#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACOXL	55289	genome.wustl.edu	37	2	111562844	111562844	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr2:111562844G>C	ENST00000389811.4	+	9	849	c.625G>C	c.(625-627)Ggt>Cgt	p.G209R	ACOXL_ENST00000340561.4_Missense_Mutation_p.G209R|ACOXL_ENST00000439055.1_Missense_Mutation_p.G209R			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	209					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						CCACAGGTTTGGTTCCGTGGC	0.507																																						dbGAP											0													136.0	132.0	134.0					2																	111562844		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.625G>C	2.37:g.111562844G>C	ENSP00000374461:p.Gly209Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_Oxase/DH_1,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	p.G209R	ENST00000389811.4	37	c.625		2	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841699	0.71488	.	.	ENSG00000153093	ENST00000389811;ENST00000439055;ENST00000422487;ENST00000340561;ENST00000417074	D;D;D;D	0.99298	-5.71;-5.71;-5.71;-5.71	5.96	5.09	0.68999	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.116344	0.56097	D	0.000026	D	0.99417	0.9794	M	0.88842	2.985	0.43039	D	0.994621	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.74023	0.973;0.982;0.977	D	0.98808	1.0742	10	0.87932	D	0	-29.3213	13.0804	0.59112	0.0773:0.0:0.9227:0.0	.	209;209;209	E9PB20;Q9NUZ1-2;Q9NUZ1	.;.;ACOXL_HUMAN	R	209;209;60;209;47	ENSP00000374461:G209R;ENSP00000407761:G209R;ENSP00000343717:G209R;ENSP00000387832:G47R	ENSP00000343717:G209R	G	+	1	0	ACOXL	111279315	1.000000	0.71417	0.469000	0.27204	0.873000	0.50193	4.720000	0.61944	1.536000	0.49237	0.655000	0.94253	GGT	ACOXL	-	superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	ENSG00000153093		0.507	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	ACOXL	HGNC	protein_coding	OTTHUMT00000254024.2	33	0.00	0	G	NM_018308		111562844	111562844	+1	no_errors	ENST00000439055	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	C
ACTG1	71	genome.wustl.edu	37	17	79478936	79478936	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr17:79478936A>G	ENST00000575842.1	-	2	782	c.356T>C	c.(355-357)aTg>aCg	p.M119T	RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.M119T|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.M119T|ACTG1_ENST00000573283.1_Missense_Mutation_p.M119T			P63261	ACTG_HUMAN	actin, gamma 1	119					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			CACCTGAGTCATCTTCTCTCT	0.602																																						dbGAP											0													45.0	59.0	54.0					17																	79478936		2202	4296	6498	-	-	-	SO:0001583	missense	0				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.356T>C	17.37:g.79478936A>G	ENSP00000458162:p.Met119Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.M119T	ENST00000575842.1	37	c.356	CCDS11782.1	17	.	.	.	.	.	.	.	.	.	.	A	14.93	2.683349	0.47991	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.97303	-4.33	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	D	0.98261	0.9424	M	0.79258	2.445	0.54753	D	0.999982	P	0.42203	0.773	D	0.72075	0.976	D	0.99376	1.0921	10	0.87932	D	0	.	12.8459	0.57829	1.0:0.0:0.0:0.0	.	119	P63261	ACTG_HUMAN	T	119	ENSP00000331514:M119T	ENSP00000331514:M119T	M	-	2	0	ACTG1	77093531	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.818000	0.91991	1.681000	0.50988	0.460000	0.39030	ATG	ACTG1	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like	ENSG00000184009		0.602	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACTG1	HGNC	protein_coding	OTTHUMT00000439935.2	31	0.00	0	A	NM_001614		79478936	79478936	-1	no_errors	ENST00000331925	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	1.000	G
ACTRT1	139741	genome.wustl.edu	37	X	127185892	127185892	+	Silent	SNP	T	T	A			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chrX:127185892T>A	ENST00000371124.3	-	1	490	c.294A>T	c.(292-294)ggA>ggT	p.G98G		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	98						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						TGGGTTTTACTCCAAGCTCCC	0.478																																						dbGAP											0													225.0	215.0	219.0					X																	127185892		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.294A>T	X.37:g.127185892T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6X7C1|Q96L10	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.G98	ENST00000371124.3	37	c.294	CCDS14611.1	X																																																																																			ACTRT1	-	pfam_Actin-like,smart_Actin-like	ENSG00000123165		0.478	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	HGNC	protein_coding	OTTHUMT00000058192.1	31	0.00	0	T	NM_138289		127185892	127185892	-1	no_errors	ENST00000371124	ensembl	human	known	69_37n	silent	34	30.61	15	SNP	0.208	A
C19orf44	84167	genome.wustl.edu	37	19	16620384	16620384	+	Silent	SNP	G	G	A	rs539818641	byFrequency	TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr19:16620384G>A	ENST00000221671.3	+	5	1380	c.1224G>A	c.(1222-1224)ccG>ccA	p.P408P	C19orf44_ENST00000594035.1_Silent_p.P408P|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	408										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						AGGATGCCCCGAGGCAGGCCC	0.597																																						dbGAP											0													45.0	50.0	48.0					19																	16620384		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1224G>A	19.37:g.16620384G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6Y7	Silent	SNP	NULL	p.P408	ENST00000221671.3	37	c.1224	CCDS12345.1	19																																																																																			C19orf44	-	NULL	ENSG00000105072		0.597	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf44	HGNC	protein_coding	OTTHUMT00000461218.1	40	0.00	0	G	NM_032207		16620384	16620384	+1	no_errors	ENST00000221671	ensembl	human	known	69_37n	silent	38	22.45	11	SNP	0.000	A
COLQ	8292	genome.wustl.edu	37	3	15520859	15520859	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr3:15520859G>A	ENST00000383788.5	-	4	477	c.352C>T	c.(352-354)Cca>Tca	p.P118S	COLQ_ENST00000383786.5_Missense_Mutation_p.P84S|COLQ_ENST00000383785.2_Missense_Mutation_p.P118S|COLQ_ENST00000383787.2_Missense_Mutation_p.P118S|COLQ_ENST00000435459.2_Missense_Mutation_p.P108S|COLQ_ENST00000383781.4_Missense_Mutation_p.P108S|COLQ_ENST00000603808.1_Missense_Mutation_p.P118S	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	118	Collagen-like 1.				acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						TCTCCCTTTGGTCCTGTCTTG	0.463																																						dbGAP											0													137.0	134.0	135.0					3																	15520859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.352C>T	3.37:g.15520859G>A	ENSP00000373298:p.Pro118Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	pfam_Collagen,tigrfam_Myxo_disulph_rpt	p.P118S	ENST00000383788.5	37	c.352	CCDS33709.1	3	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953861	0.34471	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383785;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786;ENST00000430319	D;D;D;D;D;D	0.93307	-3.2;-2.73;-2.73;-2.73;-2.73;-2.73	5.37	3.54	0.40534	.	0.051075	0.85682	D	0.000000	D	0.95348	0.8490	M	0.76574	2.34	0.58432	D	0.999998	B;D;B;B	0.89917	0.221;1.0;0.297;0.419	B;D;B;B	0.87578	0.187;0.998;0.129;0.187	D	0.93006	0.6427	10	0.29301	T	0.29	-0.062	9.1696	0.37072	0.0:0.1596:0.6745:0.1659	.	84;118;118;108	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	S	118;108;108;118;118;108;118;84;61	ENSP00000373297:P118S;ENSP00000373291:P108S;ENSP00000402511:P108S;ENSP00000373295:P118S;ENSP00000373298:P118S;ENSP00000373296:P84S	ENSP00000373291:P108S	P	-	1	0	COLQ	15495863	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.775000	0.55349	0.717000	0.32145	0.561000	0.74099	CCA	COLQ	-	pfam_Collagen	ENSG00000206561		0.463	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COLQ	HGNC	protein_coding	OTTHUMT00000343575.1	39	0.00	0	G	NM_005677		15520859	15520859	-1	no_errors	ENST00000383788	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16957287	16957287	+	lincRNA	SNP	G	G	A	rs2151192	byFrequency	TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr1:16957287G>A	ENST00000412962.1	-	0	294							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGGGCGCTCAGACTCCTCCCC	0.682																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16957287G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.682	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	11	0.00	0	G	NR_026752.1		16957287	16957287	-1	no_errors	ENST00000362058	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	0.044	A
CTTNBP2	83992	genome.wustl.edu	37	7	117375424	117375426	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	ATG	ATG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr7:117375424_117375426delATG	ENST00000160373.3	-	15	3676_3678	c.3585_3587delCAT	c.(3583-3588)atcatt>att	p.1195_1196II>I		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1195					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ATTTTCTAAAATGATGATGATTT	0.345																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3585_3587delCAT	7.37:g.117375430_117375432delATG	ENSP00000160373:p.Ile1196del	Somatic		WXS	Illumina GAIIx	Phase_IV	O43389|Q7LG11|Q9C0A5	In_Frame_Del	DEL	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I1196in_frame_del	ENST00000160373.3	37	c.3587_3585	CCDS5774.1	7																																																																																			CTTNBP2	-	NULL	ENSG00000077063		0.345	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	30	0.00	0	ATG	NM_033427		117375424	117375426	-1	no_errors	ENST00000160373	ensembl	human	known	69_37n	in_frame_del	36	12.20	5	DEL	1.000:1.000:0.997	-
DMXL1	1657	genome.wustl.edu	37	5	118513861	118513861	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr5:118513861G>T	ENST00000311085.8	+	28	7137	c.7057G>T	c.(7057-7059)Gag>Tag	p.E2353*	DMXL1_ENST00000539542.1_Nonsense_Mutation_p.E2353*	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2353										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TCCTCTAAATGAGAAAATGTG	0.408																																						dbGAP											0													109.0	103.0	105.0					5																	118513861		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.7057G>T	5.37:g.118513861G>T	ENSP00000309690:p.Glu2353*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E2353*	ENST00000311085.8	37	c.7057	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	47	13.417468	0.99740	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	.	.	.	5.72	5.72	0.89469	.	0.199119	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-21.5627	10.0068	0.41961	0.1535:0.0:0.8465:0.0	.	.	.	.	X	2353	.	ENSP00000309690:E2353X	E	+	1	0	DMXL1	118541760	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.057000	0.49931	2.717000	0.92951	0.655000	0.94253	GAG	DMXL1	-	NULL	ENSG00000172869		0.408	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	41	0.00	0	G	NM_005509		118513861	118513861	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	nonsense	51	12.07	7	SNP	1.000	T
FAN1	22909	genome.wustl.edu	37	15	31197852	31197852	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr15:31197852A>T	ENST00000362065.4	+	2	1277	c.986A>T	c.(985-987)gAt>gTt	p.D329V	FAN1_ENST00000565466.1_Missense_Mutation_p.D329V|FAN1_ENST00000561594.1_Missense_Mutation_p.D329V|FAN1_ENST00000561607.1_Missense_Mutation_p.D329V	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	329					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						TCTGCAGATGATGCTTCTGCA	0.443								Direct reversal of damage																														dbGAP											0													84.0	77.0	79.0					15																	31197852		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.986A>T	15.37:g.31197852A>T	ENSP00000354497:p.Asp329Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4M2|Q86WU8	Missense_Mutation	SNP	pfam_VRR_NUC,smart_Znf_Rad18_put	p.D329V	ENST00000362065.4	37	c.986	CCDS32186.1	15	.	.	.	.	.	.	.	.	.	.	A	15.79	2.938309	0.52972	.	.	ENSG00000198690	ENST00000362065	T	0.42131	0.98	5.3	-0.521	0.11931	.	0.726462	0.13073	N	0.415976	T	0.43122	0.1233	M	0.67953	2.075	0.09310	N	0.999997	P;D	0.59767	0.868;0.986	B;P	0.53035	0.289;0.716	T	0.31280	-0.9949	10	0.22706	T	0.39	-3.014	3.1331	0.06430	0.5407:0.2238:0.1361:0.0995	.	329;329	Q9Y2M0;Q9Y2M0-2	FAN1_HUMAN;.	V	329	ENSP00000354497:D329V	ENSP00000354497:D329V	D	+	2	0	FAN1	28985144	0.110000	0.22057	0.000000	0.03702	0.139000	0.21198	1.153000	0.31676	0.004000	0.14682	0.533000	0.62120	GAT	FAN1	-	NULL	ENSG00000198690		0.443	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAN1	HGNC	protein_coding	OTTHUMT00000430740.1	34	0.00	0	A	NM_014967		31197852	31197852	+1	no_errors	ENST00000362065	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.000	T
GPR123	84435	genome.wustl.edu	37	10	134942831	134942831	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr10:134942831C>T	ENST00000392607.3	+	7	1935	c.1499C>T	c.(1498-1500)cCg>cTg	p.P500L	GPR123_ENST00000392606.2_Missense_Mutation_p.P403L|GPR123_ENST00000607359.1_Missense_Mutation_p.P1219L	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	500					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CCCACGCAGCCGGGCAGGGAG	0.711																																						dbGAP											0													8.0	8.0	8.0					10																	134942831		2142	4221	6363	-	-	-	SO:0001583	missense	0			AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.1499C>T	10.37:g.134942831C>T	ENSP00000376384:p.Pro500Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	p.P404L	ENST00000392607.3	37	c.1211	CCDS41580.1	10	.	.	.	.	.	.	.	.	.	.	.	4.429	0.079433	0.08533	.	.	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.03889	3.77	3.71	0.469	0.16741	.	0.736359	0.12041	N	0.505051	T	0.03871	0.0109	N	0.22421	0.69	0.26409	N	0.976297	B;P	0.51240	0.223;0.943	B;P	0.44518	0.01;0.452	T	0.40308	-0.9570	10	0.72032	D	0.01	-3.0817	4.0081	0.09610	0.1837:0.5771:0.0:0.2392	.	500;1219	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	L	1219;500;404	ENSP00000376384:P500L	ENSP00000357566:P1219L	P	+	2	0	GPR123	134792821	0.018000	0.18449	0.009000	0.14445	0.004000	0.04260	0.304000	0.19228	0.138000	0.18790	-1.348000	0.01239	CCG	GPR123	-	NULL	ENSG00000197177		0.711	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	GPR123	HGNC	protein_coding	OTTHUMT00000051113.2	10	0.00	0	C			134942831	134942831	+1	no_errors	ENST00000392606	ensembl	human	putative	69_37n	missense	27	30.77	12	SNP	0.348	T
HMHA1	23526	genome.wustl.edu	37	19	1080476	1080476	+	Missense_Mutation	SNP	C	C	A	rs150994364	byFrequency	TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr19:1080476C>A	ENST00000313093.2	+	15	2073	c.1842C>A	c.(1840-1842)caC>caA	p.H614Q	HMHA1_ENST00000590577.1_Missense_Mutation_p.H249Q|HMHA1_ENST00000536472.1_Missense_Mutation_p.H482Q|HMHA1_ENST00000590214.1_Missense_Mutation_p.H641Q|HMHA1_ENST00000543365.1_Missense_Mutation_p.H497Q|HMHA1_ENST00000586866.1_Missense_Mutation_p.H618Q|HMHA1_ENST00000539243.2_Missense_Mutation_p.H630Q	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	614					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGAGGACACCAGGTTCACA	0.706																																						dbGAP											0													43.0	48.0	46.0					19																	1080476		2202	4298	6500	-	-	-	SO:0001583	missense	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.1842C>A	19.37:g.1080476C>A	ENSP00000316772:p.His614Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.H614Q	ENST00000313093.2	37	c.1842	CCDS32863.1	19	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882902	0.33255	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.21031	2.06;2.06;2.05;2.03	4.17	3.1	0.35709	.	0.143817	0.44483	U	0.000442	T	0.29389	0.0732	L	0.39633	1.23	0.35024	D	0.758146	D;D;P;D;D	0.76494	0.997;0.999;0.893;0.993;0.987	D;D;P;P;P	0.68943	0.925;0.961;0.614;0.865;0.67	T	0.29488	-1.0010	10	0.23891	T	0.37	-28.4574	7.8336	0.29358	0.0:0.798:0.0:0.202	.	482;630;249;497;614	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	Q	630;614;614;482;608;497	ENSP00000439601:H630Q;ENSP00000316772:H614Q;ENSP00000445109:H482Q;ENSP00000438979:H497Q	ENSP00000316772:H614Q	H	+	3	2	HMHA1	1031476	1.000000	0.71417	0.987000	0.45799	0.519000	0.34347	0.986000	0.29590	0.718000	0.32166	0.555000	0.69702	CAC	HMHA1	-	NULL	ENSG00000180448		0.706	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	59	0.00	0	C			1080476	1080476	+1	no_errors	ENST00000313093	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	1.000	A
KIAA0319L	79932	genome.wustl.edu	37	1	35921805	35921806	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr1:35921805_35921806insA	ENST00000325722.3	-	10	1698_1699	c.1464_1465insT	c.(1462-1467)tctactfs	p.T489fs	KIAA0319L_ENST00000485551.1_5'UTR|KIAA0319L_ENST00000373266.4_5'Flank	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	489	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTTGCAGTAGTAGAGTTGGTAG	0.51																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1465dupT	1.37:g.35921806_35921806dupA	ENSP00000318406:p.Thr489fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Frame_Shift_Ins	INS	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.T488fs	ENST00000325722.3	37	c.1465_1464	CCDS390.1	1																																																																																			KIAA0319L	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom	ENSG00000142687		0.510	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	43	0.00	0	-	NM_024874		35921805	35921806	-1	no_errors	ENST00000325722	ensembl	human	known	69_37n	frame_shift_ins	60	18.92	14	INS	0.988:0.022	A
C2CD5	9847	genome.wustl.edu	37	12	22678546	22678546	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr12:22678546C>A	ENST00000333957.4	-	5	698	c.443G>T	c.(442-444)tGc>tTc	p.C148F	C2CD5_ENST00000545552.1_Missense_Mutation_p.C148F|C2CD5_ENST00000396028.2_Missense_Mutation_p.C148F|C2CD5_ENST00000446597.1_Missense_Mutation_p.C148F|C2CD5_ENST00000544930.1_5'UTR|C2CD5_ENST00000536386.1_Missense_Mutation_p.C148F|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000542676.1_Missense_Mutation_p.C148F	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	148					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										TTACTTACTGCAAAAGAATTT	0.318																																						dbGAP											0													141.0	154.0	150.0					12																	22678546		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.443G>T	12.37:g.22678546C>A	ENSP00000334229:p.Cys148Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.C148F	ENST00000333957.4	37	c.443	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	C	13.03	2.116321	0.37339	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552	T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.08;-0.07;-0.99;-0.08	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.79179	0.4402	L	0.51422	1.61	0.80722	D	1	B;B;B;D;B	0.54964	0.402;0.173;0.28;0.969;0.101	B;B;B;P;B	0.51516	0.142;0.067;0.067;0.672;0.067	T	0.79878	-0.1617	10	0.59425	D	0.04	-20.2327	19.975	0.97300	0.0:1.0:0.0:0.0	.	148;148;148;148;148	F5H2A1;B4DRN7;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;K0528_HUMAN	F	148	ENSP00000334229:C148F;ENSP00000388756:C148F;ENSP00000439392:C148F;ENSP00000379345:C148F;ENSP00000441951:C148F;ENSP00000443204:C148F	ENSP00000334229:C148F	C	-	2	0	KIAA0528	22569813	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.731000	0.84895	2.724000	0.93272	0.585000	0.79938	TGC	KIAA0528	-	NULL	ENSG00000111731		0.318	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0528	HGNC	protein_coding	OTTHUMT00000402257.1	18	0.00	0	C	NM_014802		22678546	22678546	-1	no_errors	ENST00000333957	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	GL000209.1	8628	8630	+	IGR	DEL	TTC	TTC	-			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chrGL000209.1:8628_8630delTTC								None (None upstream) : None (None downstream)																							CTTTCCAGGGTTCTTCTTGCTGG	0.517																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															GL000209.1.37:g.8631_8633delTTC		Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2	p.F14in_frame_del		37	c.37_39		GL000209.1																																																																																			KIR2DL2	-	NULL	ENSG00000215764	0	0.517					KIR2DL2	HGNC			16	0.00	0	TTC			8628	8630	+1	no_errors	ENST00000400875	ensembl	human	known	69_37n	in_frame_del	22	33.33	11	DEL	NULL	-
LRRK2	120892	genome.wustl.edu	37	12	40643748	40643748	+	Splice_Site	SNP	G	G	A			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr12:40643748G>A	ENST00000298910.7	+	8	1016		c.e8+1		LRRK2_ENST00000343742.2_Splice_Site	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCCCTCCTCAGTAAGTAACTT	0.418																																						dbGAP											0													70.0	63.0	66.0					12																	40643748		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.958+1G>A	12.37:g.40643748G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Splice_Site	SNP	-	e8+1	ENST00000298910.7	37	c.958+1	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798834	0.70567	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.364	0.90384	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRK2	38930015	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	6.603000	0.74145	2.627000	0.88993	0.558000	0.71614	.	LRRK2	-	-	ENSG00000188906		0.418	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	29	0.00	0	G	XM_058513	Intron	40643748	40643748	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	splice_site	28	26.32	10	SNP	1.000	A
MAP3K8	1326	genome.wustl.edu	37	10	30736871	30736871	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr10:30736871G>T	ENST00000263056.1	+	4	1193	c.497G>T	c.(496-498)tGt>tTt	p.C166F	MAP3K8_ENST00000542547.1_Missense_Mutation_p.C166F|MAP3K8_ENST00000375321.1_Missense_Mutation_p.C166F	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	166	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				AGAATGGCGTGTAAACTGGTA	0.388																																						dbGAP											0													127.0	130.0	129.0					10																	30736871		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.497G>T	10.37:g.30736871G>T	ENSP00000263056:p.Cys166Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C166F	ENST00000263056.1	37	c.497	CCDS7166.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.468861|4.468861	0.84533|0.84533	.|.	.|.	ENSG00000107968|ENSG00000107968	ENST00000375328;ENST00000263056;ENST00000542547;ENST00000415139;ENST00000413724;ENST00000375321|ENST00000430603	T;T;T;T;T|.	0.48836|.	1.1;1.1;0.8;0.8;1.1|.	5.59|5.59	5.59|5.59	0.84812|0.84812	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67429|0.67429	0.2892|0.2892	L|L	0.41492|0.41492	1.28|1.28	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.83275|.	0.996|.	T|T	0.62148|0.62148	-0.6915|-0.6915	10|5	0.87932|.	D|.	0|.	.|.	19.597|19.597	0.95544|0.95544	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	166|.	P41279|.	M3K8_HUMAN|.	F|L	166|87	ENSP00000263056:C166F;ENSP00000443610:C166F;ENSP00000409653:C166F;ENSP00000391275:C166F;ENSP00000364470:C166F|.	ENSP00000263056:C166F|.	C|V	+|+	2|1	0|0	MAP3K8|MAP3K8	30776877|30776877	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.887000|0.887000	0.51463|0.51463	9.140000|9.140000	0.94607|0.94607	2.639000|2.639000	0.89480|0.89480	0.655000|0.655000	0.94253|0.94253	TGT|GTA	MAP3K8	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000107968		0.388	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAP3K8	HGNC	protein_coding	OTTHUMT00000047416.2	21	0.00	0	G	NM_005204		30736871	30736871	+1	no_errors	ENST00000263056	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	1.000	T
MYBPH	4608	genome.wustl.edu	37	1	203140616	203140616	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr1:203140616T>C	ENST00000255416.4	-	5	745	c.688A>G	c.(688-690)Atc>Gtc	p.I230V		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	230	Ig-like C2-type 1.				cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		ATGAAGAGGATGGAGTCCTGG	0.647																																					NSCLC(32;174 1025 14462 23899 42933)	dbGAP											0													70.0	67.0	68.0					1																	203140616		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.688A>G	1.37:g.203140616T>C	ENSP00000255416:p.Ile230Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16886|Q86YC5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I230V	ENST00000255416.4	37	c.688	CCDS30975.1	1	.	.	.	.	.	.	.	.	.	.	T	18.90	3.720946	0.68959	.	.	ENSG00000133055	ENST00000255416	T	0.66280	-0.2	4.62	3.48	0.39840	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000041	T	0.55465	0.1922	L	0.48174	1.505	0.41761	D	0.989718	P	0.41498	0.752	B	0.42882	0.401	T	0.51710	-0.8671	10	0.31617	T	0.26	.	10.4618	0.44583	0.0:0.0775:0.0:0.9224	.	230	Q13203	MYBPH_HUMAN	V	230	ENSP00000255416:I230V	ENSP00000255416:I230V	I	-	1	0	MYBPH	201407239	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.627000	0.61276	0.895000	0.36342	0.459000	0.35465	ATC	MYBPH	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000133055		0.647	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPH	HGNC	protein_coding	OTTHUMT00000100264.1	60	0.00	0	T	NM_004997		203140616	203140616	-1	no_errors	ENST00000255416	ensembl	human	known	69_37n	missense	87	15.53	16	SNP	1.000	C
NOL6	65083	genome.wustl.edu	37	9	33470121	33470121	+	Silent	SNP	C	C	T	rs570175286		TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr9:33470121C>T	ENST00000379471.2	-	4	534	c.447G>A	c.(445-447)aaG>aaA	p.K149K	NOL6_ENST00000455041.2_Intron|NOL6_ENST00000464829.1_5'UTR			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	149					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		GGAAACAGCCCTTCACGGCAT	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		18167	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													56.0	50.0	52.0					9																	33470121		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.447G>A	9.37:g.33470121C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	pfam_Nrap	p.K149	ENST00000379471.2	37	c.447		9																																																																																			NOL6	-	NULL	ENSG00000165271		0.602	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	NOL6	HGNC	protein_coding	OTTHUMT00000001019.2	26	0.00	0	C	NM_022917		33470121	33470121	-1	no_errors	ENST00000297990	ensembl	human	known	69_37n	silent	37	30.19	16	SNP	0.999	T
NOTCH2	4853	genome.wustl.edu	37	1	120611960	120611960	+	Missense_Mutation	SNP	C	C	T	rs2603926		TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr1:120611960C>T	ENST00000256646.2	-	1	280	c.61G>A	c.(61-63)Gcc>Acc	p.A21T		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	21				A -> T (in Ref. 2; AAG37073). {ECO:0000305}.	apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCGCGGGGGCCGCGCAGCAC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													6.0	8.0	8.0					1																	120611960		1705	3725	5430	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.61G>A	1.37:g.120611960C>T	ENSP00000256646:p.Ala21Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A21T	ENST00000256646.2	37	c.61	CCDS908.1	1	338	0.15476190476190477	115	0.23373983739837398	62	0.1712707182320442	66	0.11538461538461539	95	0.12532981530343007	c	6.410	0.443770	0.12164	.	.	ENSG00000134250	ENST00000256646	T	0.57752	0.38	3.09	2.14	0.27477	.	.	.	.	.	T	0.07324	0.0185	N	0.01874	-0.695	0.18873	N	0.999985	B;B	0.18461	0.0;0.028	B;B	0.11329	0.0;0.006	T	0.40813	-0.9543	9	0.13470	T	0.59	.	6.5614	0.22489	0.0:0.8575:0.0:0.1425	.	21;21	Q6IQ50;Q04721	.;NOTC2_HUMAN	T	21	ENSP00000256646:A21T	ENSP00000256646:A21T	A	-	1	0	NOTCH2	120413483	0.972000	0.33761	0.995000	0.50966	0.349000	0.29174	0.433000	0.21477	0.641000	0.30601	0.184000	0.17185	GCC	NOTCH2	-	pirsf_Notch	ENSG00000134250		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	21	0.00	0	C	NM_024408		120611960	120611960	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	0.990	T
NRBF2	29982	genome.wustl.edu	37	10	64913409	64913409	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr10:64913409C>G	ENST00000277746.6	+	4	476	c.295C>G	c.(295-297)Cag>Gag	p.Q99E	NRBF2_ENST00000435510.2_Missense_Mutation_p.Q89E	NM_030759.3	NP_110386.2	Q96F24	NRBF2_HUMAN	nuclear receptor binding factor 2	99					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)				large_intestine(2)|lung(3)|skin(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					TGCCCATCTTCAGACATCTCA	0.527																																						dbGAP											0													46.0	49.0	48.0					10																	64913409		2203	4300	6503	-	-	-	SO:0001583	missense	0			D82519	CCDS7268.1, CCDS60537.1	10q22.1	2012-11-01			ENSG00000148572	ENSG00000148572			19692	protein-coding gene	gene with protein product	"""comodulator of PPAR and RXR 1"", ""comodulator of PPAR and RXR 2"""					10786636	Standard	NM_001282405		Approved	DKFZp564C1664, FLJ30395, COPR1, COPR2	uc001jmj.4	Q96F24	OTTHUMG00000018309	ENST00000277746.6:c.295C>G	10.37:g.64913409C>G	ENSP00000277746:p.Gln99Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PW36|B4DWS0|Q86UR2|Q96NP6|Q9H0S9|Q9H2I2	Missense_Mutation	SNP	pfam_DUF1875	p.Q99E	ENST00000277746.6	37	c.295	CCDS7268.1	10	.	.	.	.	.	.	.	.	.	.	C	13.77	2.337152	0.41398	.	.	ENSG00000148572	ENST00000277746;ENST00000435510	.	.	.	5.36	5.36	0.76844	.	0.320106	0.33631	N	0.004707	T	0.73202	0.3557	M	0.69823	2.125	0.45979	D	0.998794	D;P	0.54207	0.965;0.811	P;B	0.53760	0.734;0.397	T	0.71839	-0.4471	9	0.33940	T	0.23	-7.6488	19.0849	0.93200	0.0:1.0:0.0:0.0	.	89;99	B4DWS0;Q96F24	.;NRBF2_HUMAN	E	99;89	.	ENSP00000277746:Q99E	Q	+	1	0	NRBF2	64583415	1.000000	0.71417	0.945000	0.38365	0.190000	0.23558	6.467000	0.73547	2.521000	0.84997	0.563000	0.77884	CAG	NRBF2	-	pfam_DUF1875	ENSG00000148572		0.527	NRBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRBF2	HGNC	protein_coding	OTTHUMT00000048247.1	28	0.00	0	C	NM_030759		64913409	64913409	+1	no_errors	ENST00000277746	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.991	G
OR5M3	219482	genome.wustl.edu	37	11	56237368	56237368	+	Silent	SNP	G	G	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr11:56237368G>T	ENST00000312240.2	-	1	646	c.606C>A	c.(604-606)ggC>ggA	p.G202G		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TGAAGTTAATGCCGGCAAGTA	0.418																																						dbGAP											0													128.0	125.0	126.0					11																	56237368		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.606C>A	11.37:g.56237368G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNM7|Q6IEW4|Q96RC0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G202	ENST00000312240.2	37	c.606	CCDS31532.1	11																																																																																			OR5M3	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174937		0.418	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	HGNC	protein_coding	OTTHUMT00000391639.1	62	0.00	0	G	NM_001004742		56237368	56237368	-1	no_errors	ENST00000312240	ensembl	human	known	69_37n	silent	56	22.22	16	SNP	0.000	T
PACS1	55690	genome.wustl.edu	37	11	65978677	65978677	+	Missense_Mutation	SNP	C	C	T	rs398123009		TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr11:65978677C>T	ENST00000320580.4	+	4	640	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	203			R -> W (in MRD17). {ECO:0000269|PubMed:23159249}.	Missing (in Ref. 2; BAC04831). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.R203W(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TTACAAGAATCGGACCATCTT	0.488																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											201.0	168.0	179.0					11																	65978677		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.607C>T	11.37:g.65978677C>T	ENSP00000316454:p.Arg203Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.R203W	ENST00000320580.4	37	c.607	CCDS8129.1	11	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102284	0.76983	.	.	ENSG00000175115	ENST00000320580;ENST00000533756;ENST00000527380	T	0.38077	1.16	4.79	4.79	0.61399	.	0.111023	0.64402	D	0.000006	T	0.63331	0.2502	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.948;0.987	T	0.69083	-0.5239	10	0.87932	D	0	-22.9264	12.765	0.57386	0.1648:0.8352:0.0:0.0	.	203;203	Q6VY07;Q6VY07-2	PACS1_HUMAN;.	W	203;100;105	ENSP00000316454:R203W	ENSP00000316454:R203W	R	+	1	2	PACS1	65735253	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	2.044000	0.41241	2.659000	0.90383	0.313000	0.20887	CGG	PACS1	-	NULL	ENSG00000175115		0.488	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACS1	HGNC	protein_coding	OTTHUMT00000391690.2	57	0.00	0	C	NM_018026		65978677	65978677	+1	no_errors	ENST00000320580	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	1.000	T
PARPBP	55010	genome.wustl.edu	37	12	102548700	102548700	+	Intron	SNP	G	G	T	rs2102476	byFrequency	TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr12:102548700G>T	ENST00000358383.5	+	4	540				PARPBP_ENST00000378128.3_Intron|PARPBP_ENST00000535811.1_Intron|PARPBP_ENST00000541394.1_Intron|PARPBP_ENST00000543784.1_Intron|PARPBP_ENST00000392911.2_Intron|PARPBP_ENST00000327680.2_Intron			Q9NWS1	PARI_HUMAN	PARP1 binding protein						DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						cctatgagacgtcatctacat	0.413													T|||	1577	0.314896	0.4213	0.2536	5008	,	,		18206	0.4187		0.2207	False		,,,				2504	0.2045					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.495+946G>T	12.37:g.102548700G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	RNA	SNP	-	NULL	ENST00000358383.5	37	NULL	CCDS9090.2	12																																																																																			PARPBP	-	-	ENSG00000185480		0.413	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	24	0.00	0	G	NM_017915		102548700	102548700	+1	no_errors	ENST00000541668	ensembl	human	known	69_37n	rna	17	14.29	3	SNP	0.565	T
PDCD4	27250	genome.wustl.edu	37	10	112650361	112650361	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr10:112650361G>C	ENST00000280154.7	+	8	1197	c.923G>C	c.(922-924)gGa>gCa	p.G308A	PDCD4_ENST00000481353.1_3'UTR|PDCD4_ENST00000393104.2_Missense_Mutation_p.G297A	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	308					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TCTAAAGGTGGAAAGCGTAAA	0.388																																					Ovarian(115;1498 1603 9363 40056 40885)	dbGAP											0													177.0	179.0	179.0					10																	112650361		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.923G>C	10.37:g.112650361G>C	ENSP00000280154:p.Gly308Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI	p.G308A	ENST00000280154.7	37	c.923	CCDS7567.1	10	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125865	0.56721	.	.	ENSG00000150593	ENST00000280154;ENST00000393104	T;T	0.39592	1.07;1.07	5.16	5.16	0.70880	Armadillo-type fold (1);	0.099210	0.64402	D	0.000001	T	0.42245	0.1194	M	0.63428	1.95	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.002;0.003	T	0.35895	-0.9770	10	0.14656	T	0.56	-11.2241	18.6411	0.91396	0.0:0.0:1.0:0.0	.	294;308;297	B4DKX4;Q53EL6;B5ME91	.;PDCD4_HUMAN;.	A	308;297	ENSP00000280154:G308A;ENSP00000376816:G297A	ENSP00000280154:G308A	G	+	2	0	PDCD4	112640351	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.247000	0.72411	2.404000	0.81709	0.650000	0.86243	GGA	PDCD4	-	superfamily_ARM-type_fold	ENSG00000150593		0.388	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD4	HGNC	protein_coding	OTTHUMT00000050361.1	86	0.00	0	G	NM_014456		112650361	112650361	+1	no_errors	ENST00000280154	ensembl	human	known	69_37n	missense	86	16.35	17	SNP	1.000	C
PHC3	80012	genome.wustl.edu	37	3	169846622	169846622	+	Silent	SNP	G	G	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr3:169846622G>T	ENST00000494943.1	-	8	1670	c.1602C>A	c.(1600-1602)ggC>ggA	p.G534G	PHC3_ENST00000467570.1_Silent_p.G493G|PHC3_ENST00000495893.2_Silent_p.G546G			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	534	Gln-rich.|Pro-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			CCAAAACCTGGCCCTGGGACA	0.517																																						dbGAP											0													131.0	134.0	133.0					3																	169846622		1952	4143	6095	-	-	-	SO:0001819	synonymous_variant	0				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.1602C>A	3.37:g.169846622G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.G546	ENST00000494943.1	37	c.1638		3																																																																																			PHC3	-	NULL	ENSG00000173889		0.517	PHC3-004	KNOWN	basic	protein_coding	PHC3	HGNC	protein_coding	OTTHUMT00000352182.3	29	0.00	0	G	NM_024947		169846622	169846622	-1	no_errors	ENST00000495893	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	1.000	T
PIK3C2G	5288	genome.wustl.edu	37	12	18435178	18435178	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr12:18435178G>T	ENST00000266497.5	+	1	201	c.163G>T	c.(163-165)Gag>Tag	p.E55*	PIK3C2G_ENST00000538779.1_Nonsense_Mutation_p.E55*|RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000535651.1_Nonsense_Mutation_p.E55*|PIK3C2G_ENST00000433979.1_Nonsense_Mutation_p.E55*			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	55					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TCCACACTACGAGAGTGAAAT	0.398																																						dbGAP											0													76.0	72.0	73.0					12																	18435178		1867	4099	5966	-	-	-	SO:0001587	stop_gained	0			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.163G>T	12.37:g.18435178G>T	ENSP00000266497:p.Glu55*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U0	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.E55*	ENST00000266497.5	37	c.163	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	G	12.50	1.957462	0.34565	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	.	.	.	4.64	-3.25	0.05079	.	1.835830	0.03304	N	0.189433	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	0.2176	9.0883	0.36594	0.4023:0.1921:0.4056:0.0	.	.	.	.	X	55	.	ENSP00000266497:E55X	E	+	1	0	PIK3C2G	18326445	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-0.329000	0.07935	-0.648000	0.05437	-0.794000	0.03295	GAG	PIK3C2G	-	NULL	ENSG00000139144		0.398	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	27	0.00	0	G	NM_004570		18435178	18435178	+1	no_errors	ENST00000538779	ensembl	human	known	69_37n	nonsense	28	31.71	13	SNP	0.000	T
PRDM11	56981	genome.wustl.edu	37	11	45230588	45230588	+	Intron	SNP	C	C	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr11:45230588C>T	ENST00000530656.1	+	5	656				PRDM11_ENST00000424263.2_Intron|PRDM11_ENST00000528980.1_Intron|PRDM11_ENST00000263765.4_Intron			Q9NQV5	PRD11_HUMAN	PR domain containing 11								methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						AGGCATAGCCCGGAAAATCAC	0.557																																					NSCLC(118;1511 1736 6472 36603 43224)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.656+4259C>T	11.37:g.45230588C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N9F1	Missense_Mutation	SNP	smart_SANT/Myb	p.P203L	ENST00000530656.1	37	c.608		11																																																																																			PRDM11	-	smart_SANT/Myb	ENSG00000019485		0.557	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	HGNC	protein_coding	OTTHUMT00000389928.1	12	0.00	0	C	NM_020229		45230588	45230588	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000534751	ensembl	human	putative	69_37n	missense	11	45.00	9	SNP	1.000	T
QSOX1	5768	genome.wustl.edu	37	1	180165578	180165578	+	Silent	SNP	T	T	C			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr1:180165578T>C	ENST00000367602.3	+	12	1724	c.1650T>C	c.(1648-1650)gcT>gcC	p.A550A	QSOX1_ENST00000367600.5_Silent_p.A550A			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	550					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTGGGTCAGCTGCCCGGAGGG	0.622																																						dbGAP											0													94.0	103.0	100.0					1																	180165578		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1650T>C	1.37:g.180165578T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Silent	SNP	pfam_Evr1_Alr,pfam_Thioredoxin_domain,superfamily_Evr1_Alr,superfamily_Thioredoxin-like_fold	p.A550	ENST00000367602.3	37	c.1650	CCDS1337.1	1																																																																																			QSOX1	-	NULL	ENSG00000116260		0.622	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	HGNC	protein_coding	OTTHUMT00000085289.1	50	0.00	0	T	NM_002826		180165578	180165578	+1	no_errors	ENST00000367602	ensembl	human	known	69_37n	silent	75	15.73	14	SNP	0.000	C
RAB2A	5862	genome.wustl.edu	37	8	61533234	61533234	+	Splice_Site	SNP	C	C	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr8:61533234C>T	ENST00000262646.7	+	8	896	c.545C>T	c.(544-546)gCa>gTa	p.A182V	RAB2A_ENST00000530071.1_3'UTR|RAB2A_ENST00000529579.1_Splice_Site_p.Q145*|RAB2A_ENST00000531289.1_Splice_Site_p.A158V	NM_002865.2	NP_002856.1	P61019	RAB2A_HUMAN	RAB2A, member RAS oncogene family	182					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(4)	6			BRCA - Breast invasive adenocarcinoma(89;0.0805)			TTATTTCAGGCAAATGGCATT	0.383																																						dbGAP											0													75.0	80.0	79.0					8																	61533234		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS6175.1, CCDS56537.1	8q12.1	2007-01-15	2007-01-15	2007-01-15	ENSG00000104388	ENSG00000104388		"""RAB, member RAS oncogene"""	9763	protein-coding gene	gene with protein product		179509	"""RAB2, member RAS oncogene family"""	RAB2			Standard	NM_002865		Approved		uc003xud.2	P61019	OTTHUMG00000134298	ENST00000262646.7:c.544-1C>T	8.37:g.61533234C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5W8|B4DMQ5|P08886	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q145*	ENST00000262646.7	37	c.433	CCDS6175.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.86|15.86	2.957444|2.957444	0.53400|0.53400	.|.	.|.	ENSG00000104388|ENSG00000104388	ENST00000262646;ENST00000531289;ENST00000543829|ENST00000529579	T;T|.	0.62498|.	0.02;0.41|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.63651|.	0.2529|.	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.06405|.	0.002;0.001|.	T|.	0.65631|.	-0.6121|.	10|.	0.42905|0.87932	T|D	0.14|0	.|.	19.7923|19.7923	0.96464|0.96464	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	158;182|.	B4DMQ5;P61019|.	.;RAB2A_HUMAN|.	V|X	182;158;136|145	ENSP00000262646:A182V;ENSP00000431846:A158V|.	ENSP00000262646:A182V|ENSP00000431589:Q145X	A|Q	+|+	2|1	0|0	RAB2A|RAB2A	61695788|61695788	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	7.053000|7.053000	0.76641|0.76641	2.752000|2.752000	0.94435|0.94435	0.557000|0.557000	0.71058|0.71058	GCA|CAA	RAB2A	-	smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase	ENSG00000104388		0.383	RAB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB2A	HGNC	protein_coding	OTTHUMT00000259145.2	35	0.00	0	C		Missense_Mutation	61533234	61533234	+1	no_errors	ENST00000529579	ensembl	human	novel	69_37n	nonsense	59	25.32	20	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113189940	113189940	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr9:113189940A>T	ENST00000401783.2	-	36	6242	c.5906T>A	c.(5905-5907)aTc>aAc	p.I1969N	SVEP1_ENST00000297826.5_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.I1946N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1969	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						AGCATCTTTGATGGCAGGTGG	0.507											OREG0019389	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													122.0	125.0	124.0					9																	113189940		2080	4218	6298	-	-	-	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.5906T>A	9.37:g.113189940A>T	ENSP00000384917:p.Ile1969Asn	Somatic	1448	WXS	Illumina GAIIx	Phase_IV	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.I1969N	ENST00000401783.2	37	c.5906	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	A	27.9	4.873772	0.91664	.	.	ENSG00000165124	ENST00000401783;ENST00000374469	T;T	0.68624	-0.34;-0.34	6.17	6.17	0.99709	Complement control module (2);Sushi/SCR/CCP (3);	0.231571	0.45361	D	0.000376	T	0.81389	0.4812	M	0.87269	2.87	0.80722	D	1	D	0.57257	0.979	P	0.58331	0.837	T	0.80710	-0.1261	10	0.27082	T	0.32	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1969	Q4LDE5	SVEP1_HUMAN	N	1969;1946	ENSP00000384917:I1969N;ENSP00000363593:I1946N	ENSP00000363593:I1946N	I	-	2	0	SVEP1	112229761	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.583000	0.90794	2.371000	0.80710	0.533000	0.62120	ATC	SVEP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.507	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		55	0.00	0	A			113189940	113189940	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	missense	49	27.94	19	SNP	1.000	T
TAS2R42	353164	genome.wustl.edu	37	12	11338712	11338712	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr12:11338712A>G	ENST00000334266.1	-	1	831	c.832T>C	c.(832-834)Tcg>Ccg	p.S278P		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	278					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			GAGTGGCACGAGGGAAAGGCA	0.398																																					Melanoma(15;352 722 10077 19546 48810)	dbGAP											0													88.0	81.0	83.0					12																	11338712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.832T>C	12.37:g.11338712A>G	ENSP00000334050:p.Ser278Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRP4|Q645X0	Missense_Mutation	SNP	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.S278P	ENST00000334266.1	37	c.832	CCDS31747.1	12	.	.	.	.	.	.	.	.	.	.	A	15.03	2.713021	0.48517	.	.	ENSG00000186136	ENST00000334266	T	0.38401	1.14	4.02	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.961498	0.08500	N	0.936626	T	0.60143	0.2246	M	0.75150	2.29	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.42085	-0.9472	10	0.72032	D	0.01	.	9.6432	0.39853	1.0:0.0:0.0:0.0	.	278	Q7RTR8	T2R42_HUMAN	P	278	ENSP00000334050:S278P	ENSP00000334050:S278P	S	-	1	0	TAS2R42	11229979	0.000000	0.05858	0.015000	0.15790	0.023000	0.10783	-0.187000	0.09656	1.619000	0.50296	0.528000	0.53228	TCG	TAS2R42	-	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186136		0.398	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R42	HGNC	protein_coding	OTTHUMT00000400243.1	24	0.00	0	A	NM_181429		11338712	11338712	-1	no_errors	ENST00000334266	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.025	G
THEM5	284486	genome.wustl.edu	37	1	151819755	151819755	+	3'UTR	DEL	C	C	-	rs146445621		TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr1:151819755delC	ENST00000368817.5	-	0	967				AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5						cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			aggaggcaggcaggggaggca	0.701																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.*92G>-	1.37:g.151819755delC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1C3	Frame_Shift_Del	DEL	pfam_Thioestr_supf	p.P209fs	ENST00000368817.5	37	c.624	CCDS1005.1	1																																																																																			THEM5	-	NULL	ENSG00000196407		0.701	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	20	0.00	0	C	NM_182578		151819755	151819755	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453881	ensembl	human	known	69_37n	frame_shift_del	31	15.38	6	DEL	0.108	-
TPPP3	51673	genome.wustl.edu	37	16	67424196	67424196	+	Missense_Mutation	SNP	G	G	A	rs562124643		TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr16:67424196G>A	ENST00000564104.1	-	3	1253	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C	TPPP3_ENST00000393957.2_Missense_Mutation_p.R138C|TPPP3_ENST00000562206.1_Missense_Mutation_p.R138C|RNU1-123P_ENST00000458950.1_RNA|TPPP3_ENST00000290942.5_Missense_Mutation_p.R138C			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	138					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		TCATCGAAGCGCTCCTTGTGG	0.597													g|||	1	0.000199681	0.0	0.0	5008	,	,		18099	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													141.0	121.0	128.0					16																	67424196		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.412C>T	16.37:g.67424196G>A	ENSP00000462435:p.Arg138Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AH9|Q9Y326|Q9Y6H0	Missense_Mutation	SNP	pfam_P25-alpha	p.R138C	ENST00000564104.1	37	c.412	CCDS10835.1	16	.	.	.	.	.	.	.	.	.	.	g	19.90	3.913007	0.72983	.	.	ENSG00000159713	ENST00000393957;ENST00000290942	T;T	0.59083	0.29;0.29	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.81602	0.4857	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87291	0.2299	10	0.87932	D	0	-21.6599	15.6512	0.77095	0.0:0.0:1.0:0.0	.	138	Q9BW30	TPPP3_HUMAN	C	138	ENSP00000377529:R138C;ENSP00000290942:R138C	ENSP00000290942:R138C	R	-	1	0	TPPP3	65981697	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	9.593000	0.98250	2.135000	0.66039	0.556000	0.70494	CGC	TPPP3	-	pfam_P25-alpha	ENSG00000159713		0.597	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TPPP3	HGNC	protein_coding	OTTHUMT00000421787.2	49	0.00	0	G	NM_015964		67424196	67424196	-1	no_errors	ENST00000290942	ensembl	human	known	69_37n	missense	32	37.25	19	SNP	1.000	A
ZNF43	7594	genome.wustl.edu	37	19	22001917	22001917	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr19:22001917T>C	ENST00000354959.4	-	2	279	c.110A>G	c.(109-111)tAc>tGc	p.Y37C	ZNF43_ENST00000598288.1_Missense_Mutation_p.Y31C|ZNF43_ENST00000595461.1_Missense_Mutation_p.Y31C|ZNF43_ENST00000598381.1_Missense_Mutation_p.Y31C|ZNF43_ENST00000594012.1_Missense_Mutation_p.Y31C	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	37	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		CAGGTTTCTGTAGTTCTCTAA	0.373																																						dbGAP											0													136.0	144.0	141.0					19																	22001917		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.110A>G	19.37:g.22001917T>C	ENSP00000347045:p.Tyr37Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y37C	ENST00000354959.4	37	c.110	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	T	15.58	2.874755	0.51695	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.02525	4.26	0.225	0.225	0.15325	Krueppel-associated box (4);	.	.	.	.	T	0.13713	0.0332	M	0.88450	2.955	0.30181	N	0.800425	D	0.89917	1.0	D	0.97110	1.0	T	0.04373	-1.0956	9	0.66056	D	0.02	.	4.823	0.13400	0.0:2.0E-4:0.0:0.9998	.	37	P17038	ZNF43_HUMAN	C	36;37	ENSP00000347045:Y37C	ENSP00000347045:Y37C	Y	-	2	0	ZNF43	21793757	0.675000	0.27558	0.963000	0.40424	0.963000	0.63663	0.903000	0.28475	0.257000	0.21650	0.254000	0.18369	TAC	ZNF43	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198521		0.373	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2	42	0.00	0	T	NM_003423		22001917	22001917	-1	no_errors	ENST00000354959	ensembl	human	known	69_37n	missense	21	21.43	6	SNP	0.999	C
ZNF655	79027	genome.wustl.edu	37	7	99170231	99170231	+	Missense_Mutation	SNP	A	A	G	rs370452982		TCGA-AC-A3QP-01A-11D-A22X-09	TCGA-AC-A3QP-10B-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5c97a092-5cc3-4ed0-ab88-d2b53a1cb98e	22971a93-3f45-418d-a4da-5f3352316d34	g.chr7:99170231A>G	ENST00000394163.2	+	3	683	c.500A>G	c.(499-501)aAc>aGc	p.N167S	GS1-259H13.10_ENST00000455905.1_Intron|ZNF655_ENST00000493277.1_Missense_Mutation_p.N202S|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000419215.2_3'UTR|ZNF655_ENST00000424881.1_Missense_Mutation_p.N202S|ZNF655_ENST00000425063.1_3'UTR|ZNF655_ENST00000252713.4_Missense_Mutation_p.N167S	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	167					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					ATGAGCTTCAACCAGAATTCA	0.383																																						dbGAP											0													59.0	59.0	59.0					7																	99170231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.500A>G	7.37:g.99170231A>G	ENSP00000377718:p.Asn167Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N202S	ENST00000394163.2	37	c.605	CCDS5669.1	7	.	.	.	.	.	.	.	.	.	.	A	0.907	-0.720327	0.03182	.	.	ENSG00000197343	ENST00000252713;ENST00000493277;ENST00000424881;ENST00000394163	T;T;T;T	0.05717	3.48;3.4;3.4;3.48	4.55	-0.552	0.11818	.	0.980022	0.08329	N	0.962572	T	0.02727	0.0082	N	0.12182	0.205	0.21579	N	0.999633	B;B	0.12630	0.006;0.001	B;B	0.08055	0.003;0.001	T	0.44967	-0.9293	10	0.02654	T	1	-1.7935	4.9243	0.13885	0.4922:0.1619:0.3459:0.0	.	202;167	Q8N720-3;Q8N720	.;ZN655_HUMAN	S	167;202;202;167	ENSP00000252713:N167S;ENSP00000419135:N202S;ENSP00000393876:N202S;ENSP00000377718:N167S	ENSP00000252713:N167S	N	+	2	0	ZNF655	99008167	0.000000	0.05858	0.549000	0.28204	0.883000	0.51084	-0.967000	0.03821	-0.073000	0.12842	-0.270000	0.10280	AAC	ZNF655	-	NULL	ENSG00000197343		0.383	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ZNF655	HGNC	protein_coding	OTTHUMT00000344929.1	34	0.00	0	A	NM_138494		99170231	99170231	+1	no_errors	ENST00000424881	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.344	G
