#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACR	49	genome.wustl.edu	37	22	51183255	51183255	+	Missense_Mutation	SNP	A	A	G	rs5771002	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr22:51183255A>G	ENST00000216139.5	+	5	926	c.886A>G	c.(886-888)Atg>Gtg	p.M296V	ACR_ENST00000527761.1_3'UTR|AC002056.5_ENST00000532913.1_RNA	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	296				M -> V (in Ref. 6; CAG30252). {ECO:0000305}.	acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		CGCTTTGCGTATGATTCAATC	0.602													A|||	3635	0.725839	0.6641	0.6772	5008	,	,		8202	0.7956		0.6789	False		,,,				2504	0.82					dbGAP											0													20.0	19.0	19.0					22																	51183255		2184	4272	6456	-	-	-	SO:0001583	missense	0			CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.886A>G	22.37:g.51183255A>G	ENSP00000216139:p.Met296Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICK2	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Pept_S1A_acrosin,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.M296V	ENST00000216139.5	37	c.886	CCDS14101.1	22	1396	0.6391941391941391	271	0.5508130081300813	223	0.6160220994475138	434	0.7587412587412588	468	0.6174142480211082	A	6.022	0.372505	0.11409	.	.	ENSG00000100312	ENST00000216139	D	0.87650	-2.28	3.55	1.27	0.21489	.	1.094960	0.07069	N	0.835194	T	0.00012	0.0000	M	0.61703	1.905	0.80722	P	0.0	B	0.17038	0.02	B	0.13407	0.009	T	0.46938	-0.9155	9	0.15066	T	0.55	-7.6646	2.6976	0.05139	0.6307:0.0:0.1323:0.237	rs5771002	296	P10323	ACRO_HUMAN	V	296	ENSP00000216139:M296V	ENSP00000216139:M296V	M	+	1	0	ACR	49530121	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-1.060000	0.03475	0.085000	0.17107	0.254000	0.18369	ATG	ACR	-	pirsf_Pept_S1A_acrosin	ENSG00000100312		0.602	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ACR	HGNC	protein_coding	OTTHUMT00000316605.2	18	0.00	0	A	NM_001097		51183255	51183255	+1	no_errors	ENST00000216139	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	0.001	G
ACSM5	54988	genome.wustl.edu	37	16	20442562	20442562	+	Silent	SNP	C	C	T	rs78006992	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr16:20442562C>T	ENST00000331849.4	+	10	1374	c.1227C>T	c.(1225-1227)aaC>aaT	p.N409N		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	409					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.N409N(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						ATGAGGGCAACGTCCTGCCTC	0.557																																						dbGAP											1	Substitution - coding silent(1)	kidney(1)											157.0	135.0	142.0					16																	20442562		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1227C>T	16.37:g.20442562C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.N409	ENST00000331849.4	37	c.1227	CCDS10585.1	16																																																																																			ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.557	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	45	0.00	0	C	NM_017888		20442562	20442562	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	silent	73	10.98	9	SNP	0.043	T
ADAM21P1	145241	genome.wustl.edu	37	14	70713858	70713858	+	RNA	SNP	T	T	C	rs61979492	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr14:70713858T>C	ENST00000530196.1	-	0	660					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TCTGTTAAGCTACATCTCATA	0.448																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713858T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.448	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	31	0.00	0	T	NG_002467		70713858	70713858	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	50	12.28	7	SNP	0.649	C
KB-7G2.8	0	genome.wustl.edu	37	22	17156061	17156061	+	lincRNA	SNP	A	A	G	rs8142573	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr22:17156061A>G	ENST00000423580.2	-	0	1750				ANKRD62P1-PARP4P3_ENST00000338526.6_RNA																							TTTCTTTTAAAAGAGTGCATT	0.299													.|||	995	0.198682	0.0136	0.1455	5008	,	,		20630	0.2788		0.2952	False		,,,				2504	0.3047					dbGAP											0																																										-	-	-			0																															22.37:g.17156061A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000423580.2	37	NULL		22																																																																																			ANKRD62P1-PARP4P3	-	-	ENSG00000189295		0.299	KB-7G2.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	ANKRD62P1-PARP4P3	HGNC	lincRNA	OTTHUMT00000418976.1	41	0.00	0	A			17156061	17156061	-1	no_errors	ENST00000338526	ensembl	human	known	69_37n	rna	40	13.04	6	SNP	0.007	G
ARHGEF38	54848	genome.wustl.edu	37	4	106580340	106580340	+	Missense_Mutation	SNP	A	A	G	rs13147012	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr4:106580340A>G	ENST00000420470.2	+	10	1507	c.1363A>G	c.(1363-1365)Acg>Gcg	p.T455A	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	455	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						GCAGCGATCAACGGGAGAGGA	0.552													G|||	1783	0.35603	0.8427	0.2637	5008	,	,		20716	0.1081		0.2386	False		,,,				2504	0.1401					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.1363A>G	4.37:g.106580340A>G	ENSP00000416125:p.Thr455Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JIB4	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.T455A	ENST00000420470.2	37	c.1363	CCDS56338.1	4	745	0.3411172161172161	408	0.8292682926829268	103	0.2845303867403315	60	0.1048951048951049	174	0.22955145118733508	G	0.010	-1.756002	0.00663	.	.	ENSG00000236699	ENST00000420470	T	0.61980	0.06	5.66	5.66	0.87406	.	.	.	.	.	T	0.00012	0.0000	N	0.00483	-1.445	0.80722	P	0.0	.	.	.	.	.	.	T	0.37103	-0.9720	6	0.07990	T	0.79	-2.8555	8.0988	0.30844	0.1366:0.2317:0.6318:0.0	rs13147012;rs17327590;rs52828309;rs13147012	.	.	.	A	455	ENSP00000416125:T455A	ENSP00000416125:T455A	T	+	1	0	ARHGEF38	106799789	0.031000	0.19500	0.069000	0.20011	0.178000	0.23041	0.693000	0.25497	1.535000	0.49220	-0.154000	0.13518	ACG	ARHGEF38	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000236699		0.552	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	40	0.00	0	A	NM_017700		106580340	106580340	+1	no_errors	ENST00000420470	ensembl	human	putative	69_37n	missense	59	10.61	7	SNP	0.001	G
BCORL1	63035	genome.wustl.edu	37	X	129149548	129149549	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G|C	G|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chrX:129149548_129149549GC>TT	ENST00000218147.7	+	4	2997_2998	c.2800_2801GC>TT	c.(2800-2802)GCa>TTa	p.A934L	BCORL1_ENST00000359304.2_Missense_Mutation_p.A934L|BCORL1_ENST00000303743.5_Missense_Mutation_p.A934L|BCORL1_ENST00000540052.1_Missense_Mutation_p.A934L			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	934					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TGGGACCCTGGCACTGTCTGTT	0.535																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	Exception_encountered	X.37:g.129149548_129149549delinsTT	ENSP00000218147:p.Ala934Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A934S|p.A934V	ENST00000218147.7	37	c.2800|c.2801	CCDS14616.1	X																																																																																			BCORL1	-	NULL	ENSG00000085185		0.535	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	28	0.00	0	G|C	NM_021946		129149548|129149549	129149548|129149549	+1	no_errors	ENST00000303743	ensembl	human	known	69_37n	missense	44|43	15.38|13.73	8|7	SNP	0.643|0.623	T
C1orf167	284498	genome.wustl.edu	37	1	11838848	11838848	+	Missense_Mutation	SNP	G	G	T	rs6697244	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:11838848G>T	ENST00000433342.1	+	11	2543	c.2543G>T	c.(2542-2544)aGc>aTc	p.S848I	RP11-56N19.5_ENST00000376620.3_RNA			Q5SNV9	CA167_HUMAN	chromosome 1 open reading frame 167	848			S -> I (in dbSNP:rs6697244). {ECO:0000269|PubMed:17974005}.							central_nervous_system(1)	1						CTGAGCAGCAGCACACTCCAA	0.637													G|||	2858	0.570687	0.3828	0.7594	5008	,	,		14977	0.7698		0.6252	False		,,,				2504	0.4294					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL834308		1p36.22	2012-04-20			ENSG00000215910	ENSG00000215910			25262	protein-coding gene	gene with protein product						12370778	Standard	XM_006710065		Approved	DKFZp434E1410, RP11-56N19.2	uc001asy.1	Q5SNV9	OTTHUMG00000002228	ENST00000433342.1:c.2543G>T	1.37:g.11838848G>T	ENSP00000414909:p.Ser848Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDA9|Q8NDF3	Missense_Mutation	SNP	NULL	p.S848I	ENST00000433342.1	37	c.2543		1	1405|1405	0.6433150183150184|0.6433150183150184	207|207	0.42073170731707316|0.42073170731707316	266|266	0.7348066298342542|0.7348066298342542	459|459	0.8024475524475524|0.8024475524475524	473|473	0.6240105540897097|0.6240105540897097	G|G	10.25|10.25	1.297401|1.297401	0.23650|0.23650	.|.	.|.	ENSG00000215910|ENSG00000215910	ENST00000312793|ENST00000433342	.|T	.|0.10192	.|2.9	4.55|4.55	-2.84|-2.84	0.05751|0.05751	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B	.|0.12630	.|0.006	.|B	.|0.10450	.|0.005	T|T	0.09185|0.09185	-1.0686|-1.0686	4|8	.|0.25106	.|T	.|0.35	-0.0039|-0.0039	6.367|6.367	0.21461|0.21461	0.0:0.1855:0.5088:0.3058|0.0:0.1855:0.5088:0.3058	rs6697244;rs6697244|rs6697244;rs6697244	.|848	.|Q5SNV9	.|CA167_HUMAN	H|I	207|848	.|ENSP00000414909:S848I	.|ENSP00000414909:S848I	Q|S	+|+	3|2	2|0	C1orf167|C1orf167	11761435|11761435	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.080000|0.080000	0.17528|0.17528	-1.006000|-1.006000	0.03671|0.03671	-0.821000|-0.821000	0.04312|0.04312	0.407000|0.407000	0.27541|0.27541	CAG|AGC	C1orf167	-	NULL	ENSG00000215910		0.637	C1orf167-201	KNOWN	basic|appris_principal	protein_coding	C1orf167	HGNC	protein_coding		36	0.00	0	G			11838848	11838848	+1	no_errors	ENST00000433342	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.000	T
C6orf183	389422	genome.wustl.edu	37	6	109517706	109517706	+	RNA	SNP	G	G	A	rs1761608	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:109517706G>A	ENST00000417143.3	+	0	421							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		AGAGAGAATTGCCCAGCTGGC	0.378													A|||	2485	0.496206	0.8124	0.2853	5008	,	,		15336	0.4544		0.4394	False		,,,				2504	0.32					dbGAP											0																																										-	-	-			0					6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109517706G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000417143.3	37	NULL		6																																																																																			C6orf183	-	-	ENSG00000243587		0.378	C6orf183-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	C6orf183	HGNC	polymorphic_pseudogene	OTTHUMT00000041736.4	50	0.00	0	G			109517706	109517706	+1	no_errors	ENST00000417143	ensembl	human	known	69_37n	rna	47	16.95	10	SNP	0.003	A
CCDC162P	221262	genome.wustl.edu	37	6	109621494	109621494	+	RNA	SNP	T	T	C	rs6927569	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:109621494T>C	ENST00000422819.1	+	0	383							A2VCL2	CC162_HUMAN	coiled-coil domain containing 162, pseudogene																		CAAGACCCTATCCGGGTGGCC	0.517													c|||	2803	0.559704	0.9191	0.4539	5008	,	,		19048	0.4048		0.5308	False		,,,				2504	0.3384					dbGAP											0																																										-	-	-			0					6q21	2011-04-28	2011-04-28	2011-04-28	ENSG00000203799	ENSG00000203799			21565	pseudogene	pseudogene			"""chromosome 6 open reading frame 184"", ""chromosome 6 open reading frame 185"""	C6orf184, C6orf185, CCDC162			Standard	NR_028595		Approved	bA425D10.7, bA425D10.3	uc003ptb.1	A2VCL2	OTTHUMG00000015342		6.37:g.109621494T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4V1|A4QMU0|Q5JSU0|Q5JSU7	RNA	SNP	-	NULL	ENST00000422819.1	37	NULL		6																																																																																			CCDC162P	-	-	ENSG00000203799		0.517	CCDC162P-002	KNOWN	basic	processed_transcript	CCDC162P	HGNC	pseudogene	OTTHUMT00000365631.1	34	0.00	0	T	NR_028595		109621494	109621494	+1	no_errors	ENST00000422819	ensembl	human	known	69_37n	rna	32	11.11	4	SNP	0.000	C
CCZ1	51622	genome.wustl.edu	37	7	5965334	5965334	+	3'UTR	SNP	C	C	T	rs5846		TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr7:5965334C>T	ENST00000325974.6	+	0	1531				RSPH10B_ENST00000535104.1_5'Flank|CCZ1_ENST00000496860.1_3'UTR|RSPH10B_ENST00000539903.1_3'UTR|CCZ1_ENST00000537980.1_3'UTR	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)							lysosome (GO:0005764)|membrane (GO:0016020)				large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						GACGGCTCACCGAGAGCATAT	0.443																																						dbGAP											0													59.0	53.0	55.0					7																	5965334		2200	4280	6480	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.*16C>T	7.37:g.5965334C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU45|O95766|Q9UG65|Q9Y359	RNA	SNP	-	NULL	ENST00000325974.6	37	NULL	CCDS34597.1	7																																																																																			CCZ1	-	-	ENSG00000122674		0.443	CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCZ1	HGNC	protein_coding	OTTHUMT00000340391.1	31	0.00	0	C	NM_015622		5965334	5965334	+1	no_errors	ENST00000496860	ensembl	human	known	69_37n	rna	39	15.22	7	SNP	0.000	T
CDH1	999	genome.wustl.edu	37	16	68862109	68862110	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr16:68862109_68862110insG	ENST00000261769.5	+	14	2388_2389	c.2197_2198insG	c.(2197-2199)aggfs	p.R733fs	CDH1_ENST00000422392.2_Frame_Shift_Ins_p.R672fs|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	733					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GTTTCTTCGGAGGAGAGCGGTG	0.53			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2199dupG	16.37:g.68862111_68862111dupG	ENSP00000261769:p.Arg733fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R734fs	ENST00000261769.5	37	c.2197_2198	CCDS10869.1	16																																																																																			CDH1	-	NULL	ENSG00000039068		0.530	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	70	0.00	0	-	NM_004360		68862109	68862110	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	56	28.21	22	INS	0.999:1.000	G
CEP250	11190	genome.wustl.edu	37	20	34062642	34062642	+	Intron	SNP	C	C	T	rs224362	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr20:34062642C>T	ENST00000397527.1	+	15	2291				RP3-477O4.14_ENST00000444933.1_RNA|RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA|CEP250_ENST00000342580.4_Intron	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa						centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			atgagagcaacgttttggaaa	0.413													T|||	2141	0.427516	0.702	0.2666	5008	,	,		21865	0.2698		0.2505	False		,,,				2504	0.5153					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.1572-685C>T	20.37:g.34062642C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	NULL	p.R26C	ENST00000397527.1	37	c.76	CCDS13255.1	20	764	0.3498168498168498	329	0.6686991869918699	109	0.3011049723756906	143	0.25	183	0.24142480211081793	T	1.973	-0.435960	0.04636	.	.	ENSG00000126001	ENST00000425096	.	.	.	3.27	0.873	0.19118	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.36720	-0.9736	3	.	.	.	.	3.1798	0.06581	0.0:0.2475:0.2178:0.5347	rs224362;rs432896;rs17092675;rs58963538;rs224362	.	.	.	C	26	.	.	R	+	1	0	CEP250	33526056	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.062000	0.14389	-0.117000	0.11872	-0.490000	0.04691	CGT	CEP250	-	NULL	ENSG00000126001		0.413	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	40	0.00	0	C	NM_007186		34062642	34062642	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000425096	ensembl	human	novel	69_37n	missense	54	10.00	6	SNP	0.000	T
COL6A5	256076	genome.wustl.edu	37	3	130159281	130159283	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	CAC	CAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr3:130159281_130159283delCAC	ENST00000432398.2	+	35	6593_6595	c.6099_6101delCAC	c.(6097-6102)atcact>att	p.T2034del	COL6A5_ENST00000265379.6_In_Frame_Del_p.T2034del	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2034	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TTGATTTCATCACTTATGACAAC	0.419																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6099_6101delCAC	3.37:g.130159281_130159283delCAC	ENSP00000390895:p.Thr2034del	Somatic		WXS	Illumina GAIIx	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	In_Frame_Del	DEL	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.T2034in_frame_del	ENST00000432398.2	37	c.6099_6101		3																																																																																			COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.419	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		24	0.00	0	CAC	NM_153264		130159281	130159283	+1	no_errors	ENST00000265379	ensembl	human	known	69_37n	in_frame_del	31	16.22	6	DEL	0.002:0.018:0.097	-
CSE1L	1434	genome.wustl.edu	37	20	47713063	47713063	+	3'UTR	SNP	C	C	T	rs17632	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr20:47713063C>T	ENST00000262982.2	+	0	3127				CSE1L_ENST00000542325.1_3'UTR|CSE1L_ENST00000469700.1_3'UTR	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AAAGGAAGTTCTCCTTTTGAA	0.378													T|||	1818	0.363019	0.3359	0.3732	5008	,	,		21825	0.3304		0.4274	False		,,,				2504	0.3599					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.*88C>T	20.37:g.47713063C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	RNA	SNP	-	NULL	ENST00000262982.2	37	NULL	CCDS13412.1	20																																																																																			CSE1L	-	-	ENSG00000124207		0.378	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	26	0.00	0	C	NM_001316		47713063	47713063	+1	no_errors	ENST00000469700	ensembl	human	known	69_37n	rna	17	19.05	4	SNP	0.649	T
CSMD2	114784	genome.wustl.edu	37	1	34025030	34025030	+	Silent	SNP	A	A	G	rs16835593	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:34025030A>G	ENST00000373381.4	-	54	8600	c.8424T>C	c.(8422-8424)acT>acC	p.T2808T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2785	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGTTACCCTGAGTGAGGCCGT	0.527													A|||	601	0.120008	0.0091	0.0893	5008	,	,		20421	0.2192		0.1531	False		,,,				2504	0.1554					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8424T>C	1.37:g.34025030A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.T2808	ENST00000373381.4	37	c.8424		1																																																																																			CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.527	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		27	0.00	0	A	NM_052896		34025030	34025030	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.998	G
CTNNA1	1495	genome.wustl.edu	37	5	138118920	138118920	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr5:138118920C>T	ENST00000302763.7	+	3	250	c.160C>T	c.(160-162)Cgt>Tgt	p.R54C	CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000518825.1_Missense_Mutation_p.R54C	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	54	Involved in homodimerization.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAGAGAGGTCGTTCTAAGAA	0.388																																						dbGAP											0													71.0	69.0	70.0					5																	138118920		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.160C>T	5.37:g.138118920C>T	ENSP00000304669:p.Arg54Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q12795|Q8N1C0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.R54C	ENST00000302763.7	37	c.160	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969251	0.74246	.	.	ENSG00000044115	ENST00000517980;ENST00000522227;ENST00000524127;ENST00000523912;ENST00000520339;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518245;ENST00000519113;ENST00000520158;ENST00000518825	T;T;T;T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.57;1.12;1.12;1.12;1.57;1.12;1.12	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.64821	0.2633	M	0.78049	2.395	0.80722	D	1	B;D	0.65815	0.206;0.995	B;P	0.60345	0.049;0.873	T	0.67007	-0.5779	10	0.62326	D	0.03	-6.5978	19.4583	0.94904	0.0:1.0:0.0:0.0	.	54;54	G3XAM7;P35221	.;CTNA1_HUMAN	C	54	ENSP00000428439:R54C;ENSP00000429636:R54C;ENSP00000428049:R54C;ENSP00000430304:R54C;ENSP00000428202:R54C;ENSP00000304669:R54C;ENSP00000428457:R54C;ENSP00000430078:R54C;ENSP00000429457:R54C;ENSP00000427821:R54C	ENSP00000304669:R54C	R	+	1	0	CTNNA1	138146819	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.704000	0.92352	0.561000	0.74099	CGT	CTNNA1	-	pfam_Vinculin/catenin	ENSG00000044115		0.388	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	29	0.00	0	C	NM_001903		138118920	138118920	+1	no_errors	ENST00000302763	ensembl	human	known	69_37n	missense	45	23.73	14	SNP	1.000	T
CYP2G1P	22952	genome.wustl.edu	37	19	41405962	41405962	+	IGR	SNP	T	T	G	rs4803400	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr19:41405962T>G	ENST00000601627.1	+	0	575				CYP2G1P_ENST00000252909.4_RNA																							CTTCTCTCTATGCTCGCTGGT	0.582													N|||	2806	0.560304	0.5855	0.6859	5008	,	,		21413	0.4405		0.506	False		,,,				2504	0.6166					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															19.37:g.41405962T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.C138G	ENST00000601627.1	37	c.412		19	1179	0.5398351648351648	275	0.5589430894308943	256	0.7071823204419889	269	0.47027972027972026	379	0.5	C	9.997	1.232291	0.22626	.	.	ENSG00000130612	ENST00000252909	.	.	.	3.12	-4.56	0.03431	.	0.801022	0.10021	N	0.726026	T	0.00012	0.0000	.	.	.	.	.	.	.	.	.	.	.	.	T	0.35176	-0.9799	5	0.66056	D	0.02	.	4.1358	0.10170	0.3975:0.1974:0.0:0.4051	rs4803400;rs17713373;rs56716115;rs4803400	.	.	.	G	138	.	ENSP00000252909:C138G	C	+	1	0	AC008537.1	46097802	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.115000	0.10741	-0.865000	0.04073	-1.231000	0.01572	TGC	CYP2G1P	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000130612		0.582	CTC-490E21.12-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	CYP2G1P	HGNC	protein_coding	OTTHUMT00000463921.1	12	0.00	0	T			41405962	41405962	+1	no_start_codon	ENST00000252909	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.000	G
UPK3B	80761	genome.wustl.edu	37	7	76629626	76629626	+	Intron	SNP	G	G	A	rs1638152		TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr7:76629626G>A	ENST00000419923.2	+	6	1408				UPK3B_ENST00000443097.2_Intron|DTX2P1-UPK3BP1-PMS2P11_ENST00000584900.1_RNA			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				TCTCTTCTAGGAGCGACCCCG	0.567																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-18515G>A	7.37:g.76629626G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Splice_Site	SNP	-	NULL	ENST00000419923.2	37	c.NULL	CCDS5588.1	7																																																																																			DTX2P1	-	-	ENSG00000186704		0.567	UPK3B-201	KNOWN	basic|CCDS	protein_coding	DTX2P1	HGNC	protein_coding		35	0.00	0	G	NM_030570		76629626	76629626	+1	no_coding_region:pseudogene	ENST00000425797	ensembl	human	known	69_37n	splice_site	32	11.11	4	SNP	0.470	A
EIF2B3	8891	genome.wustl.edu	37	1	45424509	45424509	+	Intron	SNP	G	G	C	rs637224	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:45424509G>C	ENST00000360403.2	-	4	421				EIF2B3_ENST00000372183.3_Intron|EIF2B3_ENST00000480675.1_Intron	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa						cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					TGAGCAGTGGGCTTCTGGACA	0.443													C|||	1250	0.249601	0.4773	0.1787	5008	,	,		21115	0.1647		0.1769	False		,,,				2504	0.1544				Colon(26;357 658 2581 11857 12657)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.295-17172C>G	1.37:g.45424509G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	RNA	SNP	-	NULL	ENST00000360403.2	37	NULL	CCDS517.1	1																																																																																			EIF2B3	-	-	ENSG00000070785		0.443	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B3	HGNC	protein_coding	OTTHUMT00000023724.1	26	0.00	0	G	NM_020365		45424509	45424509	-1	no_errors	ENST00000487532	ensembl	human	known	69_37n	rna	35	20.00	9	SNP	1.000	C
PDXDC2P	283970	genome.wustl.edu	37	16	70010517	70010519	+	RNA	DEL	TGT	TGT	-	rs372253115		TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr16:70010517_70010519delTGT	ENST00000531894.1	-	0	3864_3866				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.Q253delQ(2)									AGTTATAGAATGTTGTTGAGTTG	0.507																																						dbGAP											2	Deletion - In frame(2)	breast(2)																																								-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010520_70010522delTGT		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z5	In_Frame_Del	DEL	pfam_NPIP	p.Q253in_frame_del	ENST00000531894.1	37	c.761_759		16																																																																																			RP11-419C5.2	-	pfam_NPIP	ENSG00000226232		0.507	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	13	0.00	0	TGT			70010517	70010519	-1	no_errors	ENST00000532298	ensembl	human	novel	69_37n	in_frame_del	7	46.15	6	DEL	0.600:0.610:0.620	-
EPHA4	2043	genome.wustl.edu	37	2	222282765	222282765	+	3'UTR	SNP	C	C	T	rs3177117	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:222282765C>T	ENST00000281821.2	-	0	6329				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TTGTATACGGCAACTACTTTA	0.269													C|||	2158	0.430911	0.6036	0.3919	5008	,	,		17891	0.2222		0.4245	False		,,,				2504	0.4468					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*3327G>A	2.37:g.222282765C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.269	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	30	0.00	0	C			222282765	222282765	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	43	10.42	5	SNP	1.000	T
EPHA4	2043	genome.wustl.edu	37	2	222282959	222282959	+	3'UTR	SNP	G	G	T	rs8508	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:222282959G>T	ENST00000281821.2	-	0	6135				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		ATCACTCAAAGTTTGGAACGT	0.303													T|||	2206	0.440495	0.646	0.389	5008	,	,		17705	0.2232		0.4215	False		,,,				2504	0.4427					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*3133C>A	2.37:g.222282959G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.303	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	25	0.00	0	G			222282959	222282959	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	24	17.24	5	SNP	0.516	T
EPHA4	2043	genome.wustl.edu	37	2	222283000	222283000	+	3'UTR	SNP	A	A	T	rs9758	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:222283000A>T	ENST00000281821.2	-	0	6094				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TTAATTTCTTATTCAGTATGA	0.299													T|||	2432	0.485623	0.7292	0.4078	5008	,	,		18054	0.2579		0.4513	False		,,,				2504	0.4816					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*3092T>A	2.37:g.222283000A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.299	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	22	0.00	0	A			222283000	222283000	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	22	21.43	6	SNP	1.000	T
EPHA4	2043	genome.wustl.edu	37	2	222283281	222283281	+	3'UTR	SNP	T	T	C	rs3087584	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:222283281T>C	ENST00000281821.2	-	0	5813				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGTCTCAGAATGCACACACCA	0.378													C|||	2206	0.440495	0.6467	0.3876	5008	,	,		19279	0.2232		0.4215	False		,,,				2504	0.4427					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*2811A>G	2.37:g.222283281T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.378	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	19	0.00	0	T			222283281	222283281	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	20	20.00	5	SNP	0.938	C
EPHA4	2043	genome.wustl.edu	37	2	222284646	222284646	+	3'UTR	SNP	C	C	T	rs3770208	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:222284646C>T	ENST00000281821.2	-	0	4448				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CATGAGGCTacgcacatacac	0.443													C|||	2228	0.444888	0.6362	0.3934	5008	,	,		20808	0.2569		0.4195	False		,,,				2504	0.4427					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*1446G>A	2.37:g.222284646C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.443	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	21	0.00	0	C			222284646	222284646	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	23	28.12	9	SNP	0.003	T
EPHA4	2043	genome.wustl.edu	37	2	222284686	222284686	+	3'UTR	SNP	G	G	C	rs3770207	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:222284686G>C	ENST00000281821.2	-	0	4408				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		cacgcatacagacacactcac	0.443													C|||	2239	0.447085	0.6362	0.3963	5008	,	,		21235	0.2579		0.4235	False		,,,				2504	0.4468					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*1406C>G	2.37:g.222284686G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.443	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	22	0.00	0	G			222284686	222284686	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	23	20.00	6	SNP	0.994	C
FAM99B	100132464	genome.wustl.edu	37	11	1705513	1705513	+	RNA	SNP	C	C	G	rs11039555	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:1705513C>G	ENST00000382166.2	-	0	211					NR_026642.1				family with sequence similarity 99, member B (non-protein coding)																		CATCAGGATGCCGGGACCCTC	0.647																																						dbGAP											0																																										-	-	-			0			CR627417		11p15.5	2012-10-16	2011-08-31		ENSG00000205865	ENSG00000205865		"""Long non-coding RNAs"""	32369	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 99, member B"""				Standard	NR_026642		Approved	DKFZp781M09150	uc010qxa.1		OTTHUMG00000057552		11.37:g.1705513C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000382166.2	37	NULL		11																																																																																			FAM99B	-	-	ENSG00000205865		0.647	FAM99B-001	KNOWN	basic	antisense	FAM99B	HGNC	antisense	OTTHUMT00000127917.1	47	0.00	0	C			1705513	1705513	-1	no_errors	ENST00000382166	ensembl	human	known	69_37n	rna	64	12.33	9	SNP	0.000	G
FER1L4	80307	genome.wustl.edu	37	20	34194243	34194243	+	RNA	SNP	A	A	G	rs761826	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr20:34194243A>G	ENST00000430275.2	-	0	289							A9Z1Z3	FR1L4_HUMAN	fer-1-like family member 4, pseudogene (functional)							integral component of membrane (GO:0016021)											TACTCACCTAAGGCTGAATAC	0.592													G|||	1662	0.331869	0.5787	0.2032	5008	,	,		18717	0.1716		0.2227	False		,,,				2504	0.3671					dbGAP											0																																										-	-	-			0			AL121586		20q11.23	2014-09-11	2014-06-27		ENSG00000088340	ENSG00000088340		"""-"""	15801	pseudogene	pseudogene			"""fer-1-like 4 (C. elegans)"", ""fer-1-like 4 (C. elegans), pseudogene (functional)"""	C20orf124		24063685, 24961353	Standard	XR_425236		Approved	bA563A22B.1, dJ309K20.1	uc002xcx.3	A9Z1Z3	OTTHUMG00000032354		20.37:g.34194243A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9GZQ9|Q9H646|Q9H8L7	RNA	SNP	-	NULL	ENST00000430275.2	37	NULL		20																																																																																			FER1L4	-	-	ENSG00000088340		0.592	FER1L4-016	KNOWN	basic	processed_transcript	FER1L4	HGNC	pseudogene	OTTHUMT00000443297.1	29	0.00	0	A	NR_024377		34194243	34194243	-1	no_errors	ENST00000426117	ensembl	human	known	69_37n	rna	34	10.26	4	SNP	0.916	G
FOLH1	2346	genome.wustl.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H|FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																						dbGAP											1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	-	-	-	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.R281H	ENST00000256999.2	37	c.842	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT	FOLH1	-	NULL	ENSG00000086205		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	53	0.00	0	C	NM_004476		49204779	49204779	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	0.843	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																						dbGAP											0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	48	0.00	0	A	NM_004476		49204790	49204790	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	silent	45	15.09	8	SNP	1.000	G
FRG1B	284802	genome.wustl.edu	37	20	29624093	29624093	+	Splice_Site	SNP	G	G	T	rs75468660		TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr20:29624093G>T	ENST00000278882.3	+	4	496		c.e4+1		FRG1B_ENST00000358464.4_Splice_Site|FRG1B_ENST00000439954.2_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B									p.?(6)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CTGATTCCAGGTGAGCTTATG	0.299																																						dbGAP											6	Unknown(6)	kidney(4)|prostate(2)																																								-	-	-	SO:0001630	splice_region_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.116+1G>T	20.37:g.29624093G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AME5	Splice_Site	SNP	-	e2+1	ENST00000278882.3	37	c.116+1		20	.	.	.	.	.	.	.	.	.	.	.	11.58	1.679853	0.29783	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.91	1.91	0.25777	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8627	0.41125	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28237754	1.000000	0.71417	0.991000	0.47740	0.586000	0.36452	7.759000	0.85235	1.383000	0.46405	0.184000	0.17185	.	FRG1B	-	-	ENSG00000149531		0.299	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	36	0.00	0	G	NR_003579	Intron	29624093	29624093	+1	no_errors	ENST00000278882	ensembl	human	known	69_37n	splice_site	34	19.05	8	SNP	1.000	T
FRMPD2	143162	genome.wustl.edu	37	10	49388901	49388901	+	Missense_Mutation	SNP	C	C	T	rs61840030	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr10:49388901C>T	ENST00000374201.3	-	21	3037	c.2735G>A	c.(2734-2736)gGg>gAg	p.G912E	FRMPD2_ENST00000407470.4_Missense_Mutation_p.G880E|FRMPD2_ENST00000463706.1_5'Flank|FRMPD2_ENST00000305531.3_Missense_Mutation_p.G887E	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	912					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		GCTCTGCACCCCAGCCATGTC	0.483																																						dbGAP											0													1.0	1.0	1.0					10																	49388901		70	202	272	-	-	-	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2735G>A	10.37:g.49388901C>T	ENSP00000363317:p.Gly912Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.G912E	ENST00000374201.3	37	c.2735	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	C	5.948	0.358910	0.11239	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.62788	0.03;0.0;0.0	5.13	-10.3	0.00346	.	.	.	.	.	T	0.29190	0.0726	N	0.14661	0.345	0.80722	P	0.0	B;B;B	0.27450	0.103;0.179;0.103	B;B;B	0.25140	0.058;0.033;0.058	T	0.08351	-1.0726	8	0.07813	T	0.8	.	3.5111	0.07708	0.1915:0.103:0.1445:0.561	.	887;912;880	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	E	912;887;880	ENSP00000363317:G912E;ENSP00000307079:G887E;ENSP00000384339:G880E	ENSP00000307079:G887E	G	-	2	0	FRMPD2	49058907	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.517000	0.02248	-3.272000	0.00199	-0.145000	0.13849	GGG	FRMPD2	-	NULL	ENSG00000170324		0.483	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	41	0.00	0	C	NM_152428		49388901	49388901	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	0.000	T
FUCA2	2519	genome.wustl.edu	37	6	143832677	143832677	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:143832677G>A	ENST00000002165.6	-	1	150	c.95C>T	c.(94-96)aCg>aTg	p.T32M	FUCA2_ENST00000367585.1_5'UTR|FUCA2_ENST00000438118.2_Missense_Mutation_p.T32M	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	32					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		GTCGAAGCGCGTGGCGCTGTG	0.692																																						dbGAP											0													19.0	19.0	19.0					6																	143832677		2179	4277	6456	-	-	-	SO:0001583	missense	0			BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.95C>T	6.37:g.143832677G>A	ENSP00000002165:p.Thr32Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub,prints_Glyco_hydro_29_sub	p.T32M	ENST00000002165.6	37	c.95	CCDS5200.1	6	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453268	0.43531	.	.	ENSG00000001036	ENST00000002165;ENST00000438118;ENST00000367585	T;T;T	0.57273	0.41;0.41;0.41	4.52	0.131	0.14755	Glycoside hydrolase, subgroup, catalytic domain (1);	1.499700	0.04000	N	0.296267	T	0.25005	0.0607	L	0.43152	1.355	0.09310	N	1	B	0.19817	0.039	B	0.24269	0.052	T	0.34354	-0.9832	10	0.52906	T	0.07	1.1703	6.8929	0.24241	0.1551:0.0:0.5869:0.258	.	32	Q9BTY2	FUCO2_HUMAN	M	32	ENSP00000002165:T32M;ENSP00000394151:T32M;ENSP00000356557:T32M	ENSP00000002165:T32M	T	-	2	0	FUCA2	143874370	0.134000	0.22483	0.025000	0.17156	0.391000	0.30476	-0.346000	0.07760	0.144000	0.18951	-0.219000	0.12488	ACG	FUCA2	-	pfam_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub	ENSG00000001036		0.692	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUCA2	HGNC	protein_coding	OTTHUMT00000042521.2	32	0.00	0	G	NM_032020		143832677	143832677	-1	no_errors	ENST00000002165	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.010	A
GABRQ	55879	genome.wustl.edu	37	X	151821277	151821277	+	Missense_Mutation	SNP	T	T	A	rs3810651|rs57198283|rs368602583	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chrX:151821277T>A	ENST00000370306.2	+	9	1452	c.1432T>A	c.(1432-1434)Ttt>Att	p.F478I		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	478			F -> I (in dbSNP:rs3810651). {ECO:0000269|PubMed:10804200, ECO:0000269|PubMed:15489334}.		neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGACAGTATTTTTCCTACCGA	0.547													A|||	1644	0.435497	0.2065	0.536	3775	,	,		16054	0.2688		0.4235	False		,,,				2504	0.3088					dbGAP											0													119.0	111.0	114.0					X																	151821277		2150	4298	6448	-	-	-	SO:0001583	missense	0			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1432T>A	X.37:g.151821277T>A	ENSP00000359329:p.Phe478Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAt_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABAAb_rcpt,prints_GABAAa_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.F478I	ENST00000370306.2	37	c.1432	CCDS14707.1	X	765	0.46112115732368897	78	0.18309859154929578	136	0.5619834710743802	89	0.1869747899159664	223	0.3982142857142857	A	0.120	-1.126593	0.01770	.	.	ENSG00000147402	ENST00000370306	T	0.76060	-0.99	4.59	-9.19	0.00685	Neurotransmitter-gated ion-channel transmembrane domain (2);	4.285530	0.00357	N	0.000025	T	0.00012	0.0000	N	0.00583	-1.355	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.03287	-1.1052	9	0.02654	T	1	.	6.847	0.23994	0.1293:0.3351:0.4511:0.0844	rs3810651;rs52810409;rs3810651	478	Q9UN88	GBRT_HUMAN	I	478	ENSP00000359329:F478I	ENSP00000359329:F478I	F	+	1	0	GABRQ	151571933	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.939000	0.03933	-4.339000	0.00055	-1.197000	0.01672	TTT	GABRQ	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAAt_rcpt	ENSG00000147402		0.547	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRQ	HGNC	protein_coding	OTTHUMT00000058763.2	18	0.00	0	T	NM_018558		151821277	151821277	+1	no_errors	ENST00000370306	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	0.000	A
GFM1	85476	genome.wustl.edu	37	3	158367837	158367837	+	Missense_Mutation	SNP	C	C	T	rs56167308	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr3:158367837C>T	ENST00000264263.5	+	6	771	c.733C>T	c.(733-735)Cgc>Tgc	p.R245C	GFM1_ENST00000478576.1_Intron|GFM1_ENST00000486715.1_Intron					G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GAATTGGGATCGCAGGTCTGG	0.478													C|||	738	0.147364	0.1067	0.1412	5008	,	,		19200	0.125		0.2207	False		,,,				2504	0.1544					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000264263.5:c.733C>T	3.37:g.158367837C>T	ENSP00000264263:p.Arg245Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EFG/EF2,tigrfam_Small_GTP-bd_dom	p.R245C	ENST00000264263.5	37	c.733		3	334	0.15293040293040294	53	0.10772357723577236	54	0.14917127071823205	61	0.10664335664335664	166	0.21899736147757257	C	9.023	0.985369	0.18889	.	.	ENSG00000168827	ENST00000264263	T	0.64438	-0.1	2.9	-2.68	0.06041	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16541	-1.0399	7	0.87932	D	0	.	0.3229	0.00306	0.1929:0.2523:0.1978:0.357	rs56167308;rs62286653	245	Q96RP9-2	.	C	245	ENSP00000264263:R245C	ENSP00000264263:R245C	R	+	1	0	GFM1	159850531	0.000000	0.05858	0.000000	0.03702	0.106000	0.19336	-0.411000	0.07142	-0.572000	0.06006	-0.417000	0.06048	CGC	GFM1	-	pfam_ProtSyn_GTP-bd,tigrfam_Transl_elong_EFG/EF2	ENSG00000168827		0.478	GFM1-004	NOVEL	basic	protein_coding	GFM1	HGNC	protein_coding	OTTHUMT00000352274.1	37	0.00	0	C	NM_024996		158367837	158367837	+1	no_errors	ENST00000264263	ensembl	human	novel	69_37n	missense	80	12.09	11	SNP	0.000	T
GOLGA2	2801	genome.wustl.edu	37	9	131020796	131020798	+	In_Frame_Del	DEL	CCT	CCT	-	rs201018639|rs556715333|rs112603354	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr9:131020796_131020798delCCT	ENST00000421699.2	-	21	2156_2158	c.2144_2146delAGG	c.(2143-2148)gaggcg>gcg	p.E715del	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_In_Frame_Del_p.E703del	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	715	Poly-Glu.				mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						ACTGCCACCGcctcctcctcctc	0.635														1316	0.26278	0.4508	0.1844	5008	,	,		10190	0.2887		0.1034	False		,,,				2504	0.2014					dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2144_2146delAGG	9.37:g.131020805_131020807delCCT	ENSP00000416097:p.Glu715del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GRM9|Q9BRB0|Q9NYF9	In_Frame_Del	DEL	superfamily_CofA_tubulin-bd	p.E715in_frame_del	ENST00000421699.2	37	c.2146_2144	CCDS6896.2	9																																																																																			GOLGA2	-	NULL	ENSG00000167110		0.635	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA2	HGNC	protein_coding	OTTHUMT00000054358.2	29	0.00	0	CCT	NM_004486		131020796	131020798	-1	no_errors	ENST00000421699	ensembl	human	known	69_37n	in_frame_del	20	16.67	4	DEL	0.000:0.000:0.004	-
GVINP1	387751	genome.wustl.edu	37	11	6738952	6738952	+	RNA	SNP	G	G	T	rs10769716	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:6738952G>T	ENST00000526769.3	-	0	4252					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										ATCAGGGAGTGACTATTAGGT	0.418													-|||	1304	0.260383	0.1309	0.4553	5008	,	,		20753	0.3562		0.2346	False		,,,				2504	0.2249					dbGAP											0																																										-	-	-			0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6738952G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.418	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	21	0.00	0	G	NR_003945		6738952	6738952	-1	no_errors	ENST00000526769	ensembl	human	known	69_37n	rna	30	16.67	6	SNP	0.000	T
GVINP1	387751	genome.wustl.edu	37	11	6740206	6740206	+	RNA	SNP	C	C	T	rs10839602	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:6740206C>T	ENST00000526769.3	-	0	2998					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TGAATATCCACTGGGTGAATG	0.418													c|||	830	0.165735	0.0802	0.3631	5008	,	,		21566	0.2331		0.1193	False		,,,				2504	0.1196					dbGAP											0																																										-	-	-			0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6740206C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.418	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	33	0.00	0	C	NR_003945		6740206	6740206	-1	no_errors	ENST00000526769	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	1.000	T
HKDC1	80201	genome.wustl.edu	37	10	71027231	71027231	+	3'UTR	SNP	G	G	C	rs2611	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr10:71027231G>C	ENST00000354624.5	+	0	3605				HK1_ENST00000360289.2_5'Flank|RP11-227H15.5_ENST00000413220.1_RNA|HK1_ENST00000448642.2_5'Flank	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1						carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						TGTGTTGCAGGTGTTGATAGT	0.368													C|||	2064	0.412141	0.5113	0.2666	5008	,	,		18182	0.3224		0.333	False		,,,				2504	0.5552					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.*718G>C	10.37:g.71027231G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	RNA	SNP	-	NULL	ENST00000354624.5	37	NULL	CCDS7288.1	10	799	0.3658424908424908	250	0.508130081300813	104	0.287292817679558	195	0.3409090909090909	250	0.32981530343007914	C	8.320	0.824079	0.16678	.	.	ENSG00000156510	ENST00000395087	.	.	.	4.06	0.485	0.16830	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	5.999999999950489E-6	.	.	.	.	.	.	T	0.45175	-0.9279	4	0.66056	D	0.02	.	3.8983	0.09149	0.0:0.4371:0.1795:0.3834	rs2611;rs3167941;rs3740602;rs52806372;rs2611	.	.	.	L	716	.	ENSP00000378522:V716L	V	+	1	0	HKDC1	70697237	0.001000	0.12720	0.000000	0.03702	0.162000	0.22319	-0.120000	0.10660	-0.112000	0.11979	-0.215000	0.12644	GTG	HKDC1	-	-	ENSG00000156510		0.368	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	HGNC	protein_coding	OTTHUMT00000048389.1	78	0.00	0	G	NM_025130		71027231	71027231	+1	no_errors	ENST00000486754	ensembl	human	known	69_37n	rna	95	10.38	11	SNP	0.000	C
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29975994	29975994	+	RNA	SNP	C	C	A	rs549544716	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:29975994C>A	ENST00000376797.3	-	0	1053				ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		GTGACCCACCCCCCTCTCTGA	0.597													A|||	960	0.191693	0.2988	0.1744	5008	,	,		14381	0.1915		0.0964	False		,,,				2504	0.1575					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29975994C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.597	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1	31	0.00	0	C	NR_026751		29975994	29975994	+1	no_errors	ENST00000462773	ensembl	human	known	69_37n	rna	38	19.15	9	SNP	0.018	A
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29976024	29976024	+	RNA	SNP	C	C	G	rs3765604	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:29976024C>G	ENST00000376797.3	-	0	1053				ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		ATAACGAGGTCCTGGGTTCTG	0.592													G|||	959	0.191494	0.2988	0.1744	5008	,	,		14956	0.1905		0.0954	False		,,,				2504	0.1585					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29976024C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.592	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1	30	0.00	0	C	NR_026751		29976024	29976024	+1	no_errors	ENST00000462773	ensembl	human	known	69_37n	rna	40	18.37	9	SNP	0.997	G
HYDIN	54768	genome.wustl.edu	37	16	71015329	71015329	+	Missense_Mutation	SNP	G	G	T	rs78763837	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr16:71015329G>T	ENST00000393567.2	-	29	4625	c.4475C>A	c.(4474-4476)cCc>cAc	p.P1492H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1492					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCAGATTTGGGGAAAGATTCC	0.483													G|||	2340	0.467252	0.4455	0.5591	5008	,	,		18143	0.5645		0.328	False		,,,				2504	0.4744					dbGAP											0													66.0	66.0	66.0					16																	71015329		1844	4072	5916	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4475C>A	16.37:g.71015329G>T	ENSP00000377197:p.Pro1492His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.P1491H	ENST00000393567.2	37	c.4472	CCDS59269.1	16	964	0.4413919413919414	233	0.4735772357723577	184	0.5082872928176796	312	0.5454545454545454	235	0.3100263852242744	G	24.0	4.480970	0.84747	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01221	5.15	4.26	4.26	0.50523	.	0.000000	0.33023	U	0.005376	T	0.00012	0.0000	M	0.80183	2.485	0.09310	P	1.0	D	0.89917	1.0	D	0.91635	0.999	T	0.45056	-0.9287	9	0.49607	T	0.09	.	16.6224	0.84934	0.0:0.0:1.0:0.0	.	1491	F8WD23	.	H	1492;1491	ENSP00000377197:P1492H	ENSP00000313052:P1491H	P	-	2	0	HYDIN	69572830	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.105000	0.94246	2.083000	0.62718	0.603000	0.83216	CCC	HYDIN	-	NULL	ENSG00000157423		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	41	0.00	0	G			71015329	71015329	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	T
IGHG4	3503	genome.wustl.edu	37	14	106092383	106092383	+	RNA	SNP	C	C	G	rs12434110	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr14:106092383C>G	ENST00000390543.2	-	0	20							P01861	IGHG4_HUMAN	immunoglobulin heavy constant gamma 4 (G4m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										GGGGGAAGACCGATGGGCCCT	0.667													N|||	2465	0.492212	0.1445	0.6916	5008	,	,		16071	0.4534		0.6163	False		,,,				2504	0.7331					dbGAP											0													30.0	21.0	24.0					14																	106092383		1983	4071	6054	-	-	-			0			K01316		14q32.33	2012-10-02			ENSG00000211892	ENSG00000211892		"""Immunoglobulins / IGH locus"""	5528	other	immunoglobulin gene		147130					Standard	NG_001019		Approved			P01861	OTTHUMG00000152481		14.37:g.106092383C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.S7	ENST00000390543.2	37	c.21		14																																																																																			IGHG4	-	pfscan_Ig-like	ENSG00000211892		0.667	IGHG4-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG4	HGNC	IG_C_gene	OTTHUMT00000326390.1	15	0.00	0	C	NG_001019		106092383	106092383	-1	no_start_codon	ENST00000390543	ensembl	human	known	69_37n	silent	20	31.03	9	SNP	0.271	G
IGLV5-48	28780	genome.wustl.edu	37	22	22707309	22707309	+	RNA	SNP	C	C	T	rs35779014	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr22:22707309C>T	ENST00000390293.1	+	0	21									immunoglobulin lambda variable 5-48 (non-functional)																		ATCCTCTCCTCCTCCTGTTCC	0.567													.|||	984	0.196486	0.1785	0.1585	5008	,	,		16100	0.2054		0.2217	False		,,,				2504	0.2127					dbGAP											0																																										-	-	-			0			Z73649		22q11.2	2012-02-08	2008-09-15		ENSG00000211647	ENSG00000211647		"""Immunoglobulins / IGL locus"""	5925	other	immunoglobulin gene			"""immunoglobulin lambda variable 5-48"""				Standard	NG_000002		Approved				OTTHUMG00000151041		22.37:g.22707309C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L7	ENST00000390293.1	37	c.21		22																																																																																			IGLV5-48	-	NULL	ENSG00000211647		0.567	IGLV5-48-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV5-48	HGNC	IG_V_gene	OTTHUMT00000321100.2	54	0.00	0	C	NG_000002		22707309	22707309	+1	no_stop_codon	ENST00000390293	ensembl	human	known	69_37n	silent	44	10.20	5	SNP	0.007	T
IGLC3	3539	genome.wustl.edu	37	22	23247082	23247082	+	RNA	SNP	C	C	T	rs2009433	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr22:23247082C>T	ENST00000390325.2	+	0	0				IGLJ3_ENST00000390324.2_RNA			P0CG06	LAC3_HUMAN	immunoglobulin lambda constant 3 (Kern-Oz+ marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GGACCACTGGCCCCAGCTTCC	0.617													C|||	1007	0.201078	0.1974	0.1873	5008	,	,		32084	0.0079		0.3797	False		,,,				2504	0.2311					dbGAP											0																																										-	-	-			0			J00254		22q11.2	2012-02-08			ENSG00000211679	ENSG00000211679		"""Immunoglobulins / IGL locus"""	5857	other	immunoglobulin gene				IGLC			Standard	NG_000002		Approved			P0CG06	OTTHUMG00000151217		22.37:g.23247082C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8Q4|P80423	Missense_Mutation	SNP	NULL	p.P10S	ENST00000390325.2	37	c.28		22																																																																																			IGLJ3	-	NULL	ENSG00000211678		0.617	IGLC3-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGLJ3	HGNC	IG_C_gene	OTTHUMT00000321821.3	65	0.00	0	C	NG_000002		23247082	23247082	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390324	ensembl	human	known	69_37n	missense	48	11.86	7	SNP	0.009	T
IMPACT	55364	genome.wustl.edu	37	18	22028136	22028136	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr18:22028136C>T	ENST00000284202.4	+	9	889	c.748C>T	c.(748-750)Cat>Tat	p.H250Y		NM_018439.3	NP_060909	Q9P2X3	IMPCT_HUMAN	impact RWD domain protein	250					negative regulation of protein phosphorylation (GO:0001933)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					GCGTCTTCTTCATCTCATGGA	0.388																																						dbGAP											0													115.0	104.0	108.0					18																	22028136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026264	CCDS11886.1	18q11.2-q12.1	2012-12-07	2012-12-07		ENSG00000154059	ENSG00000154059			20387	protein-coding gene	gene with protein product	"""RWD domain containing 5"""	615319	"""Impact homolog (mouse)"""			11116084	Standard	NM_018439		Approved	RWDD5	uc002kvh.4	Q9P2X3	OTTHUMG00000131943	ENST00000284202.4:c.748C>T	18.37:g.22028136C>T	ENSP00000284202:p.His250Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXG0|Q49AM0|Q9H2X4	Missense_Mutation	SNP	pfam_Impact_N,pfam_RWD-domain,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pfscan_RWD-domain	p.H250Y	ENST00000284202.4	37	c.748	CCDS11886.1	18	.	.	.	.	.	.	.	.	.	.	C	13.62	2.293026	0.40594	.	.	ENSG00000154059	ENST00000284202	T	0.37058	1.22	4.38	4.38	0.52667	Ribosomal protein S5 domain 2-type fold (1);Impact, N-terminal (2);Uncharacterised protein family UPF0029, Impact, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	M	0.84948	2.725	0.58432	D	0.999996	P	0.49961	0.93	P	0.48654	0.585	T	0.65183	-0.6230	10	0.87932	D	0	.	16.1951	0.82021	0.0:1.0:0.0:0.0	.	250	Q9P2X3	IMPCT_HUMAN	Y	250	ENSP00000284202:H250Y	ENSP00000284202:H250Y	H	+	1	0	IMPACT	20282134	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.301000	0.72782	2.421000	0.82119	0.655000	0.94253	CAT	IMPACT	-	pfam_Impact_N,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000154059		0.388	IMPACT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPACT	HGNC	protein_coding	OTTHUMT00000254901.1	51	0.00	0	C	NM_018439		22028136	22028136	+1	no_errors	ENST00000284202	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	1.000	T
KLRF2	100431172	genome.wustl.edu	37	12	10046052	10046052	+	Missense_Mutation	SNP	C	C	A	rs576601	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr12:10046052C>A	ENST00000535540.1	+	5	498	c.391C>A	c.(391-393)Cct>Act	p.P131T		NM_001190765.1	NP_001177694.1	D3W0D1	KLRF2_HUMAN	killer cell lectin-like receptor subfamily F, member 2	131	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine secretion (GO:0050663)|natural killer cell degranulation (GO:0043320)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)										CAGTTTAAAACCTGGACATTT	0.333													C|||	2713	0.541733	0.2995	0.6556	5008	,	,		15218	0.4544		0.7018	False		,,,				2504	0.7137					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS53743.1	12p13.31	2010-06-30				ENSG00000256797		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	37646	protein-coding gene	gene with protein product						20194751	Standard	NM_001190765		Approved	NKp65	uc021quy.1	D3W0D1		ENST00000535540.1:c.391C>A	12.37:g.10046052C>A	ENSP00000438244:p.Pro131Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.P131T	ENST00000535540.1	37	c.391	CCDS53743.1	12	1180	0.5402930402930403	168	0.34146341463414637	229	0.6325966850828729	245	0.42832167832167833	538	0.7097625329815304	C	4.885	0.164525	0.09287	.	.	ENSG00000256797	ENST00000535540	T	0.28255	1.62	2.17	-0.135	0.13477	.	.	.	.	.	T	0.00012	0.0000	N	0.11560	0.145	0.80722	P	0.0	.	.	.	.	.	.	T	0.32188	-0.9916	6	0.15499	T	0.54	.	2.8728	0.05621	0.0:0.4939:0.2842:0.2219	rs576601;rs58812010;rs576601	.	.	.	T	131	ENSP00000438244:P131T	ENSP00000438244:P131T	P	+	1	0	KLRF2	9937319	0.000000	0.05858	0.000000	0.03702	0.246000	0.25737	-0.561000	0.05957	-0.028000	0.13850	0.297000	0.19635	CCT	KLRF2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000256797		0.333	KLRF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF2	HGNC	protein_coding		21	0.00	0	C	NM_001190765		10046052	10046052	+1	no_errors	ENST00000535540	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.000	A
KNCN	148930	genome.wustl.edu	37	1	47013180	47013180	+	3'UTR	SNP	A	A	G	rs10890404	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:47013180A>G	ENST00000481882.2	-	0	908				KNCN_ENST00000396314.3_3'UTR|KNCN_ENST00000524908.1_5'UTR|MKNK1-AS1_ENST00000602433.1_RNA			A6PVL3	KNCN_HUMAN	kinocilin							apical plasma membrane (GO:0016324)|ciliary basal body (GO:0036064)|cuticular plate (GO:0032437)|integral component of membrane (GO:0016021)|kinocilium (GO:0060091)|neuronal cell body (GO:0043025)				central_nervous_system(1)|endometrium(1)|lung(1)|ovary(1)	4	Acute lymphoblastic leukemia(166;0.155)					GCGTCCGGCGACACCTTGCTC	0.582													A|||	2553	0.509784	0.4032	0.7219	5008	,	,		15683	0.3016		0.7306	False		,,,				2504	0.4908					dbGAP											0													26.0	31.0	30.0					1																	47013180		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK056573	CCDS44133.1	1p33	2014-02-12	2006-10-26		ENSG00000162456	ENSG00000162456			26488	protein-coding gene	gene with protein product		611455				15855039	Standard	NM_001097611		Approved	FLJ32011, KINO, L5	uc001cpy.2	A6PVL3	OTTHUMG00000007987	ENST00000481882.2:c.*222T>C	1.37:g.47013180A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXE3	RNA	SNP	-	NULL	ENST00000481882.2	37	NULL		1																																																																																			KNCN	-	-	ENSG00000162456		0.582	KNCN-002	KNOWN	not_organism_supported|basic	protein_coding	KNCN	HGNC	protein_coding	OTTHUMT00000316334.2	39	0.00	0	A	NM_182516		47013180	47013180	-1	no_errors	ENST00000524908	ensembl	human	putative	69_37n	rna	37	11.90	5	SNP	0.001	G
LINC00152	112597	genome.wustl.edu	37	2	87755101	87755101	+	lincRNA	SNP	C	C	T	rs1262	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:87755101C>T	ENST00000409054.1	+	0	215					NR_015395.1				long intergenic non-protein coding RNA 152																		TGCCTGAGCCCGTGCCTGTCT	0.483													C|||	1410	0.28155	0.1437	0.4827	5008	,	,		18930	0.0714		0.4394	False		,,,				2504	0.3793					dbGAP											0																																										-	-	-			0			BC009508		2p11.2	2014-02-14	2011-08-11	2011-08-11	ENSG00000222041	ENSG00000222041		"""Long non-coding RNAs"""	28717	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 59"", ""non-protein coding RNA 152"""	C2orf59, NCRNA00152		24523021, 23801869, 22689435, 24036268	Standard	NR_024204		Approved	MGC4677	uc002ssk.4		OTTHUMG00000130273		2.37:g.87755101C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000409054.1	37	NULL		2																																																																																			LINC00152	-	-	ENSG00000222041		0.483	LINC00152-005	KNOWN	basic	lincRNA	LINC00152	HGNC	lincRNA	OTTHUMT00000330387.3	46	0.00	0	C	XR_042051		87755101	87755101	+1	no_errors	ENST00000409054	ensembl	human	known	69_37n	rna	47	20.34	12	SNP	0.000	T
LINC00243	401247	genome.wustl.edu	37	6	30782235	30782235	+	RNA	SNP	G	G	A	rs2394412	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:30782235G>A	ENST00000399196.1	-	0	459									long intergenic non-protein coding RNA 243																		ATGAGTCACCGGTAGAAGTCG	0.468													A|||	2045	0.408347	0.1316	0.4755	5008	,	,		20177	0.6508		0.3131	False		,,,				2504	0.5828					dbGAP											0																																										-	-	-			0			AK098012		6p21.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000236006	ENSG00000214894		"""Long non-coding RNAs"""	30956	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 214 (putative)"", ""non-protein coding RNA 243"""	C6orf214, NCRNA00243			Standard	XR_159458		Approved	bQB230F21.2, FLJ40693, bQB10J12.2			OTTHUMG00000031539		6.37:g.30782235G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000399196.1	37	NULL		6																																																																																			LINC00243	-	-	ENSG00000214894		0.468	LINC00243-001	KNOWN	basic|exp_conf	processed_transcript	LINC00243	HGNC	processed_transcript	OTTHUMT00000076501.3	45	0.00	0	G			30782235	30782235	-1	no_errors	ENST00000399196	ensembl	human	known	69_37n	rna	56	13.85	9	SNP	0.002	A
LOXL1	4016	genome.wustl.edu	37	15	74244344	74244344	+	3'UTR	SNP	C	C	T	rs3522	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr15:74244344C>T	ENST00000261921.7	+	0	2217				LOXL1_ENST00000567675.1_3'UTR	NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1						extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						GGATTCCGGACGCCAGACCCC	0.537													T|||	2807	0.560503	0.5961	0.5086	5008	,	,		17570	0.6101		0.4304	False		,,,				2504	0.6319					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.*166C>T	15.37:g.74244344C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUL3|Q96BW7	RNA	SNP	-	NULL	ENST00000261921.7	37	NULL	CCDS10253.1	15																																																																																			LOXL1	-	-	ENSG00000129038		0.537	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL1	HGNC	protein_coding	OTTHUMT00000268995.2	53	0.00	0	C	NM_005576		74244344	74244344	+1	no_errors	ENST00000567675	ensembl	human	known	69_37n	rna	47	14.55	8	SNP	0.103	T
MAGEA12	4111	genome.wustl.edu	37	X	151900503	151900503	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chrX:151900503C>G	ENST00000357916.4	-	2	453	c.298G>C	c.(298-300)Gac>Cac	p.D100H	CSAG4_ENST00000361201.4_RNA|CSAG1_ENST00000370291.2_5'Flank|MAGEA12_ENST00000393900.3_Missense_Mutation_p.D100H|CSAG1_ENST00000452779.2_5'Flank|CSAG1_ENST00000370287.3_5'Flank|MAGEA12_ENST00000393869.3_Missense_Mutation_p.D100H	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	100										breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GTCTCCAGGTCAGGAAAGGTG	0.537																																						dbGAP											0													143.0	120.0	128.0					X																	151900503		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.298G>C	X.37:g.151900503C>G	ENSP00000350592:p.Asp100His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSD3	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.D100H	ENST00000357916.4	37	c.298	CCDS14710.1	X	.	.	.	.	.	.	.	.	.	.	C	9.851	1.193606	0.22037	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.01933	4.55;4.55;4.55	1.14	-2.17	0.07059	.	3.215290	0.00829	N	0.001651	T	0.10594	0.0259	M	0.86953	2.85	0.09310	N	1	D	0.56746	0.977	P	0.60345	0.873	T	0.29458	-1.0011	10	0.62326	D	0.03	.	2.3943	0.04386	0.0:0.4036:0.3213:0.275	.	100	P43365	MAGAC_HUMAN	H	100	ENSP00000350592:D100H;ENSP00000377447:D100H;ENSP00000377478:D100H	ENSP00000350592:D100H	D	-	1	0	MAGEA12	151651159	0.002000	0.14202	0.000000	0.03702	0.068000	0.16541	-0.028000	0.12350	-0.758000	0.04690	0.179000	0.17066	GAC	MAGEA12	-	NULL	ENSG00000213401		0.537	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA12	HGNC	protein_coding	OTTHUMT00000058764.1	64	0.00	0	C	NM_005367		151900503	151900503	-1	no_errors	ENST00000357916	ensembl	human	known	69_37n	missense	66	21.18	18	SNP	0.000	G
MBNL2	10150	genome.wustl.edu	37	13	97995412	97995412	+	Missense_Mutation	SNP	C	C	T	rs575403433		TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr13:97995412C>T	ENST00000376673.3	+	4	1263	c.482C>T	c.(481-483)cCg>cTg	p.P161L	MBNL2_ENST00000343600.4_Missense_Mutation_p.P161L|MBNL2_ENST00000397601.1_Missense_Mutation_p.P161L|MBNL2_ENST00000445661.2_Intron|MBNL2_ENST00000345429.6_Missense_Mutation_p.P161L			Q5VZF2	MBNL2_HUMAN	muscleblind-like splicing regulator 2	161					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			GGAAGTCCACCGGTCACTGTC	0.498													.|||	1	0.000199681	0.0	0.0	5008	,	,		17164	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													91.0	91.0	91.0					13																	97995412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061261	CCDS9483.1, CCDS9484.1	13q31.1	2013-01-18	2012-02-23		ENSG00000139793	ENSG00000139793		"""Zinc fingers, CCCH-type domain containing"""	16746	protein-coding gene	gene with protein product		607327	"""muscleblind-like 2 (Drosophila)"""			11929853	Standard	NM_207304		Approved	MBLL, MBLL39	uc001vmz.4	Q5VZF2	OTTHUMG00000017239	ENST00000376673.3:c.482C>T	13.37:g.97995412C>T	ENSP00000365861:p.Pro161Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXY5|Q58F19|Q8NEV3|Q8TD82	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.P161L	ENST00000376673.3	37	c.482		13	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249730	0.59212	.	.	ENSG00000139793	ENST00000397601;ENST00000343600;ENST00000345429;ENST00000376673	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.66	4.81	0.61882	.	0.105634	0.64402	D	0.000003	T	0.40347	0.1113	L	0.38531	1.155	0.80722	D	1	P;D;P	0.56035	0.911;0.974;0.873	B;B;B	0.43301	0.243;0.415;0.324	T	0.17018	-1.0383	10	0.17369	T	0.5	.	16.9517	0.86247	0.0:0.8722:0.1278:0.0	.	161;161;161	Q5VZF2;A2A3S3;Q5VZF2-2	MBNL2_HUMAN;.;.	L	161	ENSP00000380726:P161L;ENSP00000344214:P161L;ENSP00000267287:P161L;ENSP00000365861:P161L	ENSP00000344214:P161L	P	+	2	0	MBNL2	96793413	1.000000	0.71417	0.888000	0.34837	0.990000	0.78478	7.445000	0.80570	1.503000	0.48686	0.655000	0.94253	CCG	MBNL2	-	NULL	ENSG00000139793		0.498	MBNL2-202	KNOWN	basic	protein_coding	MBNL2	HGNC	protein_coding		42	0.00	0	C	NM_144778		97995412	97995412	+1	no_errors	ENST00000376673	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	0.998	T
MED21	9412	genome.wustl.edu	37	12	27181513	27181513	+	3'UTR	SNP	T	T	G	rs8628	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr12:27181513T>G	ENST00000282892.3	+	0	584				MED21_ENST00000546323.1_Intron|MED21_ENST00000536503.1_3'UTR	NM_001271811.1|NM_004264.3	NP_001258740.1|NP_004255.2	Q13503	MED21_HUMAN	mediator complex subunit 21						blastocyst development (GO:0001824)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)	DNA-directed RNA polymerase activity (GO:0003899)|transcription coactivator activity (GO:0003713)					Colorectal(261;0.0847)					TATGACACATTACCTTTTTAG	0.303													T|||	641	0.127995	0.0461	0.1196	5008	,	,		21330	0.006		0.33	False		,,,				2504	0.1626					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U46837	CCDS8711.1	12p12	2007-07-30	2007-07-30	2007-07-30		ENSG00000152944			11473	protein-coding gene	gene with protein product		603800	"""SRB7 (suppressor of RNA polymerase B, yeast) homolog"", ""SRB7 suppressor of RNA polymerase B homolog (yeast)"""	SURB7		8598913	Standard	NM_004264		Approved	SRB7	uc001rhp.2	Q13503		ENST00000282892.3:c.*119T>G	12.37:g.27181513T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4I3|Q6IB05|Q92811	RNA	SNP	-	NULL	ENST00000282892.3	37	NULL	CCDS8711.1	12																																																																																			MED21	-	-	ENSG00000152944		0.303	MED21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED21	HGNC	protein_coding	OTTHUMT00000403262.1	36	0.00	0	T	NM_004264		27181513	27181513	+1	no_errors	ENST00000536503	ensembl	human	known	69_37n	rna	39	13.04	6	SNP	0.012	G
MLC1	23209	genome.wustl.edu	37	22	50506877	50506877	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr22:50506877G>T	ENST00000311597.5	-	10	1485	c.879C>A	c.(877-879)taC>taA	p.Y293*	MLC1_ENST00000431262.2_Nonsense_Mutation_p.Y263*|MLC1_ENST00000483836.1_5'UTR|MLC1_ENST00000450140.2_Nonsense_Mutation_p.Y241*|MLC1_ENST00000395876.2_Nonsense_Mutation_p.Y293*|MLC1_ENST00000538737.1_Nonsense_Mutation_p.Y259*|MLC1_ENST00000535444.1_Nonsense_Mutation_p.Y214*	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	293					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		TGGCTGGCGGGTAATCCTTAA	0.512																																						dbGAP											0													84.0	87.0	86.0					22																	50506877		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.879C>A	22.37:g.50506877G>T	ENSP00000310375:p.Tyr293*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Nonsense_Mutation	SNP	NULL	p.Y293*	ENST00000311597.5	37	c.879	CCDS14083.1	22	.	.	.	.	.	.	.	.	.	.	G	38	7.057247	0.98032	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140	.	.	.	4.63	2.12	0.27331	.	0.182541	0.47852	D	0.000202	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.9001	7.261	0.26203	0.2701:0.0:0.7299:0.0	.	.	.	.	X	293;293;259;263;214;241	.	ENSP00000310375:Y293X	Y	-	3	2	MLC1	48849004	0.998000	0.40836	0.980000	0.43619	0.131000	0.20780	0.505000	0.22642	1.067000	0.40740	0.563000	0.77884	TAC	MLC1	-	NULL	ENSG00000100427		0.512	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	HGNC	protein_coding	OTTHUMT00000316979.2	38	0.00	0	G	NM_015166		50506877	50506877	-1	no_errors	ENST00000311597	ensembl	human	known	69_37n	nonsense	25	21.88	7	SNP	0.999	T
MLIP	90523	genome.wustl.edu	37	6	54002231	54002231	+	Intron	SNP	A	A	C	rs2754779	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:54002231A>C	ENST00000274897.5	+	4	725				MLIP_ENST00000509997.1_Intron|MLIP_ENST00000502396.1_Missense_Mutation_p.E455A|MLIP_ENST00000370877.2_Intron|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000514921.1_Missense_Mutation_p.E444A|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000358276.5_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein							nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						GACCAAAAAGAAAAGCAGACC	0.527													C|||	1527	0.304912	0.5832	0.3501	5008	,	,		18193	0.0833		0.2704	False		,,,				2504	0.1605					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.613-11623A>C	6.37:g.54002231A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NULL	p.E455A	ENST00000274897.5	37	c.1364	CCDS4954.1	6	667	0.30540293040293043	281	0.5711382113821138	132	0.36464088397790057	47	0.08216783216783216	207	0.27308707124010556	C	0.030	-1.337566	0.01287	.	.	ENSG00000146147	ENST00000514921;ENST00000503951;ENST00000502396	T;T;T	0.39787	2.06;1.06;2.07	5.04	-1.38	0.09027	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.35599	-0.9782	7	0.16896	T	0.51	.	5.4706	0.16668	0.1365:0.395:0.0:0.4685	rs2754779;rs60117302;rs2754779	455;455;444	Q5VWP3-3;B7ZA42;D6RE05	.;.;.	A	444;403;455	ENSP00000425142:E444A;ENSP00000426830:E403A;ENSP00000426290:E455A	ENSP00000426290:E455A	E	+	2	0	MLIP	54110190	0.000000	0.05858	0.002000	0.10522	0.080000	0.17528	-0.917000	0.04025	-0.580000	0.05944	-0.935000	0.02700	GAA	MLIP	-	NULL	ENSG00000146147		0.527	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	20	0.00	0	A	NM_138569		54002231	54002231	+1	no_errors	ENST00000502396	ensembl	human	putative	69_37n	missense	28	15.15	5	SNP	0.002	C
MMP25	64386	genome.wustl.edu	37	16	3097494	3097494	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr16:3097494G>A	ENST00000336577.4	+	2	415	c.178G>A	c.(178-180)Gat>Aat	p.D60N		NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	61					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	GAAGTTGCGCGATGCCATCAA	0.687																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)	dbGAP											0													69.0	75.0	73.0					16																	3097494		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.178G>A	16.37:g.3097494G>A	ENSP00000337816:p.Asp60Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96F04|Q96TE2	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.D60N	ENST00000336577.4	37	c.178	CCDS10492.1	16	.	.	.	.	.	.	.	.	.	.	G	11.55	1.670695	0.29693	.	.	ENSG00000008516	ENST00000336577	T	0.36520	1.25	4.99	4.02	0.46733	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.000000	0.46758	D	0.000267	T	0.33294	0.0858	L	0.58428	1.81	0.25362	N	0.98878	B	0.28439	0.212	B	0.26693	0.072	T	0.21930	-1.0231	10	0.39692	T	0.17	.	11.6388	0.51220	0.0902:0.0:0.9098:0.0	.	60	Q9NPA2	MMP25_HUMAN	N	60	ENSP00000337816:D60N	ENSP00000337816:D60N	D	+	1	0	MMP25	3037495	0.000000	0.05858	0.626000	0.29213	0.370000	0.29829	0.451000	0.21779	2.319000	0.78375	0.563000	0.77884	GAT	MMP25	-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_matrix_strom	ENSG00000008516		0.687	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP25	HGNC	protein_coding	OTTHUMT00000437116.1	65	0.00	0	G	NM_022468		3097494	3097494	+1	no_errors	ENST00000336577	ensembl	human	known	69_37n	missense	108	25.52	37	SNP	0.475	A
MRGPRG-AS1	283303	genome.wustl.edu	37	11	3243346	3243346	+	RNA	SNP	C	C	T	rs11026004	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:3243346C>T	ENST00000420873.2	+	0	808				MRGPRG-AS1_ENST00000541883.1_RNA|MRGPRG-AS1_ENST00000434798.1_RNA			Q2M3A8	MRAS1_HUMAN	MRGPRG antisense RNA 1																		CTGGGTCCCTCCTGGCTGCCT	0.607													C|||	3100	0.61901	0.6112	0.3977	5008	,	,		16245	0.755		0.5825	False		,,,				2504	0.684					dbGAP											0																																										-	-	-			0			AK097749		11p15.4	2012-10-12	2012-08-15	2012-08-10	ENSG00000236301	ENSG00000236301		"""Long non-coding RNAs"""	26691	non-coding RNA	RNA, long non-coding			"""chromosome 11 open reading frame 36"", ""MRGPRG antisense RNA 1 (non-protein coding)"""	C11orf36			Standard	NR_027138		Approved	FLJ36102, HSD-40	uc001lxo.2	Q2M3A8	OTTHUMG00000011707		11.37:g.3243346C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6TF48|Q8N7R8|Q8N9X7	Missense_Mutation	SNP	NULL	p.S135F	ENST00000420873.2	37	c.404		11	1314	0.6016483516483516	293	0.5955284552845529	161	0.4447513812154696	423	0.7395104895104895	437	0.5765171503957783	c	7.560	0.664563	0.14710	.	.	ENSG00000236301	ENST00000434798;ENST00000420873;ENST00000541883	.	.	.	0.364	0.364	0.16124	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	D	0.58268	0.982	P	0.50825	0.651	T	0.38329	-0.9666	5	0.87932	D	0	.	.	.	.	rs11026004;rs59173951;rs11026004	135	Q2M3A8	CK036_HUMAN	F	135	.	ENSP00000436553:S135F	S	+	2	0	C11orf36	3199922	0.004000	0.15560	0.007000	0.13788	0.007000	0.05969	0.325000	0.19628	0.406000	0.25560	0.407000	0.27541	TCC	MRGPRG-AS1	-	NULL	ENSG00000236301		0.607	MRGPRG-AS1-002	KNOWN	alternative_5_UTR|basic	antisense	MRGPRG-AS1	HGNC	antisense	OTTHUMT00000032345.2	28	0.00	0	C	NR_027138		3243346	3243346	+1	no_errors	ENST00000420873	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.029	T
MMP24	10893	genome.wustl.edu	37	20	33864484	33864484	+	3'UTR	SNP	A	A	G	rs7280	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr20:33864484A>G	ENST00000246186.6	+	0	4095				MMP24-AS1_ENST00000455178.1_RNA|MMP24-AS1_ENST00000435366.1_RNA|MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456790.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000424358.1_RNA|RP4-614O4.11_ENST00000444717.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)						cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	CAGGCTCCCCATTGGCTCCTG	0.652													G|||	2862	0.571486	0.9614	0.3746	5008	,	,		17106	0.2877		0.4185	False		,,,				2504	0.6339					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.*2072A>G	20.37:g.33864484A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBG8|Q9H440	RNA	SNP	-	NULL	ENST00000246186.6	37	NULL	CCDS46593.1	20																																																																																			MT1P3	-	-	ENSG00000126005		0.652	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1P3	HGNC	protein_coding	OTTHUMT00000078851.4	25	0.00	0	A	NM_006690		33864484	33864484	-1	no_errors	ENST00000435366	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.000	G
MTX1	4580	genome.wustl.edu	37	1	155181843	155181843	+	Intron	SNP	G	G	T	rs2974935	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:155181843G>T	ENST00000368376.3	+	4	784				MTX1_ENST00000495589.1_Intron|MTX1_ENST00000609421.1_Intron|RP11-263K19.6_ENST00000455788.1_RNA|MTX1_ENST00000316721.4_Intron|GBAP1_ENST00000486869.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGGGTACCAGACAGGACTCC	0.567													G|||	3112	0.621406	0.6112	0.6859	5008	,	,		18889	0.7609		0.5239	False		,,,				2504	0.546					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708	ENST00000368376.3:c.679-75G>T	1.37:g.155181843G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	RNA	SNP	-	NULL	ENST00000368376.3	37	NULL	CCDS1100.1	1																																																																																			MTX1	-	-	ENSG00000173171		0.567	MTX1-001	KNOWN	basic|CCDS	protein_coding	MTX1	HGNC	protein_coding	OTTHUMT00000086844.1	38	0.00	0	G	NM_198883		155181843	155181843	+1	no_errors	ENST00000481771	ensembl	human	known	69_37n	rna	58	10.77	7	SNP	0.000	T
NF1	4763	genome.wustl.edu	37	17	29527590	29527590	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr17:29527590C>T	ENST00000358273.4	+	9	1422	c.1039C>T	c.(1039-1041)Cag>Tag	p.Q347*	NF1_ENST00000356175.3_Nonsense_Mutation_p.Q347*|NF1_ENST00000431387.4_Nonsense_Mutation_p.Q347*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	347					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCTACTTGTTCAGTCCATGGT	0.348			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(6)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	GRCh37	CS086356	NF1	S							110.0	101.0	104.0					17																	29527590		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1039C>T	17.37:g.29527590C>T	ENSP00000351015:p.Gln347*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.Q347*	ENST00000358273.4	37	c.1039	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.616177	0.96649	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	19.1503	0.93485	0.0:1.0:0.0:0.0	.	.	.	.	X	347;347;347;13	.	ENSP00000348498:Q347X	Q	+	1	0	NF1	26551716	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	7.182000	0.77689	2.542000	0.85734	0.591000	0.81541	CAG	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.348	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	56	0.00	0	C	NM_000267		29527590	29527590	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	nonsense	50	19.35	12	SNP	1.000	T
MYO15B	80022	genome.wustl.edu	37	17	73609112	73609112	+	3'UTR	SNP	G	G	A	rs820142	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr17:73609112G>A	ENST00000578382.2	+	0	4586					NR_003587.2		Q96JP2	MY15B_HUMAN	myosin XVB pseudogene							cytoplasm (GO:0005737)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)										GATCATGGGCGCATACCTGGT	0.657													A|||	2509	0.500998	0.7209	0.4107	5008	,	,		16745	0.3919		0.5258	False		,,,				2504	0.3548					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0					17q25.1	2014-07-16			ENSG00000266714	ENSG00000266714		"""Myosins / Myosin superfamily : Class XV"""	14083	pseudogene	pseudogene						11294886	Standard	NR_003587		Approved	MYO15BP	uc002jon.1	Q96JP2	OTTHUMG00000179794	ENST00000578382.2:c.*4583G>A	17.37:g.73609112G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfscan_MyTH4_dom	p.A116T	ENST00000578382.2	37	c.346		17																																																																																			MYO15B	-	pfscan_MyTH4_dom	ENSG00000266714		0.657	MYO15B-001	KNOWN	sequence_error|basic	processed_transcript	MYO15B	Clone_based_vega_gene	protein_coding	OTTHUMT00000448172.2	31	0.00	0	G	NR_003587		73609112	73609112	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000578462	ensembl	human	putative	69_37n	missense	34	12.82	5	SNP	0.001	A
NPAS2	4862	genome.wustl.edu	37	2	101437561	101437561	+	Intron	SNP	G	G	A	rs6542989	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:101437561G>A	ENST00000335681.5	+	1	263				AC092168.2_ENST00000430586.1_RNA|NPAS2_ENST00000542504.1_Missense_Mutation_p.E25K	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGACCTTTCTGAAGAGCTGGG	0.572													A|||	2081	0.415535	0.6936	0.2968	5008	,	,		15318	0.5169		0.1779	False		,,,				2504	0.2638					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.-23+685G>A	2.37:g.101437561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.E25K	ENST00000335681.5	37	c.73	CCDS2048.1	2	873	0.39972527472527475	349	0.709349593495935	102	0.281767955801105	294	0.513986013986014	128	0.16886543535620052	A	17.89	3.500184	0.64298	.	.	ENSG00000170485	ENST00000542504	T	0.05649	3.41	4.53	-3.89	0.04193	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30534	-0.9975	7	0.02654	T	1	.	7.3833	0.26868	0.4177:0.1318:0.4506:0.0	rs6542989	25	F5H027	.	K	25	ENSP00000438428:E25K	ENSP00000438428:E25K	E	+	1	0	NPAS2	100803993	0.000000	0.05858	0.000000	0.03702	0.594000	0.36715	-1.971000	0.01503	-1.504000	0.01810	-1.677000	0.00738	GAA	NPAS2	-	NULL	ENSG00000170485		0.572	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	34	0.00	0	G			101437561	101437561	+1	no_errors	ENST00000542504	ensembl	human	known	69_37n	missense	54	10.00	6	SNP	0.000	A
NPAS2	4862	genome.wustl.edu	37	2	101437601	101437601	+	Intron	SNP	C	C	G	rs6542990	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:101437601C>G	ENST00000335681.5	+	1	263				AC092168.2_ENST00000430586.1_RNA|NPAS2_ENST00000542504.1_Missense_Mutation_p.T38S	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGGACAGGCACCACCCGGCTA	0.517													C|||	2081	0.415535	0.6936	0.2968	5008	,	,		15319	0.5169		0.1779	False		,,,				2504	0.2638					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.-23+725C>G	2.37:g.101437601C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.T38S	ENST00000335681.5	37	c.113	CCDS2048.1	2	874|874	0.4001831501831502|0.4001831501831502	351|351	0.7134146341463414|0.7134146341463414	102|102	0.281767955801105|0.281767955801105	294|294	0.513986013986014|0.513986013986014	127|127	0.16754617414248021|0.16754617414248021	C|C	11.41|11.41	1.629204|1.629204	0.28978|0.28978	.|.	.|.	ENSG00000170485|ENSG00000170485	ENST00000427413|ENST00000542504	.|T	.|0.05139	.|3.49	4.38|4.38	2.43|2.43	0.29744|0.29744	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	.|B	.|0.12013	.|0.005	.|B	.|0.08055	.|0.003	T|T	0.31806|0.31806	-0.9930|-0.9930	3|7	.|0.02654	.|T	.|1	.|.	7.2842|7.2842	0.26328|0.26328	0.1915:0.6231:0.1855:0.0|0.1915:0.6231:0.1855:0.0	rs6542990|rs6542990	.|38	.|F5H027	.|.	A|S	39|38	.|ENSP00000438428:T38S	.|ENSP00000438428:T38S	P|T	+|+	1|2	0|0	NPAS2|NPAS2	100804033|100804033	0.014000|0.014000	0.17966|0.17966	0.057000|0.057000	0.19452|0.19452	0.155000|0.155000	0.21991|0.21991	0.554000|0.554000	0.23407|0.23407	1.024000|1.024000	0.39682|0.39682	0.462000|0.462000	0.41574|0.41574	CCA|ACC	NPAS2	-	NULL	ENSG00000170485		0.517	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	28	0.00	0	C			101437601	101437601	+1	no_errors	ENST00000542504	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	0.011	G
OLFML3	56944	genome.wustl.edu	37	1	114523105	114523105	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:114523105G>A	ENST00000320334.4	+	2	340	c.266G>A	c.(265-267)cGt>cAt	p.R89H	OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000369551.1_Missense_Mutation_p.R69H|OLFML3_ENST00000393300.2_Missense_Mutation_p.R69H	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	89					multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAGTGGATCGTCTGGAGCGG	0.587																																						dbGAP											0													81.0	81.0	81.0					1																	114523105		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.266G>A	1.37:g.114523105G>A	ENSP00000322273:p.Arg89His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Missense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.R89H	ENST00000320334.4	37	c.266	CCDS870.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.519266	0.96416	.	.	ENSG00000116774	ENST00000369551;ENST00000320334;ENST00000393300	D;D;D	0.90676	-2.71;-2.71;-2.71	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.91516	0.7321	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.912	D	0.92147	0.5725	10	0.54805	T	0.06	.	18.6695	0.91506	0.0:0.0:1.0:0.0	.	69;89	Q9NRN5-2;Q9NRN5	.;OLFL3_HUMAN	H	69;89;69	ENSP00000358564:R69H;ENSP00000322273:R89H;ENSP00000376977:R69H	ENSP00000322273:R89H	R	+	2	0	OLFML3	114324628	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.289000	0.72696	2.513000	0.84729	0.555000	0.69702	CGT	OLFML3	-	NULL	ENSG00000116774		0.587	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	31	0.00	0	G	NM_020190		114523105	114523105	+1	no_errors	ENST00000320334	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	1.000	A
OPA1	4976	genome.wustl.edu	37	3	193386239	193386239	+	Intron	SNP	C	C	T	rs12494482	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr3:193386239C>T	ENST00000392438.3	+	27	3052				OPA1_ENST00000361715.2_Intron|OPA1_ENST00000361510.2_Intron|OPA1_ENST00000361150.2_Intron|OPA1_ENST00000361828.2_Intron|OPA1_ENST00000361908.3_Intron	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)						apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		CATGGAGTCCCTTTTACTGAG	0.577													T|||	2335	0.466254	0.5855	0.4697	5008	,	,		18334	0.3571		0.4553	False		,,,				2504	0.4264					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2818+1170C>T	3.37:g.193386239C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNW4	Silent	SNP	NULL	p.P74	ENST00000392438.3	37	c.222	CCDS43186.1	3																																																																																			OPA1	-	NULL	ENSG00000198836		0.577	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	47	0.00	0	C	NM_130837		193386239	193386239	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000429164	ensembl	human	putative	69_37n	silent	70	12.50	10	SNP	0.001	T
OVOL2	58495	genome.wustl.edu	37	20	18005113	18005113	+	3'UTR	SNP	C	C	T	rs1976	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr20:18005113C>T	ENST00000278780.6	-	0	1237				OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2						angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TCACTAACGGCAACTGACAAT	0.493													T|||	3837	0.766174	0.9191	0.6859	5008	,	,		19367	0.7857		0.6282	False		,,,				2504	0.7382					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.*167G>A	20.37:g.18005113C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	RNA	SNP	-	NULL	ENST00000278780.6	37	NULL	CCDS13132.1	20																																																																																			OVOL2	-	-	ENSG00000125850		0.493	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVOL2	HGNC	protein_coding	OTTHUMT00000078148.5	13	0.00	0	C	NM_021220		18005113	18005113	-1	no_errors	ENST00000483661	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.000	T
PCLO	27445	genome.wustl.edu	37	7	82578885	82578885	+	Silent	SNP	C	C	T			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr7:82578885C>T	ENST00000333891.9	-	6	11356	c.11019G>A	c.(11017-11019)aaG>aaA	p.K3673K	PCLO_ENST00000423517.2_Silent_p.K3673K|PCLO_ENST00000437081.1_Silent_p.K393K	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCTGCATCATCTTGGCTGTCT	0.478																																						dbGAP											0													199.0	196.0	197.0					7																	82578885		1950	4145	6095	-	-	-	SO:0001819	synonymous_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11019G>A	7.37:g.82578885C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.K3673	ENST00000333891.9	37	c.11019	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.478	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	40	0.00	0	C	NM_014510		82578885	82578885	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	silent	25	24.24	8	SNP	1.000	T
NTN4	59277	genome.wustl.edu	37	12	96067161	96067161	+	Intron	SNP	G	G	T	rs2004786	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr12:96067161G>T	ENST00000343702.4	-	8	1959				NTN4_ENST00000344911.4_Intron|NTN4_ENST00000553059.1_Intron|NTN4_ENST00000538383.1_Intron|PGAM1P5_ENST00000552554.1_RNA	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4						axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						AAGAACTTGTGGGGGAGGAAC	0.512													G|||	1730	0.345447	0.357	0.3646	5008	,	,		15885	0.2649		0.33	False		,,,				2504	0.4151					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1511-3239C>A	12.37:g.96067161G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	RNA	SNP	-	NULL	ENST00000343702.4	37	NULL	CCDS9054.1	12																																																																																			PGAM1P5	-	-	ENSG00000257150		0.512	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM1P5	HGNC	protein_coding	OTTHUMT00000408372.1	31	0.00	0	G	NM_021229		96067161	96067161	+1	no_errors	ENST00000552554	ensembl	human	known	69_37n	rna	25	18.75	6	SNP	0.345	T
PI16	221476	genome.wustl.edu	37	6	36929296	36929296	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:36929296G>A	ENST00000373674.3	+	3	791	c.463G>A	c.(463-465)Gag>Aag	p.E155K		NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	155	SCP.				negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGGTGTTGAGGAGACCAACAT	0.587																																						dbGAP											0													166.0	146.0	153.0					6																	36929296		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.463G>A	6.37:g.36929296G>A	ENSP00000362778:p.Glu155Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.E155K	ENST00000373674.3	37	c.463	CCDS34440.1	6	.	.	.	.	.	.	.	.	.	.	G	18.04	3.533899	0.64972	.	.	ENSG00000164530	ENST00000536757;ENST00000373674;ENST00000539035	T	0.09163	3.01	5.08	5.08	0.68730	CAP domain (3);	0.585977	0.18853	N	0.129345	T	0.03783	0.0107	N	0.16233	0.39	0.09310	N	1	P;P	0.51351	0.92;0.944	P;P	0.47603	0.551;0.467	T	0.39840	-0.9594	10	0.23891	T	0.37	.	11.1793	0.48618	0.0865:0.0:0.9135:0.0	.	155;155	Q6UXB8;Q6UXB8-2	PI16_HUMAN;.	K	155;155;7	ENSP00000362778:E155K	ENSP00000362778:E155K	E	+	1	0	PI16	37037274	0.649000	0.27322	0.023000	0.16930	0.842000	0.47809	3.089000	0.50183	2.646000	0.89796	0.561000	0.74099	GAG	PI16	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000164530		0.587	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI16	HGNC	protein_coding	OTTHUMT00000040380.1	26	0.00	0	G	NM_153370		36929296	36929296	+1	no_errors	ENST00000373674	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.009	A
PIK3C2G	5288	genome.wustl.edu	37	12	18435399	18435401	+	In_Frame_Del	DEL	CCC	CCC	-	rs398055356|rs35277916	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	CCC	CCC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr12:18435399_18435401delCCC	ENST00000266497.5	+	1	422_424	c.384_386delCCC	c.(382-387)agcccc>agc	p.P129del	PIK3C2G_ENST00000538779.1_In_Frame_Del_p.P129del|RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000433979.1_In_Frame_Del_p.P129del|PIK3C2G_ENST00000535651.1_In_Frame_Del_p.P129del			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	129				Missing (in Ref. 3; EAW96387 and 4; AAI30278). {ECO:0000305}.	chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CCTGGGGAAGCCCCATAGGAAAA	0.374														1544	0.308307	0.1989	0.3934	5008	,	,		18294	0.3046		0.3917	False		,,,				2504	0.3139					dbGAP											0										763,2763		88,587,1088						0.4	0.1		dbSNP_126	65	3123,4701		610,1903,1399	no	coding	PIK3C2G	NM_004570.4		698,2490,2487	A1A1,A1R,RR		39.9156,21.6393,34.2379				3886,7464				-	-	-	SO:0001651	inframe_deletion	0			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.384_386delCCC	12.37:g.18435399_18435401delCCC	ENSP00000266497:p.Pro129del	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U0	In_Frame_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.P129in_frame_del	ENST00000266497.5	37	c.384_386	CCDS44839.1	12																																																																																			PIK3C2G	-	NULL	ENSG00000139144		0.374	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	33	0.00	0	CCC	NM_004570		18435399	18435401	+1	no_errors	ENST00000538779	ensembl	human	known	69_37n	in_frame_del	48	12.73	7	DEL	0.001:0.000:0.000	-
PIK3CA	5290	genome.wustl.edu	37	3	178922324	178922324	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr3:178922324G>A	ENST00000263967.3	+	6	1250	c.1093G>A	c.(1093-1095)Gaa>Aaa	p.E365K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	365	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E365K(6)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCATGGAGGAGAACCCTTATG	0.343		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	6	Substitution - Missense(6)	endometrium(6)											222.0	182.0	194.0					3																	178922324		1844	4096	5940	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1093G>A	3.37:g.178922324G>A	ENSP00000263967:p.Glu365Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E365K	ENST00000263967.3	37	c.1093	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611196	0.87258	.	.	ENSG00000121879	ENST00000263967	T	0.68624	-0.34	5.53	5.53	0.82687	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.000000	0.85682	D	0.000000	T	0.58075	0.2097	L	0.29908	0.895	0.80722	D	1	P	0.36086	0.536	B	0.38921	0.285	T	0.53457	-0.8436	10	0.12430	T	0.62	-11.3698	19.431	0.94765	0.0:0.0:1.0:0.0	.	365	P42336	PK3CA_HUMAN	K	365	ENSP00000263967:E365K	ENSP00000263967:E365K	E	+	1	0	PIK3CA	180405018	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.335000	0.96500	2.600000	0.87896	0.655000	0.94253	GAA	PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000121879		0.343	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	42	0.00	0	G			178922324	178922324	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	64	13.51	10	SNP	1.000	A
HELZ2	85441	genome.wustl.edu	37	20	62202632	62202632	+	Intron	SNP	A	A	G			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr20:62202632A>G	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCCTGGGAACCTCTGGCTC	0.701																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-411T>C	20.37:g.62202632A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			RP4-697K14.7	-	-	ENSG00000130589		0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	29	0.00	0	A	NM_001037335		62202632	62202632	-1	no_errors	ENST00000479540	ensembl	human	known	69_37n	rna	37	15.91	7	SNP	0.992	G
U66059.58	0	genome.wustl.edu	37	7	141988676	141988676	+	lincRNA	SNP	C	C	T	rs2960769	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr7:141988676C>T	ENST00000486508.1	+	0	362				PRSS3P3_ENST00000463748.1_RNA																							CACATGGATTCGGCTGGATTA	0.403													C|||	959	0.191494	0.1604	0.2233	5008	,	,		22618	0.0089		0.3469	False		,,,				2504	0.2393					dbGAP											0																																										-	-	-			0																															7.37:g.141988676C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000486508.1	37	NULL		7																																																																																			PRSS3P3	-	-	ENSG00000242115		0.403	U66059.58-001	KNOWN	basic	lincRNA	PRSS3P3	HGNC	lincRNA	OTTHUMT00000351333.2	36	0.00	0	C			141988676	141988676	-1	no_errors	ENST00000463748	ensembl	human	known	69_37n	rna	51	10.53	6	SNP	0.041	T
PTPN14	5784	genome.wustl.edu	37	1	214705676	214705676	+	Intron	SNP	A	A	C	rs6665957	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:214705676A>C	ENST00000366956.5	-	1	41				PTPN14_ENST00000491277.1_5'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14						lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GTGTCCTGCTACACCAGCTTC	0.652													C|||	2398	0.478834	0.767	0.2536	5008	,	,		16560	0.5248		0.2425	False		,,,				2504	0.4448				Colon(92;557 1424 24372 34121 40073)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.153+18849T>G	1.37:g.214705676A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSI0	RNA	SNP	-	NULL	ENST00000366956.5	37	NULL	CCDS1514.1	1																																																																																			PTPN14	-	-	ENSG00000152104		0.652	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	23	0.00	0	A	NM_005401		214705676	214705676	-1	no_errors	ENST00000491277	ensembl	human	putative	69_37n	rna	34	12.82	5	SNP	0.344	C
PTPN21	11099	genome.wustl.edu	37	14	89016855	89016855	+	5'UTR	SNP	G	G	T	rs2896079	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr14:89016855G>T	ENST00000556564.1	-	0	191				RP11-507K2.3_ENST00000556328.1_RNA|PTPN21_ENST00000328736.3_5'UTR|PTPN21_ENST00000554628.1_5'UTR	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ATCCTCTCCGGATGGGACGAA	0.577													G|||	964	0.192492	0.0401	0.2939	5008	,	,		14427	0.0179		0.4791	False		,,,				2504	0.2117					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.-94C>A	14.37:g.89016855G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000556564.1	37	NULL	CCDS9884.1	14																																																																																			PTPN21	-	-	ENSG00000070778		0.577	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	HGNC	protein_coding	OTTHUMT00000410303.1	15	0.00	0	G			89016855	89016855	-1	no_errors	ENST00000554628	ensembl	human	known	69_37n	rna	28	22.22	8	SNP	0.000	T
RAB13	5872	genome.wustl.edu	37	1	153954778	153954779	+	Intron	INS	-	-	AC	rs371625659|rs563763984|rs550367961|rs530111525|rs71584158|rs56853500	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:153954778_153954779insAC	ENST00000368575.3	-	7	650				RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TATCAACACCAacacacacaca	0.446																																					Ovarian(138;395 2427 24306 43415)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.534+87->GT	1.37:g.153954787_153954788dupAC		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	RNA	INS	-	NULL	ENST00000368575.3	37	NULL	CCDS1058.1	1																																																																																			RAB13	-	-	ENSG00000143545		0.446	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	HGNC	protein_coding	OTTHUMT00000088992.1	18	0.00	0	-	NM_002870		153954778	153954779	-1	no_errors	ENST00000462680	ensembl	human	known	69_37n	rna	34	15.00	6	INS	0.000:0.000	AC
RAI1	10743	genome.wustl.edu	37	17	17698429	17698429	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr17:17698429A>G	ENST00000353383.1	+	3	2636	c.2167A>G	c.(2167-2169)Aca>Gca	p.T723A	RAI1_ENST00000261641.6_Missense_Mutation_p.T723A	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	723					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		AGACCCCACTACAGCAGCTTT	0.602																																						dbGAP											0													67.0	68.0	67.0					17																	17698429		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.2167A>G	17.37:g.17698429A>G	ENSP00000323074:p.Thr723Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	smart_Znf_PHD	p.T723A	ENST00000353383.1	37	c.2167	CCDS11188.1	17	.	.	.	.	.	.	.	.	.	.	A	1.944	-0.442840	0.04604	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641;ENST00000315321	T;T;T	0.63096	-0.02;2.68;0.58	5.28	-3.56	0.04626	.	0.607879	0.16850	N	0.196990	T	0.39253	0.1071	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28459	-1.0043	10	0.14252	T	0.57	.	9.3776	0.38292	0.372:0.1133:0.5146:0.0	.	723	Q7Z5J4	RAI1_HUMAN	A	723;723;723;723;723;675	ENSP00000323074:T723A;ENSP00000379120:T723A;ENSP00000261641:T723A	ENSP00000261641:T723A	T	+	1	0	RAI1	17639154	0.000000	0.05858	0.002000	0.10522	0.454000	0.32378	-0.428000	0.06991	-0.554000	0.06150	0.459000	0.35465	ACA	RAI1	-	NULL	ENSG00000108557		0.602	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1	33	0.00	0	A	NM_030665		17698429	17698429	+1	no_errors	ENST00000353383	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.001	G
RFX8	731220	genome.wustl.edu	37	2	102067083	102067083	+	Missense_Mutation	SNP	T	T	C	rs7585228	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:102067083T>C	ENST00000376826.2	-	4	319	c.320A>G	c.(319-321)tAc>tGc	p.Y107C	RFX8_ENST00000428343.1_Intron			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	107					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						ACCTATCAGGTAGCAATACTG	0.378													T|||	3486	0.696086	0.6241	0.5403	5008	,	,		20241	0.6696		0.8469	False		,,,				2504	0.7761					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.320A>G	2.37:g.102067083T>C	ENSP00000366022:p.Tyr107Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ32	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.Y107C	ENST00000376826.2	37	c.320		2	1513	0.6927655677655677	316	0.6422764227642277	220	0.6077348066298343	337	0.5891608391608392	640	0.8443271767810027	t	9.441	1.087946	0.20390	.	.	ENSG00000196460	ENST00000376826	T	0.77750	-1.12	4.54	0.712	0.18167	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.37007	P	0.10444399999999998	.	.	.	.	.	.	T	0.30060	-0.9991	5	0.39692	T	0.17	.	3.9278	0.09272	0.0:0.1959:0.1827:0.6214	rs7585228;rs59431766	.	.	.	C	107	ENSP00000366022:Y107C	ENSP00000366022:Y107C	Y	-	2	0	RFX8	101433515	1.000000	0.71417	0.998000	0.56505	0.725000	0.41563	0.289000	0.18957	0.039000	0.15632	-0.405000	0.06341	TAC	RFX8	-	NULL	ENSG00000196460		0.378	RFX8-201	KNOWN	basic|appris_principal	protein_coding	RFX8	HGNC	protein_coding		26	0.00	0	T	NM_001145664		102067083	102067083	-1	no_errors	ENST00000376826	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	0.998	C
RHOA	387	genome.wustl.edu	37	3	49413010	49413010	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr3:49413010G>A	ENST00000418115.1	-	2	397	c.13C>T	c.(13-15)Cgg>Tgg	p.R5W	RHOA_ENST00000454011.2_Missense_Mutation_p.R5W|RHOA_ENST00000422781.1_Missense_Mutation_p.R5W	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	5					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		AGTTTCTTCCGGATGGCAGCC	0.473																																						dbGAP											0													103.0	95.0	98.0					3																	49413010		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.13C>T	3.37:g.49413010G>A	ENSP00000400175:p.Arg5Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R5W	ENST00000418115.1	37	c.13	CCDS2795.1	3	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961576	0.53400	.	.	ENSG00000067560	ENST00000418115;ENST00000454011;ENST00000422781;ENST00000445425;ENST00000431929	T;T;T;T;T	0.72051	-0.45;1.68;-0.48;-0.62;2.04	5.89	-0.78	0.10969	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	T	0.69904	0.3163	M	0.78344	2.41	0.80722	D	1	B	0.24920	0.114	B	0.17098	0.017	T	0.67130	-0.5748	10	0.59425	D	0.04	.	17.5915	0.87998	0.0:0.0:0.2927:0.7073	.	5	P61586	RHOA_HUMAN	W	5	ENSP00000400175:R5W;ENSP00000394483:R5W;ENSP00000413587:R5W;ENSP00000408402:R5W;ENSP00000400747:R5W	ENSP00000400175:R5W	R	-	1	2	RHOA	49388014	1.000000	0.71417	0.981000	0.43875	0.887000	0.51463	0.905000	0.28504	-0.467000	0.06932	-0.318000	0.08688	CGG	RHOA	-	tigrfam_Small_GTP-bd_dom	ENSG00000067560		0.473	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOA	HGNC	protein_coding	OTTHUMT00000346157.3	24	0.00	0	G	NM_001664		49413010	49413010	-1	no_errors	ENST00000418115	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	0.997	A
GIPC2	54810	genome.wustl.edu	37	1	78560583	78560583	+	Intron	SNP	G	G	A	rs565164	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:78560583G>A	ENST00000370759.3	+	3	619				RNA5SP22_ENST00000365393.1_RNA	NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						tgagattggtgcattcaTTAC	0.363													G|||	1193	0.238219	0.1604	0.1585	5008	,	,		20256	0.504		0.2594	False		,,,				2504	0.1043					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.427-53G>A	1.37:g.78560583G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYD3|Q9NXS7	RNA	SNP	-	NULL	ENST00000370759.3	37	NULL	CCDS685.1	1																																																																																			RNA5SP22	-	-	ENSG00000202263		0.363	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNA5SP22	HGNC	protein_coding	OTTHUMT00000098629.1	28	0.00	0	G	NM_017655		78560583	78560583	-1	no_errors	ENST00000365393	ensembl	human	known	69_37n	rna	31	11.11	4	SNP	0.496	A
RNF44	22838	genome.wustl.edu	37	5	175956177	175956177	+	Intron	SNP	G	G	A	rs2241584	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr5:175956177G>A	ENST00000274811.4	-	11	1761				RNF44_ENST00000537487.1_Intron	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44								zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGGTCCGCTGGAGCCAGAAC	0.617													G|||	1580	0.315495	0.3086	0.317	5008	,	,		17227	0.3115		0.3817	False		,,,				2504	0.2597					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.1237-86C>T	5.37:g.175956177G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P204L	ENST00000274811.4	37	c.611	CCDS4404.1	5	739	0.3383699633699634	157	0.31910569105691056	117	0.32320441988950277	186	0.32517482517482516	279	0.36807387862796836	G	10.28	1.306291	0.23736	.	.	ENSG00000146083	ENST00000506378	.	.	.	3.29	0.26	0.15588	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.43798	-0.9369	3	.	.	.	.	2.753	0.05286	0.2426:0.0:0.3787:0.3787	rs2241584;rs56598278;rs58450512;rs2241584	.	.	.	L	204	.	.	P	-	2	0	RNF44	175888783	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.318000	0.19504	0.025000	0.15241	-0.237000	0.12165	CCA	RNF44	-	smart_Znf_RING	ENSG00000146083		0.617	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF44	HGNC	protein_coding	OTTHUMT00000253156.2	20	0.00	0	G			175956177	175956177	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000506378	ensembl	human	putative	69_37n	missense	33	15.00	6	SNP	0.000	A
CHIAP2	149620	genome.wustl.edu	37	1	111826007	111826007	+	RNA	SNP	C	C	T	rs58982671	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:111826007C>T	ENST00000369743.4	+	0	1372					NR_003928.1				chitinase, acidic pseudogene 2																		CGACTGACACCGGCAGCAACG	0.522													c|||	1083	0.216254	0.1014	0.2608	5008	,	,		18712	0.3006		0.2783	False		,,,				2504	0.1892					dbGAP											0																																										-	-	-			0					1p13.2	2012-10-11			ENSG00000203878	ENSG00000203878			44463	pseudogene	pseudogene							Standard	NR_003928		Approved		uc009wgb.3		OTTHUMG00000012173		1.37:g.111826007C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000369743.4	37	NULL		1																																																																																			RP11-165H20.1	-	-	ENSG00000203878		0.522	CHIAP2-001	KNOWN	basic	processed_transcript	RP11-165H20.1	Clone_based_vega_gene	pseudogene	OTTHUMT00000033667.3	33	0.00	0	C			111826007	111826007	+1	no_errors	ENST00000369743	ensembl	human	known	69_37n	rna	28	12.50	4	SNP	0.913	T
RPL13AP3	645683	genome.wustl.edu	37	14	56232970	56232970	+	lincRNA	SNP	T	T	C	rs2184557	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr14:56232970T>C	ENST00000554458.1	+	0	75				RPL13AP3_ENST00000494676.1_RNA																							CGTGGCTAAGTAGTTACTGCT	0.587													C|||	3286	0.65615	0.9221	0.4914	5008	,	,		16651	0.756		0.3678	False		,,,				2504	0.6074					dbGAP											0																																										-	-	-			0																															14.37:g.56232970T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000554458.1	37	NULL		14																																																																																			RPL13AP3	-	-	ENSG00000177350		0.587	RP11-813I20.2-001	KNOWN	basic	lincRNA	RPL13AP3	HGNC	lincRNA	OTTHUMT00000411474.1	23	0.00	0	T			56232970	56232970	+1	no_errors	ENST00000494676	ensembl	human	known	69_37n	rna	29	25.64	10	SNP	1.000	C
RPL13AP3	645683	genome.wustl.edu	37	14	56233260	56233260	+	lincRNA	SNP	C	C	T	rs2152281	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr14:56233260C>T	ENST00000554458.1	+	0	75				RPL13AP3_ENST00000494676.1_RNA																							ATGGTGGTTCCTGCTGCCCTC	0.582													C|||	3081	0.615216	0.764	0.4827	5008	,	,		18770	0.7569		0.3668	False		,,,				2504	0.6176					dbGAP											0																																										-	-	-			0																															14.37:g.56233260C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000554458.1	37	NULL		14																																																																																			RPL13AP3	-	-	ENSG00000177350		0.582	RP11-813I20.2-001	KNOWN	basic	lincRNA	RPL13AP3	HGNC	lincRNA	OTTHUMT00000411474.1	29	0.00	0	C			56233260	56233260	+1	no_errors	ENST00000494676	ensembl	human	known	69_37n	rna	49	10.91	6	SNP	1.000	T
SCN9A	6335	genome.wustl.edu	37	2	167085365	167085365	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:167085365A>G	ENST00000409435.1	-	21	4041	c.4042T>C	c.(4042-4044)Tat>Cat	p.Y1348H	SCN9A_ENST00000409672.1_Missense_Mutation_p.Y1337H|SCN9A_ENST00000303354.6_Missense_Mutation_p.Y1349H|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000375387.4_Missense_Mutation_p.Y1349H			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1348					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATACACTCATAGAACTTGCCA	0.408																																						dbGAP											0													184.0	192.0	190.0					2																	167085365		2130	4279	6409	-	-	-	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4042T>C	2.37:g.167085365A>G	ENSP00000386330:p.Tyr1348His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.Y1349H	ENST00000409435.1	37	c.4045	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	A	16.17	3.047788	0.55110	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9	5.4	5.4	0.78164	.	0.000000	0.53938	D	0.000052	D	0.96703	0.8924	L	0.41632	1.29	0.53688	D	0.999978	B	0.28880	0.226	B	0.38458	0.274	D	0.95740	0.8782	10	0.27785	T	0.31	.	15.4175	0.74983	1.0:0.0:0.0:0.0	.	1337	E7EUN6	.	H	1337;1349;1349;1348	ENSP00000386306:Y1337H;ENSP00000364536:Y1349H;ENSP00000304748:Y1349H;ENSP00000386330:Y1348H	ENSP00000304748:Y1349H	Y	-	1	0	SCN9A	166793611	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.128000	0.64733	2.058000	0.61347	0.455000	0.32223	TAT	SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.408	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	35	0.00	0	A	NM_002977		167085365	167085365	-1	no_errors	ENST00000303354	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	G
SLC24A4	123041	genome.wustl.edu	37	14	92959228	92959228	+	Intron	SNP	G	G	A	rs78254567	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr14:92959228G>A	ENST00000532405.1	+	17	1942				SLC24A4_ENST00000531433.1_Intron|SLC24A4_ENST00000351924.5_Intron|SLC24A4_ENST00000393265.2_Intron|SLC24A4_ENST00000298877.1_Intron			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4						amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GGGACAAGGAGGAAGGCAGTG	0.507													G|||	1260	0.251597	0.289	0.1758	5008	,	,		18341	0.3433		0.167	False		,,,				2504	0.2474				NSCLC(10;315 435 10383 28450 38798)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1717-592G>A	14.37:g.92959228G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.R457K	ENST00000532405.1	37	c.1370	CCDS9903.2	14	464	0.21245421245421245	111	0.22560975609756098	68	0.1878453038674033	162	0.28321678321678323	123	0.16226912928759896	G	6.208	0.406585	0.11754	.	.	ENSG00000140090	ENST00000525557	.	.	.	3.14	-6.29	0.02013	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.26430	-1.0103	3	.	.	.	.	7.1452	0.25579	0.1495:0.4393:0.4112:0.0	.	.	.	.	K	457	.	.	R	+	2	0	SLC24A4	92028981	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.656000	0.01980	-1.468000	0.01892	0.655000	0.94253	AGG	SLC24A4	-	NULL	ENSG00000140090		0.507	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	HGNC	protein_coding	OTTHUMT00000395240.1	33	0.00	0	G	NM_153646		92959228	92959228	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525557	ensembl	human	putative	69_37n	missense	31	11.43	4	SNP	0.000	A
SMG7	9887	genome.wustl.edu	37	1	183511476	183511476	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:183511476G>A	ENST00000347615.2	+	14	1800	c.1681G>A	c.(1681-1683)Gga>Aga	p.G561R	SMG7_ENST00000456731.2_Missense_Mutation_p.G519R|SMG7_ENST00000508461.1_Missense_Mutation_p.G519R|SMG7_ENST00000507469.1_Missense_Mutation_p.G561R|SMG7_ENST00000515829.2_Missense_Mutation_p.G561R|SMG7_ENST00000367537.3_Missense_Mutation_p.G590R	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	561					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						CAGAGACCAAGGAAGAAGTTT	0.403																																						dbGAP											0													123.0	118.0	120.0					1																	183511476		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1681G>A	1.37:g.183511476G>A	ENSP00000340766:p.Gly561Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	pfam_EST1	p.G561R	ENST00000347615.2	37	c.1681	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322186	0.41096	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.21	5.21	0.72293	.	0.607508	0.17776	N	0.162430	T	0.31638	0.0803	N	0.19112	0.55	0.44789	D	0.997794	P;B;B;B;P;B	0.39216	0.664;0.435;0.232;0.343;0.664;0.089	B;B;B;B;B;B	0.33690	0.109;0.077;0.077;0.16;0.168;0.038	T	0.08330	-1.0727	10	0.14656	T	0.56	-9.6324	9.8039	0.40781	0.1534:0.0:0.8466:0.0	.	519;590;519;561;561;561	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	R	519;590;519;519;561;561;561	ENSP00000407629:G519R;ENSP00000356507:G590R;ENSP00000426915:G519R;ENSP00000388390:G519R;ENSP00000340766:G561R;ENSP00000425133:G561R;ENSP00000421358:G561R	ENSP00000340766:G561R	G	+	1	0	SMG7	181778099	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.562000	0.45914	2.568000	0.86640	0.655000	0.94253	GGA	SMG7	-	NULL	ENSG00000116698		0.403	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1	14	0.00	0	G	NM_014837		183511476	183511476	+1	no_errors	ENST00000507469	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	A
SMPD4P1	645280	genome.wustl.edu	37	22	20977077	20977077	+	RNA	SNP	C	C	A	rs564493	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr22:20977077C>A	ENST00000443839.1	-	0	1457									sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) pseudogene 1																		GGTTCCAGCCCACAAGGACAC	0.577													a|||	3030	0.605032	0.7201	0.4856	5008	,	,		20420	0.6438		0.3867	False		,,,				2504	0.7188					dbGAP											0																																										-	-	-			0					22q11.21	2011-03-22			ENSG00000223553	ENSG00000223553			39673	pseudogene	pseudogene							Standard	NG_028286		Approved				OTTHUMG00000030245		22.37:g.20977077C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000443839.1	37	NULL		22																																																																																			SMPD4P1	-	-	ENSG00000223553		0.577	SMPD4P1-002	KNOWN	basic	processed_transcript	SMPD4P1	HGNC	pseudogene	OTTHUMT00000319965.1	30	0.00	0	C			20977077	20977077	-1	no_errors	ENST00000443839	ensembl	human	known	69_37n	rna	35	12.50	5	SNP	0.006	A
STK3	6788	genome.wustl.edu	37	8	99895940	99895940	+	Silent	SNP	G	G	A	rs16897117	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr8:99895940G>A	ENST00000523601.1	-	3	444	c.45C>T	c.(43-45)aaC>aaT	p.N15N		NM_001256312.1	NP_001243241.1	Q13188	STK3_HUMAN	serine/threonine kinase 3	0					apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		AGGCTGCTCCGTTCCTAAGGC	0.458													G|||	236	0.0471246	0.025	0.0418	5008	,	,		18529	0.001		0.0785	False		,,,				2504	0.0961					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000523601.1:c.45C>T	8.37:g.99895940G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SARAH,pfscan_Prot_kinase_cat_dom	p.N15	ENST00000523601.1	37	c.45	CCDS59108.1	8																																																																																			STK3	-	NULL	ENSG00000104375		0.458	STK3-002	PUTATIVE	basic|CCDS	protein_coding	STK3	HGNC	protein_coding	OTTHUMT00000379636.2	22	0.00	0	G	NM_006281		99895940	99895940	-1	no_errors	ENST00000523601	ensembl	human	putative	69_37n	silent	27	12.90	4	SNP	0.000	A
STPG1	90529	genome.wustl.edu	37	1	24684116	24684116	+	3'UTR	SNP	G	G	A	rs7527465	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr1:24684116G>A	ENST00000374409.1	-	0	2176				STPG1_ENST00000337248.4_3'UTR|STPG1_ENST00000440416.1_3'UTR|STPG1_ENST00000003583.8_3'UTR|GRHL3_ENST00000350501.5_Intron|STPG1_ENST00000468303.1_5'UTR	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1						apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGTATCTGGCGGGGTTAATGT	0.547													G|||	745	0.148762	0.3472	0.1311	5008	,	,		17210	0.005		0.1262	False		,,,				2504	0.0644					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.*917C>T	1.37:g.24684116G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	RNA	SNP	-	NULL	ENST00000374409.1	37	NULL	CCDS55581.1	1																																																																																			STPG1	-	-	ENSG00000001460		0.547	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STPG1	HGNC	protein_coding	OTTHUMT00000009172.1	23	0.00	0	G	NM_178122		24684116	24684116	-1	no_errors	ENST00000468303	ensembl	human	known	69_37n	rna	28	12.50	4	SNP	0.000	A
TBCD	6904	genome.wustl.edu	37	17	80895745	80895745	+	Intron	SNP	T	T	C	rs3785520	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr17:80895745T>C	ENST00000355528.4	+	36	3411				TBCD_ENST00000539345.2_Missense_Mutation_p.V1102A|TBCD_ENST00000576691.1_3'UTR	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D						'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCGACACTCGTGTGTGTAGGC	0.627													C|||	4025	0.803714	0.9221	0.6484	5008	,	,		19797	0.7381		0.7654	False		,,,				2504	0.8609					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.3282-180T>C	17.37:g.80895745T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.V1102A	ENST00000355528.4	37	c.3305	CCDS45818.1	17	1665	0.7623626373626373	455	0.9247967479674797	251	0.6933701657458563	407	0.7115384615384616	552	0.7282321899736148	C	0.007	-1.963410	0.00461	.	.	ENSG00000141556	ENST00000334614	.	.	.	1.36	-0.273	0.12915	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.17107	-1.0380	5	.	.	.	.	5.062	0.14562	0.0:0.2701:0.0:0.7299	rs3785520;rs60326117;rs3785520	1102	Q9BTW9-4	.	A	853	.	.	V	+	2	0	TBCD	78489034	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.899000	0.01600	-0.656000	0.05380	-0.349000	0.07799	GTG	TBCD	-	NULL	ENSG00000141556		0.627	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	45	0.00	0	T	NM_005993		80895745	80895745	+1	no_errors	ENST00000539345	ensembl	human	novel	69_37n	missense	51	12.07	7	SNP	0.001	C
TCEANC	170082	genome.wustl.edu	37	X	13682577	13682577	+	3'UTR	SNP	G	G	A	rs3761625	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chrX:13682577G>A	ENST00000380600.1	+	0	2037				TCEANC_ENST00000490617.1_3'UTR			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing						regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						AAGTCACCCTGGAACTCATCC	0.378													G|||	2101	0.556556	0.3177	0.402	3775	,	,		15439	0.496		0.3857	False		,,,				2504	0.5256					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.*894G>A	X.37:g.13682577G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI06|B2RDM3	RNA	SNP	-	NULL	ENST00000380600.1	37	NULL		X																																																																																			TCEANC	-	-	ENSG00000176896		0.378	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	TCEANC	HGNC	protein_coding	OTTHUMT00000055796.1	44	0.00	0	G	NM_152634		13682577	13682577	+1	no_errors	ENST00000490617	ensembl	human	known	69_37n	rna	75	11.63	10	SNP	0.000	A
TLR1	7096	genome.wustl.edu	37	4	38798935	38798935	+	Silent	SNP	C	C	T	rs5743614	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr4:38798935C>T	ENST00000502213.2	-	3	1747	c.1518G>A	c.(1516-1518)tcG>tcA	p.S506S	TLR1_ENST00000510552.1_5'Flank|TLR1_ENST00000308979.2_Silent_p.S506S			Q15399	TLR1_HUMAN	toll-like receptor 1	506					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						AGAAATCAGCCGATGGGTGGG	0.418													c|||	2802	0.559505	0.8404	0.4654	5008	,	,		18263	0.5992		0.2744	False		,,,				2504	0.499				GBM(5;216 373 40795 46382)	dbGAP											0													75.0	79.0	78.0					4																	38798935		2202	4280	6482	-	-	-	SO:0001819	synonymous_variant	0			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1518G>A	4.37:g.38798935C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Silent	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom	p.S506	ENST00000502213.2	37	c.1518	CCDS33973.1	4																																																																																			TLR1	-	pirsf_Toll-like_receptor	ENSG00000174125		0.418	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	HGNC	protein_coding	OTTHUMT00000360510.3	57	0.00	0	C			38798935	38798935	-1	no_errors	ENST00000308979	ensembl	human	known	69_37n	silent	93	11.32	12	SNP	0.002	T
AC005013.5	0	genome.wustl.edu	37	7	28997765	28997765	+	lincRNA	SNP	C	C	G	rs740252	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr7:28997765C>G	ENST00000436594.1	+	0	192				TRIL_ENST00000322982.3_RNA																							TAAATGGCCTCTTTCGGACTT	0.701													C|||	1760	0.351438	0.1732	0.4366	5008	,	,		12656	0.2589		0.5547	False		,,,				2504	0.4182					dbGAP											0																																										-	-	-			0																															7.37:g.28997765C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000436594.1	37	NULL		7																																																																																			TRIL	-	-	ENSG00000176734		0.701	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	TRIL	HGNC	lincRNA	OTTHUMT00000327953.3	33	0.00	0	C			28997765	28997765	-1	no_errors	ENST00000322982	ensembl	human	known	69_37n	rna	58	12.12	8	SNP	0.986	G
TRIM34	53840	genome.wustl.edu	37	11	5655085	5655085	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:5655085G>A	ENST00000514226.1	+	3	812	c.475G>A	c.(475-477)Gag>Aag	p.E159K	TRIM6-TRIM34_ENST00000457787.2_Missense_Mutation_p.E159K|TRIM34_ENST00000429814.2_Missense_Mutation_p.E159K|TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.E513K|HBG2_ENST00000380259.2_Intron	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34	159	Poly-Glu.				positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGAAGCTGAGAAGCTGGA	0.453																																						dbGAP											0													76.0	78.0	78.0					11																	5655085		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.475G>A	11.37:g.5655085G>A	ENSP00000422947:p.Glu159Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.E513K	ENST00000514226.1	37	c.1537	CCDS31391.1	11	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176946	0.57692	.	.	ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258659;ENSG00000258588	ENST00000337072;ENST00000514226;ENST00000429814;ENST00000457787;ENST00000354852	T;T;T;T	0.68025	-0.3;-0.3;-0.3;1.66	4.44	1.17	0.20885	.	0.742205	0.11050	N	0.605191	T	0.65565	0.2703	M	0.86502	2.82	0.19575	N	0.999963	B;B;B	0.21381	0.035;0.011;0.055	B;B;B	0.25759	0.05;0.063;0.039	T	0.59643	-0.7416	10	0.42905	T	0.14	.	2.5797	0.04815	0.1053:0.1868:0.5158:0.1922	.	159;159;513	Q9BYJ4-2;Q9BYJ4;B2RNG4	.;TRI34_HUMAN;.	K	513;159;159;159;513	ENSP00000422947:E159K;ENSP00000402595:E159K;ENSP00000395982:E159K;ENSP00000346916:E513K	ENSP00000402595:E159K	E	+	1	0	TRIM34;TRIM6-TRIM34	5611661	0.001000	0.12720	0.960000	0.40013	0.952000	0.60782	0.737000	0.26144	0.548000	0.28955	0.655000	0.94253	GAG	TRIM34	-	NULL	ENSG00000258659		0.453	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM34	HGNC	protein_coding	OTTHUMT00000143357.2	27	0.00	0	G	NM_001003827		5655085	5655085	+1	no_errors	ENST00000337072	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.987	A
AC002472.1	0	genome.wustl.edu	37	22	21363306	21363306	+	5'Flank	SNP	G	G	A	rs2075274	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr22:21363306G>A	ENST00000547793.2	-	0	0				THAP7-AS1_ENST00000452284.1_RNA|TUBA3FP_ENST00000422086.1_RNA|THAP7-AS1_ENST00000436079.1_RNA																							GATGACCAGGGCGTAGGTGGC	0.582													G|||	939	0.1875	0.0968	0.3746	5008	,	,		20123	0.0536		0.3648	False		,,,				2504	0.1329					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0																															22.37:g.21363306G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000547793.2	37	NULL		22																																																																																			TUBA3FP	-	-	ENSG00000161149		0.582	AC002472.1-201	NOVEL	basic|appris_principal	protein_coding	TUBA3FP	HGNC	protein_coding		52	0.00	0	G			21363306	21363306	-1	no_errors	ENST00000292748	ensembl	human	known	69_37n	rna	60	10.45	7	SNP	1.000	A
UBE2Q2P1	388165	genome.wustl.edu	37	15	85113662	85113662	+	RNA	SNP	C	C	T	rs62021164	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr15:85113662C>T	ENST00000339094.1	-	0	364				LINC00933_ENST00000557887.1_RNA	NR_003661.2				ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 1																		ACCCAAGCCTCCCGCAGTCCC	0.746													.|||	203	0.0405351	0.0182	0.0648	5008	,	,		12067	0.001		0.1173	False		,,,				2504	0.0153					dbGAP											0																																										-	-	-			0					15q25.2	2013-11-05	2009-12-17	2009-12-17	ENSG00000189136	ENSG00000189136			37439	pseudogene	pseudogene			"""ubiquitin-conjugating enzyme E2Q family pseudogene 1"""	UBE2QP1			Standard	NR_003661		Approved	FLJ43276	uc002bkn.1		OTTHUMG00000148662		15.37:g.85113662C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000339094.1	37	NULL		15																																																																																			UBE2Q2P1	-	-	ENSG00000189136		0.746	UBE2Q2P1-002	KNOWN	basic	processed_transcript	UBE2Q2P1	HGNC	pseudogene	OTTHUMT00000308970.2	8	0.00	0	C	NR_003661		85113662	85113662	-1	no_errors	ENST00000339094	ensembl	human	known	69_37n	rna	9	57.14	12	SNP	0.002	T
UGP2	7360	genome.wustl.edu	37	2	64084005	64084005	+	Intron	SNP	G	G	A	rs35253921	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr2:64084005G>A	ENST00000337130.5	+	2	623				UGP2_ENST00000487469.1_Intron|UGP2_ENST00000445915.2_Intron|UGP2_ENST00000467648.2_Intron|UGP2_ENST00000394417.2_Intron	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2						carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						TTTTTTACTTGTAAATCAATA	0.303													A|||	559	0.111621	0.0151	0.2147	5008	,	,		16883	0.0744		0.2326	False		,,,				2504	0.0828					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.147+438G>A	2.37:g.64084005G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q07131|Q0P6K2|Q86Y81|Q9BU15	RNA	SNP	-	NULL	ENST00000337130.5	37	NULL	CCDS1875.1	2																																																																																			UGP2	-	-	ENSG00000169764		0.303	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGP2	HGNC	protein_coding	OTTHUMT00000251688.1	38	0.00	0	G	NM_006759		64084005	64084005	+1	no_errors	ENST00000495020	ensembl	human	known	69_37n	rna	66	14.29	11	SNP	0.000	A
VNN3	55350	genome.wustl.edu	37	6	133052666	133052666	+	Splice_Site	SNP	C	C	T			TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:133052666C>T	ENST00000392393.3	-	3	417	c.345G>A	c.(343-345)agG>agA	p.R115R	VNN3_ENST00000425515.2_Intron|VNN3_ENST00000427187.2_Intron|VNN3_ENST00000417437.2_Intron|VNN3_ENST00000414302.2_Intron|VNN3_ENST00000519686.2_Intron|VNN3_ENST00000392394.2_Splice_Site_p.R115R|VNN3_ENST00000450865.2_Intron|VNN3_ENST00000580813.1_5'Flank|VNN3_ENST00000275223.3_Intron|VNN3_ENST00000367927.5_Intron|VNN3_ENST00000509351.1_Intron|VNN3_ENST00000207771.3_Intron|VNN3_ENST00000423615.2_Intron			Q9NY84	VNN3_HUMAN	vanin 3	115	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		TTTTACTCTTCCTGTGAAGGA	0.383																																						dbGAP											0													115.0	103.0	107.0					6																	133052666		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000392393.3:c.345-1G>A	6.37:g.133052666C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	Missense_Mutation	SNP	NULL	p.E28K	ENST00000392393.3	37	c.82		6	.	.	.	.	.	.	.	.	.	.	C	4.073	0.011379	0.07912	.	.	ENSG00000093134	ENST00000544102	.	.	.	4.17	0.249	0.15531	.	.	.	.	.	T	0.07413	0.0187	.	.	.	0.19300	N	0.999973	.	.	.	.	.	.	T	0.34950	-0.9808	4	.	.	.	.	1.0226	0.01521	0.1867:0.4252:0.1813:0.2067	.	.	.	.	K	28	.	.	E	-	1	0	VNN3	133094359	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.059000	0.14322	0.027000	0.15297	0.655000	0.94253	GAA	VNN3	-	NULL	ENSG00000093134		0.383	VNN3-002	KNOWN	NAGNAG_splice_site|NMD_exception|basic	protein_coding	VNN3	HGNC	protein_coding	OTTHUMT00000042266.4	33	0.00	0	C	NR_028290	Silent	133052666	133052666	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000544102	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.000	T
SPCS2	9789	genome.wustl.edu	37	11	74660143	74660143	+	5'Flank	SNP	G	G	C	rs2165163	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr11:74660143G>C	ENST00000263672.6	+	0	0				SPCS2_ENST00000530257.1_5'Flank|XRRA1_ENST00000321448.8_5'UTR|XRRA1_ENST00000527087.1_5'UTR|XRRA1_ENST00000533598.1_5'Flank|SPCS2_ENST00000526361.1_5'Flank|XRRA1_ENST00000340360.6_5'UTR	NM_014752.2	NP_055567.2	Q15005	SPCS2_HUMAN	signal peptidase complex subunit 2 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			breast(1)	1						CAGTGTAGGCGGCAACCGACG	0.667													G|||	1346	0.26877	0.0915	0.4827	5008	,	,		15334	0.5069		0.2853	False		,,,				2504	0.0941					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			D14658	CCDS44681.1	11q13.4	2008-02-05			ENSG00000118363	ENSG00000118363			28962	protein-coding gene	gene with protein product						7788527	Standard	NM_014752		Approved	KIAA0102	uc001ovu.2	Q15005	OTTHUMG00000165517		11.37:g.74660143G>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15507|Q3KQT0|Q641R4|Q6FG65|Q6IRX0|Q6P1P4|Q96HU9	RNA	SNP	-	NULL	ENST00000263672.6	37	NULL	CCDS44681.1	11																																																																																			XRRA1	-	-	ENSG00000166435		0.667	SPCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384587.1	14	0.00	0	G	NM_014752		74660143	74660143	-1	no_errors	ENST00000524430	ensembl	human	known	69_37n	rna	25	16.67	5	SNP	0.794	C
ZNF440	126070	genome.wustl.edu	37	19	11941221	11941221	+	Missense_Mutation	SNP	T	T	A	rs424132	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr19:11941221T>A	ENST00000304060.5	+	2	291	c.127T>A	c.(127-129)Tta>Ata	p.L43I		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	43	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.		L -> I (in dbSNP:rs424132).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CCTGACCTCTTTAGGTAAGGA	0.443													g|||	1609	0.321286	0.4758	0.3271	5008	,	,		19585	0.1597		0.3628	False		,,,				2504	0.2321					dbGAP											0													103.0	112.0	109.0					19																	11941221		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.127T>A	19.37:g.11941221T>A	ENSP00000305373:p.Leu43Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1R9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L43I	ENST00000304060.5	37	c.127	CCDS42503.1	19	589	0.2696886446886447	168	0.34146341463414637	102	0.281767955801105	79	0.1381118881118881	240	0.316622691292876	a	0.001	-4.623390	0.00000	.	.	ENSG00000171295	ENST00000304060;ENST00000427505;ENST00000414255	T;T;T	0.02446	4.29;4.29;4.29	1.74	-3.49	0.04724	Krueppel-associated box (4);	.	.	.	.	T	0.00012	0.0000	N	0.16166	0.38	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.45804	-0.9236	8	0.02654	T	1	.	1.758	0.02986	0.3493:0.1726:0.3585:0.1196	rs424132	43	Q8IYI8	ZN440_HUMAN	I	43;46;45	ENSP00000305373:L43I;ENSP00000393489:L46I;ENSP00000411974:L45I	ENSP00000305373:L43I	L	+	1	2	ZNF440	11802221	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.264000	0.01173	-4.525000	0.00044	-5.145000	0.00001	TTA	ZNF440	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171295		0.443	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF440	HGNC	protein_coding	OTTHUMT00000344508.1	70	0.00	0	T	NM_152357		11941221	11941221	+1	no_errors	ENST00000304060	ensembl	human	known	69_37n	missense	79	13.04	12	SNP	0.116	A
ZNF518A	9849	genome.wustl.edu	37	10	97922576	97922576	+	RNA	SNP	A	A	G	rs11591374	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr10:97922576A>G	ENST00000534948.1	+	0	7352							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TGTTTTTTCAATGCTAGTTAA	0.264													A|||	469	0.0936502	0.1513	0.0793	5008	,	,		17453	0.005		0.162	False		,,,				2504	0.047					dbGAP											0																																										-	-	-			0			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97922576A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJI5|O15044|Q32MP4	RNA	SNP	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			ZNF518A	-	-	ENSG00000177853		0.264	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		26	0.00	0	A	NM_014803		97922576	97922576	+1	no_errors	ENST00000534948	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	0.009	G
ZNRD1-AS1	80862	genome.wustl.edu	37	6	30025285	30025285	+	RNA	SNP	C	C	T	rs6911634	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr6:30025285C>T	ENST00000431012.1	-	0	386				ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000376797.3_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA|ZNRD1-AS1_ENST00000452229.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CTTCTACGCTCTGGGTTGTTT	0.363													T|||	837	0.167133	0.2943	0.1081	5008	,	,		20099	0.1548		0.0805	False		,,,				2504	0.1391					dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30025285C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000431012.1	37	NULL		6																																																																																			ZNRD1-AS1	-	-	ENSG00000204623		0.363	ZNRD1-AS1-005	KNOWN	basic|exp_conf	antisense	ZNRD1-AS1	HGNC	antisense	OTTHUMT00000253082.1	42	0.00	0	C	NR_026751		30025285	30025285	-1	no_errors	ENST00000421692	ensembl	human	known	69_37n	rna	51	10.53	6	SNP	0.009	T
ZRSR1	7310	genome.wustl.edu	37	5	112228765	112228765	+	Missense_Mutation	SNP	C	C	A	rs459102	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr5:112228765C>A	ENST00000391338.1	+	1	1453	c.1429C>A	c.(1429-1431)Caa>Aaa	p.Q477K	REEP5_ENST00000504247.1_Intron|REEP5_ENST00000513339.1_Intron|CTC-487M23.8_ENST00000512790.1_3'UTR|REEP5_ENST00000379638.4_Intron|REEP5_ENST00000545426.1_Intron|REEP5_ENST00000474542.2_Intron|CTC-487M23.5_ENST00000602872.1_RNA	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	477						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						TCAGAGTCCCCAATCCAAATA	0.463													A|||	2349	0.46905	0.8533	0.3415	5008	,	,		13121	0.3482		0.3678	False		,,,				2504	0.2689					dbGAP											0																																										-	-	-	SO:0001583	missense	0			D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.1429C>A	5.37:g.112228765C>A	ENSP00000375133:p.Gln477Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R901|Q13570|Q2M3R8	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.Q477K	ENST00000391338.1	37	c.1429		5	983	0.4500915750915751	404	0.8211382113821138	131	0.36187845303867405	183	0.31993006993006995	265	0.3496042216358839	A	3.274	-0.148580	0.06627	.	.	ENSG00000212643	ENST00000391338	.	.	.	1.48	1.48	0.22813	.	0.380640	0.28803	N	0.014099	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41610	-0.9499	7	0.02654	T	1	.	5.7537	0.18160	0.7244:0.2756:0.0:0.0	rs459102;rs712667;rs818788;rs3193242;rs61177009	477	Q15695	U2AFL_HUMAN	K	477	.	ENSP00000375133:Q477K	Q	+	1	0	ZRSR1	112256664	0.981000	0.34729	0.037000	0.18230	0.060000	0.15804	0.237000	0.17985	0.051000	0.15978	-0.520000	0.04383	CAA	ZRSR1	-	NULL	ENSG00000212643		0.463	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	ZRSR1	HGNC	protein_coding	OTTHUMT00000371801.1	25	0.00	0	C	NM_005083		112228765	112228765	+1	no_errors	ENST00000391338	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.280	A
ZSCAN5C	649137	genome.wustl.edu	37	19	56719405	56719405	+	Missense_Mutation	SNP	A	A	C	rs12979551	byFrequency	TCGA-AC-A3TM-01A-11D-A228-09	TCGA-AC-A3TM-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e0b7762d-2e9b-4101-b3b8-475d663ebde0	31bb4a32-703d-4924-aa46-216902820061	g.chr19:56719405A>C	ENST00000534327.1	+	4	740	c.591A>C	c.(589-591)gaA>gaC	p.E197D	ZSCAN5C_ENST00000376267.1_Missense_Mutation_p.E197D			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	197			E -> D (in dbSNP:rs12979551).		regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						ATTCTCAGGAAGAGGACTTCC	0.517													A|||	2826	0.564297	0.7322	0.6441	5008	,	,		20026	0.5248		0.5746	False		,,,				2504	0.3108					dbGAP											0																																										-	-	-	SO:0001583	missense	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.591A>C	19.37:g.56719405A>C	ENSP00000435234:p.Glu197Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E197D	ENST00000534327.1	37	c.591		19	1318	0.6034798534798534	357	0.725609756097561	223	0.6160220994475138	301	0.5262237762237763	437	0.5765171503957783	a	0.009	-1.851954	0.00563	.	.	ENSG00000204532	ENST00000534327;ENST00000376267	T;T	0.06608	3.28;3.28	1.03	-2.06	0.07298	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.35574	-0.9783	5	0.14252	T	0.57	.	2.1059	0.03691	0.3232:0.0:0.1942:0.4825	rs12979551;rs12979551	.	.	.	D	197	ENSP00000435234:E197D;ENSP00000365443:E197D	ENSP00000365443:E197D	E	+	3	2	ZSCAN5C	61411217	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.729000	0.00381	-3.054000	0.00259	-3.473000	0.00035	GAA	ZSCAN5C	-	NULL	ENSG00000204532		0.517	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	46	0.00	0	A	XM_001131980		56719405	56719405	+1	no_errors	ENST00000376267	ensembl	human	known	69_37n	missense	72	16.28	14	SNP	0.000	C
