.50752	0.1634	L	0.28192	0.835	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.35919	-0.9769	10	0.02654	T	1	.	4.2912	0.10879	0.5196:0.1723:0.308:0.0	.	84	P11844	CRGA_HUMAN	Y	84	ENSP00000302105:H84Y	ENSP00000302105:H84Y	H	-	1	0	CRYGA	208736175	0.000000	0.05858	0.218000	0.23776	0.051000	0.14879	-0.432000	0.06956	0.002000	0.14630	-1.073000	0.02249	CAT	CRYGA	-	superfamily_G_crystallin-rel	ENSG00000168582		0.488	CRYGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGA	HGNC	protein_coding	OTTHUMT00000337096.1	49	0.00	0	G	NM_014617		209027930	209027930	-1	no_errors	ENST00000304502	ensembl	human	known	69_37n	missense	51	13.33	8	SNP	0.008	A
DDX39B	7919	genome.wustl.edu	37	6	31506691	31506691	+	Intron	SNP	G	G	A	rs2071596	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr6:31506691G>A	ENST00000396172.1	-	4	970				DDX39B_ENST00000449074.2_Intron|SNORD117_ENST00000364915.1_RNA|DDX39B_ENST00000415382.2_Intron|DDX39B_ENST00000376177.2_Intron|DDX39B_ENST00000453105.2_Intron|ATP6V1G2-DDX39B_ENST00000376185.1_Intron|DDX39B_ENST00000417556.2_Intron|SNORD84_ENST00000584275.1_RNA|DDX39B_ENST00000458640.1_Intron	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B						ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						ATCCCCTCTAGGGAAGTGACT	0.458													G|||	1289	0.257388	0.3268	0.2565	5008	,	,		21584	0.3661		0.17	False		,,,				2504	0.1421					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.340-59C>T	6.37:g.31506691G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfscan_Helicase_ATP-bd,pfscan_RNA_helicase_DEAD_Q_motif	p.P122L	ENST00000396172.1	37	c.365	CCDS4697.1	6	588	0.2692307692307692	161	0.32723577235772355	81	0.22375690607734808	210	0.36713286713286714	136	0.17941952506596306	g	11.52	1.664650	0.29604	.	.	ENSG00000198563	ENST00000428450;ENST00000419020	T;T	0.36699	1.24;1.62	4.33	-0.315	0.12746	.	.	.	.	.	T	0.22627	0.0546	.	.	.	0.58432	P	1.999999999946489E-6	.	.	.	.	.	.	T	0.15122	-1.0448	5	0.87932	D	0	.	7.1329	0.25512	0.5711:0.0:0.4289:0.0	rs2071596;rs60291300;rs2071596	.	.	.	L	122	ENSP00000405707:P122L;ENSP00000405245:P122L	ENSP00000405245:P122L	P	-	2	0	DDX39B	31614670	0.001000	0.12720	0.000000	0.03702	0.046000	0.14306	0.760000	0.26475	-0.012000	0.14223	-0.265000	0.10407	CCT	DDX39B	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfscan_Helicase_ATP-bd	ENSG00000198563		0.458	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39B	HGNC	protein_coding	OTTHUMT00000259083.1	33	0.00	0	G	NM_004640		31506691	31506691	-1	no_stop_codon	ENST00000428450	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.000	A
DLC1	10395	genome.wustl.edu	37	8	12957134	12957134	+	Silent	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr8:12957134G>A	ENST00000276297.4	-	9	3121	c.2712C>T	c.(2710-2712)ccC>ccT	p.P904P	DLC1_ENST00000358919.2_Silent_p.P467P|DLC1_ENST00000520226.1_Silent_p.P393P|DLC1_ENST00000512044.2_Silent_p.P501P	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	904					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CGTCCAGCTCGGGGAAGATGT	0.582																																						dbGAP											0													80.0	70.0	73.0					8																	12957134		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2712C>T	8.37:g.12957134G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.P904	ENST00000276297.4	37	c.2712	CCDS5989.1	8																																																																																			DLC1	-	NULL	ENSG00000164741		0.582	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	50	0.00	0	G	NM_182643, NM_006094		12957134	12957134	-1	no_errors	ENST00000276297	ensembl	human	known	69_37n	silent	38	17.39	8	SNP	0.003	A
DNAH1	25981	genome.wustl.edu	37	3	52388987	52388987	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr3:52388987G>A	ENST00000420323.2	+	21	3870	c.3609G>A	c.(3607-3609)atG>atA	p.M1203I		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1203	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACATCGTCATGACCCAGAATA	0.557																																						dbGAP											0													123.0	126.0	125.0					3																	52388987		2078	4208	6286	-	-	-	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.3609G>A	3.37:g.52388987G>A	ENSP00000401514:p.Met1203Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.M1203I	ENST00000420323.2	37	c.3609	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	18.93	3.726847	0.69074	.	.	ENSG00000114841	ENST00000420323	T	0.60171	0.21	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000012	T	0.53690	0.1812	L	0.41415	1.275	0.44268	D	0.997124	B	0.24258	0.1	B	0.29077	0.098	T	0.48958	-0.8988	10	0.35671	T	0.21	.	18.9092	0.92475	0.0:0.0:1.0:0.0	.	1203	C9JXH6	.	I	1203	ENSP00000401514:M1203I	ENSP00000401514:M1203I	M	+	3	0	DNAH1	52364027	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.812000	0.55628	2.481000	0.83766	0.462000	0.41574	ATG	DNAH1	-	pfam_Dynein_heavy_dom-2	ENSG00000114841		0.557	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	39	0.00	0	G	NM_015512		52388987	52388987	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	A
EPHA6	285220	genome.wustl.edu	37	3	97365038	97365038	+	Missense_Mutation	SNP	G	G	A	rs301948	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr3:97365038G>A	ENST00000514100.1	+	12	1278	c.1036G>A	c.(1036-1038)Gag>Aag	p.E346K	EPHA6_ENST00000502694.1_Intron|EPHA6_ENST00000389672.5_Intron	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TGAGCAGTGCGAGTCCAGCTC	0.473													G|||	3237	0.646366	0.6793	0.5692	5008	,	,		16158	0.6964		0.5805	False		,,,				2504	0.6728					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.1036G>A	3.37:g.97365038G>A	ENSP00000421711:p.Glu346Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RAL5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E346K	ENST00000514100.1	37	c.1036		3	1377	0.6304945054945055	344	0.6991869918699187	203	0.5607734806629834	390	0.6818181818181818	440	0.5804749340369393	G	6.017	0.371517	0.11409	.	.	ENSG00000080224	ENST00000514100	T	0.80738	-1.41	3.04	0.207	0.15214	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.40194	-0.9576	7	0.87932	D	0	.	2.779	0.05355	0.2538:0.0:0.5249:0.2212	rs301948;rs1684627;rs58241857;rs301948	346	D6RAL5	.	K	346	ENSP00000421711:E346K	ENSP00000421711:E346K	E	+	1	0	EPHA6	98847728	0.007000	0.16637	0.001000	0.08648	0.000000	0.00434	0.571000	0.23669	0.019000	0.15079	-0.824000	0.03097	GAG	EPHA6	-	smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000080224		0.473	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000359997.1	28	0.00	0	G	NM_001080448		97365038	97365038	+1	no_errors	ENST00000514100	ensembl	human	novel	69_37n	missense	23	17.86	5	SNP	0.001	A
FAM205B	389715	genome.wustl.edu	37	9	34837574	34837574	+	RNA	SNP	C	C	T	rs3739880	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:34837574C>T	ENST00000455647.2	-	0	283							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		GCTCTTGGCTCCAGGGGTCAT	0.507													C|||	2258	0.450879	0.329	0.3588	5008	,	,		17719	0.6667		0.3499	False		,,,				2504	0.5624					dbGAP											0																																										-	-	-			0					9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34837574C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRJ7	RNA	SNP	-	NULL	ENST00000455647.2	37	NULL		9																																																																																			FAM205B	-	-	ENSG00000215204		0.507	FAM205B-001	KNOWN	basic	processed_transcript	FAM205B	HGNC	pseudogene	OTTHUMT00000052246.5	47	0.00	0	C	NR_024481		34837574	34837574	-1	no_errors	ENST00000378786	ensembl	human	known	69_37n	rna	43	10.42	5	SNP	0.008	T
FASTKD2	22868	genome.wustl.edu	37	2	207656460	207656460	+	Silent	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:207656460G>A	ENST00000236980.6	+	12	2415	c.2067G>A	c.(2065-2067)ttG>ttA	p.L689L	FASTKD2_ENST00000402774.3_Silent_p.L689L|FASTKD2_ENST00000403094.3_Silent_p.L689L	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	689	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		TCACATTTTTGAAGACTAAAA	0.363																																						dbGAP											0													124.0	117.0	119.0					2																	207656460		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.2067G>A	2.37:g.207656460G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVX6|Q9Y2H7	Silent	SNP	pfam_FAST_Leu-rich,pfam_FAST_2,pfam_RAP,smart_RAP	p.L689	ENST00000236980.6	37	c.2067	CCDS2371.1	2																																																																																			FASTKD2	-	pfam_RAP,smart_RAP	ENSG00000118246		0.363	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD2	HGNC	protein_coding	OTTHUMT00000256428.2	32	0.00	0	G	NM_014929		207656460	207656460	+1	no_errors	ENST00000236980	ensembl	human	known	69_37n	silent	52	10.34	6	SNP	0.986	A
FBXL19	54620	genome.wustl.edu	37	16	30934062	30934062	+	5'Flank	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr16:30934062C>T	ENST00000380310.2	+	0	0				FBXL19_ENST00000562319.1_5'Flank|FBXL19_ENST00000565690.1_5'Flank|FBXL19_ENST00000471231.2_5'Flank|FBXL19-AS1_ENST00000563777.1_RNA|FBXL19_ENST00000338343.4_5'Flank	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						CTGCAGCCGCCATCTTTGCCG	0.632																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403		16.37:g.30934062C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT10|Q8N789|Q9NT14	RNA	SNP	-	NULL	ENST00000380310.2	37	NULL	CCDS45465.1	16																																																																																			FBXL19-AS1	-	-	ENSG00000260852		0.632	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL19-AS1	HGNC	protein_coding		29	0.00	0	C	NM_019085		30934062	30934062	-1	no_errors	ENST00000563777	ensembl	human	known	69_37n	rna	35	16.67	7	SNP	1.000	T
FBXO17	115290	genome.wustl.edu	37	19	39437131	39437131	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr19:39437131C>T	ENST00000292852.4	-	4	879	c.538G>A	c.(538-540)Gag>Aag	p.E180K	CTC-360G5.8_ENST00000599996.1_Silent_p.*84*|SARS2_ENST00000448145.2_Missense_Mutation_p.E15K|FBXO17_ENST00000595329.1_Missense_Mutation_p.E180K	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	180	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			ACACAGATCTCAATCTGGGCG	0.637																																						dbGAP											0													78.0	64.0	69.0					19																	39437131		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.538G>A	19.37:g.39437131C>T	ENSP00000292852:p.Glu180Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LQ4	Missense_Mutation	SNP	pirsf_Ser-tRNA-synth_IIa,pfam_F-box-assoc_dom,pfam_aa-tRNA-synt_IIb_cons-dom,superfamily_Galactose-bd-like,superfamily_tRNA-bd_arm,prints_Ser-tRNA-synth_IIa,pfscan_F-box-assoc_dom,pfscan_aa-tRNA-synth_II,tigrfam_Ser-tRNA-synth_IIa	p.E15K	ENST00000292852.4	37	c.43	CCDS12526.1	19	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781466	0.49891	.	.	ENSG00000104835	ENST00000448145;ENST00000392076;ENST00000292852	T;T	0.34275	1.37;1.37	4.25	4.25	0.50352	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.253091	0.27513	N	0.019028	T	0.51924	0.1703	M	0.64260	1.97	.	.	.	D;D	0.69078	0.979;0.997	D;D	0.77004	0.973;0.989	T	0.54576	-0.8273	9	0.17369	T	0.5	.	12.3348	0.55060	0.0:1.0:0.0:0.0	.	15;180	E7EX87;Q96EF6	.;FBX17_HUMAN	K	15;189;180	ENSP00000399330:E15K;ENSP00000292852:E180K	ENSP00000292852:E180K	E	-	1	0	FBXO17	44128971	0.975000	0.34042	1.000000	0.80357	0.969000	0.65631	2.535000	0.45685	2.362000	0.80069	0.455000	0.32223	GAG	FBXO17	-	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	ENSG00000104835		0.637	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO17	HGNC	protein_coding	OTTHUMT00000463273.1	26	0.00	0	C	NM_024907		39437131	39437131	-1	no_errors	ENST00000448145	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.998	T
FKBP1A	2280	genome.wustl.edu	37	20	1350709	1350709	+	3'UTR	SNP	T	T	C	rs8392	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr20:1350709T>C	ENST00000400137.4	-	0	534				SDCBP2-AS1_ENST00000609285.1_RNA|SDCBP2-AS1_ENST00000609470.1_RNA|SDCBP2-AS1_ENST00000446423.1_RNA|FKBP1A_ENST00000381724.3_3'UTR|FKBP1A_ENST00000460490.1_5'UTR	NM_000801.4	NP_000792.1	P62942	FKB1A_HUMAN	FK506 binding protein 1A, 12kDa						'de novo' protein folding (GO:0006458)|amyloid fibril formation (GO:1990000)|calcium ion transmembrane transport (GO:0070588)|chaperone-mediated protein folding (GO:0061077)|extracellular fibril organization (GO:0043206)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|protein peptidyl-prolyl isomerization (GO:0000413)|protein refolding (GO:0042026)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of amyloid precursor protein catabolic process (GO:1902991)|regulation of immune response (GO:0050776)|regulation of protein localization (GO:0032880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|SMAD protein complex assembly (GO:0007183)|T cell activation (GO:0042110)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|terminal cisterna (GO:0014802)|Z disc (GO:0030018)	activin binding (GO:0048185)|FK506 binding (GO:0005528)|ion channel binding (GO:0044325)|macrolide binding (GO:0005527)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|type I transforming growth factor beta receptor binding (GO:0034713)			central_nervous_system(1)|lung(1)|upper_aerodigestive_tract(1)	3					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)	GATCCCTCCATGGCAGATCTG	0.502													T|||	1719	0.343251	0.5129	0.3458	5008	,	,		19072	0.0883		0.4155	False		,,,				2504	0.3006					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M92423	CCDS13014.1, CCDS74688.1	20p13	2013-03-20	2002-08-29		ENSG00000088832	ENSG00000088832			3711	protein-coding gene	gene with protein product	"""calstabin 1"""	186945	"""FK506-binding protein 1A (12kD)"""	FKBP1		1930186	Standard	NM_000801		Approved	FKBP-12, FKBP12, PKC12, PPIASE, FKBP12C	uc002wey.3	P62942	OTTHUMG00000031666	ENST00000400137.4:c.*44A>G	20.37:g.1350709T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVW6|P20071|Q4VC47|Q6FGD9|Q6LEU3|Q9H103|Q9H566	RNA	SNP	-	NULL	ENST00000400137.4	37	NULL	CCDS13014.1	20																																																																																			FKBP1A	-	-	ENSG00000088832		0.502	FKBP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP1A	HGNC	protein_coding	OTTHUMT00000077534.2	22	0.00	0	T			1350709	1350709	-1	no_errors	ENST00000460490	ensembl	human	known	69_37n	rna	18	18.18	4	SNP	0.984	C
FLG	2312	genome.wustl.edu	37	1	152278093	152278093	+	Missense_Mutation	SNP	C	C	T	rs553781249	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:152278093C>T	ENST00000368799.1	-	3	9304	c.9269G>A	c.(9268-9270)cGc>cAc	p.R3090H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3090	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTCATGGCGGGATCCTTG	0.582									Ichthyosis				c|||	13	0.00259585	0.0091	0.0	5008	,	,		16620	0.0		0.0	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9269G>A	1.37:g.152278093C>T	ENSP00000357789:p.Arg3090His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.R3090H	ENST00000368799.1	37	c.9269	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	5.948	0.358913	0.11239	.	.	ENSG00000143631	ENST00000368799	T	0.01705	4.68	3.1	-3.68	0.04463	.	.	.	.	.	T	0.00271	0.0008	N	0.04636	-0.2	0.09310	N	1	P	0.35155	0.487	B	0.24541	0.054	T	0.45614	-0.9249	9	0.44086	T	0.13	.	4.4892	0.11805	0.0:0.3239:0.3493:0.3268	.	3090	P20930	FILA_HUMAN	H	3090	ENSP00000357789:R3090H	ENSP00000357789:R3090H	R	-	2	0	FLG	150544717	0.960000	0.32886	0.000000	0.03702	0.097000	0.18754	-0.243000	0.08915	-0.962000	0.03604	-0.384000	0.06662	CGC	FLG	-	NULL	ENSG00000143631		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	106	0.00	0	C	NM_002016		152278093	152278093	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	101	18.55	23	SNP	0.000	T
FRMD4A	55691	genome.wustl.edu	37	10	13705482	13705482	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr10:13705482G>T	ENST00000357447.2	-	19	1999	c.1631C>A	c.(1630-1632)tCc>tAc	p.S544Y	FRMD4A_ENST00000358621.4_Missense_Mutation_p.S529Y|FRMD4A_ENST00000378503.1_Missense_Mutation_p.S544Y	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	544					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						ATCTGAGAGGGAGCTGTCTTC	0.418																																						dbGAP											0													132.0	112.0	119.0					10																	13705482		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1631C>A	10.37:g.13705482G>T	ENSP00000350032:p.Ser544Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.S544Y	ENST00000357447.2	37	c.1631	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654926	0.88056	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	D;D;D	0.88818	-2.43;-2.43;-2.43	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.93341	0.7877	M	0.63843	1.955	0.80722	D	1	D	0.71674	0.998	D	0.69654	0.965	D	0.93991	0.7267	10	0.87932	D	0	-19.965	18.2591	0.90028	0.0:0.0:1.0:0.0	.	544	Q9P2Q2	FRM4A_HUMAN	Y	529;544;544	ENSP00000351438:S529Y;ENSP00000350032:S544Y;ENSP00000367764:S544Y	ENSP00000350032:S544Y	S	-	2	0	FRMD4A	13745488	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.483000	0.97937	2.542000	0.85734	0.650000	0.86243	TCC	FRMD4A	-	NULL	ENSG00000151474		0.418	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	70	0.00	0	G	NM_018027		13705482	13705482	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
ADGRG5	221188	genome.wustl.edu	37	16	57624549	57624549	+	IGR	SNP	G	G	A	rs67587091	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr16:57624549G>A								GPR114 (13442 upstream) : GPR56 (29100 downstream)																							CTGTTTCTAAGAAGAGTGATG	0.458													-|||	1062	0.212061	0.3638	0.1009	5008	,	,		17459	0.369		0.0348	False		,,,				2504	0.1063					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.57624549G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		16																																																																																			GPR114	-	-	ENSG00000159618	0	0.458					GPR114	HGNC			38	0.00	0	G			57624549	57624549	+1	no_errors	ENST00000569839	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	0.021	A
GPR17	2840	genome.wustl.edu	37	2	128409419	128409419	+	3'UTR	SNP	A	A	G	rs13021001	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:128409419A>G	ENST00000272644.3	+	0	1268				LIMS2_ENST00000355119.4_Intron|GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000545738.2_Intron|LIMS2_ENST00000409455.1_Intron|GPR17_ENST00000544369.1_3'UTR|LIMS2_ENST00000409254.1_5'Flank	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17						chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		CCACCTCCCCAGCAAGCAACC	0.577													A|||	701	0.139976	0.0303	0.1196	5008	,	,		19328	0.1607		0.1551	False		,,,				2504	0.2658					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.*90A>G	2.37:g.128409419A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	RNA	SNP	-	NULL	ENST00000272644.3	37	NULL	CCDS2148.1	2																																																																																			GPR17	-	-	ENSG00000144230		0.577	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR17	HGNC	protein_coding	OTTHUMT00000254390.1	22	0.00	0	A			128409419	128409419	+1	no_errors	ENST00000486700	ensembl	human	known	69_37n	rna	27	15.62	5	SNP	0.000	G
GPR179	440435	genome.wustl.edu	37	17	36490694	36490694	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:36490694G>T	ENST00000342292.4	-	8	1697	c.1677C>A	c.(1675-1677)ttC>ttA	p.F559L		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	559					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CGTAGCAGAGGAAGCTGCCCC	0.622																																						dbGAP											0													40.0	46.0	44.0					17																	36490694		2156	4269	6425	-	-	-	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.1677C>A	17.37:g.36490694G>T	ENSP00000345060:p.Phe559Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.F559L	ENST00000342292.4	37	c.1677	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297178	0.60086	.	.	ENSG00000188888	ENST00000342292	D	0.87809	-2.3	4.05	2.02	0.26589	GPCR, family 3, C-terminal (2);	0.079591	0.51477	D	0.000089	D	0.89705	0.6792	L	0.57536	1.79	0.38712	D	0.953233	D	0.71674	0.998	D	0.70227	0.968	D	0.88435	0.3038	10	0.66056	D	0.02	-13.8217	7.66	0.28398	0.2911:0.0:0.7089:0.0	.	559	Q6PRD1	GP179_HUMAN	L	559	ENSP00000345060:F559L	ENSP00000345060:F559L	F	-	3	2	GPR179	33744220	1.000000	0.71417	1.000000	0.80357	0.559000	0.35586	1.305000	0.33493	0.467000	0.27218	0.313000	0.20887	TTC	GPR179	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000188888		0.622	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	29	0.00	0	G			36490694	36490694	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	T
GVINP1	387751	genome.wustl.edu	37	11	6739407	6739407	+	RNA	SNP	A	A	G	rs12284429	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:6739407A>G	ENST00000526769.3	-	0	3797					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TTCATCGATAAGAAATCCTTG	0.438													-|||	2417	0.482628	0.4107	0.4625	5008	,	,		22368	0.4821		0.6561	False		,,,				2504	0.4162					dbGAP											0																																										-	-	-			0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6739407A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.438	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	37	0.00	0	A	NR_003945		6739407	6739407	-1	no_errors	ENST00000526769	ensembl	human	known	69_37n	rna	49	10.91	6	SNP	0.934	G
HCFC1	3054	genome.wustl.edu	37	X	153218022	153218022	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:153218022C>T	ENST00000310441.7	-	19	5851	c.4885G>A	c.(4885-4887)Gaa>Aaa	p.E1629K	HCFC1_ENST00000354233.3_Missense_Mutation_p.E1560K|HCFC1_ENST00000369984.4_Missense_Mutation_p.E1673K	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1629					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCTGGGCTTCCTCCGTGGCT	0.721																																						dbGAP											0													16.0	19.0	18.0					X																	153218022		1989	4128	6117	-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.4885G>A	X.37:g.153218022C>T	ENSP00000309555:p.Glu1629Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.E1629K	ENST00000310441.7	37	c.4885	CCDS44020.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.8|25.8	4.672861|4.672861	0.88445|0.88445	.|.	.|.	ENSG00000172534|ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233|ENST00000444191	T;T;T|.	0.08370|.	3.1;3.14;3.11|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56992|0.56992	0.2023|0.2023	L|L	0.29908|0.29908	0.895|0.895	0.48040|0.48040	D|D	0.999572|0.999572	D|.	0.63880|.	0.993|.	D|.	0.70935|.	0.971|.	T|T	0.52808|0.52808	-0.8526|-0.8526	10|5	0.37606|.	T|.	0.19|.	.|.	17.16|17.16	0.86801|0.86801	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1629|.	P51610|.	HCFC1_HUMAN|.	K|E	1629;1673;1560|203	ENSP00000309555:E1629K;ENSP00000359001:E1673K;ENSP00000346174:E1560K|.	ENSP00000309555:E1629K|.	E|G	-|-	1|2	0|0	HCFC1|HCFC1	152871216|152871216	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.460000|0.460000	0.32559|0.32559	5.024000|5.024000	0.64090|0.64090	2.317000|2.317000	0.78254|0.78254	0.513000|0.513000	0.50165|0.50165	GAA|GGA	HCFC1	-	NULL	ENSG00000172534		0.721	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	43	0.00	0	C	NM_005334		153218022	153218022	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	T
HCG9	10255	genome.wustl.edu	37	6	29943281	29943281	+	lincRNA	SNP	G	G	A	rs2071568	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr6:29943281G>A	ENST00000376800.3	+	0	393									HLA complex group 9 (non-protein coding)																		AAAGTGAGAGGAGGCGGAGGA	0.587													G|||	1282	0.25599	0.1944	0.3271	5008	,	,		17566	0.3075		0.3231	False		,,,				2504	0.1667					dbGAP											0																																										-	-	-			0			AB088085		6p21.3	2012-10-16	2011-04-11		ENSG00000204625	ENSG00000204625		"""Long non-coding RNAs"""	21243	non-coding RNA	RNA, long non-coding		615797	"""HLA complex group 9"""			10727083, 10557312	Standard	NR_028032		Approved	PERB11, HCGIX, HCGIX4, HCGIX-4	uc003rth.3		OTTHUMG00000031119		6.37:g.29943281G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000376800.3	37	NULL		6																																																																																			HCG9	-	-	ENSG00000204625		0.587	HCG9-001	KNOWN	basic	lincRNA	HCG9	HGNC	lincRNA	OTTHUMT00000076199.4	32	0.00	0	G	NR_028032		29943281	29943281	+1	no_errors	ENST00000376800	ensembl	human	known	69_37n	rna	34	15.00	6	SNP	0.002	A
HECTD4	283450	genome.wustl.edu	37	12	112743982	112743982	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:112743982G>T	ENST00000430131.2	-	7	1184	c.39C>A	c.(37-39)agC>agA	p.S13R	HECTD4_ENST00000550722.1_Missense_Mutation_p.S263R|HECTD4_ENST00000377560.5_Missense_Mutation_p.S263R			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	13					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGTGCACAGTGCTCATGGTGC	0.507																																						dbGAP											0													50.0	51.0	50.0					12																	112743982		2017	4170	6187	-	-	-	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.39C>A	12.37:g.112743982G>T	ENSP00000404379:p.Ser13Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.S263R	ENST00000430131.2	37	c.789		12	.	.	.	.	.	.	.	.	.	.	G	19.96	3.922668	0.73213	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.50277	0.76;0.81;0.75	5.39	5.39	0.77823	.	.	.	.	.	T	0.32436	0.0829	N	0.08118	0	0.44562	D	0.997522	B	0.19583	0.037	B	0.15870	0.014	T	0.17289	-1.0374	9	0.87932	D	0	.	17.6952	0.88279	0.0:0.0:1.0:0.0	.	13	Q9Y4D8	K0614_HUMAN	R	263;13;263	ENSP00000366783:S263R;ENSP00000404379:S13R;ENSP00000449784:S263R	ENSP00000366783:S263R	S	-	3	2	C12orf51	111228365	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.160000	0.42348	2.694000	0.91930	0.460000	0.39030	AGC	HECTD4	-	NULL	ENSG00000173064		0.507	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		31	0.00	0	G	NM_173813		112743982	112743982	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	T
HLA-A	3105	genome.wustl.edu	37	6	29910604	29910604	+	Silent	SNP	C	C	A	rs12721675	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr6:29910604C>A	ENST00000396634.1	+	4	485	c.144C>A	c.(142-144)gcC>gcA	p.A48A	HLA-A_ENST00000376809.5_Silent_p.A48A|HLA-A_ENST00000376802.2_Silent_p.A48A|HLA-A_ENST00000376806.5_Silent_p.A48A			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	48	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GCTTCATCGCCGTGGGCTACG	0.701									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			c|||	1915	0.382388	0.4425	0.4597	5008	,	,		15112	0.3899		0.3807	False		,,,				2504	0.2403					dbGAP											0													33.0	29.0	30.0					6																	29910604		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.144C>A	6.37:g.29910604C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.A48	ENST00000396634.1	37	c.144	CCDS34373.1	6																																																																																			HLA-A	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000206503		0.701	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	47	0.00	0	C	NM_002116		29910604	29910604	+1	no_errors	ENST00000376806	ensembl	human	known	69_37n	silent	41	10.87	5	SNP	0.000	A
HLA-V	352962	genome.wustl.edu	37	6	29760590	29760590	+	RNA	SNP	G	G	A	rs1611213	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr6:29760590G>A	ENST00000457107.1	+	0	353									major histocompatibility complex, class I, V (pseudogene)																		GAGGCAGCGGGACCTGGAGAC	0.697													g|||	1869	0.373203	0.5734	0.353	5008	,	,		10666	0.1944		0.3012	False		,,,				2504	0.3753					dbGAP											0																																										-	-	-			0			M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29760590G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			HLA-P	-	-	ENSG00000181126		0.697	HLA-V-003	KNOWN	basic	processed_transcript	HLA-P	HGNC	pseudogene	OTTHUMT00000105231.1	9	0.00	0	G	NG_002729		29760590	29760590	+1	no_errors	ENST00000446817	ensembl	human	known	69_37n	rna	3	70.00	7	SNP	0.002	A
HLA-A	3105	genome.wustl.edu	37	6	29912315	29912315	+	Missense_Mutation	SNP	A	A	C	rs41554316	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr6:29912315A>C	ENST00000396634.1	+	7	1275	c.934A>C	c.(934-936)Att>Ctt	p.I312L	HLA-A_ENST00000376809.5_Missense_Mutation_p.I312L|HLA-A_ENST00000376802.2_Intron|HLA-A_ENST00000376806.5_Missense_Mutation_p.I312L			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	312					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CGTGGGCATCATTGCTGGCCT	0.607									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												dbGAP											0													106.0	100.0	102.0					6																	29912315		1510	2709	4219	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.934A>C	6.37:g.29912315A>C	ENSP00000379873:p.Ile312Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.I312L	ENST00000396634.1	37	c.934	CCDS34373.1	6	278	0.12728937728937728	107	0.21747967479674796	53	0.1464088397790055	87	0.1520979020979021	31	0.040897097625329816	.	6.803	0.517242	0.13005	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809	T;T;T	0.00695	5.86;5.83;5.86	3.69	-7.38	0.01407	.	0.936076	0.08704	U	0.905960	T	0.00440	0.0014	M	0.78049	2.395	0.09310	N	1	B;B;B;B;B	0.18461	0.028;0.0;0.018;0.0;0.0	B;B;B;B;B	0.22753	0.004;0.003;0.041;0.003;0.002	T	0.34079	-0.9843	10	0.87932	D	0	.	7.9928	0.30250	0.3199:0.1368:0.5432:0.0	rs41554316	191;312;312;312;312	B4DVB9;P16188;Q5SRN5;P30455;P04439	.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	L	312	ENSP00000379873:I312L;ENSP00000366002:I312L;ENSP00000366005:I312L	ENSP00000366002:I312L	I	+	1	0	HLA-A	30020294	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.381000	0.00491	-1.707000	0.01402	-1.766000	0.00665	ATT	HLA-A	-	NULL	ENSG00000206503		0.607	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	85	0.00	0	A	NM_002116		29912315	29912315	+1	no_errors	ENST00000376806	ensembl	human	known	69_37n	missense	94	10.48	11	SNP	0.000	C
IFNAR1	3454	genome.wustl.edu	37	21	34721850	34721850	+	Splice_Site	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr21:34721850G>T	ENST00000270139.3	+	8	1295		c.e8+1		IFNAR1_ENST00000442357.2_Splice_Site|IFNAR1_ENST00000416947.2_Splice_Site	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1						cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	AAATGCTGAGGTAAAAAGACT	0.308																																					Esophageal Squamous(73;817 1211 32990 35667 42746)	dbGAP											0													28.0	28.0	28.0					21																	34721850		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.1143+1G>T	21.37:g.34721850G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Splice_Site	SNP	-	e8+1	ENST00000270139.3	37	c.1143+1	CCDS13624.1	21	.	.	.	.	.	.	.	.	.	.	G	19.70	3.877166	0.72180	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5961	0.76583	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IFNAR1	33643720	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	4.760000	0.62235	2.827000	0.97445	0.650000	0.86243	.	IFNAR1	-	-	ENSG00000142166		0.308	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	HGNC	protein_coding	OTTHUMT00000139823.4	34	0	0	G		Intron	34721850	34721850	+1	no_errors	ENST00000270139	ensembl	human	known	69_37n	splice_site	21	12.5	3	SNP	1.000	T
IFNAR1	3454	genome.wustl.edu	37	21	34721850	34721850	+	Splice_Site	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr21:34721850G>T	ENST00000270139.3	+	8	1295		c.e8+1		IFNAR1_ENST00000442357.2_Splice_Site|IFNAR1_ENST00000416947.2_Splice_Site	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1						cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	AAATGCTGAGGTAAAAAGACT	0.308																																					Esophageal Squamous(73;817 1211 32990 35667 42746)	dbGAP											0													28.0	28.0	28.0					21																	34721850		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.1143+1G>T	21.37:g.34721850G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Splice_Site	SNP	-	e8+1	ENST00000270139.3	37	c.1143+1	CCDS13624.1	21	.	.	.	.	.	.	.	.	.	.	G	19.70	3.877166	0.72180	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5961	0.76583	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IFNAR1	33643720	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	4.760000	0.62235	2.827000	0.97445	0.650000	0.86243	.	IFNAR1	-	-	ENSG00000142166		0.308	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	HGNC	protein_coding	OTTHUMT00000139823.4	34	0.00	0	G		Intron	34721850	34721850	+1	no_errors	ENST00000270139	ensembl	human	known	69_37n	splice_site	21	12.50	3	SNP	1.000	T
IKZF1	10320	genome.wustl.edu	37	7	50367360	50367360	+	Intron	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr7:50367360G>T	ENST00000331340.3	+	3	315				IKZF1_ENST00000439701.1_Intron|IKZF1_ENST00000343574.5_Intron|IKZF1_ENST00000492782.1_Intron|IKZF1_ENST00000359197.5_Intron|IKZF1_ENST00000438033.1_Intron|IKZF1_ENST00000413698.1_Intron|IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000440768.2_Intron|IKZF1_ENST00000357364.4_Intron|IKZF1_ENST00000349824.4_Intron	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)						B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GTGGGTAAGTGGGTCACCAGC	0.527			"""D,T"""	BCL6	"""ALL, DLBCL"""																																	dbGAP		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	28	Unknown(28)	haematopoietic_and_lymphoid_tissue(28)											35.0	34.0	34.0					7																	50367360		1566	3580	5146	-	-	-	SO:0001627	intron_variant	0			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.160+7G>T	7.37:g.50367360G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	RNA	SNP	-	NULL	ENST00000331340.3	37	NULL		7																																																																																			IKZF1	-	-	ENSG00000185811		0.527	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	IKZF1	HGNC	protein_coding	OTTHUMT00000342242.1	34	0.00	0	G	NM_006060		50367360	50367360	+1	no_errors	ENST00000484847	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	0.000	T
KCNRG	283518	genome.wustl.edu	37	13	50594417	50594417	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr13:50594417G>C	ENST00000312942.1	+	2	886	c.646G>C	c.(646-648)Gac>Cac	p.D216H	KCNRG_ENST00000360473.4_3'UTR|TRIM13_ENST00000478111.1_3'UTR	NM_173605.1	NP_775876.1	Q8N5I3	KCNRG_HUMAN	potassium channel regulator	216					protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		CTTACTGATTGACACTTTATT	0.363																																						dbGAP											0													80.0	77.0	78.0					13																	50594417		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9424.1, CCDS41889.1	13q14.11	2008-05-02			ENSG00000198553	ENSG00000198553			18893	protein-coding gene	gene with protein product							Standard	NM_173605		Approved		uc001vdu.3	Q8N5I3	OTTHUMG00000140140	ENST00000312942.1:c.646G>C	13.37:g.50594417G>C	ENSP00000324191:p.Asp216His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2X9|Q0P6D0|Q8IU75|Q8N3Q9	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.D216H	ENST00000312942.1	37	c.646	CCDS9424.1	13	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240524	0.79912	.	.	ENSG00000198553	ENST00000312942	T	0.64618	-0.11	5.49	5.49	0.81192	.	0.069488	0.56097	D	0.000021	T	0.72724	0.3496	L	0.34521	1.04	0.47862	D	0.999537	D	0.89917	1.0	D	0.91635	0.999	T	0.75348	-0.3349	10	0.87932	D	0	.	19.3764	0.94512	0.0:0.0:1.0:0.0	.	216	Q8N5I3	KCNRG_HUMAN	H	216	ENSP00000324191:D216H	ENSP00000324191:D216H	D	+	1	0	KCNRG	49492418	1.000000	0.71417	0.996000	0.52242	0.824000	0.46624	7.458000	0.80787	2.596000	0.87737	0.557000	0.71058	GAC	KCNRG	-	NULL	ENSG00000198553		0.363	KCNRG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNRG	HGNC	protein_coding	OTTHUMT00000276308.1	44	0.00	0	G			50594417	50594417	+1	no_errors	ENST00000312942	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	1.000	C
KLHL22	84861	genome.wustl.edu	37	22	20847472	20847472	+	Intron	SNP	A	A	T	rs5755677	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr22:20847472A>T	ENST00000328879.4	-	1	124				KLHL22_ENST00000470335.1_Intron|KLHL22_ENST00000440659.2_Intron	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22						cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TCTCTTGGGAAGGGATAAATG	0.493													A|||	712	0.142173	0.003	0.049	5008	,	,		19535	0.4603		0.0557	False		,,,				2504	0.1575					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.32+2574T>A	22.37:g.20847472A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.L11H	ENST00000328879.4	37	c.32	CCDS13780.1	22	352	0.16117216117216118	2	0.0040650406504065045	22	0.06077348066298342	279	0.48776223776223776	49	0.06464379947229551	A	4.999	0.185497	0.09495	.	.	ENSG00000099910	ENST00000443285	T	0.73789	-0.78	2.12	-0.0898	0.13667	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.38950	-0.9637	5	0.40728	T	0.16	.	4.1299	0.10144	0.605:0.0:0.395:0.0	rs5755677	.	.	.	H	11	ENSP00000397882:L11H	ENSP00000397882:L11H	L	-	2	0	KLHL22	19177472	0.334000	0.24739	0.047000	0.18901	0.171000	0.22731	0.297000	0.19101	-0.071000	0.12886	0.460000	0.39030	CTT	KLHL22	-	NULL	ENSG00000099910		0.493	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL22	HGNC	protein_coding	OTTHUMT00000320045.2	29	0.00	0	A	NM_032775		20847472	20847472	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000443285	ensembl	human	putative	69_37n	missense	31	11.43	4	SNP	0.063	T
LAMA5	3911	genome.wustl.edu	37	20	60902992	60902992	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr20:60902992G>T	ENST00000252999.3	-	36	4793	c.4727C>A	c.(4726-4728)cCc>cAc	p.P1576H		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1576	Laminin EGF-like 14. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ACAGTCACAGGGGCGGCAGCG	0.682																																						dbGAP											0													31.0	37.0	35.0					20																	60902992		2195	4289	6484	-	-	-	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.4727C>A	20.37:g.60902992G>T	ENSP00000252999:p.Pro1576His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.P1576H	ENST00000252999.3	37	c.4727	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199322	0.38806	.	.	ENSG00000130702	ENST00000252999	T	0.56444	0.46	4.62	2.33	0.28932	EGF-like, laminin (2);	0.119337	0.53938	D	0.000045	T	0.72795	0.3505	M	0.93678	3.445	0.80722	D	1	D	0.67145	0.996	D	0.64237	0.923	T	0.76702	-0.2862	10	0.62326	D	0.03	.	7.9354	0.29927	0.0:0.2495:0.5218:0.2286	.	1576	O15230	LAMA5_HUMAN	H	1576	ENSP00000252999:P1576H	ENSP00000252999:P1576H	P	-	2	0	LAMA5	60336387	0.998000	0.40836	0.979000	0.43373	0.023000	0.10783	3.235000	0.51328	2.076000	0.62316	0.563000	0.77884	CCC	LAMA5	-	pfscan_EGF_laminin	ENSG00000130702		0.682	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	24	0.00	0	G	NM_005560		60902992	60902992	-1	no_errors	ENST00000252999	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.870	T
LINC00470	56651	genome.wustl.edu	37	18	1272481	1272481	+	lincRNA	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr18:1272481G>T	ENST00000412816.3	-	0	450							Q9BZP3	CR002_HUMAN	long intergenic non-protein coding RNA 470											pancreas(1)	1						agcatgaaatgacaatttcac	0.289																																						dbGAP											0																																										-	-	-			0			AF295730		18p11.32	2012-10-12	2011-08-31	2011-08-31	ENSG00000132204	ENSG00000132204		"""Long non-coding RNAs"""	1225	non-coding RNA	RNA, long non-coding			"""chromosome 18 open reading frame 2"""	C18orf2		11173868	Standard	NR_023925		Approved		uc002klg.2	Q9BZP3			18.37:g.1272481G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZP2|Q9BZP4	RNA	SNP	-	NULL	ENST00000412816.3	37	NULL		18																																																																																			LINC00470	-	-	ENSG00000132204		0.289	LINC00470-001	KNOWN	basic	lincRNA	LINC00470	HGNC	lincRNA	OTTHUMT00000441551.1	44	0.00	0	G	NR_023925		1272481	1272481	-1	no_errors	ENST00000269201	ensembl	human	known	69_37n	rna	19	13.64	3	SNP	0.065	T
LINGO4	339398	genome.wustl.edu	37	1	151773634	151773634	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:151773634A>G	ENST00000368820.3	-	2	2484	c.1547T>C	c.(1546-1548)aTc>aCc	p.I516T	RP11-98D18.17_ENST00000601909.1_lincRNA	NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	516						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGGCACGGTGATGTTGGGGTC	0.577																																						dbGAP											0													167.0	170.0	169.0					1																	151773634		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.1547T>C	1.37:g.151773634A>G	ENSP00000357810:p.Ile516Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I516T	ENST00000368820.3	37	c.1547	CCDS30855.1	1	.	.	.	.	.	.	.	.	.	.	A	2.397	-0.338561	0.05243	.	.	ENSG00000213171	ENST00000368820	T	0.58358	0.34	5.35	1.66	0.24008	.	0.766968	0.11538	N	0.554037	T	0.11965	0.0291	N	0.08118	0	0.32165	N	0.582452	B	0.11235	0.004	B	0.04013	0.001	T	0.14559	-1.0468	10	0.25106	T	0.35	.	6.5677	0.22521	0.6223:0.2964:0.0813:0.0	.	516	Q6UY18	LIGO4_HUMAN	T	516	ENSP00000357810:I516T	ENSP00000357810:I516T	I	-	2	0	LINGO4	150040258	0.223000	0.23663	1.000000	0.80357	0.645000	0.38454	0.664000	0.25068	1.027000	0.39758	0.528000	0.53228	ATC	LINGO4	-	NULL	ENSG00000213171		0.577	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO4	HGNC	protein_coding	OTTHUMT00000036639.1	29	0.00	0	A	XM_291387		151773634	151773634	-1	no_errors	ENST00000368820	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	G
LRRC37A11P	342666	genome.wustl.edu	37	17	37188240	37188240	+	RNA	SNP	C	C	T	rs34700711	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:37188240C>T	ENST00000425901.2	+	0	2082					NR_033753.2				leucine rich repeat containing 37, member A11, pseudogene																		ACAGTTCAACCTCTGGACCTG	0.512													C|||	1269	0.253395	0.0212	0.438	5008	,	,		22408	0.3294		0.2932	False		,,,				2504	0.317					dbGAP											0																																										-	-	-			0					17q12	2013-05-14			ENSG00000214553	ENSG00000214553			43815	pseudogene	pseudogene							Standard	NR_033753		Approved		uc002hrd.1		OTTHUMG00000133184		17.37:g.37188240C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425901.2	37	NULL		17																																																																																			LRRC37A11P	-	-	ENSG00000214553		0.512	LRRC37A11P-002	KNOWN	basic	processed_transcript	LRRC37A11P	HGNC	pseudogene	OTTHUMT00000444105.1	81	0.00	0	C	NR_033753		37188240	37188240	+1	no_errors	ENST00000425901	ensembl	human	known	69_37n	rna	90	10.78	11	SNP	0.006	T
LSM6	11157	genome.wustl.edu	37	4	147104263	147104263	+	Intron	SNP	A	A	G	rs919483	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr4:147104263A>G	ENST00000502781.1	+	2	813				LSM6_ENST00000503982.1_3'UTR|LSM6_ENST00000296581.5_Intron			P62312	LSM6_HUMAN	LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)|tRNA processing (GO:0008033)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)					all_hematologic(180;0.151)					CAATAGGCCAAAAAAGTACTG	0.328													A|||	883	0.176318	0.1082	0.2075	5008	,	,		20812	0.1101		0.338	False		,,,				2504	0.1483				Ovarian(181;1591 2748 12147 31551)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF182292	CCDS3767.1	4q31.21	2008-02-05				ENSG00000164167			17017	protein-coding gene	gene with protein product		607286				10369684, 10523320	Standard	NM_007080		Approved	YDR378C	uc003ikq.4	P62312		ENST00000502781.1:c.94+96A>G	4.37:g.147104263A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5J5|Q9Y4Y8	RNA	SNP	-	NULL	ENST00000502781.1	37	NULL	CCDS3767.1	4																																																																																			LSM6	-	-	ENSG00000164167		0.328	LSM6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LSM6	HGNC	protein_coding	OTTHUMT00000364929.1	27	0.00	0	A			147104263	147104263	+1	no_errors	ENST00000503982	ensembl	human	known	69_37n	rna	22	15.38	4	SNP	0.000	G
LSP1	4046	genome.wustl.edu	37	11	1891771	1891771	+	Intron	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:1891771G>A	ENST00000311604.3	+	2	228				LSP1_ENST00000381775.1_Intron|LSP1_ENST00000406638.2_5'UTR|LSP1_ENST00000405957.2_Intron	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		GTGTCAGGAAGAGGGCCTGGC	0.662																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.54-9546G>A	11.37:g.1891771G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	prints_Lymphspecific	p.R28K	ENST00000311604.3	37	c.83	CCDS31334.1	11	.	.	.	.	.	.	.	.	.	.	g	5.780	0.328290	0.10956	.	.	ENSG00000130592	ENST00000418975	T	0.52295	0.67	1.97	-1.67	0.08238	.	.	.	.	.	T	0.35248	0.0925	.	.	.	0.19575	N	0.999966	.	.	.	.	.	.	T	0.40997	-0.9533	6	0.87932	D	0	.	0.2321	0.00181	0.2908:0.2086:0.2894:0.2112	.	.	.	.	K	28	ENSP00000403460:R28K	ENSP00000403460:R28K	R	+	2	0	LSP1	1848347	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.012000	0.13287	-0.403000	0.07622	-0.327000	0.08410	AGA	LSP1	-	NULL	ENSG00000130592		0.662	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	LSP1	HGNC	protein_coding	OTTHUMT00000034045.3	40	0.00	0	G	NM_002339		1891771	1891771	+1	no_stop_codon	ENST00000418975	ensembl	human	putative	69_37n	missense	39	15.22	7	SNP	0.002	A
MALL	7851	genome.wustl.edu	37	2	110855123	110855123	+	Intron	SNP	G	G	T	rs2004273	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:110855123G>T	ENST00000272462.2	-	2	879				MALL_ENST00000427178.1_Intron	NM_005434.4	NP_005425.1	Q13021	MALL_HUMAN	mal, T-cell differentiation protein-like						cholesterol homeostasis (GO:0042632)	clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	9				Epithelial(1;0.0546)|STAD - Stomach adenocarcinoma(1;0.18)		AGGGGCTGCTGCAGGGGCCGG	0.557													G|||	3703	0.739417	0.3275	0.7925	5008	,	,		15707	0.874		0.9344	False		,,,				2504	0.9192					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U17077	CCDS2085.1	2q13	2008-02-05			ENSG00000144063	ENSG00000144063			6818	protein-coding gene	gene with protein product		602022				9326933	Standard	NM_005434		Approved	BENE	uc002tfk.3	Q13021	OTTHUMG00000131196	ENST00000272462.2:c.106-5776C>A	2.37:g.110855123G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWR6|Q9BTU0	Missense_Mutation	SNP	NULL	p.A55E	ENST00000272462.2	37	c.164	CCDS2085.1	2																																																																																			MALL	-	NULL	ENSG00000144063		0.557	MALL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MALL	HGNC	protein_coding	OTTHUMT00000253921.1	26	0.00	0	G	NM_005434		110855123	110855123	-1	no_errors	ENST00000424988	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.001	T
MEAF6	64769	genome.wustl.edu	37	1	37959450	37959450	+	3'UTR	SNP	T	T	C	rs215210	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:37959450T>C	ENST00000296214.5	-	0	853				MEAF6_ENST00000373075.2_3'UTR|MEAF6_ENST00000475828.1_5'UTR|MEAF6_ENST00000373073.4_Intron|MEAF6_ENST00000373074.1_3'UTR	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6						chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						AGCAACTTGCTGGGATTACAA	0.408													C|||	3658	0.730431	0.4864	0.8357	5008	,	,		19205	0.9038		0.835	False		,,,				2504	0.6994					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.*250A>G	1.37:g.37959450T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK64|Q4F967|Q7Z311|Q86WE3	RNA	SNP	-	NULL	ENST00000296214.5	37	NULL	CCDS59196.1	1																																																																																			MEAF6	-	-	ENSG00000163875		0.408	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEAF6	HGNC	protein_coding	OTTHUMT00000012161.1	41	0.00	0	T	NM_022756		37959450	37959450	-1	no_errors	ENST00000475828	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.001	C
MEIS1	4211	genome.wustl.edu	37	2	66798424	66798424	+	3'UTR	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:66798424G>T	ENST00000272369.9	+	0	1714				MEIS1_ENST00000488550.1_3'UTR|AC007392.3_ENST00000433396.1_lincRNA|MEIS1_ENST00000407092.2_Missense_Mutation_p.M387I|MEIS1_ENST00000409517.1_3'UTR|MEIS1_ENST00000495021.2_3'UTR|MEIS1_ENST00000444274.2_3'UTR|MEIS1_ENST00000398506.2_Missense_Mutation_p.M385I	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1						angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						GTGGTCCAATGGGTGTGAGTA	0.493																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.*84G>T	2.37:g.66798424G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV50	Missense_Mutation	SNP	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.M387I	ENST00000272369.9	37	c.1161	CCDS46309.1	2	.	.	.	.	.	.	.	.	.	.	G	12.30	1.895147	0.33442	.	.	ENSG00000143995	ENST00000407092;ENST00000398506	D;D	0.84070	-1.8;-1.79	5.09	5.09	0.68999	.	.	.	.	.	T	0.74619	0.3740	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.14578	0.011	T	0.68352	-0.5431	8	0.15499	T	0.54	.	18.852	0.92235	0.0:0.0:1.0:0.0	.	385	O00470-2	.	I	387;385	ENSP00000384461:M387I;ENSP00000381518:M385I	ENSP00000381518:M385I	M	+	3	0	MEIS1	66651928	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.839000	0.86812	2.520000	0.84964	0.655000	0.94253	ATG	MEIS1	-	NULL	ENSG00000143995		0.493	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	27	0.00	0	G	NM_002398		66798424	66798424	+1	no_errors	ENST00000407092	ensembl	human	known	69_37n	missense	31	11.11	4	SNP	1.000	T
ZNRF2	223082	genome.wustl.edu	37	7	30329454	30329456	+	Intron	DEL	TGT	TGT	-	rs373052300	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr7:30329454_30329456delTGT	ENST00000323037.4	+	1	1520				MIR550A1_ENST00000385037.1_RNA	NM_147128.3	NP_667339.1	Q8NHG8	ZNRF2_HUMAN	zinc and ring finger 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(2)|prostate(1)	5						GTAAGAGCCCTGTTGTTGTAAGA	0.493														60	0.0119808	0.0197	0.0159	5008	,	,		16444	0.0		0.0139	False		,,,				2504	0.0092					dbGAP											0										257,3721		19,219,1751						-0.5	0.0			141	846,6652		32,782,2935	no	intron	ZNRF2	NM_147128.3		51,1001,4686	A1A1,A1R,RR		11.283,6.4605,9.6114				1103,10373				-	-	-	SO:0001627	intron_variant	0			AF513707	CCDS5426.1	7p15.1	2013-01-09			ENSG00000180233	ENSG00000180233		"""RING-type (C3HC4) zinc fingers"""	22316	protein-coding gene	gene with protein product		612061					Standard	NM_147128		Approved	RNF202	uc003tat.3	Q8NHG8	OTTHUMG00000097759	ENST00000323037.4:c.469+4012TGT>-	7.37:g.30329460_30329462delTGT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000323037.4	37	NULL	CCDS5426.1	7																																																																																			MIR550A1	-	-	ENSG00000207771		0.493	ZNRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR550A1	HGNC	protein_coding	OTTHUMT00000214992.1	42	0.00	0	TGT	NM_147128		30329454	30329456	+1	no_errors	ENST00000385037	ensembl	human	known	69_37n	rna	61	12.86	9	DEL	0.000:0.002:0.010	-
MKRN2	23609	genome.wustl.edu	37	3	12623430	12623430	+	Silent	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr3:12623430C>G	ENST00000170447.7	+	7	1229	c.1092C>G	c.(1090-1092)ctC>ctG	p.L364L	MKRN2_ENST00000448482.1_Silent_p.L362L|MKRN2_ENST00000411987.1_Silent_p.L321L	NM_001271707.1|NM_014160.3	NP_001258636.1|NP_054879.3	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2	364					protein ubiquitination (GO:0016567)	intracellular (GO:0005622)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(3)	16						GGAAACAGCTCAGTTCTCAAG	0.532																																						dbGAP											0													146.0	149.0	148.0					3																	12623430		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33702.1, CCDS63545.1	3p25	2008-08-13	2008-08-13		ENSG00000075975	ENSG00000075975		"""RING-type (C3HC4) zinc fingers"""	7113	protein-coding gene	gene with protein product		608426				11597136	Standard	NM_014160		Approved	RNF62, HSPC070	uc003bxd.4	Q9H000	OTTHUMG00000155371	ENST00000170447.7:c.1092C>G	3.37:g.12623430C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIA2|B3KRC5|B4DPR4|Q8N391|Q96BD4|Q9BUY2|Q9NRY1	Silent	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.L364	ENST00000170447.7	37	c.1092	CCDS33702.1	3																																																																																			MKRN2	-	NULL	ENSG00000075975		0.532	MKRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN2	HGNC	protein_coding	OTTHUMT00000339679.1	34	0.00	0	C	NM_014160		12623430	12623430	+1	no_errors	ENST00000170447	ensembl	human	known	69_37n	silent	47	12.73	7	SNP	0.991	G
MMP16	4325	genome.wustl.edu	37	8	89081730	89081730	+	Intron	SNP	T	T	C	rs2616490	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr8:89081730T>C	ENST00000286614.6	-	7	1504				MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)						chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	tcttggattatagatagagtg	0.398													T|||	2817	0.5625	0.466	0.6441	5008	,	,		18942	0.6905		0.5169	False		,,,				2504	0.5501					dbGAP											0													129.0	122.0	124.0					8																	89081730		1852	4102	5954	-	-	-	SO:0001627	intron_variant	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1222+5102A>G	8.37:g.89081730T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAN7|Q14824|Q52H48	RNA	SNP	-	NULL	ENST00000286614.6	37	NULL	CCDS6246.1	8																																																																																			MMP16	-	-	ENSG00000156103		0.398	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	31	0.00	0	T	NM_005941		89081730	89081730	-1	no_errors	ENST00000544227	ensembl	human	known	69_37n	rna	22	12.00	3	SNP	0.001	C
MUC19	283463	genome.wustl.edu	37	12	40915480	40915480	+	Intron	SNP	G	G	A	rs56952712	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:40915480G>A	ENST00000454784.4	+	50	17408							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ACCACACCGGGGGTGAGCTTG	0.502													A|||	773	0.154353	0.3502	0.111	5008	,	,		15152	0.0188		0.175	False		,,,				2504	0.0389					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.10891-20884G>A	12.37:g.40915480G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	RNA	SNP	-	NULL	ENST00000454784.4	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.502	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	77	0.00	0	G	XM_003403524		40915480	40915480	+1	no_errors	ENST00000398702	ensembl	human	known	69_37n	rna	57	12.31	8	SNP	0.003	A
MUC19	283463	genome.wustl.edu	37	12	40921902	40921902	+	3'UTR	SNP	C	C	T	rs4768287	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:40921902C>T	ENST00000474954.1	+	0	2911				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CCCCTGGAAGCTTCAGCACAG	0.438													T|||	652	0.130192	0.3003	0.0951	5008	,	,		18093	0.0188		0.1501	False		,,,				2504	0.0194					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*2908C>T	12.37:g.40921902C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	Missense_Mutation	SNP	NULL	p.L16F	ENST00000474954.1	37	c.46		12	305	0.13965201465201466	139	0.28252032520325204	35	0.09668508287292818	8	0.013986013986013986	123	0.16226912928759896	T	5.077	0.199799	0.09652	.	.	ENSG00000205592	ENST00000424466	.	.	.	1.69	0.495	0.16890	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.34204	-0.9838	3	.	.	.	.	4.3357	0.11085	0.0:0.3943:0.0:0.6057	rs4768287	.	.	.	F	16	.	.	L	+	1	0	MUC19	39208169	0.002000	0.14202	0.000000	0.03702	0.331000	0.28603	-0.017000	0.12590	-0.246000	0.09611	-0.516000	0.04426	CTT	MUC19	-	NULL	ENSG00000205592		0.438	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	66	0.00	0	C	XM_003403524		40921902	40921902	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000424466	ensembl	human	novel	69_37n	missense	43	10.42	5	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1272881	1272881	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:1272881C>G	ENST00000529681.1	+	31	14829	c.14771C>G	c.(14770-14772)tCa>tGa	p.S4924*	MUC5B_ENST00000447027.1_Nonsense_Mutation_p.S4927*|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4924	Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGTCCTCCTCAGTCCTCACC	0.637																																						dbGAP											0													61.0	70.0	67.0					11																	1272881		2161	4256	6417	-	-	-	SO:0001587	stop_gained	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14771C>G	11.37:g.1272881C>G	ENSP00000436812:p.Ser4924*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Nonsense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.S4927*	ENST00000529681.1	37	c.14780	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	55	23.321283	0.99954	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	.	.	.	2.94	2.02	0.26589	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.5556	0.17115	0.1962:0.6862:0.0:0.1176	.	.	.	.	X	4924;4927;4868;4623	.	ENSP00000343037:S4868X	S	+	2	0	MUC5B	1229457	0.000000	0.05858	0.001000	0.08648	0.151000	0.21798	-1.991000	0.01478	0.824000	0.34613	0.555000	0.69702	TCA	MUC5B	-	NULL	ENSG00000117983		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	32	0.00	0	C	XM_001126093		1272881	1272881	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	nonsense	33	13.16	5	SNP	0.003	G
MYT1L	23040	genome.wustl.edu	37	2	1926210	1926210	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:1926210C>G	ENST00000399161.2	-	10	2078	c.1331G>C	c.(1330-1332)aGa>aCa	p.R444T	MYT1L_ENST00000428368.2_Missense_Mutation_p.R444T	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	444					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGCCTTTGCTCTTTCCGTTTC	0.547																																						dbGAP											0													165.0	161.0	162.0					2																	1926210		2020	4159	6179	-	-	-	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1331G>C	2.37:g.1926210C>G	ENSP00000382114:p.Arg444Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.R444T	ENST00000399161.2	37	c.1331		2	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093496	0.56075	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.51574	0.7;0.7	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.61788	0.2375	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.99	T	0.62402	-0.6862	10	0.72032	D	0.01	-31.1582	20.2936	0.98544	0.0:1.0:0.0:0.0	.	444;444	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	T	444;392;444	ENSP00000382114:R444T;ENSP00000396103:R444T	ENSP00000295067:R392T	R	-	2	0	MYT1L	1905217	1.000000	0.71417	0.040000	0.18447	0.039000	0.13416	7.751000	0.85126	2.801000	0.96364	0.655000	0.94253	AGA	MYT1L	-	NULL	ENSG00000186487		0.547	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	46	0.00	0	C	NM_015025		1926210	1926210	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	0.991	G
NSUN4	387338	genome.wustl.edu	37	1	46827769	46827769	+	3'UTR	SNP	C	C	T	rs1053628	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:46827769C>T	ENST00000474844.1	+	0	2056				NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_3'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4						rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					GTTTGCTGCCCGCTTAGGGGC	0.473													C|||	661	0.131989	0.1331	0.147	5008	,	,		20210	0.0179		0.2724	False		,,,				2504	0.093					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.*251C>T	1.37:g.46827769C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	RNA	SNP	-	NULL	ENST00000474844.1	37	NULL	CCDS534.1	1																																																																																			NSUN4	-	-	ENSG00000117481		0.473	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1	41	0.00	0	C	NM_199044		46827769	46827769	+1	no_errors	ENST00000307089	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.007	T
NTN1	9423	genome.wustl.edu	37	17	9086708	9086708	+	Intron	SNP	T	T	C	rs62068199	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:9086708T>C	ENST00000173229.2	+	5	1518				NTN1_ENST00000538852.1_Intron|NTN1_ENST00000546090.1_Intron	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						gcccaggagctgggcgtgggg	0.567													T|||	1588	0.317093	0.3116	0.2608	5008	,	,		16344	0.1538		0.3748	False		,,,				2504	0.4734					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1411+422T>C	17.37:g.9086708T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL51	Missense_Mutation	SNP	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	p.W139R	ENST00000173229.2	37	c.415	CCDS11148.1	17	636	0.29120879120879123	152	0.3089430894308943	116	0.32044198895027626	86	0.15034965034965034	282	0.3720316622691293	T	4.302	0.055253	0.08291	.	.	ENSG00000065320	ENST00000436734	T	0.13657	2.57	3.92	-7.83	0.01201	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.36089	-0.9762	5	0.87932	D	0	.	4.9495	0.14006	0.1175:0.5571:0.1294:0.196	rs62068199	.	.	.	R	139	ENSP00000389375:W139R	ENSP00000389375:W139R	W	+	1	0	NTN1	9027433	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.428000	0.01025	-1.745000	0.01337	-1.279000	0.01387	TGG	NTN1	-	NULL	ENSG00000065320		0.567	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN1	HGNC	protein_coding	OTTHUMT00000252583.1	47	0.00	0	T			9086708	9086708	+1	no_start_codon	ENST00000436734	ensembl	human	putative	69_37n	missense	23	20.69	6	SNP	0.000	C
OR13C5	138799	genome.wustl.edu	37	9	107361642	107361642	+	Missense_Mutation	SNP	G	G	A	rs1851722	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:107361642G>A	ENST00000374779.2	-	1	146	c.53C>T	c.(52-54)tCt>tTt	p.S18F		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	18			S -> F (in dbSNP:rs1851722).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						TGGGTGACCAGAAAGTCCCTT	0.388													G|||	1205	0.240615	0.0998	0.366	5008	,	,		20151	0.38		0.2445	False		,,,				2504	0.1943					dbGAP											0													49.0	52.0	51.0					9																	107361642		2201	4294	6495	-	-	-	SO:0001583	missense	0				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.53C>T	9.37:g.107361642G>A	ENSP00000363911:p.Ser18Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S18F	ENST00000374779.2	37	c.53	CCDS35091.1	9	599	0.2742673992673993	53	0.10772357723577236	127	0.35082872928176795	218	0.3811188811188811	201	0.26517150395778366	G	15.10	2.732376	0.48939	.	.	ENSG00000255800	ENST00000374779	T	0.00441	7.41	3.84	2.91	0.33838	.	0.000000	0.36932	U	0.002336	T	0.00012	0.0000	M	0.76170	2.325	0.80722	P	0.0	D	0.60575	0.988	P	0.54924	0.764	T	0.49143	-0.8970	9	0.87932	D	0	.	10.221	0.43196	0.0:0.0:0.8:0.2	rs1851722;rs35304986;rs57432004;rs1851722	18	Q8NGS8	O13C5_HUMAN	F	18	ENSP00000363911:S18F	ENSP00000363911:S18F	S	-	2	0	OR13C5	106401463	0.025000	0.19082	0.002000	0.10522	0.240000	0.25518	2.042000	0.41222	0.777000	0.33496	0.531000	0.56144	TCT	OR13C5	-	NULL	ENSG00000255800		0.388	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	HGNC	protein_coding	OTTHUMT00000053479.2	34	0.00	0	G	NM_001004482		107361642	107361642	-1	no_errors	ENST00000374779	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.002	A
OR1D5	8386	genome.wustl.edu	37	17	2966273	2966273	+	Missense_Mutation	SNP	G	G	A	rs2676567	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:2966273G>A	ENST00000575751.1	-	1	628	c.629C>T	c.(628-630)cCc>cTc	p.P210L		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	210					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|lung(10)	11						GAACCCTAAGGGGGTGAGGAA	0.493													g|||	1358	0.271166	0.3843	0.2968	5008	,	,		30243	0.0228		0.331	False		,,,				2504	0.2945					dbGAP											0													60.0	72.0	68.0					17																	2966273		2170	4290	6460	-	-	-	SO:0001583	missense	0			AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.629C>T	17.37:g.2966273G>A	ENSP00000459028:p.Pro210Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96RA6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P210L	ENST00000575751.1	37	c.629	CCDS58499.1	17																																																																																			OR1D5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000262628		0.493	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1D5	Clone_based_vega_gene	protein_coding	OTTHUMT00000438410.2	79	0.00	0	G	NM_014566		2966273	2966273	-1	no_errors	ENST00000575751	ensembl	human	known	69_37n	missense	78	10.34	9	SNP	0.006	A
OR6J1	79549	genome.wustl.edu	37	14	23103354	23103354	+	Silent	SNP	A	A	G	rs3751483|rs386775543	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr14:23103354A>G	ENST00000540461.1	-	1	362	c.363T>C	c.(361-363)cgT>cgC	p.R121R				Q8NGC5	OR6J1_HUMAN	olfactory receptor, family 6, subfamily J, member 1 (gene/pseudogene)	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TGGTGGCATAACGGTCATAGG	0.512													G|||	1048	0.209265	0.3449	0.1455	5008	,	,		22209	0.1528		0.1978	False		,,,				2504	0.1411					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AC023226		14q11.2	2012-08-09	2012-04-20	2004-03-10	ENSG00000255804	ENSG00000255804		"""GPCR / Class A : Olfactory receptors"""	14707	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily J, member 1"""	OR6J2, OR6J1P			Standard	NG_002274		Approved			Q8NGC5	OTTHUMG00000168897	ENST00000540461.1:c.363T>C	14.37:g.23103354A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R121	ENST00000540461.1	37	c.363		14																																																																																			OR6J1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000255804		0.512	OR6J1-001	KNOWN	basic|appris_principal	protein_coding	OR6J1	HGNC	protein_coding	OTTHUMT00000401548.1	34	0.00	0	A			23103354	23103354	-1	no_errors	ENST00000540461	ensembl	human	known	69_37n	silent	39	11.36	5	SNP	1.000	G
OR8B2	26595	genome.wustl.edu	37	11	124253147	124253147	+	Silent	SNP	A	A	G	rs530704	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:124253147A>G	ENST00000375013.2	-	1	111	c.93T>C	c.(91-93)ttT>ttC	p.F31F		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AGATCACTAGAAACAGGAAAA	0.418																																						dbGAP											0													210.0	177.0	188.0					11																	124253147		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.93T>C	11.37:g.124253147A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NGH2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F31	ENST00000375013.2	37	c.93	CCDS31708.1	11																																																																																			OR8B2	-	prints_7TM_GPCR_Rhodpsn	ENSG00000204293		0.418	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B2	HGNC	protein_coding	OTTHUMT00000387290.1	61	0.00	0	A	NM_001005468		124253147	124253147	-1	no_errors	ENST00000375013	ensembl	human	known	69_37n	silent	56	11.11	7	SNP	0.003	G
ORAI2	80228	genome.wustl.edu	37	7	102079406	102079406	+	Start_Codon_SNP	SNP	G	G	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr7:102079406G>C	ENST00000356387.2	+	3	238	c.3G>C	c.(1-3)atG>atC	p.M1I	ORAI2_ENST00000473939.1_Start_Codon_SNP_p.M1I|ORAI2_ENST00000403646.3_Start_Codon_SNP_p.M1I|ORAI2_ENST00000478730.2_Start_Codon_SNP_p.M1I|ORAI2_ENST00000488996.1_Intron	NM_001126340.1|NM_001271818.1|NM_001271819.1|NM_032831.3	NP_001119812.1|NP_001258747.1|NP_001258748.1|NP_116220.1	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator 2	1						growth cone (GO:0030426)|integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15						CTCCCACCATGAGTGCTGAGC	0.597																																						dbGAP											0													125.0	116.0	119.0					7																	102079406		2202	4300	6502	-	-	-	SO:0001582	initiator_codon_variant	0			AF258552	CCDS5722.1	7q22.1	2007-08-14	2007-08-14	2007-08-14	ENSG00000160991	ENSG00000160991		"""ORAI calcium release-activated calcium modulators"""	21667	protein-coding gene	gene with protein product	"""CAP-binding protein complex interacting protein 2"""	610929	"""chromosome 7 open reading frame 19"", ""transmembrane protein 142B"""	C7orf19, TMEM142B		16582901	Standard	NM_001126340		Approved	CBCIP2, FLJ12474, FLJ14733, H_NH0514P08.8	uc003uzj.3	Q96SN7	OTTHUMG00000157722	ENST00000356387.2:c.3G>C	7.37:g.102079406G>C	ENSP00000348752:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IA68|Q8WY94|Q9H9Y3	Missense_Mutation	SNP	pfam_CRAC_channel	p.M1I	ENST00000356387.2	37	c.3	CCDS5722.1	7	.	.	.	.	.	.	.	.	.	.	G	18.45	3.625700	0.66901	.	.	ENSG00000160991	ENST00000482237;ENST00000495936;ENST00000356387;ENST00000478730;ENST00000468241;ENST00000403646;ENST00000498661;ENST00000473939	T;T;T;T;T;T;T;T	0.66995	-0.24;1.54;1.52;1.52;1.51;1.52;0.91;1.52	5.38	5.38	0.77491	.	0.043704	0.85682	D	0.000000	T	0.59514	0.2199	.	.	.	0.80722	D	1	B	0.34241	0.444	B	0.26094	0.066	T	0.63519	-0.6619	9	0.62326	D	0.03	.	18.11	0.89532	0.0:0.0:1.0:0.0	.	1	Q96SN7	ORAI2_HUMAN	I	1	ENSP00000419416:M1I;ENSP00000420178:M1I;ENSP00000348752:M1I;ENSP00000418140:M1I;ENSP00000417407:M1I;ENSP00000385489:M1I;ENSP00000418464:M1I;ENSP00000417928:M1I	ENSP00000348752:M1I	M	+	3	0	ORAI2	101866411	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	8.576000	0.90770	2.513000	0.84729	0.563000	0.77884	ATG	ORAI2	-	NULL	ENSG00000160991		0.597	ORAI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ORAI2	HGNC	protein_coding	OTTHUMT00000349509.2	48	0.00	0	G	NM_032831	Missense_Mutation	102079406	102079406	+1	no_errors	ENST00000356387	ensembl	human	known	69_37n	missense	51	17.46	11	SNP	1.000	C
PAPSS1	9061	genome.wustl.edu	37	4	108552875	108552875	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr4:108552875G>T	ENST00000265174.4	-	11	1920	c.1648C>A	c.(1648-1650)Cct>Act	p.P550T		NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1	550					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		ATTAAACCAGGGGCCATCGTC	0.448																																						dbGAP											0													116.0	116.0	116.0					4																	108552875		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.1648C>A	4.37:g.108552875G>T	ENSP00000265174:p.Pro550Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	Missense_Mutation	SNP	pfam_Sulfurylase_cat_dom,pfam_APS_kinase,superfamily_PUA-like_domain,tigrfam_Sulphate_adenylyltransferase,tigrfam_APS_kinase	p.P550T	ENST00000265174.4	37	c.1648	CCDS3676.1	4	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688419	0.88639	.	.	ENSG00000138801	ENST00000265174	T	0.32515	1.45	5.62	5.62	0.85841	Sulphate adenylyltransferase (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	H	0.94964	3.605	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.78242	-0.2280	10	0.87932	D	0	-16.122	19.69	0.95996	0.0:0.0:1.0:0.0	.	550	O43252	PAPS1_HUMAN	T	550	ENSP00000265174:P550T	ENSP00000265174:P550T	P	-	1	0	PAPSS1	108772324	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.253000	0.95501	2.648000	0.89879	0.650000	0.86243	CCT	PAPSS1	-	pfam_Sulfurylase_cat_dom,tigrfam_Sulphate_adenylyltransferase	ENSG00000138801		0.448	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPSS1	HGNC	protein_coding	OTTHUMT00000253946.2	40	0.00	0	G			108552875	108552875	-1	no_errors	ENST00000265174	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	T
PARP1	142	genome.wustl.edu	37	1	226589972	226589972	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:226589972G>T	ENST00000366794.5	-	2	372	c.229C>A	c.(229-231)Ctt>Att	p.L77I	PARP1_ENST00000366791.5_Missense_Mutation_p.L77I|PARP1_ENST00000366792.1_Missense_Mutation_p.L77I|PARP1_ENST00000366790.3_Missense_Mutation_p.L77I	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	77					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		TCCCACCGAAGCTCAGAGAAC	0.567								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														dbGAP											0													101.0	88.0	92.0					1																	226589972		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.229C>A	1.37:g.226589972G>T	ENSP00000355759:p.Leu77Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_Znf_PARP,pfam_PADR1,pfam_WGR_domain,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_WGR_domain,pirsf_NAD_ADPRT,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.L77I	ENST00000366794.5	37	c.229	CCDS1554.1	1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707871	0.68615	.	.	ENSG00000143799	ENST00000432338;ENST00000366794;ENST00000366792;ENST00000366791;ENST00000366790	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	5.2	3.29	0.37713	Zinc finger, PARP-type (3);	0.067978	0.64402	N	0.000009	T	0.59074	0.2167	L	0.48260	1.515	0.80722	D	1	P	0.47191	0.891	P	0.53809	0.735	T	0.56986	-0.7888	10	0.41790	T	0.15	.	9.2089	0.37306	0.0769:0.0:0.7762:0.1469	.	77	P09874	PARP1_HUMAN	I	77	ENSP00000355759:L77I;ENSP00000355757:L77I;ENSP00000355756:L77I;ENSP00000355755:L77I	ENSP00000355755:L77I	L	-	1	0	PARP1	224656595	1.000000	0.71417	0.931000	0.37212	0.983000	0.72400	6.042000	0.70996	1.142000	0.42291	0.650000	0.86243	CTT	PARP1	-	pfam_Znf_PARP,pirsf_NAD_ADPRT,pfscan_Znf_PARP	ENSG00000143799		0.567	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	27	0.00	0	G	NM_001618		226589972	226589972	-1	no_errors	ENST00000366794	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	T
PCID2	55795	genome.wustl.edu	37	13	113845059	113845059	+	Intron	SNP	T	T	C	rs556990	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr13:113845059T>C	ENST00000337344.4	-	7	544				PCID2_ENST00000375479.2_Intron|PCID2_ENST00000375457.2_Intron|PCID2_ENST00000375477.1_Intron|PCID2_ENST00000246505.5_Intron|PCID2_ENST00000493650.1_5'Flank|PCID2_ENST00000375459.1_Intron	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2						negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			ataacaatggttgtgggatta	0.388													T|||	2965	0.592053	0.5598	0.6354	5008	,	,		19540	0.4544		0.7942	False		,,,				2504	0.5389					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.467+126A>G	13.37:g.113845059T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	RNA	SNP	-	NULL	ENST00000337344.4	37	NULL	CCDS9532.2	13																																																																																			PCID2	-	-	ENSG00000126226		0.388	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PCID2	HGNC	protein_coding	OTTHUMT00000045897.1	14	0.00	0	T	NM_018386		113845059	113845059	-1	no_errors	ENST00000491548	ensembl	human	known	69_37n	rna	6	50.00	6	SNP	0.000	C
PCYT1B	9468	genome.wustl.edu	37	X	24608283	24608283	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:24608283C>T	ENST00000379144.2	-	4	473	c.343G>A	c.(343-345)Gat>Aat	p.D115N	PCYT1B_ENST00000379145.1_Missense_Mutation_p.D97N|PCYT1B_ENST00000356768.4_Missense_Mutation_p.D115N	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	115					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	GTGAGATCATCACTGCAAACT	0.473																																						dbGAP											0													115.0	90.0	99.0					X																	24608283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.343G>A	X.37:g.24608283C>T	ENSP00000368439:p.Asp115Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	p.D115N	ENST00000379144.2	37	c.343	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	C	31	5.062448	0.93898	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.97232	-4.3;-4.3;-4.3	5.44	5.44	0.79542	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.000000	0.85682	D	0.000000	D	0.98720	0.9570	M	0.92784	3.345	0.80722	D	1	D;D;D	0.64830	0.979;0.994;0.986	P;P;D	0.63703	0.773;0.855;0.917	D	0.99548	1.0965	10	0.66056	D	0.02	-21.6844	18.3331	0.90277	0.0:1.0:0.0:0.0	.	115;97;115	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	N	97;115;115	ENSP00000368440:D97N;ENSP00000368439:D115N;ENSP00000349211:D115N	ENSP00000349211:D115N	D	-	1	0	PCYT1B	24518204	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.320000	0.79064	2.524000	0.85096	0.600000	0.82982	GAT	PCYT1B	-	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	ENSG00000102230		0.473	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	38	0.00	0	C	NM_004845		24608283	24608283	-1	no_errors	ENST00000379144	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	1.000	T
PLBD2	196463	genome.wustl.edu	37	12	113810596	113810596	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:113810596C>T	ENST00000280800.3	+	3	558	c.527C>T	c.(526-528)tCa>tTa	p.S176L	PLBD2_ENST00000545182.2_Missense_Mutation_p.S176L	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	176					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						AACCCAGACTCACCTTACTGG	0.597																																						dbGAP											0													80.0	82.0	81.0					12																	113810596		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.527C>T	12.37:g.113810596C>T	ENSP00000280800:p.Ser176Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H5E2	Missense_Mutation	SNP	pfam_PLipase_B-like	p.S176L	ENST00000280800.3	37	c.527	CCDS9168.1	12	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929960	0.52759	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.19250	2.16;2.16	5.16	0.935	0.19483	.	0.290052	0.34700	N	0.003756	T	0.28863	0.0716	M	0.84683	2.71	0.09310	N	1	D;P	0.53151	0.958;0.902	B;P	0.47118	0.338;0.538	T	0.19647	-1.0299	10	0.72032	D	0.01	-8.0744	4.7219	0.12922	0.3857:0.4187:0.1249:0.0706	.	176;176	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	L	176	ENSP00000443463:S176L;ENSP00000280800:S176L	ENSP00000280800:S176L	S	+	2	0	PLBD2	112294979	0.000000	0.05858	0.005000	0.12908	0.021000	0.10359	0.884000	0.28214	0.168000	0.19655	0.462000	0.41574	TCA	PLBD2	-	pfam_PLipase_B-like	ENSG00000151176		0.597	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD2	HGNC	protein_coding	OTTHUMT00000404835.1	40	0.00	0	C	NM_173542		113810596	113810596	+1	no_errors	ENST00000280800	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.000	T
PLK1	5347	genome.wustl.edu	37	16	23701345	23701345	+	Silent	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr16:23701345G>A	ENST00000300093.4	+	10	1884	c.1773G>A	c.(1771-1773)ctG>ctA	p.L591L	CTD-2196E14.5_ENST00000566143.1_RNA	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	591					activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		ACAAGCTGCTGAGCTCACGCT	0.647																																					Colon(12;240 564 27038 33155)	dbGAP											0													53.0	51.0	51.0					16																	23701345		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.1773G>A	16.37:g.23701345G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15153|Q99746	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_POLO_box_duplicated_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_cat_dom	p.L591	ENST00000300093.4	37	c.1773	CCDS10616.1	16																																																																																			PLK1	-	NULL	ENSG00000166851		0.647	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK1	HGNC	protein_coding	OTTHUMT00000214057.2	46	0.00	0	G	NM_005030		23701345	23701345	+1	no_errors	ENST00000300093	ensembl	human	known	69_37n	silent	52	20.00	13	SNP	0.994	A
PNRC1	10957	genome.wustl.edu	37	6	89790641	89790641	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr6:89790641G>C	ENST00000336032.3	+	1	145	c.28G>C	c.(28-30)Gag>Cag	p.E10Q	PNRC1_ENST00000354922.3_5'Flank|PNRC1_ENST00000369472.1_5'UTR|RP11-63L7.5_ENST00000606729.1_RNA	NM_006813.2	NP_006804.1	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		CCCGCAGCGGGAGCCGCTCGT	0.617										Multiple Myeloma(7;0.094)																												dbGAP											0													38.0	42.0	41.0					6																	89790641		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03105	CCDS5018.1	6q16.1	2008-02-05	2003-09-25	2003-09-26	ENSG00000146278	ENSG00000146278			17278	protein-coding gene	gene with protein product		606714	"""proline rich 2"""	PROL2		7578250	Standard	NM_006813		Approved	B4-2, PRR2	uc003pmv.3	Q12796	OTTHUMG00000015191	ENST00000336032.3:c.28G>C	6.37:g.89790641G>C	ENSP00000336931:p.Glu10Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q0|E1P515|Q5T7J6|Q7Z5N0	Missense_Mutation	SNP	NULL	p.E10Q	ENST00000336032.3	37	c.28	CCDS5018.1	6	.	.	.	.	.	.	.	.	.	.	G	14.72	2.619667	0.46736	.	.	ENSG00000146278	ENST00000336032	T	0.48522	0.81	5.04	4.17	0.49024	.	0.400950	0.22978	N	0.053354	T	0.26268	0.0641	L	0.44542	1.39	0.80722	D	1	P;P	0.44429	0.739;0.835	B;B	0.41894	0.369;0.369	T	0.13150	-1.0520	10	0.66056	D	0.02	-5.4299	8.4378	0.32797	0.0816:0.1547:0.7637:0.0	.	10;10	Q12796;Q7Z5N0	PNRC1_HUMAN;.	Q	10	ENSP00000336931:E10Q	ENSP00000336931:E10Q	E	+	1	0	PNRC1	89847360	1.000000	0.71417	0.607000	0.28956	0.600000	0.36913	1.411000	0.34702	1.354000	0.45846	0.555000	0.69702	GAG	PNRC1	-	NULL	ENSG00000146278		0.617	PNRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNRC1	HGNC	protein_coding	OTTHUMT00000041471.1	63	0.00	0	G	NM_006813		89790641	89790641	+1	no_errors	ENST00000336032	ensembl	human	known	69_37n	missense	59	13.24	9	SNP	0.885	C
POTEE	445582	genome.wustl.edu	37	2	132022031	132022031	+	Silent	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:132022031C>T	ENST00000356920.5	+	15	3097	c.3003C>T	c.(3001-3003)ggC>ggT	p.G1001G	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	1001	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											TGCTGTCTGGCGGCACCACCA	0.537																																						dbGAP											0													1.0	1.0	1.0					2																	132022031		335	417	752	-	-	-	SO:0001819	synonymous_variant	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.3003C>T	2.37:g.132022031C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.G1001	ENST00000356920.5	37	c.3003	CCDS46414.1	2																																																																																			AC131180.1	-	pfam_Actin-like,smart_Actin-like	ENSG00000188219		0.537	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Clone_based_ensembl_gene	protein_coding		26	0.00	0	C	NM_001083538		132022031	132022031	+1	no_errors	ENST00000356920	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	1.000	T
PPP6R3	55291	genome.wustl.edu	37	11	68305274	68305274	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:68305274C>G	ENST00000393800.2	+	3	396	c.142C>G	c.(142-144)Ctg>Gtg	p.L48V	PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000265636.5_Missense_Mutation_p.L48V|PPP6R3_ENST00000265637.4_Missense_Mutation_p.L48V|PPP6R3_ENST00000393799.2_Missense_Mutation_p.L48V|PPP6R3_ENST00000524904.1_Missense_Mutation_p.L48V|PPP6R3_ENST00000393801.3_Missense_Mutation_p.L48V|PPP6R3_ENST00000524845.1_Missense_Mutation_p.L48V|PPP6R3_ENST00000529710.1_Missense_Mutation_p.L48V|PPP6R3_ENST00000527403.2_Missense_Mutation_p.L48V	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	48					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TATAGAGTTTCTGTTAAAAGC	0.353																																						dbGAP											0													90.0	88.0	89.0					11																	68305274		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.142C>G	11.37:g.68305274C>G	ENSP00000377389:p.Leu48Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.L48V	ENST00000393800.2	37	c.142	CCDS53672.1	11	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132633	0.77662	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000529344;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000531244	T;T;T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.72407	0.3456	M	0.89840	3.065	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.997;0.994;0.995;1.0;0.997	D;D;D;P;D;D	0.87578	0.945;0.945;0.919;0.831;0.998;0.919	T	0.77199	-0.2675	9	.	.	.	.	12.0504	0.53503	0.0:0.9215:0.0:0.0785	.	48;48;48;48;48;48	Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;PP6R3_HUMAN;.;.	V	48	ENSP00000377388:L48V;ENSP00000377389:L48V;ENSP00000433551:L48V;ENSP00000431415:L48V;ENSP00000265637:L48V;ENSP00000433058:L48V;ENSP00000377390:L48V;ENSP00000265636:L48V;ENSP00000437329:L48V;ENSP00000433565:L48V;ENSP00000432837:L48V	.	L	+	1	2	PPP6R3	68061850	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.876000	0.56115	2.654000	0.90174	0.563000	0.77884	CTG	PPP6R3	-	NULL	ENSG00000110075		0.353	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP6R3	HGNC	protein_coding	OTTHUMT00000395275.1	49	0.00	0	C	NM_018312		68305274	68305274	+1	no_errors	ENST00000393799	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	G
PROX1	5629	genome.wustl.edu	37	1	214170480	214170480	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:214170480G>A	ENST00000366958.4	+	2	1210	c.602G>A	c.(601-603)cGa>cAa	p.R201Q	PROX1_ENST00000435016.1_Missense_Mutation_p.R201Q|PROX1_ENST00000498508.2_Missense_Mutation_p.R201Q|PROX1_ENST00000261454.4_Missense_Mutation_p.R201Q	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	201					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		GTGAGTCCCCGAGAAAGTTAC	0.502																																						dbGAP											0													43.0	48.0	46.0					1																	214170480		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.602G>A	1.37:g.214170480G>A	ENSP00000355925:p.Arg201Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	pfam_Prox1,superfamily_Homeodomain-like	p.R201Q	ENST00000366958.4	37	c.602	CCDS31021.1	1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.715633	0.68844	.	.	ENSG00000117707	ENST00000471129;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	6.07	6.07	0.98685	.	0.062767	0.64402	D	0.000004	T	0.27663	0.0680	L	0.43152	1.355	0.80722	D	1	P	0.52463	0.953	P	0.46237	0.508	T	0.00213	-1.1913	10	0.32370	T	0.25	-1.8463	20.6593	0.99626	0.0:0.0:1.0:0.0	.	201	Q92786	PROX1_HUMAN	Q	201	ENSP00000420283:R201Q;ENSP00000355925:R201Q;ENSP00000400694:R201Q;ENSP00000261454:R201Q	ENSP00000261454:R201Q	R	+	2	0	PROX1	212237103	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	CGA	PROX1	-	pfam_Prox1	ENSG00000117707		0.502	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	HGNC	protein_coding	OTTHUMT00000089727.6	22	0.00	0	G	NM_002763		214170480	214170480	+1	no_errors	ENST00000261454	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	A
PRR4	11272	genome.wustl.edu	37	12	11324176	11324176	+	5'UTR	SNP	C	C	A	rs2416548	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:11324176C>A	ENST00000536668.1	-	0	21				TAS2R14_ENST00000381852.4_5'Flank|RP11-785H5.2_ENST00000543969.1_RNA	NR_037918.1		Q16378	PROL4_HUMAN	proline rich 4 (lacrimal)						retina homeostasis (GO:0001895)|visual perception (GO:0007601)	extracellular space (GO:0005615)				endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	9						CATGACTAAGCTAACGGCCTC	0.622													C|||	2719	0.542931	0.1732	0.6066	5008	,	,		13901	0.7569		0.6521	False		,,,				2504	0.6646					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS41756.1, CCDS55804.1	12p13	2008-02-05		2004-05-28		ENSG00000111215			18020	protein-coding gene	gene with protein product		605359		PROL4		7544782	Standard	NM_007244		Approved	LPRP	uc001qyz.4	Q16378		ENST00000536668.1:c.-1534G>T	12.37:g.11324176C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA69|F5H0D7|Q8NFB3	RNA	SNP	-	NULL	ENST00000536668.1	37	NULL		12																																																																																			PRR4	-	-	ENSG00000111215		0.622	PRR4-002	KNOWN	basic	processed_transcript	PRR4	HGNC	protein_coding	OTTHUMT00000400050.2	32	0.00	0	C	NM_007244		11324176	11324176	-1	no_errors	ENST00000535024	ensembl	human	known	69_37n	rna	29	17.14	6	SNP	0.000	A
PTPN7	5778	genome.wustl.edu	37	1	202119308	202119308	+	Intron	SNP	T	T	C	rs7551879	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:202119308T>C	ENST00000308986.5	-	9	1120				PTPN7_ENST00000309017.3_Intron|PTPN7_ENST00000543735.1_Intron|PTPN7_ENST00000492977.1_5'UTR|PTPN7_ENST00000544762.1_Intron|PTPN7_ENST00000367279.4_Intron			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						AATAAACAGCTCTAAGCAGAA	0.507													T|||	1227	0.245008	0.2224	0.2378	5008	,	,		18989	0.3502		0.159	False		,,,				2504	0.2607					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931	ENST00000308986.5:c.989+130A>G	1.37:g.202119308T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	RNA	SNP	-	NULL	ENST00000308986.5	37	NULL		1																																																																																			PTPN7	-	-	ENSG00000143851		0.507	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	PTPN7	HGNC	protein_coding		30	0.00	0	T	NM_002832		202119308	202119308	-1	no_errors	ENST00000492977	ensembl	human	known	69_37n	rna	28	12.50	4	SNP	0.001	C
PTPRVP	148713	genome.wustl.edu	37	1	202156482	202156482	+	RNA	SNP	G	G	A	rs3010088	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:202156482G>A	ENST00000482597.1	+	0	3629					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		GAAGGAGTACGAGGTACACTT	0.617													G|||	3418	0.682508	0.2943	0.8069	5008	,	,		20111	0.7202		0.83	False		,,,				2504	0.9284					dbGAP											0																																										-	-	-			0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202156482G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.617	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	34	0.00	0	G	XM_086287		202156482	202156482	+1	no_errors	ENST00000482597	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.979	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037819	10037819	+	RNA	SNP	T	T	G	rs5005396		TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrY:10037819T>G	ENST00000515896.1	+	0	56									RNA, 5.8S ribosomal pseudogene 6																		CAGCTAGCTGTGAGAATTAAT	0.527																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037819T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.527	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		37	0.00	0	T			10037819	10037819	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	36	18.18	8	SNP	1.000	G
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037835	10037835	+	RNA	SNP	T	T	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrY:10037835T>C	ENST00000515896.1	+	0	72									RNA, 5.8S ribosomal pseudogene 6																		TTAATGTGAATTGCAGGACAC	0.517																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037835T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.517	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		38	0.00	0	T			10037835	10037835	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	31	20.51	8	SNP	1.000	C
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037863	10037863	+	RNA	DEL	C	C	-	rs373540942		TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrY:10037863delC	ENST00000515896.1	+	0	100									RNA, 5.8S ribosomal pseudogene 6																		ATCGACACTTCGAACGCACTT	0.552																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037863delC		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.552	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		17	0.00	0	C			10037863	10037863	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	24	12.50	4	DEL	1.000	-
RPL23AP7	118433	genome.wustl.edu	37	2	114369771	114369771	+	RNA	SNP	C	C	T	rs145906086		TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:114369771C>T	ENST00000416673.2	-	0	385					NR_000029.3				ribosomal protein L23a pseudogene 7																		TTAAAGCCTTCGCTTTGGCTT	0.473																																						dbGAP											0																																										-	-	-			0			BC000596		2q14	2009-03-11				ENSG00000240356		"""L ribosomal proteins"""	17336	pseudogene	pseudogene						19123937	Standard	NR_000029		Approved	RPL23AL1, bA395L14.9	uc010yxy.1				2.37:g.114369771C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000416673.2	37	NULL		2																																																																																			AL078621.11	-	-	ENSG00000240356		0.473	RPL23AP7-003	KNOWN	basic	processed_transcript	RPL23AP7	Clone_based_vega_gene	pseudogene	OTTHUMT00000397215.1	35	0.00	0	C			114369771	114369771	-1	no_errors	ENST00000391616	ensembl	human	known	69_37n	rna	24	17.24	5	SNP	0.999	T
RUNX1	861	genome.wustl.edu	37	21	36421175	36421175	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr21:36421175C>G	ENST00000300305.3	-	1	466	c.22G>C	c.(22-24)Gag>Cag	p.E8Q	RUNX1_ENST00000486278.2_5'UTR|RUNX1_ENST00000437180.1_Missense_Mutation_p.E8Q			Q01196	RUNX1_HUMAN	runt-related transcription factor 1	0					behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						GGAAATGACTCAAATATGCTG	0.458			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0													240.0	195.0	210.0					21																	36421175		2203	4300	6503	-	-	-	SO:0001583	missense	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000300305.3:c.22G>C	21.37:g.36421175C>G	ENSP00000300305:p.Glu8Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Missense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.E8Q	ENST00000300305.3	37	c.22	CCDS13639.1	21	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680888	0.47886	.	.	ENSG00000159216	ENST00000300305;ENST00000437180;ENST00000455571;ENST00000416754	D;D;D	0.97710	-4.22;-4.22;-4.5	5.36	5.36	0.76844	.	0.498037	0.19004	N	0.125244	D	0.95185	0.8439	L	0.36672	1.1	0.80722	D	1	B;B	0.21071	0.051;0.005	B;B	0.20577	0.03;0.003	D	0.92554	0.6052	10	0.37606	T	0.19	-6.9302	14.661	0.68870	0.0:0.8547:0.1453:0.0	.	8;8	Q2TAM6;Q01196-8	.;.	Q	8	ENSP00000300305:E8Q;ENSP00000409227:E8Q;ENSP00000388189:E8Q	ENSP00000300305:E8Q	E	-	1	0	RUNX1	35343045	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.999000	0.57031	2.486000	0.83907	0.655000	0.94253	GAG	RUNX1	-	pirsf_TF_Runt-rel_RUNX	ENSG00000159216		0.458	RUNX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194231.1	33	0.00	0	C			36421175	36421175	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	G
SAA4	6291	genome.wustl.edu	37	11	18252993	18252993	+	3'UTR	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:18252993G>T	ENST00000278222.4	-	0	629				SAA2-SAA4_ENST00000524555.1_RNA	NM_006512.3	NP_006503.2	P35542	SAA4_HUMAN	serum amyloid A4, constitutive						acute-phase response (GO:0006953)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(1)|stomach(1)	13						ccctgtctggggggagaagtg	0.527																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M81349	CCDS7832.1	11p15.1-p14	2008-07-21			ENSG00000148965	ENSG00000148965			10516	protein-coding gene	gene with protein product		104752				8325654	Standard	NM_006512		Approved	C-SAA, CSAA		P35542	OTTHUMG00000166483	ENST00000278222.4:c.*56C>A	11.37:g.18252993G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHJ4	RNA	SNP	-	NULL	ENST00000278222.4	37	NULL	CCDS7832.1	11																																																																																			SAA2-SAA4	-	-	ENSG00000255071		0.527	SAA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAA2-SAA4	HGNC	protein_coding	OTTHUMT00000389988.1	22	0.00	0	G	NM_006512		18252993	18252993	-1	no_errors	ENST00000524555	ensembl	human	known	69_37n	rna	23	17.86	5	SNP	0.000	T
LRRC37B	114659	genome.wustl.edu	37	17	30367618	30367618	+	Intron	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:30367618C>G	ENST00000341671.7	+	7	2128				LRRC37B_ENST00000543378.2_Intron|SH3GL1P1_ENST00000579186.1_RNA|LRRC37B_ENST00000327564.7_Intron|LRRC37B_ENST00000584368.1_Intron|LRRC37B_ENST00000394713.3_Intron	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				CAAGTACCTGCAGCCCAACCC	0.582																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2123+4960C>G	17.37:g.30367618C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RC9|Q5YKG6	RNA	SNP	-	NULL	ENST00000341671.7	37	NULL	CCDS32609.1	17																																																																																			SH3GL1P1	-	-	ENSG00000266777		0.582	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL1P1	HGNC	protein_coding	OTTHUMT00000446508.1	45	0.00	0	C	NM_052888		30367618	30367618	+1	no_errors	ENST00000582640	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	1.000	G
LRRC37B	114659	genome.wustl.edu	37	17	30368062	30368062	+	Intron	SNP	A	A	G	rs2627083		TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:30368062A>G	ENST00000341671.7	+	8	2128				LRRC37B_ENST00000543378.2_Intron|SH3GL1P1_ENST00000579186.1_RNA|LRRC37B_ENST00000327564.7_Intron|LRRC37B_ENST00000584368.1_Intron|LRRC37B_ENST00000394713.3_Intron	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				CCTGGAGACCAACATTGAGCA	0.597																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2124-4657A>G	17.37:g.30368062A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RC9|Q5YKG6	RNA	SNP	-	NULL	ENST00000341671.7	37	NULL	CCDS32609.1	17																																																																																			SH3GL1P1	-	-	ENSG00000266777		0.597	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL1P1	HGNC	protein_coding	OTTHUMT00000446508.1	50	0.00	0	A	NM_052888		30368062	30368062	+1	no_errors	ENST00000579186	ensembl	human	known	69_37n	rna	43	13.73	7	SNP	0.563	G
SH3YL1	26751	genome.wustl.edu	37	2	262335	262335	+	Intron	SNP	A	A	G	rs36216559	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr2:262335A>G	ENST00000405430.1	-	3	378				SH3YL1_ENST00000403712.2_Intron|ACP1_ENST00000405233.1_5'Flank|ACP1_ENST00000272067.6_5'Flank|ACP1_ENST00000272065.5_5'Flank|SH3YL1_ENST00000356150.5_Intron|SH3YL1_ENST00000403657.1_5'Flank|SH3YL1_ENST00000403658.1_Intron|ACP1_ENST00000439645.2_5'Flank|SH3YL1_ENST00000468321.1_5'UTR|SH3YL1_ENST00000402632.1_Intron|ACP1_ENST00000407983.3_5'Flank			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1						phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)			large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		TCTGAACATCAAGTGCTAGCC	0.488													A|||	1329	0.265375	0.2095	0.2363	5008	,	,		18699	0.248		0.335	False		,,,				2504	0.3078					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.1+295T>C	2.37:g.262335A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	RNA	SNP	-	NULL	ENST00000405430.1	37	NULL		2																																																																																			SH3YL1	-	-	ENSG00000035115		0.488	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SH3YL1	HGNC	protein_coding	OTTHUMT00000322352.1	41	0.00	0	A	NM_015677		262335	262335	-1	no_errors	ENST00000468321	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.000	G
SKOR2	652991	genome.wustl.edu	37	18	44773382	44773382	+	Missense_Mutation	SNP	A	A	T	rs9956387	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr18:44773382A>T	ENST00000425639.1	-	1	2172	c.2173T>A	c.(2173-2175)Tgc>Agc	p.C725S	SKOR2_ENST00000400404.1_Intron	NM_001278063.1	NP_001264992.1	Q2VWA4	SKOR2_HUMAN	SKI family transcriptional corepressor 2	725					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of cerebellar granule cell precursor proliferation (GO:0021936)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(1)	1						CTGGGGTAGCAGCAGCTGGTT	0.746													T|||	2083	0.415935	0.3941	0.4078	5008	,	,		6816	0.2996		0.5258	False		,,,				2504	0.4581					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY669508	CCDS62441.1, CCDS74222.1	18q21.1	2011-08-04			ENSG00000215474	ENSG00000215474		"""SKI transcriptional corepressors"""	32695	protein-coding gene	gene with protein product	"""functional smad suppressing element 18"""					16200078, 18522874	Standard	NM_001278063		Approved	CORL2, FUSSEL18, Fussel-18	uc031rif.1	Q2VWA4		ENST00000425639.1:c.2173T>A	18.37:g.44773382A>T	ENSP00000414750:p.Cys725Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like,superfamily_FH2_actin-bd	p.C725S	ENST00000425639.1	37	c.2173		18	940	0.43040293040293043	202	0.4105691056910569	151	0.4171270718232044	178	0.3111888111888112	409	0.5395778364116095	T	0.042	-1.280436	0.01398	.	.	ENSG00000215474	ENST00000425639	T	0.66995	-0.24	4.64	3.45	0.39498	.	.	.	.	.	T	0.00012	0.0000	N	0.01874	-0.695	0.09310	P	0.9999999999999999	.	.	.	.	.	.	T	0.44877	-0.9299	6	0.02654	T	1	-2.8548	9.0712	0.36493	0.293:0.0:0.0:0.707	rs9956387	.	.	.	S	725	ENSP00000414750:C725S	ENSP00000414750:C725S	C	-	1	0	SKOR2	43027380	1.000000	0.71417	1.000000	0.80357	0.081000	0.17604	2.126000	0.42026	0.162000	0.19483	-0.827000	0.03088	TGC	SKOR2	-	NULL	ENSG00000215474		0.746	SKOR2-002	NOVEL	basic|appris_candidate_longest	protein_coding	SKOR2	HGNC	protein_coding	OTTHUMT00000450685.2	26	0.00	0	A	NM_001037802		44773382	44773382	-1	no_errors	ENST00000425639	ensembl	human	novel	69_37n	missense	27	15.15	5	SNP	1.000	T
SLC25A14	9016	genome.wustl.edu	37	X	129498836	129498836	+	Intron	SNP	T	T	A	rs2235800	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:129498836T>A	ENST00000218197.5	+	7	946				SLC25A14_ENST00000467496.1_Intron|SLC25A14_ENST00000339231.3_Intron|SLC25A14_ENST00000543953.1_3'UTR|SLC25A14_ENST00000361980.5_Intron	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14						aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						TGGCCTAAATTCCCTTGTCTC	0.408													A|||	1468	0.388874	0.2602	0.2709	3775	,	,		14789	0.2867		0.328	False		,,,				2504	0.3241					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.719+110T>A	X.37:g.129498836T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	RNA	SNP	-	NULL	ENST00000218197.5	37	NULL	CCDS14623.1	X																																																																																			SLC25A14	-	-	ENSG00000102078		0.408	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A14	HGNC	protein_coding	OTTHUMT00000058253.1	21	0.00	0	T	NM_022810, NM_003951		129498836	129498836	+1	no_errors	ENST00000471795	ensembl	human	known	69_37n	rna	23	17.24	5	SNP	0.000	A
SLC2A13	114134	genome.wustl.edu	37	12	40422143	40422143	+	Silent	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:40422143G>A	ENST00000280871.4	-	3	935	c.885C>T	c.(883-885)atC>atT	p.I295I	SLC2A13_ENST00000380858.1_Silent_p.I295I	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	295					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				TGTTGTTTTTGATGCTATCAT	0.373										HNSCC(50;0.14)																												dbGAP											0													102.0	104.0	103.0					12																	40422143		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.885C>T	12.37:g.40422143G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S07	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Plexin-like_fold,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.I295	ENST00000280871.4	37	c.885	CCDS8736.2	12																																																																																			SLC2A13	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000151229		0.373	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A13	HGNC	protein_coding	OTTHUMT00000132849.2	56	0.00	0	G			40422143	40422143	-1	no_errors	ENST00000280871	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	1.000	A
SMC1B	27127	genome.wustl.edu	37	22	45741354	45741354	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr22:45741354C>G	ENST00000357450.4	-	24	3591	c.3592G>C	c.(3592-3594)Ggc>Cgc	p.G1198R	SMC1B_ENST00000404354.3_Missense_Mutation_p.G1124R	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	1198					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GGATAGATGCCGATCAGCGCG	0.463																																						dbGAP											0													124.0	119.0	120.0					22																	45741354		1892	4122	6014	-	-	-	SO:0001583	missense	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.3592G>C	22.37:g.45741354C>G	ENSP00000350036:p.Gly1198Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.G1198R	ENST00000357450.4	37	c.3592	CCDS43027.1	22	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234852	0.79800	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;D	0.97161	-0.53;-4.27	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000008	D	0.98855	0.9613	M	0.91717	3.235	0.43467	D	0.995679	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99441	1.0938	10	0.87932	D	0	.	19.9365	0.97143	0.0:1.0:0.0:0.0	.	1124;1198	Q8NDV3-2;Q8NDV3-3	.;.	R	1198;1124	ENSP00000350036:G1198R;ENSP00000385902:G1124R	ENSP00000350036:G1198R	G	-	1	0	SMC1B	44120018	1.000000	0.71417	0.994000	0.49952	0.363000	0.29612	7.611000	0.82962	2.721000	0.93114	0.585000	0.79938	GGC	SMC1B	-	pfam_RecF/RecN/SMC	ENSG00000077935		0.463	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2	23	0.00	0	C	NM_148674		45741354	45741354	-1	no_errors	ENST00000357450	ensembl	human	known	69_37n	missense	18	17.39	4	SNP	1.000	G
SMUG1	23583	genome.wustl.edu	37	12	54575800	54575800	+	3'UTR	SNP	C	C	A	rs2233921	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr12:54575800C>A	ENST00000508394.2	-	0	955				SMUG1_ENST00000401977.2_3'UTR|SMUG1_ENST00000506595.1_Intron|SMUG1_ENST00000337581.3_3'UTR|SMUG1_ENST00000514685.1_Intron|SMUG1_ENST00000505128.1_3'UTR|SMUG1_ENST00000513838.1_Intron|SMUG1_ENST00000505662.1_5'UTR|SMUG1_ENST00000243112.5_Intron	NM_001243787.1|NM_001243788.1|NM_014311.2	NP_001230716.1|NP_001230717.1|NP_055126.1	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional uracil-DNA glycosylase 1						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA N-glycosylase activity (GO:0019104)|oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703)|single-strand selective uracil DNA N-glycosylase activity (GO:0017065)|uracil DNA N-glycosylase activity (GO:0004844)			kidney(1)|large_intestine(4)|lung(1)	6						TTGCTCCAGTCCAGGAGATGT	0.507								Base excision repair (BER), DNA glycosylases					C|||	1579	0.315296	0.034	0.3948	5008	,	,		22434	0.3998		0.4771	False		,,,				2504	0.3855					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF125182	CCDS8874.1, CCDS58239.1	12q13.13	2013-10-28			ENSG00000123415	ENSG00000123415			17148	protein-coding gene	gene with protein product		607753				10074426, 11526119	Standard	NM_014311		Approved	UNG3, FDG, HMUDG	uc009znf.2	Q53HV7	OTTHUMG00000160068	ENST00000508394.2:c.*80G>T	12.37:g.54575800C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2K9|O95862|Q0D2M0|Q8NB71|Q9BWC8	RNA	SNP	-	NULL	ENST00000508394.2	37	NULL	CCDS8874.1	12																																																																																			SMUG1	-	-	ENSG00000123415		0.507	SMUG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMUG1	HGNC	protein_coding	OTTHUMT00000359074.3	35	0.00	0	C	NM_014311		54575800	54575800	-1	no_errors	ENST00000505662	ensembl	human	known	69_37n	rna	35	12.50	5	SNP	0.000	A
SPAG11B	10407	genome.wustl.edu	37	8	7320265	7320265	+	Missense_Mutation	SNP	G	G	A	rs138861652	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr8:7320265G>A	ENST00000297498.2	-	2	344	c.178C>T	c.(178-180)Cgg>Tgg	p.R60W	SPAG11B_ENST00000359758.5_Missense_Mutation_p.R60W|SPAG11B_ENST00000317900.5_Missense_Mutation_p.R60W|SPAG11B_ENST00000398462.2_Missense_Mutation_p.R60W|SPAG11B_ENST00000361111.2_Missense_Mutation_p.R60W	NM_016512.3	NP_057596.1	Q08648	SG11B_HUMAN	sperm associated antigen 11B	60					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				large_intestine(2)|lung(3)|urinary_tract(1)	6				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		AAGAGGTCCCGTTTCACTGCG	0.572																																						dbGAP											0													11.0	16.0	14.0					8																	7320265		2119	4198	6317	-	-	-	SO:0001583	missense	0			AF168616	CCDS5964.1, CCDS5965.1, CCDS5966.1, CCDS5967.1, CCDS47774.1	8p23.1	2014-02-21	2007-03-15	2007-03-15	ENSG00000164871	ENSG00000164871			14534	protein-coding gene	gene with protein product	"""epididymal protein 2B"""	606560				8167223, 1693137	Standard	NM_058200		Approved	HE2, EP2, EP2C, EP2D, EDDM2B	uc003wrl.3	Q08648	OTTHUMG00000129219	ENST00000297498.2:c.178C>T	8.37:g.7320265G>A	ENSP00000297498:p.Arg60Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFH0|Q546A0|Q6ZYB2|Q9H4P8|Q9H4P9|Q9H4Q0|Q9H4Q1|Q9H4Q2|Q9NRT3|Q9NRV4|Q9NRV5|Q9NRV6|Q9NRV7|Q9NRV8	Missense_Mutation	SNP	pfam_Sperm_Ag_HE2,pfam_Defensin_beta-typ	p.R60W	ENST00000297498.2	37	c.178	CCDS5966.1	8	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396207	0.42512	.	.	ENSG00000164871	ENST00000528943;ENST00000359758;ENST00000361111;ENST00000297498;ENST00000398462;ENST00000317900	T;T;T	0.62788	0.92;0.0;0.75	2.58	0.61	0.17580	.	.	.	.	.	T	0.69242	0.3089	L	0.52573	1.65	0.09310	N	1	D;D;D;D;D	0.89917	0.986;1.0;1.0;0.998;0.999	P;D;D;P;P	0.69307	0.537;0.963;0.949;0.738;0.88	T	0.57711	-0.7764	9	0.66056	D	0.02	.	8.3001	0.32008	0.0:0.4868:0.5132:0.0	.	60;60;60;60;60	Q08648-3;A8MZA0;Q08648;Q6PDA7-3;E9PAK7	.;.;SG11B_HUMAN;.;.	W	43;60;60;60;60;60	ENSP00000437154:R43W;ENSP00000354411:R60W;ENSP00000297498:R60W	ENSP00000297498:R60W	R	-	1	2	SPAG11B	7307675	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-0.041000	0.12084	0.141000	0.18875	0.454000	0.30748	CGG	SPAG11B	-	pfam_Sperm_Ag_HE2	ENSG00000164871		0.572	SPAG11B-003	KNOWN	basic|CCDS	protein_coding	SPAG11B	HGNC	protein_coding	OTTHUMT00000251390.2	52	0.00	0	G	NM_058202, NM_058200, NM_058201, NM_016512, NM_058203, NM_058206, NM_058207		7320265	7320265	-1	no_errors	ENST00000398462	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	0.000	A
SNTB1	6641	genome.wustl.edu	37	8	121583603	121583603	+	Intron	SNP	G	G	A	rs72680561	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr8:121583603G>A	ENST00000395601.3	-	5	1551				SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Intron	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)						muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CACGGATGAGGACTGTGGATG	0.443													G|||	1094	0.21845	0.2973	0.2161	5008	,	,		17446	0.1319		0.174	False		,,,				2504	0.2485					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.1136+3722C>T	8.37:g.121583603G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9E0|O14912|Q4KMG8	RNA	SNP	-	NULL	ENST00000395601.3	37	NULL	CCDS6334.1	8																																																																																			SNTB1	-	-	ENSG00000172164		0.443	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTB1	HGNC	protein_coding	OTTHUMT00000381535.1	45	0.00	0	G	NM_021021		121583603	121583603	-1	no_errors	ENST00000519177	ensembl	human	known	69_37n	rna	30	13.89	5	SNP	0.000	A
SSBP2	23635	genome.wustl.edu	37	5	80715913	80715913	+	3'UTR	SNP	T	T	G	rs9641	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr5:80715913T>G	ENST00000320672.4	-	0	1706				SSBP2_ENST00000505980.1_3'UTR|SSBP2_ENST00000514493.1_3'UTR|SSBP2_ENST00000510060.1_5'UTR|SSBP2_ENST00000509053.1_3'UTR	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2						regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)		SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		TTGTAATAATTAAAATGTAAA	0.328													T|||	384	0.0766773	0.2292	0.0317	5008	,	,		17779	0.0089		0.0229	False		,,,				2504	0.0276					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.*410A>C	5.37:g.80715913T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	RNA	SNP	-	NULL	ENST00000320672.4	37	NULL	CCDS4056.1	5																																																																																			SSBP2	-	-	ENSG00000145687		0.328	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP2	HGNC	protein_coding	OTTHUMT00000239249.1	32	0.00	0	T	NM_012446		80715913	80715913	-1	no_errors	ENST00000510060	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	1.000	G
TAF15	8148	genome.wustl.edu	37	17	34147185	34147185	+	Silent	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:34147185G>A	ENST00000588240.1	+	4	232	c.117G>A	c.(115-117)ggG>ggA	p.G39G	TAF15_ENST00000592237.1_5'UTR|AC015849.13_ENST00000589356.1_RNA|AC015849.19_ENST00000588415.1_RNA|TAF15_ENST00000311979.3_Silent_p.G39G	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		CTGGCTATGGGCAAACGACTG	0.338			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																	dbGAP		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	0													136.0	137.0	137.0					17																	34147185		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.117G>A	17.37:g.34147185G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPM5|Q15775|Q5T077	Silent	SNP	pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.G39	ENST00000588240.1	37	c.117	CCDS32623.1	17																																																																																			TAF15	-	NULL	ENSG00000172660		0.338	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF15	HGNC	protein_coding	OTTHUMT00000449134.1	72	0.00	0	G	NM_139215		34147185	34147185	+1	no_errors	ENST00000588240	ensembl	human	known	69_37n	silent	55	25.33	19	SNP	1.000	A
TAF1L	138474	genome.wustl.edu	37	9	32632045	32632045	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:32632045G>A	ENST00000242310.4	-	1	3622	c.3533C>T	c.(3532-3534)tCt>tTt	p.S1178F	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1178					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCCAGTGGCAGAAGACTTAAG	0.478																																						dbGAP											0													190.0	146.0	161.0					9																	32632045		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3533C>T	9.37:g.32632045G>A	ENSP00000418379:p.Ser1178Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.S1178F	ENST00000242310.4	37	c.3533	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	11.36	1.616676	0.28801	.	.	ENSG00000122728	ENST00000242310	T	0.18174	2.23	0.479	0.479	0.16796	.	0.059177	0.64402	D	0.000001	T	0.17831	0.0428	L	0.41824	1.3	0.50171	D	0.999856	P	0.35944	0.529	P	0.45946	0.498	T	0.04825	-1.0924	10	0.72032	D	0.01	.	6.6915	0.23174	2.0E-4:0.0:0.9998:0.0	.	1178	Q8IZX4	TAF1L_HUMAN	F	1178	ENSP00000418379:S1178F	ENSP00000418379:S1178F	S	-	2	0	TAF1L	32622045	1.000000	0.71417	0.913000	0.36048	0.282000	0.26991	6.138000	0.71717	0.507000	0.28148	0.195000	0.17529	TCT	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.478	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	47	0.00	0	G			32632045	32632045	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	missense	61	15.07	11	SNP	1.000	A
TBC1D8B	54885	genome.wustl.edu	37	X	106117064	106117064	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:106117064G>T	ENST00000357242.5	+	21	3406	c.3232G>T	c.(3232-3234)Gca>Tca	p.A1078S	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.A1072S	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	1078							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GTGGTCATTTGCATTTGAACA	0.443																																						dbGAP											0													96.0	89.0	92.0					X																	106117064		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.3232G>T	X.37:g.106117064G>T	ENSP00000349781:p.Ala1078Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.A1078S	ENST00000357242.5	37	c.3232	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	G	3.611	-0.079650	0.07141	.	.	ENSG00000133138	ENST00000357242;ENST00000276175	T;T	0.05855	3.38;3.39	5.72	1.62	0.23740	.	0.140991	0.48767	N	0.000173	T	0.03915	0.0110	N	0.17723	0.515	0.40000	D	0.975158	B	0.19706	0.038	B	0.21151	0.033	T	0.36939	-0.9727	10	0.02654	T	1	-9.8037	13.7662	0.62997	0.0:0.0:0.4749:0.5251	.	1078	Q0IIM8	TBC8B_HUMAN	S	1078;1072	ENSP00000349781:A1078S;ENSP00000276175:A1072S	ENSP00000276175:A1072S	A	+	1	0	TBC1D8B	106003720	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	2.206000	0.42779	0.148000	0.19059	-0.245000	0.11935	GCA	TBC1D8B	-	NULL	ENSG00000133138		0.443	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	HGNC	protein_coding	OTTHUMT00000057807.2	38	0.00	0	G	NM_017752		106117064	106117064	+1	no_errors	ENST00000357242	ensembl	human	known	69_37n	missense	34	18.60	8	SNP	1.000	T
TBX2	6909	genome.wustl.edu	37	17	59486624	59486624	+	3'UTR	SNP	G	G	C	rs3198587	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr17:59486624G>C	ENST00000240328.3	+	0	3177				TBX2_ENST00000586986.1_3'UTR|RP11-332H18.4_ENST00000592009.1_RNA|C17orf82_ENST00000335108.2_5'Flank	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2						aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						TACAGGGCTGGGGGGGCCCTT	0.547													G|||	969	0.19349	0.0416	0.1744	5008	,	,		9226	0.3284		0.2107	False		,,,				2504	0.2556				GBM(3;187 253 11467 14965 23079)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.*757G>C	17.37:g.59486624G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16424|Q7Z647	RNA	SNP	-	NULL	ENST00000240328.3	37	NULL	CCDS11627.2	17																																																																																			TBX2	-	-	ENSG00000121068		0.547	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TBX2	HGNC	protein_coding	OTTHUMT00000346977.2	35	0.00	0	G	NM_005994		59486624	59486624	+1	no_errors	ENST00000586986	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.000	C
TBXAS1	6916	genome.wustl.edu	37	7	139652440	139652440	+	Missense_Mutation	SNP	C	C	T	rs6952940	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr7:139652440C>T	ENST00000458722.1	+	6	678	c.541C>T	c.(541-543)Ccg>Tcg	p.P181S	TBXAS1_ENST00000425687.1_Intron|TBXAS1_ENST00000462275.1_Intron|TBXAS1_ENST00000448866.1_Intron|TBXAS1_ENST00000263552.6_Intron|TBXAS1_ENST00000411653.1_Intron|TBXAS1_ENST00000436047.2_Intron|TBXAS1_ENST00000414508.2_Intron|TBXAS1_ENST00000416849.2_Missense_Mutation_p.P182S|TBXAS1_ENST00000336425.5_Intron			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	150					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	TTTGTCGAAGCCGAGTGGTAT	0.388													C|||	77	0.0153754	0.0265	0.013	5008	,	,		18326	0.0		0.0318	False		,,,				2504	0.001					dbGAP											0													149.0	130.0	136.0					7																	139652440		692	1591	2283	-	-	-	SO:0001583	missense	0			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000458722.1:c.541C>T	7.37:g.139652440C>T	ENSP00000411274:p.Pro181Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.P182S	ENST00000458722.1	37	c.544		7	33	0.01510989010989011	10	0.02032520325203252	4	0.011049723756906077	0	0.0	19	0.025065963060686015	C	6.590	0.477149	0.12521	.	.	ENSG00000059377	ENST00000416849;ENST00000458722	T;T	0.66815	-0.23;-0.23	3.04	0.142	0.14816	.	.	.	.	.	T	0.17577	0.0422	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.10245	-1.0638	9	0.41790	T	0.15	.	3.6036	0.08034	0.0:0.5417:0.2093:0.249	rs6952940;rs6952940	182	E7EP08	.	S	182;181	ENSP00000389414:P182S;ENSP00000411274:P181S	ENSP00000389414:P182S	P	+	1	0	TBXAS1	139298909	0.000000	0.05858	0.002000	0.10522	0.029000	0.11900	-0.262000	0.08682	0.017000	0.15025	0.591000	0.81541	CCG	TBXAS1	-	NULL	ENSG00000059377		0.388	TBXAS1-004	NOVEL	basic	protein_coding	TBXAS1	HGNC	protein_coding	OTTHUMT00000348376.1	33	0.00	0	C			139652440	139652440	+1	no_errors	ENST00000416849	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.002	T
TCEANC	170082	genome.wustl.edu	37	X	13682577	13682577	+	3'UTR	SNP	G	G	A	rs3761625	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:13682577G>A	ENST00000380600.1	+	0	2037				TCEANC_ENST00000490617.1_3'UTR			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing						regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						AAGTCACCCTGGAACTCATCC	0.378													G|||	2101	0.556556	0.3177	0.402	3775	,	,		15439	0.496		0.3857	False		,,,				2504	0.5256					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.*894G>A	X.37:g.13682577G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI06|B2RDM3	RNA	SNP	-	NULL	ENST00000380600.1	37	NULL		X																																																																																			TCEANC	-	-	ENSG00000176896		0.378	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	TCEANC	HGNC	protein_coding	OTTHUMT00000055796.1	73	0.00	0	G	NM_152634		13682577	13682577	+1	no_errors	ENST00000490617	ensembl	human	known	69_37n	rna	99	13.91	16	SNP	0.000	A
TDRD7	23424	genome.wustl.edu	37	9	100223030	100223030	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:100223030A>T	ENST00000355295.4	+	7	1721	c.1426A>T	c.(1426-1428)Aat>Tat	p.N476Y	TDRD7_ENST00000422139.2_Missense_Mutation_p.N402Y	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	476					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				GAGCAACACAAATGAAGTGGT	0.368																																						dbGAP											0													47.0	48.0	48.0					9																	100223030		2200	4300	6500	-	-	-	SO:0001583	missense	0			AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.1426A>T	9.37:g.100223030A>T	ENSP00000347444:p.Asn476Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.N476Y	ENST00000355295.4	37	c.1426	CCDS6725.1	9	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016389	0.75161	.	.	ENSG00000196116	ENST00000355295;ENST00000422139	T;T	0.10005	2.92;2.92	5.59	5.59	0.84812	Maternal tudor protein (1);	0.124960	0.64402	D	0.000001	T	0.33585	0.0868	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.04373	-1.0956	10	0.66056	D	0.02	-24.0455	14.8999	0.70670	1.0:0.0:0.0:0.0	.	476	Q8NHU6	TDRD7_HUMAN	Y	476;402	ENSP00000347444:N476Y;ENSP00000413608:N402Y	ENSP00000347444:N476Y	N	+	1	0	TDRD7	99262851	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	6.198000	0.72106	2.252000	0.74401	0.533000	0.62120	AAT	TDRD7	-	pfam_Tudor	ENSG00000196116		0.368	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD7	HGNC	protein_coding	OTTHUMT00000053322.1	32	0.00	0	A	NM_014290		100223030	100223030	+1	no_errors	ENST00000355295	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	1.000	T
TINF2	26277	genome.wustl.edu	37	14	24709337	24709337	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr14:24709337G>C	ENST00000267415.7	-	8	1495	c.1154C>G	c.(1153-1155)tCc>tGc	p.S385C	TINF2_ENST00000558510.1_5'Flank|TINF2_ENST00000540705.1_Missense_Mutation_p.S350C|TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000399423.4_3'UTR|TINF2_ENST00000538777.1_3'UTR	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	385					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		GGTAATGACGGAGCTGCACAG	0.512									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																													dbGAP											0													185.0	193.0	190.0					14																	24709337		1997	4164	6161	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.1154C>G	14.37:g.24709337G>C	ENSP00000267415:p.Ser385Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3W5Q7|Q9H904|Q9UHC2	Missense_Mutation	SNP	NULL	p.S385C	ENST00000267415.7	37	c.1154	CCDS41936.1	14	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433087	0.25813	.	.	ENSG00000092330	ENST00000267415;ENST00000540705	D;D	0.86497	-2.12;-2.13	5.41	4.51	0.55191	.	0.427763	0.21983	N	0.066280	D	0.89529	0.6741	M	0.62723	1.935	0.46028	D	0.99882	P;D	0.54964	0.924;0.969	P;P	0.55161	0.694;0.77	D	0.89821	0.3989	10	0.66056	D	0.02	-0.3526	11.5117	0.50496	0.0:0.0:0.8215:0.1785	.	350;385	B4DFJ1;Q9BSI4	.;TINF2_HUMAN	C	385;350	ENSP00000267415:S385C;ENSP00000442154:S350C	ENSP00000267415:S385C	S	-	2	0	TINF2	23779177	0.993000	0.37304	0.029000	0.17559	0.037000	0.13140	2.764000	0.47613	1.504000	0.48704	-0.261000	0.10672	TCC	TINF2	-	NULL	ENSG00000092330		0.512	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINF2	HGNC	protein_coding	OTTHUMT00000415406.2	37	0.00	0	G			24709337	24709337	-1	no_errors	ENST00000267415	ensembl	human	known	69_37n	missense	49	10.91	6	SNP	0.542	C
TLE4	7091	genome.wustl.edu	37	9	82286352	82286352	+	Intron	SNP	G	G	A	rs2297498	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr9:82286352G>A	ENST00000376552.2	+	8	1627				TLE4_ENST00000265284.6_Intron|TLE4_ENST00000376544.3_Intron|TLE4_ENST00000376537.4_Intron|TLE4_ENST00000376520.4_Intron|TLE4_ENST00000376534.4_Intron	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TTTTATTTTCGTGTCAGATTA	0.443													A|||	2719	0.542931	0.1475	0.6686	5008	,	,		18414	0.7153		0.6243	False		,,,				2504	0.727					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.609+17362G>A	9.37:g.82286352G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	RNA	SNP	-	NULL	ENST00000376552.2	37	NULL	CCDS43837.1	9																																																																																			TLE4	-	-	ENSG00000106829		0.443	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	HGNC	protein_coding	OTTHUMT00000052792.4	10	0.00	0	G	XM_212237		82286352	82286352	+1	no_errors	ENST00000493163	ensembl	human	known	69_37n	rna	8	38.46	5	SNP	0.641	A
TPTEP1	387590	genome.wustl.edu	37	22	17128089	17128089	+	lincRNA	SNP	G	G	A	rs3091370	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr22:17128089G>A	ENST00000426585.1	+	0	442									transmembrane phosphatase with tensin homology pseudogene 1																		TGCTCTTTGTGCTCTCCTCCC	0.522													.|||	972	0.194089	0.0106	0.1354	5008	,	,		17601	0.2718		0.2803	False		,,,				2504	0.3149					dbGAP											0																																										-	-	-			0					22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17128089G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181		0.522	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	HGNC	lincRNA	OTTHUMT00000280575.1	87	0.00	0	G	NR_001591		17128089	17128089	+1	no_errors	ENST00000400593	ensembl	human	known	69_37n	rna	73	11.90	10	SNP	0.054	A
TRBV24-1	28563	genome.wustl.edu	37	7	142364557	142364557	+	RNA	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr7:142364557G>T	ENST00000390397.2	+	0	228									T cell receptor beta variable 24-1																		GCCTACGGTTGATCTATTACT	0.443																																						dbGAP											0													69.0	67.0	68.0					7																	142364557		1866	4116	5982	-	-	-			0			M11951		7q34	2012-02-07			ENSG00000211750	ENSG00000211750		"""T cell receptors / TRB locus"""	12203	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV241, TCRBV15S1, TCRBV24S1			OTTHUMG00000158889		7.37:g.142364557G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L64F	ENST00000390397.2	37	c.192		7																																																																																			TRBV24-1	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211750		0.443	TRBV24-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV24-1	HGNC	TR_V_gene	OTTHUMT00000352499.1	67	0.00	0	G	NG_001333		142364557	142364557	+1	no_stop_codon	ENST00000390397	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.075	T
TRIM49C	642612	genome.wustl.edu	37	11	89768577	89768577	+	Silent	SNP	C	C	T	rs61903674	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr11:89768577C>T	ENST00000448984.1	+	3	527	c.198C>T	c.(196-198)acC>acT	p.T66T	TRIM49C_ENST00000432771.1_Silent_p.T66T	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	66						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						ACCTCAAAACCAACATTCATT	0.458													c|||	231	0.0461262	0.003	0.0605	5008	,	,		16161	0.002		0.1054	False		,,,				2504	0.0787					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.198C>T	11.37:g.89768577C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.T66	ENST00000448984.1	37	c.198	CCDS53694.1	11																																																																																			TRIM49C	-	NULL	ENSG00000204449		0.458	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	64	0.00	0	C	NM_001195234		89768577	89768577	+1	no_errors	ENST00000448984	ensembl	human	known	69_37n	silent	54	11.48	7	SNP	0.001	T
TRNT1	51095	genome.wustl.edu	37	3	3189187	3189187	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr3:3189187G>A	ENST00000251607.6	+	7	958	c.856G>A	c.(856-858)Gat>Aat	p.D286N	TRNT1_ENST00000280591.6_Missense_Mutation_p.D266N	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	286					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		TAAAAATGTTGATGGTTTTTC	0.358																																						dbGAP											0													83.0	88.0	86.0					3																	3189187		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.856G>A	3.37:g.3189187G>A	ENSP00000251607:p.Asp286Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	pfam_PolA_pol_head_dom	p.D286N	ENST00000251607.6	37	c.856	CCDS2561.2	3	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935620	0.34189	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.44083	0.93;1.01	5.64	4.72	0.59763	.	0.746656	0.13652	N	0.372219	T	0.21145	0.0509	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.08953	-1.0697	10	0.16896	T	0.51	-13.4517	13.3122	0.60386	0.0:0.3262:0.6738:0.0	.	266;286	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	N	286;266	ENSP00000251607:D286N;ENSP00000280591:D266N	ENSP00000251607:D286N	D	+	1	0	TRNT1	3164187	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	1.951000	0.40333	2.667000	0.90743	0.655000	0.94253	GAT	TRNT1	-	NULL	ENSG00000072756		0.358	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNT1	HGNC	protein_coding	OTTHUMT00000337616.1	22	0.00	0	G			3189187	3189187	+1	no_errors	ENST00000251607	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.987	A
TSSK2	23617	genome.wustl.edu	37	22	19119656	19119656	+	Silent	SNP	C	C	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr22:19119656C>T	ENST00000399635.2	+	1	1336	c.744C>T	c.(742-744)ctC>ctT	p.L248L	DGCR14_ENST00000252137.6_3'UTR	NM_053006.4	NP_443732.3	Q96PF2	TSSK2_HUMAN	testis-specific serine kinase 2	248	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(2)|lung(2)|prostate(4)|stomach(1)	11	Colorectal(54;0.0993)					GCAAGGACCTCATCTACCGCA	0.607																																						dbGAP											0													94.0	79.0	84.0					22																	19119656		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF362953	CCDS13755.1	22q11.21	2007-01-30	2005-03-10	2005-03-12	ENSG00000206203	ENSG00000206203			11401	protein-coding gene	gene with protein product		610710	"""serine/threonine kinase 22B (spermiogenesis associated)"""	STK22B		10591208	Standard	NM_053006		Approved	SPOGA2, FLJ38613	uc002zow.2	Q96PF2	OTTHUMG00000150118	ENST00000399635.2:c.744C>T	22.37:g.19119656C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IY55	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L248	ENST00000399635.2	37	c.744	CCDS13755.1	22																																																																																			TSSK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000206203		0.607	TSSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK2	HGNC	protein_coding	OTTHUMT00000316431.1	26	0.00	0	C			19119656	19119656	+1	no_errors	ENST00000399635	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	1.000	T
UROD	7389	genome.wustl.edu	37	1	45480407	45480407	+	Splice_Site	SNP	G	G	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:45480407G>C	ENST00000246337.4	+	8	893		c.e8-1		UROD_ENST00000494399.1_3'UTR	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase						heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					CTTTTTTCTAGATCATCTTTG	0.527									Porphyria Cutanea Tarda, Type II		OREG0013449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													75.0	74.0	74.0					1																	45480407		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	PCT-II	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.775-1G>C	1.37:g.45480407G>C		Somatic	931	WXS	Illumina GAIIx	Phase_IV	A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	Splice_Site	SNP	-	e8-1	ENST00000246337.4	37	c.775-1	CCDS518.1	1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619261	0.66787	.	.	ENSG00000126088	ENST00000246337;ENST00000372139;ENST00000428106	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2617	0.98447	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UROD	45252994	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.281000	0.78621	2.793000	0.96121	0.655000	0.94253	.	UROD	-	-	ENSG00000126088		0.527	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROD	HGNC	protein_coding	OTTHUMT00000024803.1	10	0	0	G	NM_000374	Intron	45480407	45480407	+1	no_errors	ENST00000246337	ensembl	human	known	69_37n	splice_site	9	30.77	4	SNP	1.000	C
UROD	7389	genome.wustl.edu	37	1	45480407	45480407	+	Splice_Site	SNP	G	G	C			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:45480407G>C	ENST00000246337.4	+	8	893		c.e8-1		UROD_ENST00000494399.1_3'UTR	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase						heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					CTTTTTTCTAGATCATCTTTG	0.527									Porphyria Cutanea Tarda, Type II		OREG0013449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													75.0	74.0	74.0					1																	45480407		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	PCT-II	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.775-1G>C	1.37:g.45480407G>C		Somatic	931	WXS	Illumina GAIIx	Phase_IV	A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	Splice_Site	SNP	-	e8-1	ENST00000246337.4	37	c.775-1	CCDS518.1	1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619261	0.66787	.	.	ENSG00000126088	ENST00000246337;ENST00000372139;ENST00000428106	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2617	0.98447	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UROD	45252994	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.281000	0.78621	2.793000	0.96121	0.655000	0.94253	.	UROD	-	-	ENSG00000126088		0.527	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROD	HGNC	protein_coding	OTTHUMT00000024803.1	10	0.00	0	G	NM_000374	Intron	45480407	45480407	+1	no_errors	ENST00000246337	ensembl	human	known	69_37n	splice_site	9	30.77	4	SNP	1.000	C
TTC22	55001	genome.wustl.edu	37	1	55250479	55250479	+	Intron	SNP	C	C	T	rs78948067	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:55250479C>T	ENST00000371276.4	-	5	1124				TTC22_ENST00000371274.4_3'UTR	NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22											kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						CTGGGAGCTCCGAGTCGGCTT	0.557													C|||	315	0.0628994	0.0151	0.0793	5008	,	,		15042	0.0198		0.1322	False		,,,				2504	0.089					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.1020+1176G>A	1.37:g.55250479C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NWT4	Missense_Mutation	SNP	NULL	p.R145Q	ENST00000371276.4	37	c.434	CCDS44152.1	1	165	0.07554945054945054	9	0.018292682926829267	31	0.0856353591160221	12	0.02097902097902098	113	0.14907651715039577	C	4.932	0.173172	0.09391	.	.	ENSG00000006555	ENST00000448308	.	.	.	1.71	0.78	0.18556	.	.	.	.	.	T	0.00300	0.0009	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.11891	-1.0569	4	0.66056	D	0.02	.	4.3298	0.11057	0.0:0.7889:0.0:0.2111	.	.	.	.	Q	145	.	ENSP00000390300:R145Q	R	-	2	0	TTC22	55023067	0.000000	0.05858	0.001000	0.08648	0.026000	0.11368	-0.992000	0.03724	0.281000	0.22233	-0.657000	0.03884	CGG	TTC22	-	NULL	ENSG00000006555		0.557	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TTC22	HGNC	protein_coding	OTTHUMT00000027438.1	46	0.00	0	C	NM_017904		55250479	55250479	-1	no_start_codon	ENST00000448308	ensembl	human	putative	69_37n	missense	45	10.00	5	SNP	0.001	T
USP48	84196	genome.wustl.edu	37	1	22032270	22032270	+	Silent	SNP	G	G	A	rs530768144		TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:22032270G>A	ENST00000308271.9	-	19	2982	c.2334C>T	c.(2332-2334)caC>caT	p.H778H	USP48_ENST00000400301.1_Silent_p.H778H|USP48_ENST00000374732.3_Silent_p.H316H|USP48_ENST00000529637.1_Silent_p.H790H	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	778	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TGAGGCCCCCGTGGGGACACA	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		14021	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													66.0	70.0	69.0					1																	22032270		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2334C>T	1.37:g.22032270G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19,pfscan_Ubiquitin_supergroup	p.H778	ENST00000308271.9	37	c.2334	CCDS30623.1	1																																																																																			USP48	-	NULL	ENSG00000090686		0.403	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP48	HGNC	protein_coding	OTTHUMT00000021372.1	42	0.00	0	G	NM_032236		22032270	22032270	-1	no_errors	ENST00000308271	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.852	A
USH2A	7399	genome.wustl.edu	37	1	215901420	215901420	+	Silent	SNP	G	G	T			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr1:215901420G>T	ENST00000307340.3	-	61	12404	c.12018C>A	c.(12016-12018)ccC>ccA	p.P4006P	USH2A_ENST00000366943.2_Silent_p.P4006P	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4006	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAGGATCGTCGGGTCTCTCCT	0.458										HNSCC(13;0.011)																												dbGAP											0													136.0	128.0	131.0					1																	215901420		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12018C>A	1.37:g.215901420G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.P4006	ENST00000307340.3	37	c.12018	CCDS31025.1	1																																																																																			USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	41	0.00	0	G	NM_007123		215901420	215901420	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	silent	42	10.64	5	SNP	0.000	T
UTP14A	10813	genome.wustl.edu	37	X	129055208	129055208	+	Silent	SNP	A	A	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chrX:129055208A>G	ENST00000394422.3	+	11	1021	c.993A>G	c.(991-993)aaA>aaG	p.K331K	UTP14A_ENST00000425117.2_Silent_p.K279K|UTP14A_ENST00000498179.1_3'UTR|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Silent_p.K277K|UTP14A_ENST00000371042.3_Silent_p.K163K	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	331					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						CTAAGAACAAAGAACTGACAC	0.493																																						dbGAP											0													94.0	87.0	89.0					X																	129055208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.993A>G	X.37:g.129055208A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	pfam_SSU_processome_Utp14	p.K331	ENST00000394422.3	37	c.993	CCDS14615.1	X																																																																																			UTP14A	-	pfam_SSU_processome_Utp14	ENSG00000156697		0.493	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	HGNC	protein_coding	OTTHUMT00000058221.1	45	0.00	0	A	NM_006649		129055208	129055208	+1	no_errors	ENST00000394422	ensembl	human	known	69_37n	silent	36	14.29	6	SNP	1.000	G
WISP2	8839	genome.wustl.edu	37	20	43356156	43356156	+	3'UTR	SNP	C	C	T	rs1061098	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr20:43356156C>T	ENST00000372868.2	+	0	1304				RP11-445H22.4_ENST00000445420.1_RNA|WISP2_ENST00000471629.1_3'UTR|RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000372865.4_3'UTR|WISP2_ENST00000190983.4_3'UTR|RP11-445H22.4_ENST00000427598.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GACCTAGTCCCCTTTCCTCTA	0.547													C|||	1553	0.310104	0.2526	0.2853	5008	,	,		20063	0.37		0.34	False		,,,				2504	0.3129					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.*208C>T	20.37:g.43356156C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N4|E1P612|Q6PEG3	RNA	SNP	-	NULL	ENST00000372868.2	37	NULL	CCDS13336.1	20																																																																																			WISP2	-	-	ENSG00000064205		0.547	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000127824.1	42	0.00	0	C	NM_003881		43356156	43356156	+1	no_errors	ENST00000471629	ensembl	human	known	69_37n	rna	49	15.25	9	SNP	0.000	T
ZC3H12D	340152	genome.wustl.edu	37	6	149782908	149782908	+	Intron	SNP	A	A	G	rs376757	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr6:149782908A>G	ENST00000409806.3	-	3	764				ZC3H12D_ENST00000409948.1_Intron|ZC3H12D_ENST00000542614.1_Intron|ZC3H12D_ENST00000389942.5_Intron|ZC3H12D_ENST00000416573.2_Intron			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D						negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		tatcgatgttagaagtgcACC	0.438													A|||	1494	0.298323	0.4879	0.2478	5008	,	,		22166	0.1141		0.3509	False		,,,				2504	0.2137					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.445+58T>C	6.37:g.149782908A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	RNA	SNP	-	NULL	ENST00000409806.3	37	NULL		6																																																																																			ZC3H12D	-	-	ENSG00000178199		0.438	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	ZC3H12D	HGNC	protein_coding	OTTHUMT00000286400.2	40	0.00	0	A	NM_207360		149782908	149782908	-1	no_errors	ENST00000462655	ensembl	human	known	69_37n	rna	54	10.00	6	SNP	0.000	G
ZNF37BP	100129482	genome.wustl.edu	37	10	43046109	43046109	+	RNA	SNP	T	T	G	rs11239669	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr10:43046109T>G	ENST00000452075.3	-	0	709					NR_026777.1				zinc finger protein 37B, pseudogene																		TGCCTAAAAATGTCCACCTCC	0.433													G|||	759	0.151558	0.2156	0.1816	5008	,	,		16706	0.1677		0.0934	False		,,,				2504	0.0869					dbGAP											0																																										-	-	-			0			AK026980		10q11.21	2012-10-05	2010-08-03	2010-08-03	ENSG00000234420	ENSG00000234420			13103	pseudogene	pseudogene			"""zinc finger protein 37b (KOX 21)"", ""zinc finger protein 37B"", ""zinc finger protein 37B (pseudogene)"""	ZNF37B		2014798, 8464732	Standard	NR_026777		Approved	KOX21, FLJ23327	uc001jab.4		OTTHUMG00000018011		10.37:g.43046109T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000452075.3	37	NULL		10																																																																																			ZNF37BP	-	-	ENSG00000234420		0.433	ZNF37BP-002	KNOWN	basic	processed_transcript	ZNF37BP	HGNC	pseudogene	OTTHUMT00000047675.2	8	0.00	0	T	NR_026777		43046109	43046109	-1	no_errors	ENST00000473592	ensembl	human	known	69_37n	rna	2	71.43	5	SNP	0.001	G
ZNF48	197407	genome.wustl.edu	37	16	30409062	30409062	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr16:30409062G>A	ENST00000320159.2	+	2	867	c.491G>A	c.(490-492)gGg>gAg	p.G164E	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						ACTCATAGTGGGGAGAAGCCC	0.612																																						dbGAP											0													44.0	54.0	51.0					16																	30409062		2197	4300	6497	-	-	-	SO:0001583	missense	0			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.491G>A	16.37:g.30409062G>A	ENSP00000324056:p.Gly164Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G164E	ENST00000320159.2	37	c.491	CCDS10679.1	16	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235674	0.58886	.	.	ENSG00000180035	ENST00000495929;ENST00000320159	T	0.19806	2.12	4.81	4.81	0.61882	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40818	N	0.001018	T	0.37544	0.1007	L	0.56340	1.77	0.35032	D	0.758916	D	0.59357	0.985	P	0.58620	0.842	T	0.49082	-0.8976	10	0.72032	D	0.01	-6.9165	15.763	0.78101	0.0:0.0:1.0:0.0	.	164	Q96MX3	ZNF48_HUMAN	E	289;164	ENSP00000324056:G164E	ENSP00000324056:G164E	G	+	2	0	ZNF48	30316563	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.314000	0.59166	2.637000	0.89404	0.563000	0.77884	GGG	ZNF48	-	pfscan_Znf_C2H2	ENSG00000180035		0.612	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF48	HGNC	protein_coding	OTTHUMT00000255549.2	37	0.00	0	G	NM_152652		30409062	30409062	+1	no_errors	ENST00000320159	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.958	A
ZNF487	642819	genome.wustl.edu	37	10	43978087	43978087	+	Silent	SNP	A	A	G	rs3750890	byFrequency	TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr10:43978087A>G	ENST00000431662.1	+	5	1002	c.1002A>G	c.(1000-1002)agA>agG	p.R334R	ZNF487_ENST00000437590.2_3'UTR			B1APH4	ZN487_HUMAN	zinc finger protein 487	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TACATCAGAGAATACATACTG	0.413													A|||	2356	0.470447	0.1029	0.6297	5008	,	,		20687	0.6974		0.5855	False		,,,				2504	0.502					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					10q11.21	2013-06-03	2013-03-06	2013-03-06	ENSG00000243660	ENSG00000243660			23488	other	unknown			"""KRAB domain only 1"", ""zinc finger protein 487, pseudogene"""	KRBO1, ZNF487P			Standard	NR_026693		Approved			B1APH4	OTTHUMG00000185507	ENST00000431662.1:c.1002A>G	10.37:g.43978087A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1APH5|B7Z7S5	Silent	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R334	ENST00000431662.1	37	c.1002		10																																																																																			ZNF487P	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000243660		0.413	ZNF487-201	KNOWN	basic|appris_principal	protein_coding	ZNF487P	HGNC	protein_coding		14	0.00	0	A	XM_926224		43978087	43978087	+1	no_errors	ENST00000431662	ensembl	human	known	69_37n	silent	19	20.83	5	SNP	0.998	G
ZNF518B	85460	genome.wustl.edu	37	4	10446457	10446457	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr4:10446457C>G	ENST00000326756.3	-	3	1934	c.1496G>C	c.(1495-1497)gGa>gCa	p.G499A		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	499					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G499V(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TGATGCAGCTCCAAGACTACG	0.373																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											91.0	95.0	94.0					4																	10446457		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1496G>C	4.37:g.10446457C>G	ENSP00000317614:p.Gly499Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LN8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G499A	ENST00000326756.3	37	c.1496	CCDS33960.1	4	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658682	0.47467	.	.	ENSG00000178163	ENST00000326756	T	0.01918	4.56	5.43	3.51	0.40186	.	0.681976	0.13735	N	0.366413	T	0.01905	0.0060	L	0.36672	1.1	0.09310	N	1	B	0.24721	0.11	B	0.20577	0.03	T	0.46400	-0.9194	10	0.22706	T	0.39	-13.7159	2.9949	0.05995	0.1987:0.5358:0.1671:0.0983	.	499	Q9C0D4	Z518B_HUMAN	A	499	ENSP00000317614:G499A	ENSP00000317614:G499A	G	-	2	0	ZNF518B	10055555	0.000000	0.05858	0.020000	0.16555	0.715000	0.41141	0.574000	0.23714	1.478000	0.48253	0.655000	0.94253	GGA	ZNF518B	-	NULL	ENSG00000178163		0.373	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	26	0.00	0	C	NM_053042		10446457	10446457	-1	no_errors	ENST00000326756	ensembl	human	known	69_37n	missense	17	15.00	3	SNP	0.001	G
ZNF574	64763	genome.wustl.edu	37	19	42584206	42584206	+	Missense_Mutation	SNP	G	G	T	rs151136059		TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr19:42584206G>T	ENST00000600245.1	+	2	2103	c.1448G>T	c.(1447-1449)cGg>cTg	p.R483L	ZNF574_ENST00000222339.7_Missense_Mutation_p.R573L|ZNF574_ENST00000359044.4_Missense_Mutation_p.R483L|CTB-59C6.3_ENST00000594531.1_RNA			Q6ZN55	ZN574_HUMAN	zinc finger protein 574	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20		Prostate(69;0.059)				CAGCTGACCCGGCACCAACGT	0.597																																						dbGAP											0													74.0	82.0	79.0					19																	42584206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074788	CCDS12596.1	19q13.2	2013-09-20			ENSG00000105732	ENSG00000105732		"""Zinc fingers, C2H2-type"""	26166	protein-coding gene	gene with protein product						12477932	Standard	NM_022752		Approved	FLJ22059	uc002osm.4	Q6ZN55	OTTHUMG00000182751	ENST00000600245.1:c.1448G>T	19.37:g.42584206G>T	ENSP00000469029:p.Arg483Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPE0|Q6ZN10|Q7L5Z5|Q8NCE3|Q9H6N0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R573L	ENST00000600245.1	37	c.1718	CCDS12596.1	19	.	.	.	.	.	.	.	.	.	.	g	15.76	2.927443	0.52759	.	.	ENSG00000105732	ENST00000222339;ENST00000359044;ENST00000535775	T;T	0.28454	1.61;1.61	4.66	3.63	0.41609	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.071347	0.56097	D	0.000025	T	0.33702	0.0872	L	0.37466	1.105	0.36995	D	0.894981	P;D	0.53312	0.8;0.959	P;P	0.53954	0.477;0.738	T	0.21895	-1.0232	10	0.25106	T	0.35	-18.8754	11.7429	0.51803	0.0873:0.0:0.9127:0.0	.	483;572	Q6ZN55;Q6ZN55-2	ZN574_HUMAN;.	L	573;483;90	ENSP00000222339:R573L;ENSP00000351939:R483L	ENSP00000222339:R573L	R	+	2	0	ZNF574	47276046	0.945000	0.32115	1.000000	0.80357	0.926000	0.56050	3.224000	0.51238	1.207000	0.43291	0.550000	0.68814	CGG	ZNF574	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000105732		0.597	ZNF574-002	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ZNF574	HGNC	protein_coding	OTTHUMT00000463458.1	24	0.00	0	G	NM_022752		42584206	42584206	+1	no_errors	ENST00000222339	ensembl	human	known	69_37n	missense	26	12.90	4	SNP	1.000	T
ZNF776	284309	genome.wustl.edu	37	19	58265037	58265037	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A3BB-01A-21D-A19Y-09	TCGA-AC-A3BB-10A-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	69990efb-cbdc-4364-b4c0-53a3a921b3ec	40c00f60-3ff1-4cb7-a1ed-657bab88f84d	g.chr19:58265037T>A	ENST00000317178.5	+	3	802	c.539T>A	c.(538-540)cTc>cAc	p.L180H		NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		TTGAGATTACTCCAACAAGAG	0.403																																						dbGAP											0													84.0	80.0	81.0					19																	58265037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.539T>A	19.37:g.58265037T>A	ENSP00000321812:p.Leu180His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZS36|Q8N968	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L180H	ENST00000317178.5	37	c.539	CCDS12962.2	19	.	.	.	.	.	.	.	.	.	.	T	12.38	1.919314	0.33908	.	.	ENSG00000152443	ENST00000317178	T	0.09723	2.95	2.07	2.07	0.26955	.	.	.	.	.	T	0.15478	0.0373	L	0.48986	1.54	0.09310	N	0.999998	B;D	0.65815	0.004;0.995	B;P	0.52823	0.007;0.71	T	0.11446	-1.0587	9	0.52906	T	0.07	.	5.2098	0.15310	0.0:0.1631:0.0:0.8369	.	180;180	Q68DI1;B4DSC6	ZN776_HUMAN;.	H	180	ENSP00000321812:L180H	ENSP00000321812:L180H	L	+	2	0	ZNF776	62956849	0.004000	0.15560	0.014000	0.15608	0.639000	0.38242	1.507000	0.35758	0.946000	0.37632	0.254000	0.18369	CTC	ZNF776	-	NULL	ENSG00000152443		0.403	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF776	HGNC	protein_coding	OTTHUMT00000346722.2	27	0.00	0	T	NM_173632		58265037	58265037	+1	no_errors	ENST00000317178	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.001	A
