#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48511181	48511181	+	Silent	SNP	T	T	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr7:48511181T>C	ENST00000435803.1	+	45	12984	c.12960T>C	c.(12958-12960)gaT>gaC	p.D4320D	ABCA13_ENST00000544596.1_Silent_p.D50D	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4320					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AATTCCAGGATTCATGTGGCT	0.348																																						dbGAP											0													64.0	56.0	59.0					7																	48511181		1822	4068	5890	-	-	-	SO:0001819	synonymous_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12960T>C	7.37:g.48511181T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F586L	ENST00000435803.1	37	c.1756	CCDS47584.1	7																																																																																			ABCA13	-	NULL	ENSG00000179869		0.348	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	51	0.00	0	T	NM_152701		48511181	48511181	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453246	ensembl	human	known	69_37n	missense	54	19.40	13	SNP	0.877	C
ABCF1	23	genome.wustl.edu	37	6	30553921	30553921	+	Missense_Mutation	SNP	C	C	T	rs370684998		TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr6:30553921C>T	ENST00000326195.8	+	18	1836	c.1724C>T	c.(1723-1725)aCg>aTg	p.T575M	ABCF1_ENST00000396515.4_Intron|ABCF1_ENST00000376545.3_Missense_Mutation_p.T537M|MIR877_ENST00000401282.1_RNA	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	575					inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						GAAAAACAAACGAAGGAAGCC	0.542																																						dbGAP											0													42.0	47.0	45.0					6																	30553921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.1724C>T	6.37:g.30553921C>T	ENSP00000313603:p.Thr575Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T575M	ENST00000326195.8	37	c.1724	CCDS34380.1	6	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953735	0.53293	.	.	ENSG00000204574	ENST00000326195;ENST00000376545	T;T	0.55588	0.51;0.87	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.35278	0.0926	L	0.46157	1.445	0.80722	D	1	P;P	0.35628	0.513;0.513	B;B	0.34038	0.174;0.174	T	0.44636	-0.9315	10	0.56958	D	0.05	-6.4327	16.3085	0.82859	0.0:1.0:0.0:0.0	.	537;575	Q2L6I2;Q8NE71	.;ABCF1_HUMAN	M	575;537	ENSP00000313603:T575M;ENSP00000365728:T537M	ENSP00000313603:T575M	T	+	2	0	ABCF1	30661900	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.342000	0.72982	2.385000	0.81259	0.555000	0.69702	ACG	ABCF1	-	NULL	ENSG00000204574		0.542	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABCF1	HGNC	protein_coding	OTTHUMT00000076137.3	32	0.00	0	C			30553921	30553921	+1	no_errors	ENST00000326195	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	T
ABL1	25	genome.wustl.edu	37	9	133589825	133589825	+	IGR	SNP	A	A	G			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr9:133589825A>G								EXOSC2 (9577 upstream) : ABL1 (120627 downstream)																							CCACACTGCAATGTTTTTGTG	0.448																																						dbGAP											0													197.0	181.0	187.0					9																	133589825		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.133589825A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_F-actin_binding,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.N40S		37	c.119		9	.	.	.	.	.	.	.	.	.	.	A	15.15	2.747862	0.49257	.	.	ENSG00000097007	ENST00000372348;ENST00000393293	T	0.78126	-1.15	5.71	5.71	0.89125	.	0.233302	0.42294	D	0.000738	T	0.80969	0.4726	N	0.25647	0.755	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.82192	-0.0579	10	0.49607	T	0.09	.	15.1681	0.72846	1.0:0.0:0.0:0.0	.	58	Q59FK4	.	S	40	ENSP00000361423:N40S	ENSP00000361423:N40S	N	+	2	0	ABL1	132579646	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.421000	0.90259	2.171000	0.68590	0.533000	0.62120	AAT	ABL1	-	NULL	ENSG00000097007	0	0.448					ABL1	HGNC			122	0.00	0	A			133589825	133589825	+1	no_errors	ENST00000372348	ensembl	human	known	69_37n	missense	86	31.75	40	SNP	1.000	G
ACSS1	84532	genome.wustl.edu	37	20	24990121	24990121	+	Intron	SNP	G	G	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr20:24990121G>T	ENST00000323482.4	-	13	1851				ACSS1_ENST00000484396.1_5'UTR|ACSS1_ENST00000432802.2_Intron|ACSS1_ENST00000537502.1_Intron|ACSS1_ENST00000542618.1_Intron	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1						acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AAATCCGAAGGGCTTTTGAAT	0.443																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.1772-97C>A	20.37:g.24990121G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	RNA	SNP	-	NULL	ENST00000323482.4	37	NULL	CCDS13167.1	20																																																																																			ACSS1	-	-	ENSG00000154930		0.443	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS1	HGNC	protein_coding	OTTHUMT00000078386.2	15	0.00	0	G	NM_032501		24990121	24990121	-1	no_errors	ENST00000484396	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.016	T
CTSF	8722	genome.wustl.edu	37	11	66328130	66328130	+	IGR	SNP	G	G	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr11:66328130G>T	ENST00000310325.5	-	0	2035				ACTN3_ENST00000513398.1_RNA|ACTN3_ENST00000502692.1_RNA|CTD-3074O7.2_ENST00000504911.1_lincRNA	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						TCCAGGGTGAGATCCAGAAGA	0.597																																						dbGAP											0													110.0	119.0	116.0					11																	66328130		2175	4274	6449	-	-	-	SO:0001628	intergenic_variant	0			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090		11.37:g.66328130G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	NULL	p.E631D	ENST00000310325.5	37	c.1893	CCDS8144.1	11																																																																																			ACTN3	-	NULL	ENSG00000248746		0.597	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN3	HGNC	protein_coding	OTTHUMT00000393047.1	53	0.00	0	G	NM_003793		66328130	66328130	+1	pseudogene	ENST00000502692	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	T
AKAP9	10142	genome.wustl.edu	37	7	91687351	91687351	+	Intron	SNP	A	A	G	rs1544377	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr7:91687351A>G	ENST00000359028.2	+	24	5862				AKAP9_ENST00000358100.2_Intron|AKAP9_ENST00000491695.1_3'UTR|AKAP9_ENST00000356239.3_Intron			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATTTTATAACATTTATTTGAT	0.254			T	BRAF	papillary thyroid								G|||	1803	0.360024	0.4569	0.3559	5008	,	,		15146	0.1617		0.3857	False		,,,				2504	0.41					dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0																																										-	-	-	SO:0001627	intron_variant	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.5638-3223A>G	7.37:g.91687351A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	RNA	SNP	-	NULL	ENST00000359028.2	37	NULL		7																																																																																			AKAP9	-	-	ENSG00000127914		0.254	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		34	0.00	0	A	NM_005751		91687351	91687351	+1	no_errors	ENST00000491695	ensembl	human	known	69_37n	rna	46	11.54	6	SNP	0.000	G
APMAP	57136	genome.wustl.edu	37	20	24959420	24959420	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr20:24959420G>A	ENST00000217456.2	-	3	601	c.311C>T	c.(310-312)tCc>tTc	p.S104F	APMAP_ENST00000447138.1_Missense_Mutation_p.S104F	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	104					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										ATGTGCTATGGACTCCGGTCC	0.547																																						dbGAP											0													71.0	73.0	72.0					20																	24959420		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.311C>T	20.37:g.24959420G>A	ENSP00000217456:p.Ser104Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	pfam_Strictosidine_synth_cons-reg,pfam_SGL	p.S104F	ENST00000217456.2	37	c.311	CCDS13166.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.244079|4.244079	0.79912|0.79912	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000451442|ENST00000217456;ENST00000447138	.|T;T	.|0.33865	.|1.39;1.39	5.08|5.08	5.08|5.08	0.68730|0.68730	.|Six-bladed beta-propeller, TolB-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70552|0.70552	0.3237|0.3237	H|H	0.94658|0.94658	3.565|3.565	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;0.986;0.996	T|T	0.79492|0.79492	-0.1781|-0.1781	5|10	.|0.87932	.|D	.|0	-28.1284|-28.1284	16.0204|16.0204	0.80478|0.80478	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|104;88;104	.|Q9HDC9-2;A2A2F9;Q9HDC9	.|.;.;APMAP_HUMAN	S|F	89|104	.|ENSP00000217456:S104F;ENSP00000415373:S104F	.|ENSP00000217456:S104F	P|S	-|-	1|2	0|0	C20orf3|C20orf3	24907420|24907420	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	8.876000|8.876000	0.92379|0.92379	2.642000|2.642000	0.89623|0.89623	0.561000|0.561000	0.74099|0.74099	CCA|TCC	APMAP	-	NULL	ENSG00000101474		0.547	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APMAP	HGNC	protein_coding	OTTHUMT00000078380.2	26	0.00	0	G	NM_020531		24959420	24959420	-1	no_errors	ENST00000217456	ensembl	human	known	69_37n	missense	17	41.94	13	SNP	1.000	A
BANP	54971	genome.wustl.edu	37	16	88014554	88014554	+	Intron	SNP	G	G	A	rs8052770	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr16:88014554G>A	ENST00000393207.1	+	3	291				BANP_ENST00000286122.7_Intron|BANP_ENST00000355022.4_Intron|BANP_ENST00000393208.2_Intron|BANP_ENST00000355163.5_Intron|BANP_ENST00000479780.2_Intron|BANP_ENST00000538234.1_Intron	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein						cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		CAACCTTAAGGTGTCAGCACT	0.323													G|||	1938	0.386981	0.5855	0.4092	5008	,	,		19674	0.4821		0.1879	False		,,,				2504	0.2096					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.71-88G>A	16.37:g.88014554G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	RNA	SNP	-	NULL	ENST00000393207.1	37	NULL	CCDS54054.1	16																																																																																			BANP	-	-	ENSG00000172530		0.323	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	46	0.00	0	G	NM_017869		88014554	88014554	+1	no_errors	ENST00000474563	ensembl	human	putative	69_37n	rna	42	10.64	5	SNP	0.030	A
BAZ1A	11177	genome.wustl.edu	37	14	35240799	35240799	+	Silent	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr14:35240799C>T	ENST00000382422.2	-	20	3546	c.3219G>A	c.(3217-3219)gtG>gtA	p.V1073V	BAZ1A_ENST00000358716.4_Silent_p.V1041V|BAZ1A_ENST00000360310.1_Silent_p.V1073V			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1073					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		CCACACTGCTCACTGATTGTG	0.378																																						dbGAP											0													197.0	188.0	191.0					14																	35240799		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.3219G>A	14.37:g.35240799C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	NULL	p.E23K	ENST00000382422.2	37	c.67	CCDS9651.1	14																																																																																			BAZ1A	-	NULL	ENSG00000198604		0.378	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1A	HGNC	protein_coding	OTTHUMT00000276646.1	48	0.00	0	C			35240799	35240799	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000554865	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
BLMH	642	genome.wustl.edu	37	17	28598289	28598289	+	Splice_Site	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr17:28598289C>T	ENST00000261714.6	-	10	1320	c.1146G>A	c.(1144-1146)aaG>aaA	p.K382K	BLMH_ENST00000394819.3_Splice_Site_p.K295K|BLMH_ENST00000582669.1_5'Flank	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	382					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	AGGGTCATACCTTCTCTGAGA	0.453																																					Pancreas(127;628 1772 12912 33293 36203)	dbGAP											0													113.0	103.0	106.0					17																	28598289		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.1146+1G>A	17.37:g.28598289C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R796|Q53F86|Q9UER9	Silent	SNP	pfam_Peptidase_C1B,pirsf_Peptidase_C1B	p.K382	ENST00000261714.6	37	c.1146	CCDS32604.1	17																																																																																			BLMH	-	pfam_Peptidase_C1B,pirsf_Peptidase_C1B	ENSG00000108578		0.453	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLMH	HGNC	protein_coding	OTTHUMT00000447940.1	41	0.00	0	C	NM_000386	Silent	28598289	28598289	-1	no_errors	ENST00000261714	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	1.000	T
C16orf82	162083	genome.wustl.edu	37	16	27080290	27080290	+	lincRNA	SNP	G	G	A	rs559401032		TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr16:27080290G>A	ENST00000505035.1	+	0	2263				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		GCACCGTCTCGGTGGATGGGA	0.567																																						dbGAP											0																																										-	-	-			0			BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27080290G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGC2|Q8NEF0	RNA	SNP	-	NULL	ENST00000505035.1	37	NULL		16																																																																																			C16orf82	-	-	ENSG00000234186		0.567	C16orf82-001	KNOWN	basic	lincRNA	C16orf82	HGNC	lincRNA	OTTHUMT00000366634.1	29	0.00	0	G	NM_001145545		27080290	27080290	+1	no_errors	ENST00000418886	ensembl	human	known	69_37n	rna	20	25.93	7	SNP	0.000	A
C20orf203	284805	genome.wustl.edu	37	20	31238627	31238627	+	lincRNA	SNP	C	C	T	rs7272020	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr20:31238627C>T	ENST00000608990.1	-	0	764							Q8NBC4	CT203_HUMAN	chromosome 20 open reading frame 203							cytoplasm (GO:0005737)											TCCTCCTTCCCGCCCCACCGC	0.602													C|||	610	0.121805	0.0484	0.147	5008	,	,		11617	0.0		0.2714	False		,,,				2504	0.1748					dbGAP											0																																										-	-	-			0			AK091025		20q11.21	2013-12-06			ENSG00000198547	ENSG00000198547			26592	protein-coding gene	gene with protein product						20376170	Standard	NM_182584		Approved	FLJ33706	uc021wbx.1	Q8NBC4	OTTHUMG00000032224		20.37:g.31238627C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B8JHY2	RNA	SNP	-	NULL	ENST00000608990.1	37	NULL		20																																																																																			C20orf203	-	-	ENSG00000198547		0.602	C20orf203-001	KNOWN	basic	lincRNA	C20orf203	HGNC	lincRNA	OTTHUMT00000078641.3	37	0.00	0	C	NM_182584		31238627	31238627	-1	no_errors	ENST00000360785	ensembl	human	known	69_37n	rna	38	13.64	6	SNP	0.000	T
CALCA	796	genome.wustl.edu	37	11	14992711	14992711	+	Silent	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr11:14992711G>A	ENST00000486207.1	-	1	36	c.28C>T	c.(28-30)Ctg>Ttg	p.L10L	CALCA_ENST00000396372.2_Silent_p.L10L|CALCA_ENST00000361010.3_Silent_p.L10L|CALCA_ENST00000359642.3_Silent_p.L10L|CALCA_ENST00000331587.4_Silent_p.L10L|CALCB_ENST00000523376.1_Intron			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	10					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						CTGAGAGCCAGGAAGGGGGAG	0.532																																						dbGAP											0													98.0	89.0	92.0					11																	14992711		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.28C>T	11.37:g.14992711G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q93048|Q9UCP0	Silent	SNP	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Procalcitonin_A-typ	p.L10	ENST00000486207.1	37	c.28	CCDS31432.1	11																																																																																			CALCA	-	pfam_Procalcitonin/adrenomedullin	ENSG00000110680		0.532	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALCA	HGNC	protein_coding	OTTHUMT00000357068.1	57	0.00	0	G	NM_001741		14992711	14992711	-1	no_errors	ENST00000331587	ensembl	human	known	69_37n	silent	46	14.81	8	SNP	0.994	A
CCDC30	728621	genome.wustl.edu	37	1	42948585	42948585	+	Intron	SNP	C	C	A	rs6656344	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:42948585C>A	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						CACTGAGAAACAAGTCTTTAA	0.368													A|||	2405	0.480232	0.5219	0.2983	5008	,	,		19920	0.5962		0.3519	False		,,,				2504	0.5654					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+98C>A	1.37:g.42948585C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14F06|Q5VVM5	RNA	SNP	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			CCDC30	-	-	ENSG00000186409		0.368	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding		14	0.00	0	C	NM_025030		42948585	42948585	+1	no_errors	ENST00000475614	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.020	A
CCDC37	348807	genome.wustl.edu	37	3	126137601	126137601	+	Missense_Mutation	SNP	G	G	A	rs113086673		TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr3:126137601G>A	ENST00000352312.1	+	7	733	c.634G>A	c.(634-636)Gtg>Atg	p.V212M	CCDC37_ENST00000393425.1_Missense_Mutation_p.V213M|CCDC37_ENST00000505024.1_Missense_Mutation_p.V213M	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	212										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		CTGCAGCTCCGTGCAGGCCAT	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		13363	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													33.0	37.0	35.0					3																	126137601		2196	4298	6494	-	-	-	SO:0001583	missense	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.634G>A	3.37:g.126137601G>A	ENSP00000344749:p.Val212Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	superfamily_SuperAg_toxin_C_Staph/Strep	p.V213M	ENST00000352312.1	37	c.637	CCDS3037.1	3	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090838	0.36855	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.16457	2.34;2.34;2.34	5.09	2.32	0.28847	.	0.123877	0.53938	N	0.000048	T	0.33381	0.0861	M	0.70595	2.14	0.49687	D	0.999812	D;D	0.89917	1.0;1.0	D;D	0.79784	0.992;0.993	T	0.02596	-1.1136	10	0.31617	T	0.26	-30.2007	6.9567	0.24576	0.1637:0.1433:0.693:0.0	.	213;212	Q494V2-2;Q494V2	.;CCD37_HUMAN	M	212;213;213	ENSP00000344749:V212M;ENSP00000377076:V213M;ENSP00000423046:V213M	ENSP00000344749:V212M	V	+	1	0	CCDC37	127620291	0.999000	0.42202	0.476000	0.27291	0.028000	0.11728	2.880000	0.48530	0.192000	0.20272	-0.333000	0.08304	GTG	CCDC37	-	NULL	ENSG00000163885		0.652	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	112	0.00	0	G	NM_182628		126137601	126137601	+1	no_errors	ENST00000393425	ensembl	human	known	69_37n	missense	56	30.86	25	SNP	0.959	A
COX11	1353	genome.wustl.edu	37	17	53038654	53038654	+	3'UTR	SNP	A	A	C	rs1802212	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr17:53038654A>C	ENST00000299335.3	-	0	2409				TOM1L1_ENST00000540336.1_3'UTR|TOM1L1_ENST00000445275.2_3'UTR|TOM1L1_ENST00000348161.4_3'UTR|TOM1L1_ENST00000575882.1_3'UTR|TOM1L1_ENST00000572158.1_3'UTR|TOM1L1_ENST00000536554.1_3'UTR|COX11_ENST00000573912.1_5'Flank	NM_004375.3	NP_004366.1	Q9Y6N1	COX11_HUMAN	cytochrome c oxidase assembly homolog 11 (yeast)						hydrogen ion transmembrane transport (GO:1902600)|negative regulation of glucokinase activity (GO:0033132)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|prostate(1)	9						TAAAACGTAGACTCTGTGCAG	0.398													A|||	759	0.151558	0.0605	0.1585	5008	,	,		20632	0.129		0.2714	False		,,,				2504	0.1697					dbGAP											0													93.0	76.0	81.0					17																	53038654		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF044321	CCDS11583.1, CCDS58579.1	17q22	2012-10-15	2012-10-15			ENSG00000166260		"""Mitochondrial respiratory chain complex assembly factors"""	2261	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit 11"", ""cytochrome c oxidase assembly protein COX11"""	603648	"""COX11 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX11 cytochrome c oxidase assembly homolog (yeast)"""			9878253	Standard	NM_004375		Approved	COX11P	uc010wng.1	Q9Y6N1		ENST00000299335.3:c.*1440T>G	17.37:g.53038654A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTY5|I3L220|Q6FHB7|Q9BRX0|Q9UME8	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_assmbl_CtaG,superfamily_CtaG/Cox11_dom	p.V223G	ENST00000299335.3	37	c.668	CCDS11583.1	17																																																																																			COX11	-	NULL	ENSG00000166260		0.398	COX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX11	HGNC	protein_coding	OTTHUMT00000439182.1	11	0.00	0	A	NM_004375		53038654	53038654	-1	no_errors	ENST00000572558	ensembl	human	known	69_37n	missense	13	48.00	12	SNP	0.018	C
CROCC	9696	genome.wustl.edu	37	1	17249172	17249172	+	Silent	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:17249172C>T	ENST00000375541.5	+	2	144	c.75C>T	c.(73-75)agC>agT	p.S25S		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGGAGAGCAGCGTCCTGTGCC	0.647																																						dbGAP											0													86.0	89.0	88.0					1																	17249172		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.75C>T	1.37:g.17249172C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.S25	ENST00000375541.5	37	c.75	CCDS30616.1	1																																																																																			CROCC	-	NULL	ENSG00000058453		0.647	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	148	0.00	0	C	NM_014675		17249172	17249172	+1	no_errors	ENST00000375541	ensembl	human	known	69_37n	silent	49	27.54	19	SNP	0.031	T
DNAH14	127602	genome.wustl.edu	37	1	225284921	225284921	+	Intron	SNP	T	T	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:225284921T>C	ENST00000445597.2	+	16	3051				DNAH14_ENST00000430092.1_Silent_p.F1225F|DNAH14_ENST00000439375.2_Silent_p.F1225F			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AACCAGTCTTTCATTCTTCAG	0.313																																						dbGAP											0													129.0	108.0	114.0					1																	225284921		692	1590	2282	-	-	-	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3051+11430T>C	1.37:g.225284921T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.F1225	ENST00000445597.2	37	c.3675		1																																																																																			DNAH14	-	pfam_Dynein_heavy_dom-2	ENSG00000185842		0.313	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	32	0.00	0	T	XM_059166		225284921	225284921	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	silent	48	39.51	32	SNP	0.628	C
ECRP	643332	genome.wustl.edu	37	14	21387994	21387994	+	lincRNA	SNP	A	A	G	rs10459477	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr14:21387994A>G	ENST00000555642.1	-	0	344				RP11-84C10.2_ENST00000258817.2_lincRNA|RP11-219E7.4_ENST00000553534.1_lincRNA																							TGGAAAAACCAAAATACTTTT	0.408													-|||	2789	0.556909	0.2602	0.7882	5008	,	,		21704	0.5099		0.7058	False		,,,				2504	0.6892					dbGAP											0																																										-	-	-			0																															14.37:g.21387994A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000555642.1	37	NULL		14																																																																																			RP11-84C10.2	-	-	ENSG00000136315		0.408	RP11-84C10.3-001	KNOWN	basic	lincRNA	ECRP	Clone_based_vega_gene	lincRNA	OTTHUMT00000411340.1	63	0.00	0	A			21387994	21387994	+1	no_errors	ENST00000258817	ensembl	human	known	69_37n	rna	56	12.50	8	SNP	0.000	G
FAM184B	27146	genome.wustl.edu	37	4	17694943	17694943	+	Silent	SNP	A	A	G	rs3733579	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr4:17694943A>G	ENST00000265018.3	-	6	1682	c.1470T>C	c.(1468-1470)ctT>ctC	p.L490L		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	490										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GAGAATTCTGAAGCTTCACAT	0.463													G|||	3300	0.658946	0.5234	0.7104	5008	,	,		17385	0.8948		0.6312	False		,,,				2504	0.591					dbGAP											0													152.0	133.0	139.0					4																	17694943		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.1470T>C	4.37:g.17694943A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L490	ENST00000265018.3	37	c.1470	CCDS47033.1	4																																																																																			FAM184B	-	NULL	ENSG00000047662		0.463	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184B	HGNC	protein_coding	OTTHUMT00000360137.1	72	0.00	0	A	NM_015688		17694943	17694943	-1	no_errors	ENST00000265018	ensembl	human	known	69_37n	silent	62	10.14	7	SNP	0.839	G
FHAD1	114827	genome.wustl.edu	37	1	15656011	15656011	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:15656011G>A	ENST00000375998.4	+	13	1880	c.1880G>A	c.(1879-1881)gGg>gAg	p.G627E	FHAD1_ENST00000375999.3_Missense_Mutation_p.G627E|FHAD1_ENST00000471347.1_3'UTR|RP3-467K16.2_ENST00000428747.1_RNA|FHAD1_ENST00000401090.2_Missense_Mutation_p.G297E|FHAD1_ENST00000358897.4_Missense_Mutation_p.G627E|FHAD1_ENST00000417793.1_Missense_Mutation_p.G627E|FHAD1_ENST00000375995.3_Missense_Mutation_p.G232E			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	627										skin(1)|stomach(1)	2						CGGGACCTCGGGATCCTGCCC	0.582																																						dbGAP											0													19.0	24.0	23.0					1																	15656011		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1880G>A	1.37:g.15656011G>A	ENSP00000365166:p.Gly627Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.G627E	ENST00000375998.4	37	c.1880		1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894071	0.33442	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000375995;ENST00000401090	D;D;D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97	5.41	4.49	0.54785	.	0.208574	0.33309	N	0.005058	T	0.80929	0.4718	L	0.34521	1.04	0.26867	N	0.967832	P;D	0.53312	0.931;0.959	P;P	0.51615	0.476;0.675	T	0.70178	-0.4943	10	0.14656	T	0.56	-9.7654	9.3393	0.38069	0.1013:0.0:0.8987:0.0	.	627;318	B1AJZ9;B1AJZ8	FHAD1_HUMAN;.	E	627;627;627;627;232;297	ENSP00000351770:G627E;ENSP00000407615:G627E;ENSP00000365167:G627E;ENSP00000365166:G627E;ENSP00000365163:G232E;ENSP00000383868:G297E	ENSP00000351770:G627E	G	+	2	0	FHAD1	15528598	0.796000	0.28864	0.004000	0.12327	0.010000	0.07245	2.716000	0.47219	1.262000	0.44165	0.555000	0.69702	GGG	FHAD1	-	NULL	ENSG00000142621		0.582	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2	26	0.00	0	G	NM_052929		15656011	15656011	+1	no_errors	ENST00000375999	ensembl	human	known	69_37n	missense	6	45.45	5	SNP	0.017	A
FMN2	56776	genome.wustl.edu	37	1	240255915	240255915	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:240255915C>T	ENST00000319653.9	+	1	736	c.506C>T	c.(505-507)gCg>gTg	p.A169V		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	169					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCAGCAGGGGCGCAGGATGGA	0.637																																						dbGAP											0													59.0	61.0	60.0					1																	240255915		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.506C>T	1.37:g.240255915C>T	ENSP00000318884:p.Ala169Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.A169V	ENST00000319653.9	37	c.506	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	9.854	1.194471	0.22037	.	.	ENSG00000155816	ENST00000319653	T	0.31769	1.48	3.83	1.91	0.25777	.	0.208454	0.32473	N	0.006048	T	0.22859	0.0552	L	0.54323	1.7	0.80722	D	1	P	0.35011	0.48	B	0.21151	0.033	T	0.05354	-1.0890	10	0.52906	T	0.07	.	9.5823	0.39495	0.0:0.8255:0.0:0.1745	.	169	Q9NZ56	FMN2_HUMAN	V	169	ENSP00000318884:A169V	ENSP00000318884:A169V	A	+	2	0	FMN2	238322538	0.125000	0.22332	0.995000	0.50966	0.482000	0.33219	1.645000	0.37238	0.388000	0.25054	0.313000	0.20887	GCG	FMN2	-	NULL	ENSG00000155816		0.637	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	77	0.00	0	C	XM_371352		240255915	240255915	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	89	24.17	29	SNP	0.992	T
FOXA1	3169	genome.wustl.edu	37	14	38061463	38061463	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr14:38061463T>C	ENST00000250448.2	-	2	587	c.526A>G	c.(526-528)Atc>Gtc	p.I176V	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.I143V	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	176					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		ATGAGCGAGATGTACGAGTAG	0.657																																						dbGAP											0													96.0	88.0	91.0					14																	38061463		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.526A>G	14.37:g.38061463T>C	ENSP00000250448:p.Ile176Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.I176V	ENST00000250448.2	37	c.526	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	T	19.29	3.798359	0.70567	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95342	-3.68;-3.68	3.88	3.88	0.44766	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95310	0.8478	L	0.42686	1.345	0.58432	D	0.999999	D	0.67145	0.996	D	0.83275	0.996	D	0.95406	0.8494	10	0.87932	D	0	.	11.8192	0.52228	0.0:0.0:0.0:1.0	.	176	P55317	FOXA1_HUMAN	V	176;143	ENSP00000250448:I176V;ENSP00000440178:I143V	ENSP00000250448:I176V	I	-	1	0	FOXA1	37131214	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	7.800000	0.85949	1.626000	0.50381	0.413000	0.27773	ATC	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000129514		0.657	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	96	0.00	0	T			38061463	38061463	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	36	32.08	17	SNP	1.000	C
FRG1B	284802	genome.wustl.edu	37	20	29614296	29614297	+	5'UTR	INS	-	-	AGA	rs376619640		TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr20:29614296_29614297insAGA	ENST00000278882.3	+	0	289_290				FRG1B_ENST00000439954.2_5'UTR|FRG1B_ENST00000358464.4_5'UTR			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						aagagaaaaagagaagatgaag	0.292																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-91->AGA	20.37:g.29614300_29614302dupAGA		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	RNA	INS	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.292	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	36	0.00	0	-	NR_003579		29614296	29614297	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	33	13.16	5	INS	0.998:0.997	AGA
GAK	2580	genome.wustl.edu	37	4	882688	882688	+	Silent	SNP	C	C	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr4:882688C>A	ENST00000314167.4	-	11	1262	c.1152G>T	c.(1150-1152)cgG>cgT	p.R384R	GAK_ENST00000511163.1_Silent_p.R305R	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	384					cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		TGGTGAAGAGCCGCTCTGTCC	0.642																																						dbGAP											0													100.0	80.0	86.0					4																	882688		2199	4298	6497	-	-	-	SO:0001819	synonymous_variant	0			D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.1152G>T	4.37:g.882688C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U4P5|Q9BVY6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_N,superfamily_Kinase-like_dom,superfamily_DnaJ_N,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_DnaJ_N,pfscan_Prot_kinase_cat_dom,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_N	p.R384	ENST00000314167.4	37	c.1152	CCDS3340.1	4																																																																																			GAK	-	NULL	ENSG00000178950		0.642	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	HGNC	protein_coding	OTTHUMT00000239188.1	117	0.00	0	C	NM_005255		882688	882688	-1	no_errors	ENST00000314167	ensembl	human	known	69_37n	silent	51	47.96	47	SNP	0.958	A
GLP2R	9340	genome.wustl.edu	37	17	9769199	9769199	+	Intron	SNP	T	T	C	rs756223	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr17:9769199T>C	ENST00000262441.5	+	9	1569				GLP2R_ENST00000574745.1_Intron	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	gagcattccctttggtcacaa	0.418													C|||	1713	0.342053	0.612	0.2896	5008	,	,		21802	0.2927		0.1233	False		,,,				2504	0.2904					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1056+3792T>C	17.37:g.9769199T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAT3	Silent	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.P221	ENST00000262441.5	37	c.663	CCDS11150.1	17	640	0.29304029304029305	303	0.6158536585365854	90	0.24861878453038674	162	0.28321678321678323	85	0.11213720316622691	C	6.595	0.478230	0.12521	.	.	ENSG00000065325	ENST00000304773	.	.	.	2.02	-4.02	0.04034	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.38178	-0.9673	4	0.66056	D	0.02	.	4.5335	0.12017	0.1706:0.2265:0.0:0.603	rs756223	.	.	.	L	344	.	ENSP00000303605:F344L	F	+	1	0	GLP2R	9709924	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.805000	0.01737	-1.716000	0.01387	-0.166000	0.13349	TTT	GLP2R	-	NULL	ENSG00000065325		0.418	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	65	0.00	0	T			9769199	9769199	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458005	ensembl	human	putative	69_37n	silent	28	12.50	4	SNP	0.000	C
GREB1	9687	genome.wustl.edu	37	2	11758591	11758591	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr2:11758591C>T	ENST00000381486.2	+	22	3890	c.3590C>T	c.(3589-3591)aCg>aTg	p.T1197M	GREB1_ENST00000396123.1_Missense_Mutation_p.T195M|GREB1_ENST00000234142.5_Missense_Mutation_p.T1197M	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1197	Ser-rich.					integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CCCGGGCCGACGCCCCAGCCC	0.706																																					Ovarian(39;850 945 2785 23371 33093)	dbGAP											0													8.0	11.0	10.0					2																	11758591		2062	4150	6212	-	-	-	SO:0001583	missense	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3590C>T	2.37:g.11758591C>T	ENSP00000370896:p.Thr1197Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	NULL	p.T1197M	ENST00000381486.2	37	c.3590	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	C	4.944	0.175340	0.09391	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.23147	3.24;3.24;1.92	4.08	0.985	0.19779	.	4.471260	0.00357	N	0.000039	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	P	0.42123	0.771	B	0.31495	0.131	T	0.21415	-1.0246	10	0.46703	T	0.11	-43.5327	6.9861	0.24729	0.0:0.5942:0.1855:0.2203	.	1197	Q4ZG55	GREB1_HUMAN	M	1197;1197;195	ENSP00000370896:T1197M;ENSP00000234142:T1197M;ENSP00000379429:T195M	ENSP00000234142:T1197M	T	+	2	0	GREB1	11676042	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.330000	0.19715	0.211000	0.20683	-0.152000	0.13540	ACG	GREB1	-	NULL	ENSG00000196208		0.706	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	74	0.00	0	C	NM_014668		11758591	11758591	+1	no_errors	ENST00000234142	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	0.000	T
GTF3C2	2976	genome.wustl.edu	37	2	27558252	27558252	+	Intron	SNP	A	A	G	rs11684134	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr2:27558252A>G	ENST00000359541.2	-	10	2006				AC109828.1_ENST00000592265.1_RNA|AC109828.1_ENST00000589232.1_RNA|AC109828.1_ENST00000589853.1_RNA|AC109828.1_ENST00000585645.1_RNA|AC109828.1_ENST00000608473.1_RNA|AC109828.1_ENST00000585326.1_RNA|AC109828.1_ENST00000416453.2_RNA|AC109828.1_ENST00000590383.1_RNA|AC109828.1_ENST00000588707.1_RNA|AC109828.1_ENST00000587586.1_RNA|AC109828.1_ENST00000590754.1_RNA|GTF3C2_ENST00000264720.3_Intron			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa						5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGGGGAGATAAAAGGAAATG	0.498													A|||	2063	0.411941	0.4743	0.4813	5008	,	,		20005	0.2302		0.4175	False		,,,				2504	0.4601					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.1576+212T>C	2.37:g.27558252A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L15S	ENST00000359541.2	37	c.44	CCDS1749.1	2	802	0.36721611721611724	224	0.45528455284552843	154	0.425414364640884	106	0.1853146853146853	318	0.41952506596306066	A	4.910	0.169107	0.09339	.	.	ENSG00000115207	ENST00000454704	.	.	.	4.23	-7.46	0.01369	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.45175	-0.9279	3	.	.	.	.	2.7608	0.05306	0.1727:0.3901:0.309:0.1282	rs11684134;rs58554036;rs11684134	.	.	.	S	15	.	.	L	-	2	0	GTF3C2	27411756	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-1.954000	0.01525	-1.328000	0.02261	0.459000	0.35465	TTA	GTF3C2	-	NULL	ENSG00000115207		0.498	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C2	HGNC	protein_coding	OTTHUMT00000215028.2	25	0.00	0	A			27558252	27558252	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000454704	ensembl	human	putative	69_37n	missense	25	19.35	6	SNP	0.000	G
GVINP1	387751	genome.wustl.edu	37	11	6739551	6739551	+	RNA	SNP	T	T	C	rs11040984	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr11:6739551T>C	ENST00000526769.3	-	0	3653					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TCTCATTCTTTGGCCAGAAAT	0.413													T|||	831	0.165935	0.0802	0.3646	5008	,	,		24208	0.2331		0.1193	False		,,,				2504	0.1196					dbGAP											0																																										-	-	-			0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6739551T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.413	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	33	0.00	0	T	NR_003945		6739551	6739551	-1	no_errors	ENST00000526769	ensembl	human	known	69_37n	rna	24	14.29	4	SNP	0.000	C
HERC5	51191	genome.wustl.edu	37	4	89426971	89426971	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr4:89426971T>C	ENST00000264350.3	+	23	3170	c.3017T>C	c.(3016-3018)aTg>aCg	p.M1006T	HERC5_ENST00000508159.1_Missense_Mutation_p.M644T	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	1006	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TATTCTACAATGGAAACAGTT	0.403																																					Esophageal Squamous(39;887 1012 34045 50514)	dbGAP											0													56.0	54.0	55.0					4																	89426971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.3017T>C	4.37:g.89426971T>C	ENSP00000264350:p.Met1006Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTQ1|Q69G20	Missense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Haem_Oase-like_multi-hlx,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.M1006T	ENST00000264350.3	37	c.3017	CCDS3630.1	4	.	.	.	.	.	.	.	.	.	.	T	12.99	2.103543	0.37145	.	.	ENSG00000138646	ENST00000264350;ENST00000508159	T;T	0.56444	0.46;0.46	4.33	4.33	0.51752	HECT (4);	0.000000	0.49916	D	0.000135	T	0.60805	0.2297	M	0.75447	2.3	0.24871	N	0.99228	B	0.26577	0.153	B	0.41374	0.355	T	0.59037	-0.7529	10	0.49607	T	0.09	.	11.5084	0.50481	0.0:0.0:0.0:1.0	.	1006	Q9UII4	HERC5_HUMAN	T	1006;644	ENSP00000264350:M1006T;ENSP00000424129:M644T	ENSP00000264350:M1006T	M	+	2	0	HERC5	89645994	0.995000	0.38212	0.958000	0.39756	0.505000	0.33919	0.759000	0.26461	1.818000	0.53035	0.482000	0.46254	ATG	HERC5	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000138646		0.403	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC5	HGNC	protein_coding	OTTHUMT00000253554.2	36	0.00	0	T	NM_016323		89426971	89426971	+1	no_errors	ENST00000264350	ensembl	human	known	69_37n	missense	16	46.67	14	SNP	0.995	C
HMCN2	256158	genome.wustl.edu	37	9	133281691	133281691	+	3'UTR	SNP	C	C	T	rs11244201	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr9:133281691C>T	ENST00000277491.7	+	0	1272				HMCN2_ENST00000487727.2_Intron																							GGTCTTCCAACGTGGCCCTAT	0.572													C|||	2552	0.509585	0.2723	0.487	5008	,	,		17431	0.4891		0.7873	False		,,,				2504	0.5818					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0																														ENST00000277491.7:c.*50C>T	9.37:g.133281691C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000277491.7	37	NULL		9																																																																																			HMCN2	-	-	ENSG00000148357		0.572	AL354898.1-201	NOVEL	basic|appris_principal	protein_coding	HMCN2	HGNC	protein_coding		8	0.00	0	C			133281691	133281691	+1	no_errors	ENST00000480829	ensembl	human	known	69_37n	rna	8	57.89	11	SNP	0.002	T
MAML3	55534	genome.wustl.edu	37	4	140811096	140811096	+	Silent	SNP	C	C	T	rs79090010|rs561881989|rs58287721	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr4:140811096C>T	ENST00000509479.2	-	2	2350	c.1494G>A	c.(1492-1494)caG>caA	p.Q498Q	MAML3_ENST00000398940.1_Intron|MAML3_ENST00000327122.5_Silent_p.Q342Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.537													c|||	1260	0.251597	0.1415	0.2536	5008	,	,		15575	0.2321		0.341	False		,,,				2504	0.3272					dbGAP											0													13.0	20.0	18.0					4																	140811096		2114	4243	6357	-	-	-	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1494G>A	4.37:g.140811096C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q498	ENST00000509479.2	37	c.1494	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.537	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	47	0.00	0	C			140811096	140811096	-1	no_errors	ENST00000509479	ensembl	human	known	69_37n	silent	47	11.32	6	SNP	0.999	T
MAMLD1	10046	genome.wustl.edu	37	X	149680750	149680750	+	3'UTR	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chrX:149680750G>A	ENST00000370401.2	+	0	3156				MAMLD1_ENST00000432680.2_Missense_Mutation_p.D802N|MAMLD1_ENST00000426613.2_3'UTR|MAMLD1_ENST00000262858.5_3'UTR			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1						male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCCAAGTGGATAATAGCGT	0.577																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.*521G>A	X.37:g.149680750G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NULL	p.D802N	ENST00000370401.2	37	c.2404	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	g	14.02	2.412281	0.42817	.	.	ENSG00000013619	ENST00000432680	T	0.65916	-0.18	4.8	3.92	0.45320	.	.	.	.	.	T	0.56558	0.1993	L	0.27053	0.805	0.36154	D	0.847658	P	0.52061	0.95	P	0.50708	0.648	T	0.58578	-0.7612	9	0.20046	T	0.44	.	14.3734	0.66857	0.0:0.1452:0.8548:0.0	.	802	Q13495-3	.	N	802	ENSP00000414517:D802N	ENSP00000414517:D802N	D	+	1	0	MAMLD1	149431408	0.896000	0.30565	0.004000	0.12327	0.051000	0.14879	3.514000	0.53422	0.804000	0.34136	0.413000	0.27773	GAT	MAMLD1	-	NULL	ENSG00000013619		0.577	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2	106	0.00	0	G	NM_005491		149680750	149680750	+1	no_errors	ENST00000432680	ensembl	human	known	69_37n	missense	50	35.44	28	SNP	0.050	A
MATN2	4147	genome.wustl.edu	37	8	98900332	98900332	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr8:98900332G>T	ENST00000520016.1	+	1	128	c.4G>T	c.(4-6)Gaa>Taa	p.E2*	MATN2_ENST00000524308.1_Nonsense_Mutation_p.E2*|MATN2_ENST00000254898.5_Nonsense_Mutation_p.E2*|MATN2_ENST00000521689.1_Nonsense_Mutation_p.E2*|MATN2_ENST00000522025.2_Intron			O00339	MATN2_HUMAN	matrilin 2	2						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CTTGAAAATGGAAAAGATGCT	0.587																																						dbGAP											0													49.0	48.0	48.0					8																	98900332		1990	4171	6161	-	-	-	SO:0001587	stop_gained	0			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.4G>T	8.37:g.98900332G>T	ENSP00000430487:p.Glu2*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Nonsense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_VWF_A	p.E2*	ENST00000520016.1	37	c.4	CCDS55264.1	8	.	.	.	.	.	.	.	.	.	.	G	41	8.814546	0.98964	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000520016	.	.	.	5.02	4.15	0.48705	.	0.472337	0.17869	N	0.159229	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.5265	9.0918	0.36614	0.0983:0.0:0.9017:0.0	.	.	.	.	X	2	.	ENSP00000254898:E2X	E	+	1	0	MATN2	98969508	1.000000	0.71417	0.974000	0.42286	0.673000	0.39480	4.029000	0.57253	1.344000	0.45657	0.655000	0.94253	GAA	MATN2	-	NULL	ENSG00000132561		0.587	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1	47	0.00	0	G			98900332	98900332	+1	no_errors	ENST00000254898	ensembl	human	known	69_37n	nonsense	22	58.49	31	SNP	0.989	T
MKLN1	4289	genome.wustl.edu	37	7	131172381	131172381	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr7:131172381A>G	ENST00000352689.6	+	18	2142	c.2102A>G	c.(2101-2103)gAt>gGt	p.D701G	MKLN1_ENST00000421797.2_Missense_Mutation_p.D609G|MKLN1_ENST00000498778.1_3'UTR	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	701					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					TCTGATGTGGATCACACCTAT	0.393																																						dbGAP											0													103.0	95.0	98.0					7																	131172381		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.2102A>G	7.37:g.131172381A>G	ENSP00000323527:p.Asp701Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Missense_Mutation	SNP	pfam_Muskelin_N,pfam_Kelch_1,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_LisH_dimerisation,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.D701G	ENST00000352689.6	37	c.2102	CCDS34754.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.02|18.02	3.530243|3.530243	0.64860|0.64860	.|.	.|.	ENSG00000128585|ENSG00000128585	ENST00000421797;ENST00000352689|ENST00000388758	T;T|.	0.46451|.	1.86;0.87|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59945|0.59945	0.2231|0.2231	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	P;P|B	0.36483|0.06786	0.555;0.495|0.001	B;B|B	0.28465|0.01281	0.078;0.09|0.0	T|T	0.57705|0.57705	-0.7765|-0.7765	10|8	0.31617|0.66056	T|D	0.26|0.02	-19.8148|-19.8148	15.519|15.519	0.75851|0.75851	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	701;678|173	Q9UL63;B4DG30|F8W7E8	MKLN1_HUMAN;.|.	G|V	609;701|173	ENSP00000398094:D609G;ENSP00000323527:D701G|.	ENSP00000323527:D701G|ENSP00000373410:I173V	D|I	+|+	2|1	0|0	MKLN1|MKLN1	130822921|130822921	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.313000|9.313000	0.96297|0.96297	2.255000|2.255000	0.74692|0.74692	0.533000|0.533000	0.62120|0.62120	GAT|ATC	MKLN1	-	NULL	ENSG00000128585		0.393	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MKLN1	HGNC	protein_coding	OTTHUMT00000337473.4	48	0.00	0	A	NM_013255		131172381	131172381	+1	no_errors	ENST00000352689	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	G
MUC19	283463	genome.wustl.edu	37	12	40938751	40938751	+	Intron	SNP	A	A	G	rs7304329	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr12:40938751A>G	ENST00000454784.4	+	55	17711							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ATCTCCTCTGAAAATCTTTGT	0.333													G|||	999	0.199481	0.3207	0.1657	5008	,	,		18721	0.1706		0.1899	False		,,,				2504	0.0992					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.10890+66A>G	12.37:g.40938751A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	RNA	SNP	-	NULL	ENST00000454784.4	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.333	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	39	0.00	0	A	XM_003403524		40938751	40938751	+1	no_errors	ENST00000492952	ensembl	human	known	69_37n	rna	49	10.91	6	SNP	0.002	G
NFKBIB	4793	genome.wustl.edu	37	19	39396099	39396099	+	Silent	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr19:39396099C>T	ENST00000313582.5	+	3	577	c.543C>T	c.(541-543)ccC>ccT	p.P181P	NFKBIB_ENST00000392079.3_Silent_p.P149P|NFKBIB_ENST00000572515.1_Silent_p.P181P	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	181					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCTTGTACCCCGATTCCGACT	0.637																																					Pancreas(165;1492 2005 6979 7739 34483)	dbGAP											0													65.0	67.0	66.0					19																	39396099		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.543C>T	19.37:g.39396099C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3F4|Q96BJ7	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P181	ENST00000313582.5	37	c.543	CCDS12524.1	19																																																																																			NFKBIB	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104825		0.637	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIB	HGNC	protein_coding	OTTHUMT00000438155.1	27	0.00	0	C	NM_002503		39396099	39396099	+1	no_errors	ENST00000313582	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	0.000	T
NKAP	79576	genome.wustl.edu	37	X	119077367	119077367	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chrX:119077367G>A	ENST00000371410.3	-	1	368	c.202C>T	c.(202-204)Cga>Tga	p.R68*		NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	68	Ser-rich.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						GACTGGTTTCGGGAGCCTTGG	0.682																																						dbGAP											0													33.0	35.0	35.0					X																	119077367		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.202C>T	X.37:g.119077367G>A	ENSP00000360464:p.Arg68*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPW6|Q96BQ2|Q9H638	Nonsense_Mutation	SNP	pfam_DUF926	p.R68*	ENST00000371410.3	37	c.202	CCDS14592.1	X	.	.	.	.	.	.	.	.	.	.	g	19.56	3.849678	0.71603	.	.	ENSG00000101882	ENST00000371410	.	.	.	4.0	-0.119	0.13543	.	0.412500	0.24160	N	0.040992	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.6151	2.2316	0.03998	0.1116:0.3345:0.3544:0.1994	.	.	.	.	X	68	.	ENSP00000360464:R68X	R	-	1	2	NKAP	118961395	0.877000	0.30153	0.005000	0.12908	0.049000	0.14656	0.944000	0.29043	-0.134000	0.11516	-0.236000	0.12185	CGA	NKAP	-	NULL	ENSG00000101882		0.682	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAP	HGNC	protein_coding	OTTHUMT00000058072.1	48	0.00	0	G	NM_024528		119077367	119077367	-1	no_errors	ENST00000371410	ensembl	human	known	69_37n	nonsense	41	25.45	14	SNP	0.002	A
OR5A2	219981	genome.wustl.edu	37	11	59190237	59190237	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr11:59190237G>C	ENST00000302040.4	-	1	212	c.190C>G	c.(190-192)Ctc>Gtc	p.L64V		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						AGGTTACTGAGGAAGAAGTAC	0.498																																						dbGAP											0													145.0	121.0	129.0					11																	59190237		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.190C>G	11.37:g.59190237G>C	ENSP00000303834:p.Leu64Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L64V	ENST00000302040.4	37	c.190	CCDS31560.1	11	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923314	0.73213	.	.	ENSG00000172324	ENST00000302040	T	0.14022	2.54	5.38	5.38	0.77491	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31936	U	0.006828	T	0.42108	0.1188	M	0.93375	3.41	0.31558	N	0.657875	D	0.63046	0.992	P	0.54460	0.753	T	0.62779	-0.6782	10	0.87932	D	0	.	16.9596	0.86269	0.0:0.0:1.0:0.0	.	64	Q8NGI9	OR5A2_HUMAN	V	64	ENSP00000303834:L64V	ENSP00000303834:L64V	L	-	1	0	OR5A2	58946813	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	3.681000	0.54648	2.688000	0.91661	0.585000	0.79938	CTC	OR5A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000172324		0.498	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A2	HGNC	protein_coding	OTTHUMT00000394552.1	36	0.00	0	G	NM_001001954		59190237	59190237	-1	no_errors	ENST00000302040	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	1.000	C
OR7C1	26664	genome.wustl.edu	37	19	14910386	14910386	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr19:14910386G>A	ENST00000248073.2	-	1	637	c.563C>T	c.(562-564)gCc>gTc	p.A188V	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	188					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						GTCAGAACAGGCGAGCTTCAG	0.423																																						dbGAP											0													96.0	96.0	96.0					19																	14910386		2203	4300	6503	-	-	-	SO:0001583	missense	0			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.563C>T	19.37:g.14910386G>A	ENSP00000248073:p.Ala188Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A188V	ENST00000248073.2	37	c.563	CCDS12317.1	19	.	.	.	.	.	.	.	.	.	.	g	19.63	3.863110	0.71949	.	.	ENSG00000127530	ENST00000248073	T	0.00183	8.6	3.64	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.752143	0.10714	U	0.642541	T	0.00580	0.0019	M	0.81802	2.56	0.09310	N	0.999999	D	0.67145	0.996	D	0.67900	0.954	T	0.54768	-0.8244	10	0.87932	D	0	.	13.18	0.59649	0.0:0.0:1.0:0.0	.	188	O76099	OR7C1_HUMAN	V	188	ENSP00000248073:A188V	ENSP00000248073:A188V	A	-	2	0	OR7C1	14771386	0.007000	0.16637	0.224000	0.23877	0.045000	0.14185	1.480000	0.35464	2.024000	0.59613	0.543000	0.68304	GCC	OR7C1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000127530		0.423	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	13	0.00	0	G			14910386	14910386	-1	no_errors	ENST00000248073	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.261	A
PBX1	5087	genome.wustl.edu	37	1	164610617	164610617	+	Intron	SNP	A	A	G			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:164610617A>G	ENST00000420696.2	+	2	453				PBX1_ENST00000367897.1_Intron|PBX1_ENST00000401534.1_Intron|RNU6-171P_ENST00000384354.1_RNA|PBX1_ENST00000474046.1_3'UTR|PBX1_ENST00000560641.1_Intron|PBX1_ENST00000540236.1_Intron|PBX1_ENST00000559240.1_Intron	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CCATCCAGTGACCTAGTCTGG	0.542			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																	dbGAP		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	0																																										-	-	-	SO:0001627	intron_variant	0			M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.265+78069A>G	1.37:g.164610617A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSC1|F5H4U9|Q5T488	RNA	SNP	-	NULL	ENST00000420696.2	37	NULL	CCDS1246.1	1																																																																																			PBX1	-	-	ENSG00000185630		0.542	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBX1	HGNC	protein_coding	OTTHUMT00000082864.4	27	0.00	0	A	NM_002585		164610617	164610617	+1	no_errors	ENST00000474046	ensembl	human	known	69_37n	rna	17	58.54	24	SNP	0.000	G
PRLR	5618	genome.wustl.edu	37	5	35065981	35065981	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr5:35065981delA	ENST00000382002.5	-	10	1505	c.1079delT	c.(1078-1080)ttgfs	p.L360fs	PRLR_ENST00000509934.1_5'Flank|PRLR_ENST00000511486.1_Frame_Shift_Del_p.L259fs|PRLR_ENST00000310101.5_Intron|PRLR_ENST00000513753.1_Intron|PRLR_ENST00000342362.5_Frame_Shift_Del_p.L259fs|PRLR_ENST00000231423.3_Intron|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000542609.1_Intron|PRLR_ENST00000397391.3_Intron	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	360					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	CTTTTCAGACAAAAGGGAAGG	0.512																																						dbGAP											0													79.0	84.0	82.0					5																	35065981		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.1079delT	5.37:g.35065981delA	ENSP00000371432:p.Leu360fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Frame_Shift_Del	DEL	pfam_Growth/epo_recpt_lig-bind,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L360fs	ENST00000382002.5	37	c.1079	CCDS3909.1	5																																																																																			PRLR	-	NULL	ENSG00000113494		0.512	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	46	0.00	0	A			35065981	35065981	-1	no_errors	ENST00000382002	ensembl	human	known	69_37n	frame_shift_del	6	83.33	35	DEL	0.628	-
PTENP1	11191	genome.wustl.edu	37	9	33674777	33674777	+	RNA	SNP	T	T	A	rs10814025	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr9:33674777T>A	ENST00000532280.1	-	0	2720					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		AATATGCTTTTAAAAAAATGC	0.398													A|||	1416	0.282748	0.4425	0.2767	5008	,	,		20451	0.2153		0.2932	False		,,,				2504	0.1299					dbGAP											0																																										-	-	-			0			AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33674777T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			PTENP1	-	-	ENSG00000237984		0.398	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	HGNC	pseudogene	OTTHUMT00000395145.1	47	0.00	0	T	NR_023917		33674777	33674777	-1	no_errors	ENST00000532280	ensembl	human	known	69_37n	rna	29	14.71	5	SNP	0.973	A
PTENP1	11191	genome.wustl.edu	37	9	33674789	33674789	+	RNA	SNP	A	A	C	rs10814026	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr9:33674789A>C	ENST00000532280.1	-	0	2708					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		AAAAAATGCGAAAACAACAAG	0.393													C|||	1416	0.282748	0.4425	0.2767	5008	,	,		20167	0.2153		0.2932	False		,,,				2504	0.1299					dbGAP											0																																										-	-	-			0			AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33674789A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			PTENP1	-	-	ENSG00000237984		0.393	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	HGNC	pseudogene	OTTHUMT00000395145.1	45	0.00	0	A	NR_023917		33674789	33674789	-1	no_errors	ENST00000532280	ensembl	human	known	69_37n	rna	32	13.51	5	SNP	0.987	C
PWP1	11137	genome.wustl.edu	37	12	108104257	108104257	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr12:108104257C>T	ENST00000412830.3	+	14	1534	c.1366C>T	c.(1366-1368)Cgg>Tgg	p.R456W	PWP1_ENST00000541166.1_Missense_Mutation_p.R394W	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	456					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						AGAAGGGCTTCGGGTCTGGGA	0.428																																						dbGAP											0													137.0	146.0	143.0					12																	108104257		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.1366C>T	12.37:g.108104257C>T	ENSP00000387365:p.Arg456Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3R6|Q7Z3X9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R456W	ENST00000412830.3	37	c.1366	CCDS9114.1	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623517	0.87460	.	.	ENSG00000136045	ENST00000412830;ENST00000541166	T;T	0.34472	1.36;1.99	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.60845	-0.7182	10	0.72032	D	0.01	.	19.6964	0.96028	0.0:1.0:0.0:0.0	.	456	Q13610	PWP1_HUMAN	W	456;394	ENSP00000387365:R456W;ENSP00000445249:R394W	ENSP00000387365:R456W	R	+	1	2	PWP1	106628387	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.393000	0.59665	2.748000	0.94277	0.655000	0.94253	CGG	PWP1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000136045		0.428	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP1	HGNC	protein_coding	OTTHUMT00000406539.1	82	0.00	0	C	NM_007062		108104257	108104257	+1	no_errors	ENST00000412830	ensembl	human	known	69_37n	missense	46	34.72	25	SNP	1.000	T
PYGB	5834	genome.wustl.edu	37	20	25277244	25277244	+	3'UTR	SNP	A	A	G	rs9927	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr20:25277244A>G	ENST00000216962.4	+	0	2728				PYGB_ENST00000471359.1_3'UTR|ABHD12_ENST00000376542.3_Intron	NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TTTGCCAGCCACTGGTGGTCC	0.552													G|||	2796	0.558307	0.4773	0.366	5008	,	,		18287	0.9087		0.4871	False		,,,				2504	0.5164					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.*86A>G	20.37:g.25277244A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AK1|Q9NPX8	RNA	SNP	-	NULL	ENST00000216962.4	37	NULL	CCDS13171.1	20																																																																																			PYGB	-	-	ENSG00000100994		0.552	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	48	0.00	0	A	NM_002862		25277244	25277244	+1	no_errors	ENST00000471359	ensembl	human	known	69_37n	rna	39	11.36	5	SNP	0.006	G
RICTOR	253260	genome.wustl.edu	37	5	38982118	38982118	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr5:38982118C>A	ENST00000357387.3	-	8	634	c.604G>T	c.(604-606)Gtg>Ttg	p.V202L	RICTOR_ENST00000296782.5_Missense_Mutation_p.V202L	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CGAAGGGCCACCACCTCTGGA	0.333																																						dbGAP											0													119.0	127.0	124.0					5																	38982118		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.604G>T	5.37:g.38982118C>A	ENSP00000349959:p.Val202Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V202L	ENST00000357387.3	37	c.604	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580023	0.65992	.	.	ENSG00000164327	ENST00000357387;ENST00000296782;ENST00000514735	T;T;T	0.63744	-0.06;-0.06;-0.06	4.98	4.98	0.66077	Armadillo-like helical (1);Armadillo-type fold (1);	0.062767	0.64402	D	0.000005	T	0.60586	0.2280	N	0.21282	0.65	0.80722	D	1	P;P;B;B	0.50528	0.612;0.936;0.175;0.039	B;P;B;B	0.50405	0.169;0.64;0.093;0.028	T	0.67321	-0.5700	10	0.87932	D	0	-4.0967	18.2527	0.90009	0.0:1.0:0.0:0.0	.	202;202;202;202	Q8N6M7;E7ETT0;Q6R327;Q6R327-3	.;.;RICTR_HUMAN;.	L	202;202;186	ENSP00000349959:V202L;ENSP00000296782:V202L;ENSP00000423162:V186L	ENSP00000296782:V202L	V	-	1	0	RICTOR	39017875	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.344000	0.79328	2.300000	0.77407	0.467000	0.42956	GTG	RICTOR	-	superfamily_ARM-type_fold	ENSG00000164327		0.333	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	51	0.00	0	C	NM_152756		38982118	38982118	-1	no_errors	ENST00000296782	ensembl	human	known	69_37n	missense	46	18.97	11	SNP	1.000	A
SDK1	221935	genome.wustl.edu	37	7	4167090	4167090	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr7:4167090C>A	ENST00000404826.2	+	26	4040	c.3901C>A	c.(3901-3903)Ccg>Acg	p.P1301T	SDK1_ENST00000389531.3_Missense_Mutation_p.P1301T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1301	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GACATCCGTGCCGGAACAGGA	0.532																																						dbGAP											0													139.0	127.0	131.0					7																	4167090		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3901C>A	7.37:g.4167090C>A	ENSP00000385899:p.Pro1301Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P1301T	ENST00000404826.2	37	c.3901	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	17.77	3.471484	0.63737	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56611	0.45;0.45	5.88	5.88	0.94601	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.74764	0.3759	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	T	0.76610	-0.2896	10	0.87932	D	0	.	18.4227	0.90597	0.0:1.0:0.0:0.0	.	1301;1301	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	T	1301	ENSP00000385899:P1301T;ENSP00000374182:P1301T	ENSP00000374182:P1301T	P	+	1	0	SDK1	4133616	0.999000	0.42202	0.549000	0.28204	0.248000	0.25809	6.857000	0.75455	2.788000	0.95919	0.650000	0.86243	CCG	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.532	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	82	0.00	0	C	NM_152744		4167090	4167090	+1	no_errors	ENST00000404826	ensembl	human	known	69_37n	missense	46	41.03	32	SNP	1.000	A
SLC11A1	6556	genome.wustl.edu	37	2	219249931	219249931	+	Missense_Mutation	SNP	G	G	T	rs139900230		TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr2:219249931G>T	ENST00000233202.6	+	4	675	c.335G>T	c.(334-336)cGt>cTt	p.R112L	SLC11A1_ENST00000539932.1_5'UTR|SLC11A1_ENST00000473367.1_3'UTR	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	112					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGCTGCACGTCTGGGCGTG	0.642																																						dbGAP											0													100.0	94.0	96.0					2																	219249931		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.335G>T	2.37:g.219249931G>T	ENSP00000233202:p.Arg112Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C0H5Y3	Missense_Mutation	SNP	pfam_Nat-R-assoc-macro_Nramp,prints_Nat-R-assoc-macro_Nramp,tigrfam_Nat-R-assoc-macro_Nramp	p.R112L	ENST00000233202.6	37	c.335	CCDS2415.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.162159	0.94727	.	.	ENSG00000018280	ENST00000233202	T	0.75477	-0.94	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000001	D	0.91164	0.7217	H	0.96720	3.87	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.989;0.989;0.997	D	0.93923	0.7207	10	0.87932	D	0	-31.6531	18.2375	0.89954	0.0:0.0:1.0:0.0	.	112;112;112	Q9HBK0;B4DQ73;P49279	.;.;NRAM1_HUMAN	L	112	ENSP00000233202:R112L	ENSP00000233202:R112L	R	+	2	0	SLC11A1	218958175	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	9.188000	0.94921	2.637000	0.89404	0.549000	0.68633	CGT	SLC11A1	-	pfam_Nat-R-assoc-macro_Nramp,tigrfam_Nat-R-assoc-macro_Nramp	ENSG00000018280		0.642	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC11A1	HGNC	protein_coding	OTTHUMT00000195076.2	50	0.00	0	G	NM_000578		219249931	219249931	+1	no_errors	ENST00000233202	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	1.000	T
SLC1A6	6511	genome.wustl.edu	37	19	15061096	15061096	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr19:15061096G>A	ENST00000221742.3	-	9	1613	c.1606C>T	c.(1606-1608)Ctc>Ttc	p.L536F	SLC1A6_ENST00000430939.2_Missense_Mutation_p.L472F|SLC1A6_ENST00000600144.1_Missense_Mutation_p.L458F	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	536					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						AGGCTGGGGAGGGTAAGCTCA	0.617																																						dbGAP											0													54.0	50.0	51.0					19																	15061096		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1606C>T	19.37:g.15061096G>A	ENSP00000221742:p.Leu536Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N753	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.L536F	ENST00000221742.3	37	c.1606	CCDS12321.1	19	.	.	.	.	.	.	.	.	.	.	g	13.03	2.115677	0.37339	.	.	ENSG00000105143	ENST00000430939;ENST00000221742	T;T	0.72725	-0.68;0.39	4.9	3.84	0.44239	.	0.486738	0.20645	N	0.088325	T	0.46521	0.1397	N	0.08118	0	0.42030	D	0.99102	B;B	0.28439	0.192;0.212	B;B	0.27076	0.076;0.06	T	0.34900	-0.9810	10	0.15066	T	0.55	-17.7869	10.1071	0.42539	0.0:0.0:0.6348:0.3652	.	472;536	E7EV13;P48664	.;EAA4_HUMAN	F	472;536	ENSP00000409386:L472F;ENSP00000221742:L536F	ENSP00000221742:L536F	L	-	1	0	SLC1A6	14922096	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	3.370000	0.52372	1.255000	0.44051	0.544000	0.68410	CTC	SLC1A6	-	NULL	ENSG00000105143		0.617	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	HGNC	protein_coding	OTTHUMT00000466283.1	35	0.00	0	G	NM_005071		15061096	15061096	-1	no_errors	ENST00000221742	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.666	A
SLC22A23	63027	genome.wustl.edu	37	6	3438738	3438738	+	Intron	SNP	G	G	A	rs12197689	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr6:3438738G>A	ENST00000406686.3	-	1	654				SLC22A23_ENST00000490273.1_Intron|SLC22A23_ENST00000380298.2_Intron|SLC22A23_ENST00000380302.4_Intron|SLC22A23_ENST00000436008.2_Intron	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23						ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				GGCCTCCAGCGCTTGGTGTCT	0.507													G|||	3102	0.619409	0.382	0.5274	5008	,	,		19587	0.6478		0.7435	False		,,,				2504	0.8487					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.654+17401C>T	6.37:g.3438738G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R38C	ENST00000406686.3	37	c.112	CCDS47363.1	6	1315	0.6021062271062271	191	0.3882113821138211	210	0.580110497237569	351	0.6136363636363636	563	0.7427440633245382	G	7.792	0.711731	0.15306	.	.	ENSG00000137266	ENST00000467177	T	0.59772	0.24	3.35	-6.71	0.01760	.	.	.	.	.	T	0.29491	0.0735	.	.	.	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.39941	-0.9589	5	0.56958	D	0.05	.	6.6583	0.23000	0.5285:0.0:0.3433:0.1283	rs12197689;rs13208913;rs17136554;rs12197689	.	.	.	C	38	ENSP00000418985:R38C	ENSP00000418985:R38C	R	-	1	0	SLC22A23	3383737	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.068000	0.00620	-2.086000	0.00863	-2.199000	0.00308	CGC	SLC22A23	-	pfscan_MFS_dom	ENSG00000137266		0.507	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	SLC22A23	HGNC	protein_coding	OTTHUMT00000353059.1	28	0.00	0	G	NM_021945		3438738	3438738	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000467177	ensembl	human	putative	69_37n	missense	32	11.11	4	SNP	0.000	A
SLC43A3	29015	genome.wustl.edu	37	11	57193111	57193111	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr11:57193111T>C	ENST00000395123.2	-	4	521	c.217A>G	c.(217-219)Atc>Gtc	p.I73V	SLC43A3_ENST00000529554.1_Missense_Mutation_p.I73V|SLC43A3_ENST00000528098.1_5'UTR|SLC43A3_ENST00000352187.1_Missense_Mutation_p.I73V|SLC43A3_ENST00000395124.1_Missense_Mutation_p.I73V|SLC43A3_ENST00000533524.1_Missense_Mutation_p.I86V	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	73					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						AGGGTGAAGATGAGTGAGAAC	0.532																																						dbGAP											0													107.0	95.0	99.0					11																	57193111		2201	4296	6497	-	-	-	SO:0001583	missense	0			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.217A>G	11.37:g.57193111T>C	ENSP00000378555:p.Ile73Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.I73V	ENST00000395123.2	37	c.217	CCDS7956.1	11	.	.	.	.	.	.	.	.	.	.	T	0.984	-0.696288	0.03279	.	.	ENSG00000134802	ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524;ENST00000530005;ENST00000529113;ENST00000525474;ENST00000529112;ENST00000528187;ENST00000529494;ENST00000533245;ENST00000533235;ENST00000524863;ENST00000532795;ENST00000533051	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01	5.4	4.28	0.50868	Major facilitator superfamily domain, general substrate transporter (1);	0.073677	0.56097	D	0.000024	T	0.20780	0.0500	N	0.11255	0.115	0.40102	D	0.976381	B;B;B	0.28713	0.22;0.036;0.036	B;B;B	0.31101	0.086;0.124;0.097	T	0.09796	-1.0658	10	0.14252	T	0.57	-37.154	7.5056	0.27542	0.0:0.154:0.0:0.846	.	73;86;73	B4DV87;E7EQD2;Q8NBI5	.;.;S43A3_HUMAN	V	73;73;73;73;86;73;20;73;73;86;73;73;73;73;73;73	ENSP00000378555:I73V;ENSP00000378556:I73V;ENSP00000337561:I73V;ENSP00000436254:I73V;ENSP00000434515:I86V;ENSP00000435893:I73V;ENSP00000434293:I20V;ENSP00000436055:I73V;ENSP00000434913:I73V;ENSP00000435273:I86V;ENSP00000433974:I73V;ENSP00000431762:I73V;ENSP00000435156:I73V;ENSP00000434569:I73V;ENSP00000435109:I73V;ENSP00000435490:I73V	ENSP00000337561:I73V	I	-	1	0	SLC43A3	56949687	1.000000	0.71417	0.997000	0.53966	0.175000	0.22909	1.248000	0.32827	2.038000	0.60285	0.459000	0.35465	ATC	SLC43A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000134802		0.532	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC43A3	HGNC	protein_coding	OTTHUMT00000393057.1	49	0.00	0	T	NM_017611		57193111	57193111	-1	no_errors	ENST00000352187	ensembl	human	known	69_37n	missense	30	38.78	19	SNP	1.000	C
SLC5A10	125206	genome.wustl.edu	37	17	18922824	18922824	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr17:18922824C>T	ENST00000395645.3	+	12	1348	c.1330C>T	c.(1330-1332)Cag>Tag	p.Q444*	SLC5A10_ENST00000395647.2_Nonsense_Mutation_p.Q460*|SLC5A10_ENST00000317977.6_Nonsense_Mutation_p.Q414*|SLC5A10_ENST00000395642.1_Nonsense_Mutation_p.Q414*|SLC5A10_ENST00000395643.2_Nonsense_Mutation_p.Q417*|SLC5A10_ENST00000417251.2_Nonsense_Mutation_p.Q408*	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	444					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						CATCTACATGCAGTCAGTGAC	0.627																																						dbGAP											0													78.0	65.0	69.0					17																	18922824		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.1330C>T	17.37:g.18922824C>T	ENSP00000379007:p.Gln444*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Nonsense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.Q460*	ENST00000395645.3	37	c.1378	CCDS42275.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.913304	0.97099	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	.	.	.	4.49	4.49	0.54785	.	0.112919	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.0419	0.71796	0.0:1.0:0.0:0.0	.	.	.	.	X	414;460;414;408;444;417	.	ENSP00000324346:Q414X	Q	+	1	0	SLC5A10	18863549	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	7.598000	0.82745	2.201000	0.70794	0.561000	0.74099	CAG	SLC5A10	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000154025		0.627	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A10	HGNC	protein_coding	OTTHUMT00000132129.2	40	0.00	0	C	NM_152351		18922824	18922824	+1	no_errors	ENST00000395647	ensembl	human	known	69_37n	nonsense	32	30.43	14	SNP	1.000	T
SLC5A11	115584	genome.wustl.edu	37	16	24920357	24920357	+	Silent	SNP	G	G	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr16:24920357G>A	ENST00000347898.3	+	14	2212	c.1590G>A	c.(1588-1590)acG>acA	p.T530T	SLC5A11_ENST00000545376.1_Silent_p.T460T|SLC5A11_ENST00000449109.2_Silent_p.T374T|SLC5A11_ENST00000539472.1_Silent_p.T466T|SLC5A11_ENST00000568579.1_Silent_p.T460T|SLC5A11_ENST00000569071.1_Silent_p.T374T|SLC5A11_ENST00000567758.1_Silent_p.T495T|SLC5A11_ENST00000424767.2_Silent_p.T495T|SLC5A11_ENST00000565769.1_Silent_p.T466T	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TCCTGTCCACGGTCACCCTCA	0.537																																						dbGAP											0													136.0	102.0	113.0					16																	24920357		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1590G>A	16.37:g.24920357G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.T530	ENST00000347898.3	37	c.1590	CCDS10625.1	16																																																																																			SLC5A11	-	NULL	ENSG00000158865		0.537	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	HGNC	protein_coding	OTTHUMT00000214091.3	109	0.00	0	G	NM_052944		24920357	24920357	+1	no_errors	ENST00000347898	ensembl	human	known	69_37n	silent	50	29.58	21	SNP	0.000	A
STAC	6769	genome.wustl.edu	37	3	36587735	36587735	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr3:36587735G>T	ENST00000273183.3	+	11	1463	c.1163G>T	c.(1162-1164)gGa>gTa	p.G388V	STAC_ENST00000457375.2_Missense_Mutation_p.G327V	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	388					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						GTCCTCAGTGGAAAAAAGAAA	0.448																																						dbGAP											0													154.0	136.0	142.0					3																	36587735		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.1163G>T	3.37:g.36587735G>T	ENSP00000273183:p.Gly388Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8S8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.G388V	ENST00000273183.3	37	c.1163	CCDS2662.1	3	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273123	0.80580	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687	T;T	0.09723	2.95;2.95	5.17	5.17	0.71159	Src homology-3 domain (1);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.35770	0.0943	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.10894	-1.0610	10	0.87932	D	0	.	16.8263	0.85933	0.0:0.0:1.0:0.0	.	327;388	E9PEA7;Q99469	.;STAC_HUMAN	V	388;327;320	ENSP00000273183:G388V;ENSP00000393713:G327V	ENSP00000273183:G388V	G	+	2	0	STAC	36562739	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.280000	0.78610	2.565000	0.86533	0.655000	0.94253	GGA	STAC	-	pfam_SH3_2,superfamily_SH3_domain	ENSG00000144681		0.448	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC	HGNC	protein_coding	OTTHUMT00000253338.2	42	0.00	0	G	NM_003149		36587735	36587735	+1	no_errors	ENST00000273183	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	T
TCEAL7	56849	genome.wustl.edu	37	X	102586400	102586400	+	Silent	SNP	C	C	A			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chrX:102586400C>A	ENST00000332431.4	+	3	323	c.69C>A	c.(67-69)cgC>cgA	p.R23R	TCEAL7_ENST00000372666.1_Silent_p.R23R	NM_152278.3	NP_689491.1	Q9BRU2	TCAL7_HUMAN	transcription elongation factor A (SII)-like 7	23					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|upper_aerodigestive_tract(1)	2						aggaaaaacgcccgtatggag	0.438																																						dbGAP											0													42.0	39.0	40.0					X																	102586400		2200	4288	6488	-	-	-	SO:0001819	synonymous_variant	0			BC016786	CCDS14506.1	Xq22.1	2014-03-21			ENSG00000182916	ENSG00000182916			28336	protein-coding gene	gene with protein product		300771				14702039, 16221301	Standard	NM_152278		Approved	MGC23947, WEX5	uc004ekc.2	Q9BRU2	OTTHUMG00000022096	ENST00000332431.4:c.69C>A	X.37:g.102586400C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSV2|Q96AT4	Silent	SNP	pfam_TF_A-like/BEX-like	p.R23	ENST00000332431.4	37	c.69	CCDS14506.1	X																																																																																			TCEAL7	-	pfam_TF_A-like/BEX-like	ENSG00000182916		0.438	TCEAL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL7	HGNC	protein_coding	OTTHUMT00000057704.1	17	0.00	0	C	NM_152278		102586400	102586400	+1	no_errors	ENST00000332431	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	0.000	A
TECTA	7007	genome.wustl.edu	37	11	121059793	121059793	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr11:121059793G>T	ENST00000392793.1	+	22	6438	c.6167G>T	c.(6166-6168)tGc>tTc	p.C2056F	TECTA_ENST00000264037.2_Missense_Mutation_p.C2056F			O75443	TECTA_HUMAN	tectorin alpha	2056	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TTGCAGACTTGCCCACACAAT	0.418																																						dbGAP											0													108.0	96.0	100.0					11																	121059793		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.6167G>T	11.37:g.121059793G>T	ENSP00000376543:p.Cys2056Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.C2056F	ENST00000392793.1	37	c.6167	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285203	0.80803	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.94966	-3.57;-3.57	6.07	6.07	0.98685	Zona pellucida sperm-binding protein (3);	0.000000	0.85682	D	0.000000	D	0.97486	0.9177	M	0.81497	2.545	0.58432	D	0.999993	D	0.69078	0.997	D	0.83275	0.996	D	0.97447	1.0025	10	0.87932	D	0	.	20.2543	0.98414	0.0:0.0:1.0:0.0	.	2056	O75443	TECTA_HUMAN	F	2056	ENSP00000376543:C2056F;ENSP00000264037:C2056F	ENSP00000264037:C2056F	C	+	2	0	TECTA	120565003	1.000000	0.71417	0.998000	0.56505	0.939000	0.58152	7.876000	0.87215	2.884000	0.98904	0.655000	0.94253	TGC	TECTA	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	ENSG00000109927		0.418	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	42	0.00	0	G	NM_005422		121059793	121059793	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	missense	27	10.00	3	SNP	1.000	T
TNFRSF25	8718	genome.wustl.edu	37	1	6525171	6525171	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:6525171C>T	ENST00000356876.3	-	3	359	c.272G>A	c.(271-273)cGc>cAc	p.R91H	TNFRSF25_ENST00000351959.5_Missense_Mutation_p.R91H|TNFRSF25_ENST00000461703.2_5'UTR|TNFRSF25_ENST00000348333.3_Intron|TNFRSF25_ENST00000351748.3_Intron|TNFRSF25_ENST00000377782.3_Missense_Mutation_p.R91H	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	91					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		GGCCTGGCAGCGGGCACATTC	0.602																																						dbGAP											0													77.0	76.0	76.0					1																	6525171		2203	4300	6503	-	-	-	SO:0001583	missense	0			U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.272G>A	1.37:g.6525171C>T	ENSP00000349341:p.Arg91His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	pfam_Death,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_25	p.R91H	ENST00000356876.3	37	c.272	CCDS71.1	1	.	.	.	.	.	.	.	.	.	.	c	17.57	3.422270	0.62622	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959	D;D;D	0.93488	-3.04;-3.23;-3.16	5.41	5.41	0.78517	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.195008	0.25101	U	0.033134	D	0.96762	0.8943	M	0.85462	2.755	0.80722	D	1	D;D;D	0.89917	1.0;0.968;1.0	D;P;D	0.79108	0.992;0.507;0.959	D	0.97047	0.9761	10	0.66056	D	0.02	-0.0082	14.745	0.69483	0.0:1.0:0.0:0.0	.	91;91;91	Q93038-11;Q93038-10;Q93038	.;.;TNR25_HUMAN	H	91	ENSP00000349341:R91H;ENSP00000367013:R91H;ENSP00000337713:R91H	ENSP00000337713:R91H	R	-	2	0	TNFRSF25	6447758	0.965000	0.33210	1.000000	0.80357	0.142000	0.21351	0.482000	0.22276	2.525000	0.85131	0.489000	0.48404	CGC	TNFRSF25	-	smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000215788		0.602	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF25	HGNC	protein_coding	OTTHUMT00000002259.1	41	0.00	0	C	NM_148965		6525171	6525171	-1	no_errors	ENST00000377782	ensembl	human	known	69_37n	missense	19	47.22	17	SNP	1.000	T
TNRC6B	23112	genome.wustl.edu	37	22	40677226	40677226	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr22:40677226C>T	ENST00000454349.2	+	11	3726	c.3515C>T	c.(3514-3516)aCa>aTa	p.T1172I	TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000497559.1_Intron|TNRC6B_ENST00000335727.9_Intron|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1172	Gln-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						TCTGGTTCCACACTACCCAAC	0.537																																						dbGAP											0													137.0	125.0	128.0					22																	40677226		692	1591	2283	-	-	-	SO:0001583	missense	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.3515C>T	22.37:g.40677226C>T	ENSP00000401946:p.Thr1172Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.T1172I	ENST00000454349.2	37	c.3515	CCDS54533.1	22	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366865	0.82463	.	.	ENSG00000100354	ENST00000454349	T	0.12039	2.72	6.05	6.05	0.98169	.	.	.	.	.	T	0.14787	0.0357	N	0.08118	0	0.27727	N	0.944928	P	0.52316	0.952	P	0.49140	0.601	T	0.17048	-1.0382	9	0.59425	D	0.04	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	1172	Q9UPQ9	TNR6B_HUMAN	I	1172	ENSP00000401946:T1172I	ENSP00000401946:T1172I	T	+	2	0	TNRC6B	39007172	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.398000	0.73244	2.878000	0.98634	0.650000	0.86243	ACA	TNRC6B	-	NULL	ENSG00000100354		0.537	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		63	0.00	0	C			40677226	40677226	+1	no_errors	ENST00000454349	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
TSPAN9	10867	genome.wustl.edu	37	12	3390479	3390479	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr12:3390479C>T	ENST00000011898.5	+	7	709	c.548C>T	c.(547-549)aCg>aTg	p.T183M	TSPAN9_ENST00000537971.1_Missense_Mutation_p.T183M|TSPAN9_ENST00000407263.1_Missense_Mutation_p.T183M	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	183						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			AACGCCACCACGCCTTTGTGG	0.662																																						dbGAP											0													29.0	22.0	24.0					12																	3390479		2062	3926	5988	-	-	-	SO:0001583	missense	0			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.548C>T	12.37:g.3390479C>T	ENSP00000011898:p.Thr183Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUQ7|Q53FV2|Q6FGJ8	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T183M	ENST00000011898.5	37	c.548	CCDS8520.1	12	.	.	.	.	.	.	.	.	.	.	C	11.91	1.779534	0.31502	.	.	ENSG00000011105	ENST00000537971;ENST00000011898;ENST00000407263	D;D;D	0.87334	-2.24;-2.24;-2.24	4.86	3.94	0.45596	Tetraspanin, EC2 domain (1);	0.181186	0.45867	D	0.000323	D	0.84759	0.5543	L	0.42686	1.345	0.29553	N	0.851244	P	0.45531	0.86	P	0.49140	0.601	T	0.80195	-0.1483	10	0.48119	T	0.1	.	8.0663	0.30663	0.1811:0.6436:0.1753:0.0	.	183	O75954	TSN9_HUMAN	M	183	ENSP00000444799:T183M;ENSP00000011898:T183M;ENSP00000384488:T183M	ENSP00000011898:T183M	T	+	2	0	TSPAN9	3260740	0.982000	0.34865	0.683000	0.30040	0.099000	0.18886	1.953000	0.40352	0.993000	0.38866	0.561000	0.74099	ACG	TSPAN9	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000011105		0.662	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN9	HGNC	protein_coding	OTTHUMT00000317606.2	56	0.00	0	C	NM_006675		3390479	3390479	+1	no_errors	ENST00000011898	ensembl	human	known	69_37n	missense	40	28.57	16	SNP	0.906	T
UBR3	130507	genome.wustl.edu	37	2	170732399	170732399	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr2:170732399A>G	ENST00000272793.5	+	3	834	c.784A>G	c.(784-786)Atg>Gtg	p.M262V	UBR3_ENST00000418381.1_Missense_Mutation_p.M262V			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	262					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GGGAGGAGCAATGCGGTCTGT	0.373																																						dbGAP											0													137.0	125.0	129.0					2																	170732399		692	1591	2283	-	-	-	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.784A>G	2.37:g.170732399A>G	ENSP00000272793:p.Met262Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.M262V	ENST00000272793.5	37	c.784		2	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341448	0.81911	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.59502	0.26;0.26	5.22	5.22	0.72569	.	.	.	.	.	T	0.64494	0.2603	L	0.59436	1.845	0.80722	D	1	P	0.40332	0.713	P	0.54815	0.761	T	0.61093	-0.7132	9	0.02654	T	1	.	15.0966	0.72238	1.0:0.0:0.0:0.0	.	262	Q6ZT12	UBR3_HUMAN	V	262	ENSP00000272793:M262V;ENSP00000396068:M262V	ENSP00000272793:M262V	M	+	1	0	UBR3	170440645	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.862000	0.92283	1.970000	0.57323	0.377000	0.23210	ATG	UBR3	-	NULL	ENSG00000144357		0.373	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	21	0.00	0	A	NM_172070		170732399	170732399	+1	no_errors	ENST00000272793	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	G
VWA5B1	127731	genome.wustl.edu	37	1	20680718	20680718	+	Missense_Mutation	SNP	G	G	A	rs2072751	byFrequency	TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr1:20680718G>A	ENST00000375079.2	+	22	3821	c.3625G>A	c.(3625-3627)Gag>Aag	p.E1209K	VWA5B1_ENST00000289815.8_Missense_Mutation_p.E1178K	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	1209						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TGAGAATCTCGAGTTCAATAT	0.607													G|||	1149	0.229433	0.208	0.1801	5008	,	,		17189	0.2887		0.2237	False		,,,				2504	0.2382					dbGAP											0													7.0	11.0	10.0					1																	20680718		690	1588	2278	-	-	-	SO:0001583	missense	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.3625G>A	1.37:g.20680718G>A	ENSP00000364220:p.Glu1209Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.E1209K	ENST00000375079.2	37	c.3625		1	507	0.23214285714285715	84	0.17073170731707318	75	0.20718232044198895	189	0.3304195804195804	159	0.20976253298153033	G	9.915	1.210621	0.22289	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375079	T;T	0.33438	1.41;1.41	5.58	4.67	0.58626	.	0.128661	0.53938	N	0.000059	T	0.00012	0.0000	N	0.20685	0.6	0.09310	P	0.9999999999999991	P;B;D	0.65815	0.94;0.016;0.995	B;B;P	0.49332	0.187;0.016;0.607	T	0.44003	-0.9356	9	0.22706	T	0.39	-6.2611	11.7748	0.51979	0.0726:0.1247:0.8026:0.0	rs2072751;rs59623880;rs2072751	1209;1179;1204	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	K	1209;1178;1209	ENSP00000289815:E1178K;ENSP00000364220:E1209K	ENSP00000289815:E1178K	E	+	1	0	VWA5B1	20553305	1.000000	0.71417	0.892000	0.35008	0.362000	0.29581	4.651000	0.61447	0.737000	0.32582	-1.688000	0.00730	GAG	VWA5B1	-	NULL	ENSG00000158816		0.607	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4	56	0.00	0	G	XM_001722222		20680718	20680718	+1	no_errors	ENST00000375089	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.999	A
XPO4	64328	genome.wustl.edu	37	13	21361159	21361159	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr13:21361159G>T	ENST00000255305.6	-	22	3274	c.3203C>A	c.(3202-3204)aCa>aAa	p.T1068K	XPO4_ENST00000400602.2_Missense_Mutation_p.T1068K			Q9C0E2	XPO4_HUMAN	exportin 4	1068					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		GGTCATCTCTGTGTTGTGCTT	0.428																																						dbGAP											0													43.0	49.0	47.0					13																	21361159		1896	4105	6001	-	-	-	SO:0001583	missense	0			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.3203C>A	13.37:g.21361159G>T	ENSP00000255305:p.Thr1068Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T1068K	ENST00000255305.6	37	c.3203	CCDS41872.1	13	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650962	0.67472	.	.	ENSG00000132953	ENST00000400602;ENST00000255305	T;T	0.66638	-0.22;-0.22	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);Exportin 1, C-terminal (1);	0.241548	0.42053	D	0.000766	T	0.64034	0.2562	L	0.38175	1.15	0.58432	D	0.999997	B	0.27166	0.17	B	0.35971	0.215	T	0.57705	-0.7765	10	0.27082	T	0.32	-4.1044	19.7167	0.96124	0.0:0.0:1.0:0.0	.	1068	Q9C0E2	XPO4_HUMAN	K	1068	ENSP00000383444:T1068K;ENSP00000255305:T1068K	ENSP00000255305:T1068K	T	-	2	0	XPO4	20259159	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	6.298000	0.72763	2.667000	0.90743	0.655000	0.94253	ACA	XPO4	-	superfamily_ARM-type_fold	ENSG00000132953		0.428	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	31	0.00	0	G	NM_022459		21361159	21361159	-1	no_errors	ENST00000255305	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	1.000	T
ZNF394	84124	genome.wustl.edu	37	7	99097289	99097289	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr7:99097289T>C	ENST00000337673.6	-	1	631	c.428A>G	c.(427-429)cAg>cGg	p.Q143R	ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000394177.3_5'UTR|ZNF394_ENST00000426306.2_Missense_Mutation_p.Q143R|ZNF789_ENST00000494186.1_Intron	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	143	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GAGCGCTCGCTGCAGAGCCCG	0.632																																					Ovarian(24;589 697 9939 12704 40742)	dbGAP											0													78.0	87.0	84.0					7																	99097289		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.428A>G	7.37:g.99097289T>C	ENSP00000337363:p.Gln143Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.Q143R	ENST00000337673.6	37	c.428	CCDS5666.1	7	.	.	.	.	.	.	.	.	.	.	T	15.53	2.861571	0.51482	.	.	ENSG00000160908	ENST00000337673;ENST00000426306	T;T	0.04406	3.63;3.63	3.98	0.259	0.15583	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.336884	0.21909	N	0.067337	T	0.05090	0.0136	M	0.67953	2.075	0.09310	N	1	B;B	0.18610	0.029;0.029	B;B	0.21917	0.037;0.015	T	0.37731	-0.9693	10	0.25751	T	0.34	.	2.5142	0.04664	0.2017:0.2227:0.0:0.5756	.	143;143	Q05DA6;Q53GI3	.;ZN394_HUMAN	R	143	ENSP00000337363:Q143R;ENSP00000409565:Q143R	ENSP00000337363:Q143R	Q	-	2	0	ZNF394	98935225	0.059000	0.20769	0.003000	0.11579	0.428000	0.31595	0.209000	0.17435	0.039000	0.15632	0.459000	0.35465	CAG	ZNF394	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000160908		0.632	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF394	HGNC	protein_coding	OTTHUMT00000336498.1	29	0.00	0	T	NM_032164		99097289	99097289	-1	no_errors	ENST00000337673	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.007	C
ZNF793	390927	genome.wustl.edu	37	19	38028653	38028653	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr19:38028653A>G	ENST00000587143.1	+	6	1328	c.1093A>G	c.(1093-1095)Aag>Gag	p.K365E	ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000445217.1_Missense_Mutation_p.K365E|ZNF793_ENST00000589319.1_Intron|ZNF793_ENST00000542455.1_Missense_Mutation_p.K365E			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACAGGAGAGAAGCCCTATGG	0.453																																					Melanoma(44;400 1431 1499 19093)	dbGAP											0													64.0	72.0	69.0					19																	38028653		2156	4288	6444	-	-	-	SO:0001583	missense	0			AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.1093A>G	19.37:g.38028653A>G	ENSP00000468605:p.Lys365Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K365E	ENST00000587143.1	37	c.1093	CCDS46062.1	19	.	.	.	.	.	.	.	.	.	.	A	20.6	4.010483	0.75046	.	.	ENSG00000188227	ENST00000542455;ENST00000445217	T;T	0.27104	1.69;1.69	3.95	3.95	0.45737	.	.	.	.	.	T	0.48059	0.1479	M	0.70842	2.15	0.30697	N	0.750758	D	0.89917	1.0	D	0.72625	0.978	T	0.50558	-0.8814	8	.	.	.	.	12.2004	0.54321	1.0:0.0:0.0:0.0	.	365	E9PGN4	.	E	365	ENSP00000444355:K365E;ENSP00000396402:K365E	.	K	+	1	0	ZNF793	42720493	1.000000	0.71417	0.988000	0.46212	0.910000	0.53928	7.814000	0.86154	1.763000	0.52060	0.528000	0.53228	AAG	ZNF793	-	pfscan_Znf_C2H2	ENSG00000188227		0.453	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF793	HGNC	protein_coding	OTTHUMT00000458621.1	25	0.00	0	A	NM_001013659		38028653	38028653	+1	no_errors	ENST00000445217	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	G
ZSCAN5B	342933	genome.wustl.edu	37	19	56703342	56703342	+	Silent	SNP	T	T	C			TCGA-AC-A3EH-01A-22D-A228-09	TCGA-AC-A3EH-11B-21D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b01def5e-e7b8-4a89-bc6c-4cc33528fb4e	a9f3d560-75fb-436a-90d4-8e70ebeb2d6c	g.chr19:56703342T>C	ENST00000586855.2	-	3	778	c.465A>G	c.(463-465)agA>agG	p.R155R	ZSCAN5B_ENST00000358992.3_Silent_p.R155R			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	155					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TCGGATCATCTCTGACACTGG	0.557																																						dbGAP											0													30.0	33.0	32.0					19																	56703342		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.465A>G	19.37:g.56703342T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R155	ENST00000586855.2	37	c.465	CCDS46203.1	19																																																																																			ZSCAN5B	-	NULL	ENSG00000197213		0.557	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	HGNC	protein_coding	OTTHUMT00000457834.2	55	0.00	0	T	NM_001080456		56703342	56703342	-1	no_errors	ENST00000358992	ensembl	human	known	69_37n	silent	47	11.32	6	SNP	0.000	C
