#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC4	10257	genome.wustl.edu	37	13	95727760	95727760	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:95727760A>G	ENST00000376887.4	-	22	2846	c.2732T>C	c.(2731-2733)cTc>cCc	p.L911P	ABCC4_ENST00000474158.1_5'Flank|ABCC4_ENST00000412704.1_Missense_Mutation_p.L864P	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	911	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	GATGGTCCAGAGCCCCTGGAG	0.493																																						dbGAP											0													122.0	117.0	119.0					13																	95727760		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.2732T>C	13.37:g.95727760A>G	ENSP00000366084:p.Leu911Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM	p.L911P	ENST00000376887.4	37	c.2732	CCDS9474.1	13	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487781	0.84854	.	.	ENSG00000125257	ENST00000412704;ENST00000376887	D;D	0.90444	-2.67;-2.67	5.39	5.39	0.77823	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97523	0.9189	H	0.99249	4.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.99293	1.0899	10	0.87932	D	0	.	15.4116	0.74929	1.0:0.0:0.0:0.0	.	864;911	O15439-2;O15439	.;MRP4_HUMAN	P	864;911	ENSP00000388657:L864P;ENSP00000366084:L911P	ENSP00000366084:L911P	L	-	2	0	ABCC4	94525761	1.000000	0.71417	0.989000	0.46669	0.987000	0.75469	7.106000	0.77039	2.029000	0.59856	0.460000	0.39030	CTC	ABCC4	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000125257		0.493	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2	67	0.00	0	A	NM_005845		95727760	95727760	-1	no_errors	ENST00000376887	ensembl	human	known	69_37n	missense	51	23.88	16	SNP	1.000	G
ADAM10	102	genome.wustl.edu	37	15	58903290	58903290	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr15:58903290A>C	ENST00000260408.3	-	13	2155	c.1712T>G	c.(1711-1713)aTc>aGc	p.I571S	ADAM10_ENST00000396140.2_Missense_Mutation_p.I270S|ADAM10_ENST00000561288.1_Intron|ADAM10_ENST00000402627.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	571	Cys-rich.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		TTTCTCACAGATAGAACCTGC	0.358																																						dbGAP											0													106.0	105.0	106.0					15																	58903290		2192	4291	6483	-	-	-	SO:0001583	missense	0			AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.1712T>G	15.37:g.58903290A>C	ENSP00000260408:p.Ile571Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU28|Q10742|Q92650	Missense_Mutation	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.I571S	ENST00000260408.3	37	c.1712	CCDS10167.1	15	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414032	0.83449	.	.	ENSG00000137845	ENST00000260408;ENST00000396136;ENST00000396140	T;T	0.27402	1.67;2.99	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.60038	0.2238	M	0.86953	2.85	0.80722	D	1	D;P;P	0.57257	0.979;0.54;0.93	D;P;P	0.70487	0.969;0.856;0.892	T	0.64976	-0.6280	10	0.44086	T	0.13	-3.7222	15.3484	0.74363	1.0:0.0:0.0:0.0	.	270;390;571	B4DU28;A8MY20;O14672	.;.;ADA10_HUMAN	S	571;390;270	ENSP00000260408:I571S;ENSP00000379444:I270S	ENSP00000260408:I571S	I	-	2	0	ADAM10	56690582	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.862000	0.92283	2.073000	0.62155	0.533000	0.62120	ATC	ADAM10	-	NULL	ENSG00000137845		0.358	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM10	HGNC	protein_coding	OTTHUMT00000255880.2	35	0.00	0	A	NM_001110		58903290	58903290	-1	no_errors	ENST00000260408	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	C
ADAMTS7	11173	genome.wustl.edu	37	15	79058017	79058017	+	Missense_Mutation	SNP	G	G	T	rs111789308	byFrequency	TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr15:79058017G>T	ENST00000388820.4	-	19	4446	c.4236C>A	c.(4234-4236)aaC>aaA	p.N1412K	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1412	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GCCAGCCGGCGTTCCTGACAA	0.657																																						dbGAP											0													31.0	37.0	35.0					15																	79058017		2187	4278	6465	-	-	-	SO:0001583	missense	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4236C>A	15.37:g.79058017G>T	ENSP00000373472:p.Asn1412Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14F51|Q6P7J9	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.N1412K	ENST00000388820.4	37	c.4236	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	g	8.534	0.871646	0.17322	.	.	ENSG00000136378	ENST00000388820	T	0.60548	0.18	3.85	-0.412	0.12367	.	0.644288	0.15754	N	0.246281	T	0.53786	0.1818	L	0.38175	1.15	0.30351	N	0.784789	D	0.89917	1.0	D	0.85130	0.997	T	0.54193	-0.8330	10	0.06236	T	0.91	.	4.3054	0.10944	0.5255:0.0:0.3156:0.1589	.	1412	Q9UKP4	ATS7_HUMAN	K	1412	ENSP00000373472:N1412K	ENSP00000373472:N1412K	N	-	3	2	ADAMTS7	76845072	0.026000	0.19158	0.979000	0.43373	0.024000	0.10985	-0.236000	0.09003	-0.197000	0.10350	-1.940000	0.00497	AAC	ADAMTS7	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000136378		0.657	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	231	0.00	0	G	NM_014272		79058017	79058017	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	missense	245	13.64	39	SNP	0.879	T
ALX1	8092	genome.wustl.edu	37	12	85674145	85674145	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr12:85674145G>C	ENST00000316824.3	+	1	261	c.106G>C	c.(106-108)Gac>Cac	p.D36H		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	36					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		GGAGACGCTGGACAATGAGTC	0.572																																						dbGAP											0													67.0	66.0	66.0					12																	85674145		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.106G>C	12.37:g.85674145G>C	ENSP00000315417:p.Asp36His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q546C8|Q96FH4	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.D36H	ENST00000316824.3	37	c.106	CCDS9028.1	12	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603071	0.87157	.	.	ENSG00000180318	ENST00000316824	D	0.94457	-3.43	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.93347	0.7879	N	0.24115	0.695	0.80722	D	1	D	0.58970	0.984	P	0.52066	0.689	D	0.94420	0.7640	10	0.87932	D	0	.	19.3578	0.94422	0.0:0.0:1.0:0.0	.	36	Q15699	ALX1_HUMAN	H	36	ENSP00000315417:D36H	ENSP00000315417:D36H	D	+	1	0	ALX1	84198276	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.946000	0.92992	2.562000	0.86427	0.650000	0.86243	GAC	ALX1	-	NULL	ENSG00000180318		0.572	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX1	HGNC	protein_coding	OTTHUMT00000406072.1	49	0.00	0	G	NM_006982		85674145	85674145	+1	no_errors	ENST00000316824	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	C
ANGPTL4	51129	genome.wustl.edu	37	19	8436129	8436129	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:8436129G>C	ENST00000301455.2	+	6	933	c.762G>C	c.(760-762)gaG>gaC	p.E254D	ANGPTL4_ENST00000541807.1_Missense_Mutation_p.E87D|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.E216D	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	254	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						CTCCAGGCGAGTTCTGGCTGG	0.652																																						dbGAP											0													37.0	39.0	39.0					19																	8436129		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.762G>C	19.37:g.8436129G>C	ENSP00000301455:p.Glu254Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E254D	ENST00000301455.2	37	c.762	CCDS12200.1	19	.	.	.	.	.	.	.	.	.	.	G	20.6	4.018142	0.75275	.	.	ENSG00000167772	ENST00000301455;ENST00000393962;ENST00000541807	T;T;T	0.28454	1.61;1.61;1.61	4.79	2.23	0.28157	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.054043	0.64402	D	0.000001	T	0.45094	0.1325	M	0.66506	2.035	0.45261	D	0.998261	D;D	0.69078	0.997;0.987	D;P	0.68192	0.956;0.889	T	0.39683	-0.9602	10	0.66056	D	0.02	.	5.3048	0.15797	0.2364:0.1681:0.5955:0.0	.	216;254	A8MY84;Q9BY76	.;ANGL4_HUMAN	D	254;216;87	ENSP00000301455:E254D;ENSP00000377534:E216D;ENSP00000439833:E87D	ENSP00000301455:E254D	E	+	3	2	ANGPTL4	8342129	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	0.717000	0.25851	1.131000	0.42111	0.555000	0.69702	GAG	ANGPTL4	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000167772		0.652	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL4	HGNC	protein_coding	OTTHUMT00000460322.1	31	0.00	0	G	NM_139314		8436129	8436129	+1	no_errors	ENST00000301455	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	C
ARID3C	138715	genome.wustl.edu	37	9	34625785	34625785	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr9:34625785C>G	ENST00000378909.2	-	2	437	c.345G>C	c.(343-345)aaG>aaC	p.K115N		NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	115	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		ATTCCTTCCTCTTGGGGTCTG	0.542																																						dbGAP											0													191.0	150.0	164.0					9																	34625785		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.345G>C	9.37:g.34625785C>G	ENSP00000368189:p.Lys115Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.K115N	ENST00000378909.2	37	c.345	CCDS35006.1	9	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225702	0.58668	.	.	ENSG00000205143	ENST00000378909	T	0.63580	-0.05	5.1	3.25	0.37280	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.47455	D	0.000226	T	0.69993	0.3173	L	0.59436	1.845	0.47905	D	0.99954	D	0.62365	0.991	D	0.64144	0.922	T	0.69691	-0.5077	10	0.72032	D	0.01	-25.8172	8.0292	0.30454	0.0:0.6768:0.0:0.3232	.	115	A6NKF2	ARI3C_HUMAN	N	115	ENSP00000368189:K115N	ENSP00000368189:K115N	K	-	3	2	ARID3C	34615785	0.988000	0.35896	1.000000	0.80357	0.998000	0.95712	0.285000	0.18883	0.720000	0.32209	0.551000	0.68910	AAG	ARID3C	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	ENSG00000205143		0.542	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3C	HGNC	protein_coding	OTTHUMT00000348265.1	44	0.00	0	C	XM_071061		34625785	34625785	-1	no_errors	ENST00000378909	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	1.000	G
ATP10A	57194	genome.wustl.edu	37	15	25959223	25959223	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr15:25959223C>T	ENST00000356865.6	-	10	2053	c.1942G>A	c.(1942-1944)Gac>Aac	p.D648N		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	648					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		AGCATGCCGTCGCTGGACGGG	0.677																																						dbGAP											0													41.0	44.0	43.0					15																	25959223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1942G>A	15.37:g.25959223C>T	ENSP00000349325:p.Asp648Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.D648N	ENST00000356865.6	37	c.1942	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	C	9.461	1.093123	0.20471	.	.	ENSG00000206190	ENST00000356865	T	0.10960	2.82	3.77	1.85	0.25348	HAD-like domain (1);	0.370467	0.30219	N	0.010129	T	0.08714	0.0216	L	0.40543	1.245	0.40415	D	0.979783	B	0.25351	0.124	B	0.21708	0.036	T	0.24012	-1.0172	10	0.27082	T	0.32	-24.5452	9.9997	0.41920	0.0:0.8315:0.0:0.1685	.	648	O60312	AT10A_HUMAN	N	648	ENSP00000349325:D648N	ENSP00000349325:D648N	D	-	1	0	ATP10A	23510316	0.999000	0.42202	0.003000	0.11579	0.122000	0.20287	4.440000	0.59975	0.392000	0.25172	0.561000	0.74099	GAC	ATP10A	-	superfamily_HAD-like_dom	ENSG00000206190		0.677	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	127	0.00	0	C	NM_024490		25959223	25959223	-1	no_errors	ENST00000356865	ensembl	human	known	69_37n	missense	127	30.22	55	SNP	0.839	T
B3GNT2	10678	genome.wustl.edu	37	2	62450520	62450520	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:62450520C>T	ENST00000301998.4	+	2	1417	c.1165C>T	c.(1165-1167)Cag>Tag	p.Q389*	B3GNT2_ENST00000405767.1_Nonsense_Mutation_p.Q389*	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	389					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			TATTTGGTCTCAGTTGCAGAG	0.323																																						dbGAP											0													43.0	46.0	45.0					2																	62450520		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.1165C>T	2.37:g.62450520C>T	ENSP00000305595:p.Gln389*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Nonsense_Mutation	SNP	pfam_Glyco_trans_31	p.Q389*	ENST00000301998.4	37	c.1165	CCDS1870.1	2	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787639	0.90367	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	.	.	.	5.54	4.64	0.57946	.	0.474372	0.25792	N	0.028264	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	14.0048	0.64456	0.4335:0.5665:0.0:0.0	.	.	.	.	X	389	.	ENSP00000305595:Q389X	Q	+	1	0	B3GNT2	62304024	0.997000	0.39634	0.998000	0.56505	0.995000	0.86356	1.600000	0.36762	1.288000	0.44600	0.650000	0.86243	CAG	B3GNT2	-	NULL	ENSG00000170340		0.323	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT2	HGNC	protein_coding	OTTHUMT00000251606.2	39	0.00	0	C	NM_006577		62450520	62450520	+1	no_errors	ENST00000301998	ensembl	human	known	69_37n	nonsense	30	18.92	7	SNP	0.919	T
C10orf95	79946	genome.wustl.edu	37	10	104211144	104211145	+	Splice_Site	DEL	TG	TG	-			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr10:104211144_104211145delTG	ENST00000239125.1	-	1	155_156	c.81_82delCA	c.(79-84)gacaag>gaag	p.DK27fs	RP11-18I14.10_ENST00000594818.1_RNA|RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000596366.1_RNA|RP11-18I14.10_ENST00000492465.2_RNA|RP11-18I14.10_ENST00000596045.1_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95	27										liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		CCCACTCACTTGTCTCCTTCAG	0.629																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.83+1CA>-	10.37:g.104211144_104211145delTG		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ7	Frame_Shift_Del	DEL	NULL	p.D27fs	ENST00000239125.1	37	c.82_81	CCDS7534.1	10																																																																																			C10orf95	-	NULL	ENSG00000120055		0.629	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf95	HGNC	protein_coding	OTTHUMT00000050065.1	35	0.00	0	TG	NM_024886	Frame_Shift_Del	104211144	104211145	-1	no_errors	ENST00000239125	ensembl	human	known	69_37n	frame_shift_del	55	15.38	10	DEL	0.978:0.961	-
ERICH3	127254	genome.wustl.edu	37	1	75100419	75100419	+	Intron	SNP	A	A	C	rs75609067	byFrequency	TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:75100419A>C	ENST00000326665.5	-	6	822				C1orf173_ENST00000420661.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN												NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						ttggactttgagtatttctag	0.403													A|||	163	0.0325479	0.1195	0.0072	5008	,	,		19280	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0																														ENST00000326665.5:c.603+1544T>G	1.37:g.75100419A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	RNA	SNP	-	NULL	ENST00000326665.5	37	NULL	CCDS30755.1	1																																																																																			C1orf173	-	-	ENSG00000178965		0.403	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	14	0.00	0	A			75100419	75100419	-1	no_errors	ENST00000479666	ensembl	human	known	69_37n	rna	9	35.71	5	SNP	0.992	C
C5orf38	153571	genome.wustl.edu	37	5	2755228	2755228	+	3'UTR	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr5:2755228G>A	ENST00000334000.3	+	0	607				C5orf38_ENST00000397835.4_Missense_Mutation_p.G140D|IRX2_ENST00000502957.1_5'Flank	NM_178569.2	NP_848664.1	Q86SI9	CEI_HUMAN	chromosome 5 open reading frame 38							extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(1)	4				GBM - Glioblastoma multiforme(108;0.205)		GGAACAGCCGGCCCCGGAGGC	0.701																																						dbGAP											0													17.0	19.0	19.0					5																	2755228		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AY249324	CCDS34131.1	5p15.33	2014-06-02			ENSG00000186493	ENSG00000186493			24226	protein-coding gene	gene with protein product	"""coordinated expression to IRX2"", ""IRX2 neighbor"""	610522				16515847, 16750006	Standard	XM_005248256		Approved	CEI, IRX2NB	uc003jdc.3	Q86SI9	OTTHUMG00000161741	ENST00000334000.3:c.*73G>A	5.37:g.2755228G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G140D	ENST00000334000.3	37	c.419	CCDS34131.1	5	.	.	.	.	.	.	.	.	.	.	G	11.78	1.741930	0.30865	.	.	ENSG00000186493	ENST00000397835	.	.	.	2.83	-4.6	0.03390	.	.	.	.	.	T	0.17152	0.0412	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23261	-1.0193	4	.	.	.	.	1.2194	0.01921	0.3511:0.327:0.1817:0.1402	.	.	.	.	D	140	.	.	G	+	2	0	C5orf38	2808228	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.450000	0.06803	-1.282000	0.02396	-0.671000	0.03813	GGC	C5orf38	-	NULL	ENSG00000186493		0.701	C5orf38-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C5orf38	HGNC	protein_coding	OTTHUMT00000365956.2	28	0.00	0	G	NM_178569		2755228	2755228	+1	no_errors	ENST00000397835	ensembl	human	putative	69_37n	missense	18	21.74	5	SNP	0.000	A
C6orf163	206412	genome.wustl.edu	37	6	88074687	88074687	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:88074687T>A	ENST00000388923.4	+	5	814	c.563T>A	c.(562-564)gTg>gAg	p.V188E	RP1-102H19.8_ENST00000448282.2_Intron|C6orf163_ENST00000608326.1_Missense_Mutation_p.V58E|C6orf163_ENST00000608891.1_3'UTR	NM_001010868.2	NP_001010868.2	Q5TEZ5	CF163_HUMAN	chromosome 6 open reading frame 163	188										central_nervous_system(1)|kidney(1)	2						AGCAAAGCCGTGGAGGAAATT	0.363																																						dbGAP											0													62.0	57.0	58.0					6																	88074687		692	1591	2283	-	-	-	SO:0001583	missense	0			AK092941	CCDS55042.1	6q15	2012-02-07			ENSG00000203872	ENSG00000203872			21403	protein-coding gene	gene with protein product							Standard	NM_001010868		Approved		uc021zcl.1	Q5TEZ5	OTTHUMG00000015169	ENST00000388923.4:c.563T>A	6.37:g.88074687T>A	ENSP00000373575:p.Val188Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V188E	ENST00000388923.4	37	c.563	CCDS55042.1	6	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.288419	0.00248	.	.	ENSG00000203872	ENST00000388923;ENST00000369574	T	0.75050	-0.9	6.17	2.28	0.28536	.	0.918761	0.09523	N	0.790676	T	0.23846	0.0577	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.31833	-0.9929	8	0.02654	T	1	-0.2385	5.3026	0.15785	0.1739:0.1593:0.0:0.6668	.	.	.	.	E	188;62	ENSP00000373575:V188E	ENSP00000358587:V62E	V	+	2	0	C6orf163	88131406	0.012000	0.17670	0.134000	0.22075	0.002000	0.02628	-0.223000	0.09177	0.193000	0.20303	-1.139000	0.01908	GTG	C6orf163	-	NULL	ENSG00000203872		0.363	C6orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf163	HGNC	protein_coding	OTTHUMT00000041436.2	39	0.00	0	T	NM_001010868		88074687	88074687	+1	no_errors	ENST00000388923	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.135	A
C7orf62	219557	genome.wustl.edu	37	7	88423598	88423598	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:88423598G>C	ENST00000297203.2	-	2	844	c.659C>G	c.(658-660)tCc>tGc	p.S220C	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	220										NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						GAATTCTTCGGATTTGCACAA	0.438																																						dbGAP											0													136.0	123.0	127.0					7																	88423598		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.659C>G	7.37:g.88423598G>C	ENSP00000297203:p.Ser220Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S220C	ENST00000297203.2	37	c.659	CCDS34678.1	7	.	.	.	.	.	.	.	.	.	.	G	1.650	-0.514180	0.04200	.	.	ENSG00000164645	ENST00000297203	T	0.14516	2.5	6.17	3.22	0.36961	.	1.042720	0.07435	N	0.896301	T	0.14917	0.0360	L	0.39633	1.23	0.09310	N	1	B	0.20671	0.047	B	0.18263	0.021	T	0.32745	-0.9895	10	0.33141	T	0.24	-4.4536	13.849	0.63485	0.0:0.4491:0.5509:0.0	.	220	Q8TBZ9	CG062_HUMAN	C	220	ENSP00000297203:S220C	ENSP00000297203:S220C	S	-	2	0	C7orf62	88261534	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	0.591000	0.23969	0.908000	0.36671	-0.176000	0.13171	TCC	C7orf62	-	NULL	ENSG00000164645		0.438	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf62	HGNC	protein_coding	OTTHUMT00000332714.1	48	0.00	0	G	NM_152706		88423598	88423598	-1	no_errors	ENST00000297203	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	0.001	C
CADPS2	93664	genome.wustl.edu	37	7	122078500	122078500	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:122078500C>A	ENST00000449022.2	-	17	2390	c.2371G>T	c.(2371-2373)Gcc>Tcc	p.A791S	CADPS2_ENST00000412584.2_Missense_Mutation_p.A788S|CADPS2_ENST00000334010.7_Missense_Mutation_p.A792S|CADPS2_ENST00000313070.7_Missense_Mutation_p.A788S|RP5-1101C3.1_ENST00000592542.1_RNA	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	791	Interaction with DRD2.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ATGGGAGTGGCAATATCTTTC	0.423																																						dbGAP											0													74.0	67.0	70.0					7																	122078500		1890	4118	6008	-	-	-	SO:0001583	missense	0				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.2371G>T	7.37:g.122078500C>A	ENSP00000398481:p.Ala791Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,pfam_Pleckstrin_homology,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A791S	ENST00000449022.2	37	c.2371	CCDS55158.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.594|8.594	0.885299|0.885299	0.17540|0.17540	.|.	.|.	ENSG00000081803|ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022|ENST00000397721	T;T;T;T|.	0.32988|.	1.43;1.43;1.43;1.43|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.058110|.	0.64402|.	D|.	0.000001|.	T|T	0.50956|0.50956	0.1646|0.1646	N|N	0.12182|0.12182	0.205|0.205	0.42839|0.42839	D|D	0.994042|0.994042	P;B;P;B|.	0.35612|.	0.512;0.321;0.512;0.122|.	B;B;B;B|.	0.38755|.	0.15;0.281;0.15;0.088|.	T|T	0.45175|0.45175	-0.9279|-0.9279	9|5	.|.	.|.	.|.	-12.8549|-12.8549	20.0826|20.0826	0.97783|0.97783	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	791;788;791;788|.	B7ZM57;Q86UW7-2;Q86UW7;Q86UW7-3|.	.;.;CAPS2_HUMAN;.|.	S|F	788;792;792;755;788;791|436	ENSP00000325581:A788S;ENSP00000333940:A792S;ENSP00000400401:A788S;ENSP00000398481:A791S|.	.|.	A|C	-|-	1|2	0|0	CADPS2|CADPS2	121865736|121865736	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.143000|2.143000	0.42187|0.42187	2.746000|2.746000	0.94184|0.94184	0.655000|0.655000	0.94253|0.94253	GCC|TGC	CADPS2	-	NULL	ENSG00000081803		0.423	CADPS2-001	KNOWN	basic|CCDS	protein_coding	CADPS2	HGNC	protein_coding	OTTHUMT00000347414.2	43	0.00	0	C	NM_017954		122078500	122078500	-1	no_errors	ENST00000449022	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	1.000	A
DRC7	84229	genome.wustl.edu	37	16	57755632	57755632	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr16:57755632G>C	ENST00000360716.3	+	10	1481	c.1260G>C	c.(1258-1260)caG>caC	p.Q420H	CCDC135_ENST00000394337.4_Missense_Mutation_p.Q420H|CCDC135_ENST00000336825.8_Missense_Mutation_p.Q355H			Q8IY82	CC135_HUMAN		420					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GGGTGGAGCAGATTGAGATCT	0.557																																						dbGAP											0													125.0	110.0	115.0					16																	57755632		2197	4300	6497	-	-	-	SO:0001583	missense	0																														ENST00000360716.3:c.1260G>C	16.37:g.57755632G>C	ENSP00000353942:p.Gln420His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	NULL	p.Q420H	ENST00000360716.3	37	c.1260	CCDS10787.1	16	.	.	.	.	.	.	.	.	.	.	.	3.852	-0.031641	0.07543	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.11930	2.73;2.73;2.73	4.96	2.96	0.34315	.	0.439500	0.24681	N	0.036464	T	0.21145	0.0509	L	0.53249	1.67	0.28607	N	0.908865	D;D	0.61080	0.975;0.989	P;P	0.56700	0.725;0.804	T	0.04386	-1.0955	10	0.37606	T	0.19	-31.1066	6.7526	0.23495	0.0972:0.1791:0.7237:0.0	.	355;420	Q8IY82-2;Q8IY82	.;CC135_HUMAN	H	420;355;420	ENSP00000377869:Q420H;ENSP00000338938:Q355H;ENSP00000353942:Q420H	ENSP00000338938:Q355H	Q	+	3	2	CCDC135	56313133	0.948000	0.32251	0.993000	0.49108	0.683000	0.39861	1.144000	0.31565	0.483000	0.27608	0.651000	0.88453	CAG	CCDC135	-	NULL	ENSG00000159625		0.557	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC135	HGNC	protein_coding	OTTHUMT00000433323.2	76	0.00	0	G			57755632	57755632	+1	no_errors	ENST00000360716	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	0.988	C
CCDC69	26112	genome.wustl.edu	37	5	150564003	150564003	+	Splice_Site	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr5:150564003C>G	ENST00000355417.2	-	8	790		c.e8-1		CCDC69_ENST00000521308.1_Splice_Site	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69											haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTTCTCTTTCTATAACAATG	0.463																																						dbGAP											0													82.0	78.0	79.0					5																	150564003		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.616-1G>C	5.37:g.150564003C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9X6	Splice_Site	SNP	-	e8-1	ENST00000355417.2	37	c.616-1	CCDS4312.1	5	.	.	.	.	.	.	.	.	.	.	C	14.75	2.629545	0.46944	.	.	ENSG00000198624	ENST00000355417	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8378	0.78811	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC69	150544196	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	4.954000	0.63631	2.584000	0.87258	0.561000	0.74099	.	CCDC69	-	-	ENSG00000198624		0.463	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC69	HGNC	protein_coding	OTTHUMT00000252435.1	33	0.00	0	C	NM_015621	Intron	150564003	150564003	-1	no_errors	ENST00000355417	ensembl	human	known	69_37n	splice_site	18	25.00	6	SNP	1.000	G
CCL20	6364	genome.wustl.edu	37	2	228680153	228680154	+	Intron	INS	-	-	T	rs34834265|rs397976487		TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:228680153_228680154insT	ENST00000358813.4	+	2	134				CCL20_ENST00000409189.3_Intron|CCL20_ENST00000473642.1_3'UTR			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20						cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		ATACCTTTCACTTTTTTTTTTT	0.361																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.77-16->T	2.37:g.228680164_228680164dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S51|Q99664	RNA	INS	-	NULL	ENST00000358813.4	37	NULL	CCDS2469.1	2																																																																																			CCL20	-	-	ENSG00000115009		0.361	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	HGNC	protein_coding	OTTHUMT00000331641.1	21	0.00	0	-	NM_004591		228680153	228680154	+1	no_errors	ENST00000473642	ensembl	human	known	69_37n	rna	16	15.79	3	INS	0.008:0.010	T
CCR2	729230	genome.wustl.edu	37	3	46399722	46399722	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr3:46399722A>T	ENST00000400888.2	+	1	743	c.704A>T	c.(703-705)gAg>gTg	p.E235V	CCR2_ENST00000445132.2_Missense_Mutation_p.E235V|CCR2_ENST00000292301.4_Missense_Mutation_p.E235V|CCR2_ENST00000465202.1_3'UTR			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	235					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		TGTCGAAACGAGAAGAAGAGG	0.468																																						dbGAP											0													223.0	207.0	212.0					3																	46399722		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.704A>T	3.37:g.46399722A>T	ENSP00000383681:p.Glu235Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR2	p.E235V	ENST00000400888.2	37	c.704	CCDS43078.1	3	.	.	.	.	.	.	.	.	.	.	A	17.37	3.372814	0.61624	.	.	ENSG00000121807	ENST00000445132;ENST00000292301;ENST00000400888	T;T;T	0.73575	-0.76;-0.76;-0.76	5.04	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000032	D	0.84660	0.5521	M	0.78916	2.43	0.18873	N	0.999989	D;P	0.59357	0.985;0.76	P;P	0.62089	0.898;0.589	T	0.79042	-0.1965	10	0.87932	D	0	.	15.0728	0.72053	1.0:0.0:0.0:0.0	.	235;235	P41597;Q4VBL2	CCR2_HUMAN;.	V	235	ENSP00000399285:E235V;ENSP00000292301:E235V;ENSP00000383681:E235V	ENSP00000292301:E235V	E	+	2	0	CCR2	46374726	1.000000	0.71417	0.992000	0.48379	0.895000	0.52256	4.670000	0.61583	2.032000	0.59987	0.528000	0.53228	GAG	CCR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000121807		0.468	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCR2	HGNC	protein_coding	OTTHUMT00000344292.1	41	0.00	0	A	NM_000647		46399722	46399722	+1	no_errors	ENST00000292301	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.166	T
CLEC4M	10332	genome.wustl.edu	37	19	7830731	7830731	+	Missense_Mutation	SNP	G	G	A	rs76899402		TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:7830731G>A	ENST00000327325.5	+	4	540	c.422G>A	c.(421-423)cGg>cAg	p.R141Q	CLEC4M_ENST00000394122.2_Missense_Mutation_p.R129Q|CLEC4M_ENST00000596707.1_Missense_Mutation_p.R120Q|CLEC4M_ENST00000357361.2_Missense_Mutation_p.R141Q|CLEC4M_ENST00000597522.1_Missense_Mutation_p.R141Q|CLEC4M_ENST00000248228.4_Intron|CLEC4M_ENST00000596363.1_Missense_Mutation_p.R113Q|CLEC4M_ENST00000359059.5_Intron|CLEC4M_ENST00000334806.5_Intron|CLEC4M_ENST00000595496.1_Missense_Mutation_p.R120Q	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	141	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)	p.R141Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						GAGCTGACCCGGCTGAAGGCT	0.582																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											13.0	13.0	13.0					19																	7830731		1642	3266	4908	-	-	-	SO:0001583	missense	0			AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.422G>A	19.37:g.7830731G>A	ENSP00000316228:p.Arg141Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.R141Q	ENST00000327325.5	37	c.422	CCDS12187.1	19	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.920834	0.00498	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000357361;ENST00000358690	T;T;T	0.22336	1.97;1.96;1.97	0.905	-1.81	0.07882	.	.	.	.	.	T	0.07188	0.0182	N	0.04636	-0.2	0.09310	N	1	B;B;B;B;B;B;B	0.17268	0.004;0.001;0.001;0.0;0.007;0.021;0.001	B;B;B;B;B;B;B	0.10450	0.003;0.005;0.001;0.0;0.002;0.003;0.005	T	0.33059	-0.9883	9	0.07482	T	0.82	.	6.6496	0.22955	0.409:0.0:0.591:0.0	.	120;113;141;113;120;141;85	Q9H2X3-5;B4DNV9;Q9H2X3;Q9H2X3-9;Q9H2X3-7;Q9H2X3-4;Q9H2X3-10	.;.;CLC4M_HUMAN;.;.;.;.	Q	141;129;141;85	ENSP00000316228:R141Q;ENSP00000377680:R129Q;ENSP00000349924:R141Q	ENSP00000316228:R141Q	R	+	2	0	CLEC4M	7736731	0.001000	0.12720	0.004000	0.12327	0.024000	0.10985	-1.792000	0.01756	-2.527000	0.00494	-2.768000	0.00120	CGG	CLEC4M	-	NULL	ENSG00000104938		0.582	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4M	HGNC	protein_coding	OTTHUMT00000461161.1	58	0.00	0	G	NM_014257		7830731	7830731	+1	no_errors	ENST00000327325	ensembl	human	known	69_37n	missense	63	14.86	11	SNP	0.005	A
CLIC5	53405	genome.wustl.edu	37	6	46047560	46047560	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:46047560G>T	ENST00000185206.6	-	1	572	c.420C>A	c.(418-420)agC>agA	p.S140R		NM_001114086.1	NP_001107558.1	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5	140					auditory receptor cell stereocilium organization (GO:0060088)|chloride transport (GO:0006821)|diet induced thermogenesis (GO:0002024)|female pregnancy (GO:0007565)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	actin cytoskeleton (GO:0015629)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|stereocilium (GO:0032420)	voltage-gated chloride channel activity (GO:0005247)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	13						GAATGGTGAAGCTTGAAGGAG	0.488																																						dbGAP											0													122.0	114.0	116.0					6																	46047560		692	1591	2283	-	-	-	SO:0001583	missense	0			AF216941	CCDS4914.1, CCDS47438.1, CCDS59022.1	6p12.3	2014-03-14			ENSG00000112782	ENSG00000112782		"""Ion channels / Chloride channels : Intracellular"""	13517	protein-coding gene	gene with protein product		607293				10793131	Standard	NM_001114086		Approved		uc003oxv.3	Q9NZA1	OTTHUMG00000014775	ENST00000185206.6:c.420C>A	6.37:g.46047560G>T	ENSP00000185206:p.Ser140Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUF1|Q5T4Z0|Q8NBY3|Q96JT5|Q9BWZ0	Missense_Mutation	SNP	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.S140R	ENST00000185206.6	37	c.420	CCDS47438.1	6	.	.	.	.	.	.	.	.	.	.	G	12.03	1.815057	0.32053	.	.	ENSG00000112782	ENST00000185206	T	0.25250	1.81	4.69	3.79	0.43588	.	0.840782	0.10615	N	0.654048	T	0.05777	0.0151	N	0.14661	0.345	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.26744	-1.0094	10	0.17369	T	0.5	.	10.0847	0.42410	0.0:0.0:0.7793:0.2206	.	140	Q9NZA1	CLIC5_HUMAN	R	140	ENSP00000185206:S140R	ENSP00000185206:S140R	S	-	3	2	CLIC5	46155519	0.932000	0.31603	0.292000	0.24919	0.164000	0.22412	1.370000	0.34238	1.264000	0.44198	-0.284000	0.09977	AGC	CLIC5	-	NULL	ENSG00000112782		0.488	CLIC5-002	KNOWN	basic|CCDS	protein_coding	CLIC5	HGNC	protein_coding	OTTHUMT00000040761.1	37	0.00	0	G			46047560	46047560	-1	no_errors	ENST00000185206	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	0.629	T
CMA1	1215	genome.wustl.edu	37	14	24975399	24975399	+	Silent	SNP	C	C	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:24975399C>A	ENST00000250378.3	-	4	464	c.435G>T	c.(433-435)cgG>cgT	p.R145R	RP11-80A15.1_ENST00000555109.1_Intron|CMA1_ENST00000206446.4_Silent_p.R34R	NM_001836.3	NP_001827.1	P23946	CMA1_HUMAN	chymase 1, mast cell	145	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|cellular response to glucose stimulus (GO:0071333)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|interleukin-1 beta biosynthetic process (GO:0050720)|midbrain development (GO:0030901)|peptide metabolic process (GO:0006518)|positive regulation of angiogenesis (GO:0045766)|regulation of inflammatory response (GO:0050727)	extracellular region (GO:0005576)|intracellular (GO:0005622)	peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			kidney(1)|lung(8)|pancreas(1)|prostate(1)	11				GBM - Glioblastoma multiforme(265;0.0271)		AGCCAGCCACCCGGCACATTC	0.582																																						dbGAP											0													48.0	43.0	45.0					14																	24975399		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9630.1	14q12	2012-08-30			ENSG00000092009	ENSG00000092009	3.4.21.39		2097	protein-coding gene	gene with protein product		118938				8468056	Standard	NM_001836		Approved		uc001wpp.1	P23946	OTTHUMG00000140181	ENST00000250378.3:c.435G>T	14.37:g.24975399C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM8|Q16018|Q3SY36|Q3SY37|Q9UDH5	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.R145	ENST00000250378.3	37	c.435	CCDS9630.1	14																																																																																			CMA1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000092009		0.582	CMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMA1	HGNC	protein_coding	OTTHUMT00000276535.2	31	0.00	0	C			24975399	24975399	-1	no_errors	ENST00000250378	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	0.685	A
COG1	9382	genome.wustl.edu	37	17	71203396	71203396	+	Splice_Site	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr17:71203396G>A	ENST00000299886.4	+	13	2885		c.e13+1		FAM104A_ENST00000583178.1_5'Flank	NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1						Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			AAAAGCTCAGGTTGGTGCCAA	0.468																																						dbGAP											0													96.0	85.0	89.0					17																	71203396		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.2805+1G>A	17.37:g.71203396G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPV9|Q9P2G6	Splice_Site	SNP	-	e13+1	ENST00000299886.4	37	c.2805+1	CCDS11692.1	17	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395947	0.83011	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COG1	68714991	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.108000	0.64609	2.941000	0.99782	0.655000	0.94253	.	COG1	-	-	ENSG00000166685		0.468	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG1	HGNC	protein_coding	OTTHUMT00000441638.1	37	0.00	0	G		Intron	71203396	71203396	+1	no_errors	ENST00000299886	ensembl	human	known	69_37n	splice_site	21	27.59	8	SNP	1.000	A
COL6A1	1291	genome.wustl.edu	37	21	47423943	47423943	+	3'UTR	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr21:47423943G>A	ENST00000361866.3	+	0	3217				COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CCTGCACGCCGGCACCAAACC	0.572																																						dbGAP											0													38.0	42.0	40.0					21																	47423943		2200	4300	6500	-	-	-	SO:0001624	3_prime_UTR_variant	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.*16G>A	21.37:g.47423943G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	RNA	SNP	-	NULL	ENST00000361866.3	37	NULL	CCDS13727.1	21																																																																																			COL6A1	-	-	ENSG00000142156		0.572	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	34	0.00	0	G	NM_001848		47423943	47423943	+1	no_errors	ENST00000486023	ensembl	human	known	69_37n	rna	38	11.63	5	SNP	0.000	A
COPA	1314	genome.wustl.edu	37	1	160275320	160275320	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:160275320T>C	ENST00000241704.7	-	17	1799	c.1570A>G	c.(1570-1572)Att>Gtt	p.I524V	COPA_ENST00000368069.3_Missense_Mutation_p.I533V	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	524					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTCTCATGAATGTTACATAAA	0.463																																						dbGAP											0													123.0	115.0	118.0					1																	160275320		2203	4300	6503	-	-	-	SO:0001583	missense	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1570A>G	1.37:g.160275320T>C	ENSP00000241704:p.Ile524Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T201|Q8IXZ9	Missense_Mutation	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I533V	ENST00000241704.7	37	c.1597	CCDS1202.1	1	.	.	.	.	.	.	.	.	.	.	T	10.27	1.302636	0.23736	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.61274	2.62;0.12	5.64	5.64	0.86602	Coatomer, WD associated region (1);	0.000000	0.85682	D	0.000000	T	0.22781	0.0550	N	0.16656	0.425	0.54753	D	0.999985	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.003	T	0.12785	-1.0534	10	0.12766	T	0.61	-15.8451	13.345	0.60566	0.0:0.0:0.0:1.0	.	524;533	P53621;P53621-2	COPA_HUMAN;.	V	533;524	ENSP00000357048:I533V;ENSP00000241704:I524V	ENSP00000241704:I524V	I	-	1	0	COPA	158541944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.434000	0.80377	2.367000	0.80283	0.528000	0.53228	ATT	COPA	-	pfam_Coatomer_WD-assoc_reg,pirsf_Coatomer_asu	ENSG00000122218		0.463	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1	49	0.00	0	T	NM_004371		160275320	160275320	-1	no_errors	ENST00000368069	ensembl	human	known	69_37n	missense	36	40.98	25	SNP	1.000	C
CRMP1	1400	genome.wustl.edu	37	4	5841382	5841382	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:5841382T>C	ENST00000397890.2	-	9	1049	c.835A>G	c.(835-837)Att>Gtt	p.I279V	CRMP1_ENST00000324989.7_Missense_Mutation_p.I393V|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Missense_Mutation_p.I277V	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	279					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CTGGCGGCAATGGGCTCTCCA	0.557																																						dbGAP											0													23.0	26.0	25.0					4																	5841382		2203	4299	6502	-	-	-	SO:0001583	missense	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.835A>G	4.37:g.5841382T>C	ENSP00000380987:p.Ile279Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.I393V	ENST00000397890.2	37	c.1177	CCDS43207.1	4	.	.	.	.	.	.	.	.	.	.	T	11.84	1.760144	0.31137	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.89939	-2.59;-2.59;-2.59	3.71	3.71	0.42584	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.83885	0.5351	L	0.39467	1.215	0.80722	D	1	B;B;B;B	0.16396	0.016;0.017;0.001;0.003	B;B;B;B	0.18871	0.023;0.012;0.003;0.018	T	0.82291	-0.0530	10	0.72032	D	0.01	-11.9166	11.99	0.53169	0.0:0.0:0.0:1.0	.	393;277;279;216	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	V	393;279;279;277	ENSP00000321606:I393V;ENSP00000380987:I279V;ENSP00000425742:I277V	ENSP00000321606:I393V	I	-	1	0	CRMP1	5892283	1.000000	0.71417	0.986000	0.45419	0.338000	0.28826	5.626000	0.67777	1.692000	0.51112	0.459000	0.35465	ATT	CRMP1	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.557	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	41	0.00	0	T	NM_001313		5841382	5841382	-1	no_errors	ENST00000324989	ensembl	human	known	69_37n	missense	61	17.57	13	SNP	1.000	C
DHX37	57647	genome.wustl.edu	37	12	125470788	125470788	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr12:125470788C>G	ENST00000308736.2	-	2	228	c.130G>C	c.(130-132)Gat>Cat	p.D44H		NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	44							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		TTGCTTGCATCAACTCCCTTC	0.532																																						dbGAP											0													141.0	128.0	133.0					12																	125470788		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.130G>C	12.37:g.125470788C>G	ENSP00000311135:p.Asp44His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUI7|Q9P211	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D44H	ENST00000308736.2	37	c.130	CCDS9261.1	12	.	.	.	.	.	.	.	.	.	.	C	11.18	1.563527	0.27915	.	.	ENSG00000150990	ENST00000308736	T	0.04862	3.54	4.04	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	M	0.83118	2.625	0.80722	D	1	D	0.71674	0.998	P	0.60789	0.879	T	0.08576	-1.0715	10	0.87932	D	0	-7.0973	15.3096	0.74019	0.0:1.0:0.0:0.0	.	44	Q8IY37	DHX37_HUMAN	H	44	ENSP00000311135:D44H	ENSP00000311135:D44H	D	-	1	0	DHX37	124036741	1.000000	0.71417	0.119000	0.21687	0.191000	0.23601	6.639000	0.74314	1.948000	0.56530	0.491000	0.48974	GAT	DHX37	-	NULL	ENSG00000150990		0.532	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	HGNC	protein_coding		38	0.00	0	C	NM_032656		125470788	125470788	-1	no_errors	ENST00000308736	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	0.943	G
PGS1	9489	genome.wustl.edu	37	17	76421448	76421448	+	IGR	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr17:76421448C>T	ENST00000262764.6	+	0	2201				DNAH17_ENST00000585328.1_Missense_Mutation_p.V4369M|AC061992.1_ENST00000600087.1_5'Flank|DNAH17_ENST00000389840.5_Missense_Mutation_p.V4397M|DNAH17_ENST00000586052.1_5'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			AGTCCGTACACGTAGGAGCCC	0.537																																					Esophageal Squamous(45;182 1126 10685 43198)	dbGAP											0													104.0	104.0	104.0					17																	76421448		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8			17.37:g.76421448C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.V4397M	ENST00000262764.6	37	c.13189	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530680	0.64860	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.14022	2.54	4.85	4.85	0.62838	.	0.000000	0.50627	D	0.000104	T	0.44095	0.1277	M	0.92122	3.275	0.41896	D	0.990395	D	0.89917	1.0	D	0.71870	0.975	T	0.54510	-0.8283	10	0.87932	D	0	.	11.6147	0.51083	0.0:0.9189:0.0:0.081	.	4369	E7EUM8	.	M	4369;4397	ENSP00000374490:V4397M	ENSP00000300671:V4369M	V	-	1	0	DNAH17	73933043	0.766000	0.28496	0.995000	0.50966	0.753000	0.42808	1.406000	0.34646	2.505000	0.84491	0.591000	0.81541	GTG	DNAH17	-	pfam_Dynein_heavy	ENSG00000187775		0.537	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000437301.1	57	0.00	0	C	NM_024419		76421448	76421448	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.987	T
DNAH8	1769	genome.wustl.edu	37	6	38899636	38899636	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:38899636A>G	ENST00000359357.3	+	74	10927	c.10673A>G	c.(10672-10674)tAc>tGc	p.Y3558C	DNAH8_ENST00000449981.2_Missense_Mutation_p.Y3775C|DNAH8_ENST00000441566.1_Missense_Mutation_p.Y3522C|RP1-207H1.3_ENST00000416948.1_RNA|RP1-207H1.3_ENST00000453417.1_RNA|RP1-207H1.3_ENST00000418399.1_RNA			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3558	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTTAAACTTTACATTACTACG	0.348																																						dbGAP											0													159.0	163.0	162.0					6																	38899636		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.10673A>G	6.37:g.38899636A>G	ENSP00000352312:p.Tyr3558Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Y3558C	ENST00000359357.3	37	c.10673		6	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109299	0.77096	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.21734	1.99;1.99;1.99	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.62708	0.2450	H	0.99475	4.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.80948	-0.1154	10	0.87932	D	0	.	16.3265	0.82983	1.0:0.0:0.0:0.0	.	3522;3558	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	C	3763;3763;3558;3522	ENSP00000333363:Y3763C;ENSP00000352312:Y3558C;ENSP00000402294:Y3522C	ENSP00000333363:Y3763C	Y	+	2	0	DNAH8	39007614	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	5.888000	0.69758	2.313000	0.78055	0.455000	0.32223	TAC	DNAH8	-	NULL	ENSG00000124721		0.348	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	15	0.00	0	A	NM_001206927		38899636	38899636	+1	no_errors	ENST00000359357	ensembl	human	known	69_37n	missense	20	39.39	13	SNP	1.000	G
DOCK9	23348	genome.wustl.edu	37	13	99534235	99534235	+	Silent	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:99534235C>T	ENST00000376460.1	-	24	2666	c.2586G>A	c.(2584-2586)gtG>gtA	p.V862V	DOCK9_ENST00000448493.2_Silent_p.V874V|DOCK9_ENST00000339416.2_Silent_p.V863V|DOCK9_ENST00000442173.1_Silent_p.V862V	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	863					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGGCGATCATCACGTGGCCTT	0.502																																						dbGAP											0													108.0	106.0	107.0					13																	99534235		2158	4255	6413	-	-	-	SO:0001819	synonymous_variant	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2586G>A	13.37:g.99534235C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V863	ENST00000376460.1	37	c.2589	CCDS45062.1	13																																																																																			DOCK9	-	superfamily_ARM-type_fold	ENSG00000088387		0.502	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	53	0.00	0	C	NM_015296		99534235	99534235	-1	no_errors	ENST00000339416	ensembl	human	known	69_37n	silent	56	13.85	9	SNP	1.000	T
DTHD1	401124	genome.wustl.edu	37	4	36286023	36286023	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:36286023A>C	ENST00000456874.2	+	1	380	c.322A>C	c.(322-324)Aat>Cat	p.N108H	DTHD1_ENST00000357504.3_Intron|DTHD1_ENST00000507598.1_Missense_Mutation_p.N148H	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	108					signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						TGAGAACATAAATGGCAACAG	0.393																																						dbGAP											0													160.0	128.0	138.0					4																	36286023		692	1591	2283	-	-	-	SO:0001583	missense	0			AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.322A>C	4.37:g.36286023A>C	ENSP00000401597:p.Asn108His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK4|B4E2N7	Missense_Mutation	SNP	pfam_Death,superfamily_DEATH-like,pfscan_Death	p.N108H	ENST00000456874.2	37	c.322	CCDS54754.1	4	.	.	.	.	.	.	.	.	.	.	A	8.383	0.837955	0.16891	.	.	ENSG00000197057	ENST00000507598;ENST00000456874	T;T	0.22945	1.93;1.94	4.65	3.45	0.39498	.	.	.	.	.	T	0.13457	0.0326	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.19095	-1.0316	7	0.44086	T	0.13	.	5.9722	0.19359	0.7825:0.0:0.2175:0.0	.	.	.	.	H	148;108	ENSP00000424426:N148H;ENSP00000401597:N108H	ENSP00000401597:N108H	N	+	1	0	DTHD1	35962418	0.996000	0.38824	0.004000	0.12327	0.057000	0.15508	1.734000	0.38166	0.899000	0.36444	0.524000	0.50904	AAT	DTHD1	-	NULL	ENSG00000197057		0.393	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DTHD1	HGNC	protein_coding		22	0.00	0	A	NM_001136536		36286023	36286023	+1	no_errors	ENST00000456874	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	0.004	C
DTX4	23220	genome.wustl.edu	37	11	58949804	58949804	+	Silent	SNP	G	G	T	rs571331933		TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr11:58949804G>T	ENST00000227451.3	+	2	908	c.804G>T	c.(802-804)ggG>ggT	p.G268G	DTX4_ENST00000532982.1_Silent_p.G162G	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	268					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				TGCCCACTGGGACAACCATGG	0.642																																						dbGAP											0													27.0	39.0	35.0					11																	58949804		2062	4190	6252	-	-	-	SO:0001819	synonymous_variant	0			AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.804G>T	11.37:g.58949804G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VF38	Silent	SNP	pfam_WWE-dom,pfam_Znf_C3HC4_RING-type,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.G268	ENST00000227451.3	37	c.804	CCDS44612.1	11																																																																																			DTX4	-	NULL	ENSG00000110042		0.642	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX4	HGNC	protein_coding	OTTHUMT00000394228.1	42	0.00	0	G	XM_166213		58949804	58949804	+1	no_errors	ENST00000227451	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	0.002	T
DUSP10	11221	genome.wustl.edu	37	1	221875987	221875987	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:221875987T>A	ENST00000366899.3	-	4	1454	c.1216A>T	c.(1216-1218)Atc>Ttc	p.I406F	DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_Missense_Mutation_p.I64F|DUSP10_ENST00000544095.1_Missense_Mutation_p.I64F	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	406	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		TGGCAGTGGATGAGAAGCCCC	0.502																																						dbGAP											0													71.0	68.0	69.0					1																	221875987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.1216A>T	1.37:g.221875987T>A	ENSP00000355866:p.Ile406Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_Blood-coag_inhib_Disintegrin,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.I406F	ENST00000366899.3	37	c.1216	CCDS1528.1	1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.875384	0.91664	.	.	ENSG00000143507	ENST00000366899;ENST00000418487;ENST00000323825;ENST00000544095	T;T;T	0.64803	-0.12;-0.12;-0.12	5.72	5.72	0.89469	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.81148	0.4762	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.84382	0.0550	10	0.87932	D	0	.	16.2988	0.82793	0.0:0.0:0.0:1.0	.	406	Q9Y6W6	DUS10_HUMAN	F	406;351;64;64	ENSP00000355866:I406F;ENSP00000322015:I64F;ENSP00000441302:I64F	ENSP00000322015:I64F	I	-	1	0	DUSP10	219942610	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.997000	0.88414	2.311000	0.77944	0.533000	0.62120	ATC	DUSP10	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000143507		0.502	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1	34	0.00	0	T	NM_007207		221875987	221875987	-1	no_errors	ENST00000366899	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	A
DUSP13	51207	genome.wustl.edu	37	10	76857643	76857643	+	5'UTR	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr10:76857643C>T	ENST00000472493.2	-	0	78				DUSP13_ENST00000605915.1_Splice_Site_p.G22G|DUSP13_ENST00000607131.1_Splice_Site_p.R93R|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000464872.1_5'Flank|DUSP13_ENST00000372700.3_Splice_Site_p.A50A|DUSP13_ENST00000607009.1_5'UTR|DUSP13_ENST00000491677.2_Splice_Site_p.R129R|DUSP13_ENST00000478873.2_Splice_Site_p.G136G	NM_016364.3	NP_057448.3	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13						meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GTGAGTCCATCCTGGAACAGA	0.642																																					NSCLC(174;1655 2059 12324 40663 42963)	dbGAP											0													47.0	43.0	44.0					10																	76857643		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000472493.2:c.-1G>A	10.37:g.76857643C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.R129	ENST00000472493.2	37	c.387	CCDS7346.1	10																																																																																			DUSP13	-	NULL	ENSG00000079393		0.642	DUSP13-004	KNOWN	basic|CCDS	protein_coding	DUSP13	HGNC	protein_coding	OTTHUMT00000048786.3	31	0.00	0	C			76857643	76857643	-1	no_errors	ENST00000491677	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	0.999	T
DYRK3	8444	genome.wustl.edu	37	1	206821263	206821263	+	Silent	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:206821263G>T	ENST00000367109.2	+	3	888	c.720G>T	c.(718-720)gtG>gtT	p.V240V	DYRK3_ENST00000489878.1_Intron|DYRK3_ENST00000367108.3_Silent_p.V220V|DYRK3_ENST00000367106.1_Silent_p.V220V	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TAAAAATGGTGCGCAATGAGA	0.458																																					Melanoma(164;427 2622 26826 51707)	dbGAP											0													81.0	78.0	79.0					1																	206821263		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.720G>T	1.37:g.206821263G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V240	ENST00000367109.2	37	c.720	CCDS30999.1	1																																																																																			DYRK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000143479		0.458	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK3	HGNC	protein_coding	OTTHUMT00000088458.1	51	0.00	0	G	NM_003582		206821263	206821263	+1	no_errors	ENST00000367109	ensembl	human	known	69_37n	silent	67	11.84	9	SNP	0.994	T
EEF1A2	1917	genome.wustl.edu	37	20	62121944	62121944	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr20:62121944T>A	ENST00000298049.7	-	5	987	c.917A>T	c.(916-918)gAc>gTc	p.D306V	EEF1A2_ENST00000217182.3_Missense_Mutation_p.D306V			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	306					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GCCGACGTTGTCGCCGGGCAG	0.622																																						dbGAP											0													113.0	103.0	107.0					20																	62121944		2201	4293	6494	-	-	-	SO:0001583	missense	0			AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.917A>T	20.37:g.62121944T>A	ENSP00000298049:p.Asp306Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EF1A_euk/arc	p.D306V	ENST00000298049.7	37	c.917	CCDS13522.1	20	.	.	.	.	.	.	.	.	.	.	T	17.26	3.344468	0.61073	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.64085	-0.08;-0.08	3.82	3.82	0.43975	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.052791	0.64402	D	0.000001	D	0.87430	0.6175	H	0.99555	4.625	0.80722	D	1	D;D	0.67145	0.996;0.961	D;D	0.83275	0.996;0.963	D	0.91888	0.5521	10	0.87932	D	0	-33.4668	12.8892	0.58061	0.0:0.0:0.0:1.0	.	282;306	Q59GP5;Q05639	.;EF1A2_HUMAN	V	306	ENSP00000298049:D306V;ENSP00000217182:D306V	ENSP00000217182:D306V	D	-	2	0	EEF1A2	61592388	1.000000	0.71417	0.976000	0.42696	0.365000	0.29674	7.843000	0.86859	1.506000	0.48736	0.454000	0.30748	GAC	EEF1A2	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Transl_elong_EF1A_euk/arc	ENSG00000101210		0.622	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A2	HGNC	protein_coding	OTTHUMT00000080495.1	76	0.00	0	T	NM_001958		62121944	62121944	-1	no_errors	ENST00000217182	ensembl	human	known	69_37n	missense	60	34.07	31	SNP	1.000	A
EFNA3	1944	genome.wustl.edu	37	1	155058949	155058949	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:155058949G>T	ENST00000368408.3	+	5	717	c.647G>T	c.(646-648)aGc>aTc	p.S216I	EFNA3_ENST00000505139.1_Missense_Mutation_p.S211I|EFNA3_ENST00000498667.1_3'UTR|EFNA3_ENST00000556931.1_Missense_Mutation_p.S211I|EFNA3_ENST00000418360.2_Missense_Mutation_p.S190I	NM_004952.4	NP_004943.1	P52797	EFNA3_HUMAN	ephrin-A3	216					axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		all cancers(21;5.67e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000284)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGCGGGACCAGCCCCAAACGG	0.612											OREG0013850	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													102.0	99.0	100.0					1																	155058949		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017722	CCDS1090.1	1q21-q22	2011-03-09			ENSG00000143590	ENSG00000143590		"""Ephrins"""	3223	protein-coding gene	gene with protein product		601381		EPLG3		8660976	Standard	NM_004952		Approved	LERK3, Ehk1-L	uc001fhf.3	P52797	OTTHUMG00000035313	ENST00000368408.3:c.647G>T	1.37:g.155058949G>T	ENSP00000357393:p.Ser216Ile	Somatic	220	WXS	Illumina GAIIx	Phase_IV	B7ZAD3|D3DV85|Q0VGC9|Q5SR70	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.S216I	ENST00000368408.3	37	c.647	CCDS1090.1	1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703336	0.68501	.	.	ENSG00000143590;ENSG00000143590;ENSG00000143590;ENSG00000251246	ENST00000556931;ENST00000368408;ENST00000418360;ENST00000505139	D;D;D;D	0.96967	-3.79;-3.77;-4.19;-3.79	4.06	4.06	0.47325	.	0.108135	0.64402	D	0.000008	D	0.95411	0.8510	L	0.27053	0.805	0.51012	D	0.999905	D;D;D	0.71674	0.995;0.998;0.995	D;P;D	0.72982	0.979;0.896;0.979	D	0.96427	0.9316	10	0.87932	D	0	-11.6395	14.1188	0.65172	0.0:0.0:1.0:0.0	.	190;211;216	B7ZAD3;B4DXG7;P52797	.;.;EFNA3_HUMAN	I	211;216;190;211	ENSP00000450814:S211I;ENSP00000357393:S216I;ENSP00000391370:S190I;ENSP00000426741:S211I	ENSP00000357393:S216I	S	+	2	0	RP11-540D14.8;EFNA3	153325573	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.676000	0.74498	2.253000	0.74438	0.462000	0.41574	AGC	EFNA3	-	NULL	ENSG00000143590		0.612	EFNA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFNA3	HGNC	protein_coding	OTTHUMT00000085429.1	77	0.00	0	G	NM_004952		155058949	155058949	+1	no_errors	ENST00000368408	ensembl	human	known	69_37n	missense	80	12.09	11	SNP	1.000	T
EGF	1950	genome.wustl.edu	37	4	110932572	110932572	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:110932572G>C	ENST00000265171.5	+	24	4030	c.3585G>C	c.(3583-3585)agG>agC	p.R1195S	EGF_ENST00000509793.1_Missense_Mutation_p.R1153S|EGF_ENST00000503392.1_Missense_Mutation_p.R1154S	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	1195					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GGCAACAAAGGGCCCTGGACC	0.473																																						dbGAP											0													103.0	110.0	107.0					4																	110932572		2203	4300	6503	-	-	-	SO:0001583	missense	0			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.3585G>C	4.37:g.110932572G>C	ENSP00000265171:p.Arg1195Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_LDLR_classB_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.R1195S	ENST00000265171.5	37	c.3585	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278218	0.40294	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.90261	-2.64;-2.55;-2.43	3.85	-2.47	0.06442	.	0.559188	0.16715	N	0.202500	D	0.89262	0.6665	L	0.32530	0.975	0.09310	N	1	D;D;D	0.69078	0.994;0.997;0.994	P;P;P	0.62298	0.796;0.9;0.796	T	0.82924	-0.0216	10	0.87932	D	0	.	9.3689	0.38241	0.6904:0.0:0.3096:0.0	.	1154;1153;1195	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	S	1153;1195;1154	ENSP00000424316:R1153S;ENSP00000265171:R1195S;ENSP00000421384:R1154S	ENSP00000265171:R1195S	R	+	3	2	EGF	111152021	0.140000	0.22579	0.001000	0.08648	0.009000	0.06853	0.362000	0.20284	-0.635000	0.05531	-0.150000	0.13652	AGG	EGF	-	NULL	ENSG00000138798		0.473	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	19	0.00	0	G			110932572	110932572	+1	no_errors	ENST00000265171	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.002	C
EMG1	10436	genome.wustl.edu	37	12	7080048	7080048	+	5'UTR	SNP	A	A	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr12:7080048A>T	ENST00000261406.6	+	0	105				PHB2_ENST00000542912.1_5'Flank|PHB2_ENST00000399433.2_5'Flank|PHB2_ENST00000546111.1_5'Flank|PHB2_ENST00000544134.1_5'Flank|PHB2_ENST00000535923.1_5'Flank|PHB2_ENST00000440277.1_5'Flank	NM_006331.7	NP_006322.4			EMG1 N1-specific pseudouridine methyltransferase																		CGCTGTTCTTATTTAAGAGCG	0.537																																						dbGAP											0													23.0	22.0	22.0					12																	7080048		1888	4113	6001	-	-	-	SO:0001623	5_prime_UTR_variant	0			U72514	CCDS73430.1	12p13	2013-05-22	2013-05-22			ENSG00000126749			16912	protein-coding gene	gene with protein product		611531	"""EMG1 nucleolar protein homolog (S. cerevisiae)"""			9074930, 11935223, 19463982	Standard	NM_006331		Approved	C2F, NEP1, Grcc2f	uc001qsh.4	Q92979		ENST00000261406.6:c.-39A>T	12.37:g.7080048A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000261406.6	37	NULL		12																																																																																			EMG1	-	-	ENSG00000126749		0.537	EMG1-201	KNOWN	basic|appris_principal	protein_coding	EMG1	HGNC	protein_coding		79	0.00	0	A	NM_006331		7080048	7080048	+1	no_errors	ENST00000261406	ensembl	human	known	69_37n	rna	82	12.77	12	SNP	0.000	T
RSPH10B2	728194	genome.wustl.edu	37	7	6836437	6836437	+	Intron	SNP	G	G	T	rs2528352	byFrequency	TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:6836437G>T	ENST00000403107.1	+	19	2819				RSPH10B2_ENST00000297186.3_Intron|RSPH10B2_ENST00000359718.3_Intron|RSPH10B2_ENST00000463354.2_3'UTR|CCZ1B_ENST00000597208.1_5'UTR|RSPH10B2_ENST00000404077.1_Intron|RSPH10B2_ENST00000433859.2_Intron			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)											breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						CCAGCTGCTCGCTCTCTTCCT	0.537													.|||	1395	0.278554	0.1679	0.2061	5008	,	,		7726	0.5417		0.1471	False		,,,				2504	0.3436					dbGAP											0													79.0	85.0	83.0					7																	6836437		1696	3682	5378	-	-	-	SO:0001627	intron_variant	0				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.2432+40G>T	7.37:g.6836437G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	RNA	SNP	-	NULL	ENST00000403107.1	37	NULL	CCDS43552.1	7																																																																																			AC073343.11	-	-	ENSG00000226150		0.537	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000226150	Clone_based_vega_gene	protein_coding	OTTHUMT00000324184.4	9	0.00	0	G	NM_001099697		6836437	6836437	-1	no_errors	ENST00000429267	ensembl	human	known	69_37n	rna	6	45.45	5	SNP	0.001	T
EXD2	55218	genome.wustl.edu	37	14	69708534	69708534	+	3'UTR	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:69708534C>G	ENST00000409018.3	+	0	2711				RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409675.1_3'UTR|EXD2_ENST00000449989.1_3'UTR|EXD2_ENST00000409014.1_3'UTR|EXD2_ENST00000492815.1_3'UTR	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2								3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CAAACTCCATCTCCCAATAGA	0.473																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.*717C>G	14.37:g.69708534C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIH6|G5E947|Q6AWB6|Q8N3D3	RNA	SNP	-	NULL	ENST00000409018.3	37	NULL	CCDS53902.1	14																																																																																			EXD2	-	-	ENSG00000081177		0.473	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	HGNC	protein_coding	OTTHUMT00000335504.1	55	0.00	0	C			69708534	69708534	+1	no_errors	ENST00000492815	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	0.000	G
F5	2153	genome.wustl.edu	37	1	169483582	169483582	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:169483582C>G	ENST00000367797.3	-	25	6845	c.6644G>C	c.(6643-6645)cGc>cCc	p.R2215P	F5_ENST00000367796.3_Missense_Mutation_p.R2220P	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2215	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GAGTTCCAGGCGAAGTGCAAT	0.383																																						dbGAP											0													88.0	90.0	90.0					1																	169483582		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6644G>C	1.37:g.169483582C>G	ENSP00000356771:p.Arg2215Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.R2220P	ENST00000367797.3	37	c.6659	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629818	0.87660	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.86164	-2.08;-2.08	5.09	5.09	0.68999	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.96390	0.8822	H	0.99042	4.41	0.49582	D	0.999804	D	0.89917	1.0	D	0.97110	1.0	D	0.98331	1.0533	9	0.87932	D	0	-11.6206	18.0692	0.89400	0.0:1.0:0.0:0.0	.	2215	P12259	FA5_HUMAN	P	2215;2220	ENSP00000356771:R2215P;ENSP00000356770:R2220P	ENSP00000356770:R2220P	R	-	2	0	F5	167750206	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.309000	0.72825	2.356000	0.79943	0.591000	0.81541	CGC	F5	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000198734		0.383	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	67	0.00	0	C	NM_000130		169483582	169483582	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	1.000	G
FAM65B	9750	genome.wustl.edu	37	6	24836037	24836037	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:24836037C>T	ENST00000259698.4	-	16	2340	c.2165G>A	c.(2164-2166)gGa>gAa	p.G722E	FAM65B_ENST00000538035.1_Missense_Mutation_p.G701E	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	722					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GGTCCCAACTCCTGTGTCTTC	0.537																																						dbGAP											0													108.0	94.0	98.0					6																	24836037		692	1591	2283	-	-	-	SO:0001583	missense	0			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.2165G>A	6.37:g.24836037C>T	ENSP00000259698:p.Gly722Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G722E	ENST00000259698.4	37	c.2165	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	C	28.7	4.938927	0.92526	.	.	ENSG00000111913	ENST00000259698;ENST00000538035	T;T	0.47528	0.84;0.84	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.60741	0.2292	L	0.61218	1.895	0.80722	D	1	D;D	0.76494	0.999;0.973	D;P	0.70016	0.967;0.73	T	0.60347	-0.7281	10	0.49607	T	0.09	-24.0699	19.1916	0.93669	0.0:1.0:0.0:0.0	.	701;722	F5GX51;Q9Y4F9	.;FA65B_HUMAN	E	722;701	ENSP00000259698:G722E;ENSP00000441138:G701E	ENSP00000259698:G722E	G	-	2	0	FAM65B	24944016	1.000000	0.71417	0.837000	0.33122	0.982000	0.71751	7.452000	0.80683	2.541000	0.85698	0.655000	0.94253	GGA	FAM65B	-	NULL	ENSG00000111913		0.537	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	HGNC	protein_coding	OTTHUMT00000040024.2	106	0.00	0	C			24836037	24836037	-1	no_errors	ENST00000259698	ensembl	human	known	69_37n	missense	112	13.18	17	SNP	1.000	T
FOSB	2354	genome.wustl.edu	37	19	45976235	45976235	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:45976235G>A	ENST00000353609.3	+	4	1574	c.982G>A	c.(982-984)Gat>Aat	p.D328N	FOSB_ENST00000592811.1_3'UTR|FOSB_ENST00000592436.1_3'UTR|FOSB_ENST00000591858.1_Missense_Mutation_p.D289N|FOSB_ENST00000417353.2_Missense_Mutation_p.D292N|FOSB_ENST00000586615.1_Missense_Mutation_p.D279N|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000443841.2_Missense_Mutation_p.D185N|FOSB_ENST00000585836.1_Missense_Mutation_p.D253N	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	328					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		CCAGCCTTCCGATCCCCTGAA	0.577																																						dbGAP											0													87.0	85.0	86.0					19																	45976235		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.982G>A	19.37:g.45976235G>A	ENSP00000245919:p.Asp328Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.D328N	ENST00000353609.3	37	c.982	CCDS12664.1	19	.	.	.	.	.	.	.	.	.	.	G	35	5.418653	0.96092	.	.	ENSG00000125740	ENST00000353609;ENST00000417353;ENST00000455928;ENST00000443841	T;T;T	0.46063	0.88;0.88;0.88	4.74	4.74	0.60224	.	0.150767	0.56097	D	0.000022	T	0.57902	0.2085	L	0.47190	1.495	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.992;0.997;0.997;0.992	T	0.60801	-0.7191	10	0.87932	D	0	-13.5396	15.3304	0.74203	0.0:0.0:1.0:0.0	.	185;289;253;292;328	E7EPR6;A8VJF0;A8VJF3;E9PHJ3;P53539	.;.;.;.;FOSB_HUMAN	N	328;292;281;185	ENSP00000245919:D328N;ENSP00000407207:D292N;ENSP00000414177:D185N	ENSP00000245919:D328N	D	+	1	0	FOSB	50668075	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.403000	0.79983	2.481000	0.83766	0.555000	0.69702	GAT	FOSB	-	NULL	ENSG00000125740		0.577	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSB	HGNC	protein_coding	OTTHUMT00000459561.1	53	0.00	0	G	NM_006732		45976235	45976235	+1	no_errors	ENST00000353609	ensembl	human	known	69_37n	missense	64	17.95	14	SNP	1.000	A
FCAR	2204	genome.wustl.edu	37	19	55396826	55396826	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:55396826G>A	ENST00000355524.3	+	3	260	c.250G>A	c.(250-252)Gag>Aag	p.E84K	FCAR_ENST00000391726.3_Missense_Mutation_p.E72K|FCAR_ENST00000345937.4_Missense_Mutation_p.E84K|FCAR_ENST00000353758.4_Intron|FCAR_ENST00000469767.1_Missense_Mutation_p.E84K|FCAR_ENST00000359272.4_Missense_Mutation_p.E72K|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391724.3_Missense_Mutation_p.E72K|FCAR_ENST00000391723.3_Missense_Mutation_p.E72K|FCAR_ENST00000391725.3_Missense_Mutation_p.E84K	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	84	Ig-like C2-type 1.				immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GACTGATCCTGAGTTCGTCAT	0.493																																						dbGAP											0													128.0	111.0	117.0					19																	55396826		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.250G>A	19.37:g.55396826G>A	ENSP00000347714:p.Glu84Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	smart_Ig_sub	p.E84K	ENST00000355524.3	37	c.250	CCDS12907.1	19	.	.	.	.	.	.	.	.	.	.	G	9.831	1.188540	0.21954	.	.	ENSG00000186431	ENST00000433231;ENST00000391726;ENST00000355524;ENST00000391725;ENST00000345937;ENST00000359272;ENST00000391723;ENST00000391724	T;T;T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74;2.74;2.74	3.19	-1.83	0.07833	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.35739	N	0.003005	T	0.15609	0.0376	L	0.31157	0.91	0.09310	N	1	B;P;D;B;B;D;B;P	0.65815	0.062;0.872;0.979;0.092;0.316;0.995;0.412;0.692	B;B;P;B;P;P;P;B	0.62089	0.188;0.352;0.584;0.113;0.573;0.898;0.539;0.068	T	0.10894	-1.0610	10	0.40728	T	0.16	.	6.4936	0.22130	0.5695:0.0:0.4305:0.0	.	72;72;72;72;84;84;84;84	Q92588;Q92593;Q92587;Q9UEK0;Q53X39;P24071-3;P24071;P24071-4	.;.;.;.;.;.;FCAR_HUMAN;.	K	84;72;84;84;84;72;72;72	ENSP00000375606:E72K;ENSP00000347714:E84K;ENSP00000375605:E84K;ENSP00000338257:E84K;ENSP00000352218:E72K;ENSP00000375603:E72K;ENSP00000375604:E72K	ENSP00000338257:E84K	E	+	1	0	FCAR	60088638	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.579000	0.05834	-0.265000	0.09352	-0.251000	0.11542	GAG	FCAR	-	smart_Ig_sub	ENSG00000186431		0.493	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCAR	HGNC	protein_coding	OTTHUMT00000141243.1	47	0.00	0	G	NM_002000		55396826	55396826	+1	no_errors	ENST00000355524	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	0.000	A
FOXP4	116113	genome.wustl.edu	37	6	41557815	41557815	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:41557815C>G	ENST00000307972.4	+	10	1276	c.1264C>G	c.(1264-1266)Cta>Gta	p.L422V	FOXP4_ENST00000409208.1_Missense_Mutation_p.L410V|FOXP4_ENST00000373060.1_Missense_Mutation_p.L422V|FOXP4_ENST00000373063.3_Missense_Mutation_p.L409V|FOXP4_ENST00000373057.3_Missense_Mutation_p.L420V			Q8IVH2	FOXP4_HUMAN	forkhead box P4	422					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					TGTCACCCCTCTACGGCCCCC	0.667																																						dbGAP											0													31.0	34.0	33.0					6																	41557815		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.1264C>G	6.37:g.41557815C>G	ENSP00000309823:p.Leu422Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L422V	ENST00000307972.4	37	c.1264	CCDS34447.1	6	.	.	.	.	.	.	.	.	.	.	C	7.643	0.681373	0.14907	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73	3.82	-0.346	0.12620	.	0.000000	0.56097	D	0.000025	T	0.76300	0.3968	L	0.38175	1.15	0.44711	D	0.997702	B;P;B	0.36483	0.243;0.555;0.227	B;B;B	0.42319	0.066;0.383;0.074	T	0.68569	-0.5374	10	0.15499	T	0.54	.	9.5156	0.39104	0.0:0.5832:0.0:0.4168	.	409;420;422	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	V	422;409;410;420;422	ENSP00000362151:L422V;ENSP00000362154:L409V;ENSP00000386958:L410V;ENSP00000362148:L420V;ENSP00000309823:L422V	ENSP00000309823:L422V	L	+	1	2	FOXP4	41665793	0.001000	0.12720	0.485000	0.27403	0.786000	0.44442	-0.113000	0.10774	-0.044000	0.13491	-0.380000	0.06706	CTA	FOXP4	-	NULL	ENSG00000137166		0.667	FOXP4-002	KNOWN	basic|CCDS	protein_coding	FOXP4	HGNC	protein_coding	OTTHUMT00000106767.1	40	0.00	0	C	NM_138457		41557815	41557815	+1	no_errors	ENST00000307972	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	0.635	G
FYB	2533	genome.wustl.edu	37	5	39202503	39202503	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr5:39202503A>C	ENST00000351578.6	-	2	750	c.560T>G	c.(559-561)cTt>cGt	p.L187R	FYB_ENST00000540520.1_Missense_Mutation_p.L197R|FYB_ENST00000505428.1_Missense_Mutation_p.L187R|FYB_ENST00000515010.1_Missense_Mutation_p.L187R|FYB_ENST00000512982.1_Missense_Mutation_p.L187R	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	187					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTTGGGTTCAAGATCTTGTGA	0.493																																						dbGAP											0													88.0	89.0	89.0					5																	39202503		1860	4097	5957	-	-	-	SO:0001583	missense	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.560T>G	5.37:g.39202503A>C	ENSP00000316460:p.Leu187Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.L197R	ENST00000351578.6	37	c.590	CCDS47200.1	5	.	.	.	.	.	.	.	.	.	.	A	1.867	-0.461259	0.04508	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02	6.07	-3.99	0.04069	.	1.447450	0.03723	N	0.252234	T	0.11110	0.0271	N	0.22421	0.69	0.09310	N	1	B;B	0.24823	0.112;0.029	B;B	0.22386	0.039;0.016	T	0.18147	-1.0346	10	0.16896	T	0.51	0.6459	2.9661	0.05908	0.3296:0.0635:0.3591:0.2477	.	197;187	B4DLN2;O15117	.;FYB_HUMAN	R	187;187;187;187;197;187	ENSP00000316460:L187R;ENSP00000426346:L187R;ENSP00000425845:L187R;ENSP00000427114:L187R;ENSP00000442840:L197R	ENSP00000316460:L187R	L	-	2	0	FYB	39238260	0.153000	0.22777	0.000000	0.03702	0.664000	0.39144	0.479000	0.22228	-0.918000	0.03808	0.533000	0.62120	CTT	FYB	-	NULL	ENSG00000082074		0.493	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	37	0.00	0	A	NM_001465		39202503	39202503	-1	no_errors	ENST00000540520	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.001	C
GABBR1	2550	genome.wustl.edu	37	6	29588977	29588977	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:29588977G>A	ENST00000377034.4	-	11	1559	c.1224C>T	c.(1222-1224)atC>atT	p.I408I	GABBR1_ENST00000376977.3_Silent_p.I408I|GABBR1_ENST00000355973.3_Silent_p.I291I|GABBR1_ENST00000377016.4_Silent_p.I346I|GABBR1_ENST00000377012.4_Silent_p.I291I	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	408					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CTGTGCAGTTGATAGAAGGGT	0.493																																						dbGAP											0													169.0	134.0	147.0					6																	29588977		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1224C>T	6.37:g.29588977G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.I408	ENST00000377034.4	37	c.1224	CCDS4663.1	6																																																																																			GABBR1	-	pfam_ANF_lig-bd_rcpt	ENSG00000204681		0.493	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	49	0.00	0	G			29588977	29588977	-1	no_errors	ENST00000377034	ensembl	human	known	69_37n	silent	56	18.84	13	SNP	1.000	A
GABBR1	2550	genome.wustl.edu	37	6	29589964	29589964	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:29589964C>A	ENST00000377034.4	-	9	1317	c.982G>T	c.(982-984)Gaa>Taa	p.E328*	GABBR1_ENST00000376977.3_Nonsense_Mutation_p.E328*|GABBR1_ENST00000355973.3_Nonsense_Mutation_p.E211*|GABBR1_ENST00000377016.4_Nonsense_Mutation_p.E266*|GABBR1_ENST00000377012.4_Nonsense_Mutation_p.E211*	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	328					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TTCACTCGTTCCTCCAGGTCG	0.488																																						dbGAP											0													54.0	54.0	54.0					6																	29589964		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.982G>T	6.37:g.29589964C>A	ENSP00000366233:p.Glu328*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.E328*	ENST00000377034.4	37	c.982	CCDS4663.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.425267	0.97555	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	.	.	.	4.39	4.39	0.52855	.	0.109676	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-33.5689	14.5091	0.67772	0.0:1.0:0.0:0.0	.	.	.	.	X	211;328;266;211;328	.	ENSP00000348248:E211X	E	-	1	0	GABBR1	29697943	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.716000	0.47219	2.295000	0.77249	0.544000	0.68410	GAA	GABBR1	-	pfam_ANF_lig-bd_rcpt	ENSG00000204681		0.488	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	56	0.00	0	C			29589964	29589964	-1	no_errors	ENST00000377034	ensembl	human	known	69_37n	nonsense	49	28.99	20	SNP	1.000	A
GALNT12	79695	genome.wustl.edu	37	9	101594189	101594189	+	Silent	SNP	A	A	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr9:101594189A>T	ENST00000375011.3	+	4	867	c.867A>T	c.(865-867)acA>acT	p.T289T		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	289					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				CGTGGCACACAGTTCCTGAGA	0.537																																						dbGAP											0													70.0	58.0	62.0					9																	101594189		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.867A>T	9.37:g.101594189A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.T289	ENST00000375011.3	37	c.867	CCDS6737.1	9																																																																																			GALNT12	-	pfam_Glyco_trans_2	ENSG00000119514		0.537	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT12	HGNC	protein_coding	OTTHUMT00000053382.1	43	0.00	0	A	NM_024642		101594189	101594189	+1	no_errors	ENST00000375011	ensembl	human	known	69_37n	silent	31	31.11	14	SNP	0.021	T
GAPVD1	26130	genome.wustl.edu	37	9	128122822	128122822	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr9:128122822G>C	ENST00000495955.1	+	27	4404	c.4114G>C	c.(4114-4116)Gca>Cca	p.A1372P	GAPVD1_ENST00000265956.4_Missense_Mutation_p.A1346P|GAPVD1_ENST00000312123.9_Missense_Mutation_p.A1333P|GAPVD1_ENST00000470056.1_Missense_Mutation_p.A1327P|GAPVD1_ENST00000297933.6_Missense_Mutation_p.A1354P|GAPVD1_ENST00000394104.2_Missense_Mutation_p.A1372P|GAPVD1_ENST00000394083.2_Missense_Mutation_p.A1306P|GAPVD1_ENST00000394105.2_Missense_Mutation_p.A1381P			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1372	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TCTTCGAGAAGCACCATGGCC	0.473																																						dbGAP											0													116.0	103.0	108.0					9																	128122822		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.4114G>C	9.37:g.128122822G>C	ENSP00000419063:p.Ala1372Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	pfam_RasGAP,pfam_VPS9,superfamily_Rho_GTPase_activation_prot,smart_VPS9_subgr,pfscan_VPS9,pfscan_RasGAP	p.A1381P	ENST00000495955.1	37	c.4141		9	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828240	0.90955	.	.	ENSG00000165219	ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000297933;ENST00000312123;ENST00000438537	T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.66	5.66	0.87406	Vacuolar sorting protein 9 (1);	0.000000	0.85682	D	0.000000	T	0.54175	0.1842	L	0.58428	1.81	0.80722	D	1	P;P;D;D;P;D	0.71674	0.621;0.781;0.996;0.998;0.721;0.994	P;B;D;D;P;D	0.78314	0.525;0.358;0.989;0.989;0.756;0.991	T	0.52548	-0.8561	10	0.62326	D	0.03	.	18.7139	0.91668	0.0:0.0:1.0:0.0	.	1372;387;1327;1333;1354;1381	Q14C86;B3KTX2;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	GAPD1_HUMAN;.;.;.;.;.	P	1327;1381;1372;1346;1306;1372;1354;1333;65	ENSP00000419767:A1327P;ENSP00000377665:A1381P;ENSP00000377664:A1372P;ENSP00000265956:A1346P;ENSP00000377645:A1306P;ENSP00000419063:A1372P;ENSP00000297933:A1354P;ENSP00000309582:A1333P	ENSP00000265956:A1346P	A	+	1	0	GAPVD1	127162643	1.000000	0.71417	0.999000	0.59377	0.844000	0.47949	9.476000	0.97823	2.664000	0.90586	0.591000	0.81541	GCA	GAPVD1	-	pfscan_VPS9	ENSG00000165219		0.473	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1	69	0.00	0	G			128122822	128122822	+1	no_errors	ENST00000394105	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	1.000	C
GMEB2	26205	genome.wustl.edu	37	20	62226998	62226998	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr20:62226998G>C	ENST00000266068.1	-	5	1062	c.584C>G	c.(583-585)gCc>gGc	p.A195G	GMEB2_ENST00000370069.1_Missense_Mutation_p.A144G|GMEB2_ENST00000370077.1_Missense_Mutation_p.A195G			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	195					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			AATGTACTCGGCCGACGTGGG	0.642																																						dbGAP											0													55.0	47.0	50.0					20																	62226998		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.584C>G	20.37:g.62226998G>C	ENSP00000266068:p.Ala195Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Missense_Mutation	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Sig_transdc_His_kin_Hpt_dom,smart_SAND_dom,pfscan_SAND_dom	p.A195G	ENST00000266068.1	37	c.584	CCDS13528.1	20	.	.	.	.	.	.	.	.	.	.	G	2.067	-0.414012	0.04799	.	.	ENSG00000101216	ENST00000370069;ENST00000370077;ENST00000266068	T;T;T	0.63417	-0.04;0.55;0.55	4.49	3.5	0.40072	.	0.667732	0.14661	N	0.305986	T	0.34483	0.0899	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15464	-1.0436	10	0.22109	T	0.4	0.0276	12.7339	0.57212	0.0:0.1656:0.8344:0.0	.	195	Q9UKD1	GMEB2_HUMAN	G	144;195;195	ENSP00000359086:A144G;ENSP00000359094:A195G;ENSP00000266068:A195G	ENSP00000266068:A195G	A	-	2	0	GMEB2	61697442	0.159000	0.22864	0.047000	0.18901	0.169000	0.22640	2.613000	0.46351	0.961000	0.38030	0.563000	0.77884	GCC	GMEB2	-	NULL	ENSG00000101216		0.642	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMEB2	HGNC	protein_coding	OTTHUMT00000080166.1	24	0.00	0	G	NM_012384		62226998	62226998	-1	no_errors	ENST00000266068	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	0.000	C
GPR124	25960	genome.wustl.edu	37	8	37686409	37686409	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr8:37686409C>G	ENST00000412232.2	+	3	355	c.342C>G	c.(340-342)gaC>gaG	p.D114E	GPR124_ENST00000315215.7_Missense_Mutation_p.D114E	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	114					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TCTGCAGGGACCTGAGGAACA	0.672																																						dbGAP											0													71.0	68.0	69.0					8																	37686409		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.342C>G	8.37:g.37686409C>G	ENSP00000406367:p.Asp114Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like	p.D114E	ENST00000412232.2	37	c.342	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565617	0.65651	.	.	ENSG00000020181	ENST00000428068;ENST00000416514;ENST00000315215;ENST00000412232	T;T;T	0.60797	0.16;0.16;0.16	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.68403	0.2997	L	0.48986	1.54	0.49299	D	0.999774	D;D	0.76494	0.999;0.998	D;D	0.87578	0.998;0.976	T	0.69975	-0.4999	10	0.72032	D	0.01	-50.6306	9.6787	0.40056	0.0:0.7824:0.1424:0.0752	.	114;114	Q96PE1-2;Q96PE1	.;GP124_HUMAN	E	72;107;114;114	ENSP00000400860:D72E;ENSP00000323508:D114E;ENSP00000406367:D114E	ENSP00000323508:D114E	D	+	3	2	GPR124	37805567	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	2.362000	0.44169	2.724000	0.93272	0.561000	0.74099	GAC	GPR124	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000020181		0.672	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	HGNC	protein_coding	OTTHUMT00000343331.2	62	0.00	0	C			37686409	37686409	+1	no_errors	ENST00000412232	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	G
HEATR4	399671	genome.wustl.edu	37	14	73945253	73945253	+	3'UTR	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:73945253G>T	ENST00000553558.1	-	0	3460				HEATR4_ENST00000560393.1_3'UTR|RP1-240K6.3_ENST00000515412.2_RNA|HEATR4_ENST00000334988.2_3'UTR|HEATR4_ENST00000566478.1_5'UTR	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		CAATTAAAAAGACCCAATGTG	0.383																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.*58C>A	14.37:g.73945253G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7V9|E9KL41	RNA	SNP	-	NULL	ENST00000553558.1	37	NULL	CCDS9815.2	14																																																																																			HEATR4	-	-	ENSG00000187105		0.383	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEATR4	HGNC	protein_coding	OTTHUMT00000414422.2	45	0.00	0	G	NM_203309		73945253	73945253	-1	no_errors	ENST00000565094	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.002	T
HSD17B8	7923	genome.wustl.edu	37	6	33172845	33172845	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:33172845G>A	ENST00000374662.3	+	2	246	c.219G>A	c.(217-219)caG>caA	p.Q73Q	HSD17B8_ENST00000469186.1_3'UTR|MIR219-1_ENST00000362166.1_RNA	NM_014234.4	NP_055049.1	Q92506	DHB8_HUMAN	hydroxysteroid (17-beta) dehydrogenase 8	73					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|fatty acid biosynthetic process (GO:0006633)	mitochondrial envelope (GO:0005740)|mitochondrial matrix (GO:0005759)|plasma membrane (GO:0005886)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	9						CTGCCTTCCAGGCTGACGTGT	0.672																																						dbGAP											0													13.0	14.0	14.0					6																	33172845		1504	2708	4212	-	-	-	SO:0001819	synonymous_variant	0			D82061	CCDS4769.1	6p21.3	2011-09-14	2002-02-19	2002-02-22	ENSG00000204228	ENSG00000204228	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	3554	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 30C, member 1"""	601417	"""FabG (beta-ketoacyl-[acyl-carrier-protein] reductase, E coli) like (E. coli)"""	FABGL		8812499, 19027726	Standard	NM_014234		Approved	HKE6, D6S2245E, RING2, KE6, H2-KE6, SDR30C1	uc003odi.2	Q92506	OTTHUMG00000031117	ENST00000374662.3:c.219G>A	6.37:g.33172845G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLX7|Q5STP7|Q9UIQ1	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH,prints_ADH_insect	p.Q73	ENST00000374662.3	37	c.219	CCDS4769.1	6																																																																																			HSD17B8	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,smart_PKS/FAS_KR	ENSG00000204228		0.672	HSD17B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B8	HGNC	protein_coding	OTTHUMT00000076196.1	13	0.00	0	G	NM_014234		33172845	33172845	+1	no_errors	ENST00000374662	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	1.000	A
ITGAX	3687	genome.wustl.edu	37	16	31373987	31373987	+	Silent	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr16:31373987C>T	ENST00000268296.4	+	12	1393	c.1272C>T	c.(1270-1272)gcC>gcT	p.A424A	ITGAX_ENST00000562522.1_Silent_p.A424A	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	424					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TCCTGGGGGCCCCCCGCTACC	0.657																																						dbGAP											0													25.0	25.0	25.0					16																	31373987		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1272C>T	16.37:g.31373987C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.A424	ENST00000268296.4	37	c.1272	CCDS10711.1	16																																																																																			ITGAX	-	smart_Int_alpha_beta-p,prints_Integrin_alpha	ENSG00000140678		0.657	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	41	0.00	0	C	NM_000887		31373987	31373987	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	silent	51	10.53	6	SNP	0.992	T
ITGB7	3695	genome.wustl.edu	37	12	53587587	53587587	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr12:53587587C>G	ENST00000267082.5	-	11	1638	c.1407G>C	c.(1405-1407)gaG>gaC	p.E469D	ITGB7_ENST00000422257.3_Missense_Mutation_p.E469D|ITGB7_ENST00000550743.2_Missense_Mutation_p.E469D|ITGB7_ENST00000338737.4_Missense_Mutation_p.E469D	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	469					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCGTGTGCAACTCCACAATCA	0.587																																						dbGAP											0													87.0	77.0	80.0					12																	53587587		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.1407G>C	12.37:g.53587587C>G	ENSP00000267082:p.Glu469Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Plexin-like_fold,superfamily_Integrin_bsu_tail,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.E469D	ENST00000267082.5	37	c.1407	CCDS8849.1	12	.	.	.	.	.	.	.	.	.	.	C	9.176	1.022403	0.19433	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737	T;T;T	0.64085	-0.08;-0.08;-0.08	4.67	3.77	0.43336	Integrin beta subunit, N-terminal (2);	0.000000	0.41605	D	0.000842	T	0.34629	0.0904	N	0.13098	0.295	0.33075	D	0.535871	B	0.29232	0.238	B	0.24974	0.057	T	0.42172	-0.9467	10	0.05436	T	0.98	.	7.3123	0.26481	0.1673:0.7447:0.0:0.088	.	469	P26010	ITB7_HUMAN	D	469	ENSP00000408741:E469D;ENSP00000267082:E469D;ENSP00000345501:E469D	ENSP00000267082:E469D	E	-	3	2	ITGB7	51873854	0.152000	0.22762	0.993000	0.49108	0.667000	0.39255	0.531000	0.23052	1.318000	0.45170	0.655000	0.94253	GAG	ITGB7	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000139626		0.587	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB7	HGNC	protein_coding	OTTHUMT00000405821.2	30	0.00	0	C			53587587	53587587	-1	no_errors	ENST00000267082	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.861	G
KAT7	11143	genome.wustl.edu	37	17	47893207	47893207	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr17:47893207G>C	ENST00000259021.4	+	8	1175	c.895G>C	c.(895-897)Gaa>Caa	p.E299Q	KAT7_ENST00000454930.2_Missense_Mutation_p.E160Q|KAT7_ENST00000424009.2_Missense_Mutation_p.E269Q|KAT7_ENST00000513980.1_3'UTR|KAT7_ENST00000510819.1_Missense_Mutation_p.E130Q|KAT7_ENST00000509773.1_Missense_Mutation_p.E189Q|KAT7_ENST00000503935.2_Missense_Mutation_p.E143Q|KAT7_ENST00000435742.2_Missense_Mutation_p.E113Q	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	299					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										ACCTCTTTTAGAAAACCTGAC	0.448																																						dbGAP											0													101.0	101.0	101.0					17																	47893207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.895G>C	17.37:g.47893207G>C	ENSP00000259021:p.Glu299Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.E299Q	ENST00000259021.4	37	c.895	CCDS11554.1	17	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796762	0.70567	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.65923	0.2738	L	0.46157	1.445	0.80722	D	1	D;P;D;D;D;D	0.59357	0.965;0.915;0.967;0.985;0.984;0.974	P;B;P;P;P;P	0.56343	0.703;0.374;0.637;0.731;0.786;0.796	T	0.60414	-0.7268	9	0.30854	T	0.27	-19.8163	18.8697	0.92308	0.0:0.0:1.0:0.0	.	262;130;189;160;299;269	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251;G5E9K7	.;.;.;.;KAT7_HUMAN;.	Q	299;160;189;130;269;143;113	.	ENSP00000259021:E299Q	E	+	1	0	KAT7	45248206	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.750000	0.91623	2.788000	0.95919	0.650000	0.86243	GAA	KAT7	-	NULL	ENSG00000136504		0.448	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1	46	0.00	0	G	NM_007067		47893207	47893207	+1	no_errors	ENST00000259021	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	C
KIF12	113220	genome.wustl.edu	37	9	116860125	116860125	+	Intron	SNP	C	C	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr9:116860125C>A	ENST00000374118.3	-	3	199				KIF12_ENST00000473174.1_5'Flank	NM_138424.1	NP_612433.1	Q96FN5	KIF12_HUMAN	kinesin family member 12						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	17						agttcccaaacaatggctcat	0.478																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC010626	CCDS6801.1	9q33.1	2008-02-05			ENSG00000136883	ENSG00000136883		"""Kinesins"""	21495	protein-coding gene	gene with protein product		611278					Standard	NM_138424		Approved		uc004bif.3	Q96FN5	OTTHUMG00000020533	ENST00000374118.3:c.39-104G>T	9.37:g.116860125C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBE0	RNA	SNP	-	NULL	ENST00000374118.3	37	NULL	CCDS6801.1	9																																																																																			KIF12	-	-	ENSG00000136883		0.478	KIF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF12	HGNC	protein_coding	OTTHUMT00000053751.1	19	0.00	0	C	NM_138424		116860125	116860125	-1	no_errors	ENST00000491059	ensembl	human	known	69_37n	rna	12	50.00	12	SNP	0.000	A
KLK6	5653	genome.wustl.edu	37	19	51470541	51470541	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:51470541G>A	ENST00000376851.3	-	3	520	c.81C>T	c.(79-81)ccC>ccT	p.P27P	KLK6_ENST00000391808.1_5'UTR|KLK6_ENST00000424910.2_Intron|KLK6_ENST00000594641.1_Silent_p.P27P|CTB-147C22.9_ENST00000594512.1_RNA|KLK6_ENST00000310157.2_Silent_p.P27P|KLK6_ENST00000376853.4_Silent_p.P27P	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	27	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		TCTTGTCGCAGGGTCCGCCAT	0.582																																						dbGAP											0													135.0	119.0	124.0					19																	51470541		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.81C>T	19.37:g.51470541G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJA1|A8MW09|Q6H301	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.P27	ENST00000376851.3	37	c.81	CCDS12811.1	19																																																																																			KLK6	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000167755		0.582	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLK6	HGNC	protein_coding	OTTHUMT00000465060.1	45	0.00	0	G	NM_002774		51470541	51470541	-1	no_errors	ENST00000310157	ensembl	human	known	69_37n	silent	36	30.77	16	SNP	0.149	A
KRT222	125113	genome.wustl.edu	37	17	38818225	38818227	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr17:38818225_38818227delCTT	ENST00000476049.1	-	2	207_209	c.166_168delAAG	c.(166-168)aagdel	p.K56del	KRT222_ENST00000394052.3_In_Frame_Del_p.K56del			Q8N1A0	KT222_HUMAN	keratin 222	56						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(2)|skin(1)	15						GTCGGGCCTCCTTGAGTTCTGCT	0.463																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK092967	CCDS11371.1	17q21.2	2013-06-25	2009-08-25	2009-08-25	ENSG00000213424	ENSG00000213424		"""-"""	28695	protein-coding gene	gene with protein product			"""keratin 222 pseudogene"""	KRT222P		16831889	Standard	NM_152349		Approved	KA21, MGC45562	uc002hvc.2	Q8N1A0	OTTHUMG00000133374	ENST00000476049.1:c.166_168delAAG	17.37:g.38818225_38818227delCTT	ENSP00000463483:p.Lys56del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z368	In_Frame_Del	DEL	pfam_F,prints_Keratin_I	p.K56in_frame_del	ENST00000476049.1	37	c.168_166	CCDS11371.1	17																																																																																			KRT222	-	pfam_F	ENSG00000213424		0.463	KRT222-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	KRT222	HGNC	protein_coding	OTTHUMT00000447539.1	52	0.00	0	CTT	NM_152349		38818225	38818227	-1	no_errors	ENST00000394052	ensembl	human	known	69_37n	in_frame_del	81	10.99	10	DEL	0.965:0.999:1.000	-
L1CAM	3897	genome.wustl.edu	37	X	153133854	153133854	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chrX:153133854T>G	ENST00000370060.1	-	14	1795	c.1606A>C	c.(1606-1608)Acc>Ccc	p.T536P	L1CAM_ENST00000361981.3_Missense_Mutation_p.T531P|L1CAM_ENST00000543994.1_Missense_Mutation_p.T538P|L1CAM_ENST00000370057.3_Missense_Mutation_p.T536P|L1CAM_ENST00000361699.4_Missense_Mutation_p.T536P|L1CAM_ENST00000370055.1_Missense_Mutation_p.T531P|L1CAM_ENST00000538883.1_Missense_Mutation_p.T538P	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	536	Ig-like C2-type 6.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACGTGAAGGTCACCCTGGAA	0.597																																						dbGAP											0													146.0	151.0	149.0					X																	153133854		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1606A>C	X.37:g.153133854T>G	ENSP00000359077:p.Thr536Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T538P	ENST00000370060.1	37	c.1612	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	T	18.04	3.535436	0.64972	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	5.62	5.62	0.85841	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.520724	0.17111	N	0.186607	T	0.82162	0.4977	M	0.89030	3	0.43874	D	0.99648	P;P;P	0.45715	0.836;0.854;0.865	P;P;P	0.58130	0.59;0.833;0.713	D	0.83818	0.0245	10	0.56958	D	0.05	.	12.6654	0.56840	0.0:0.0:0.0:1.0	.	531;536;536	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	P	536;538;536;538;531;531;536	ENSP00000359077:T536P;ENSP00000438430:T538P;ENSP00000359074:T536P;ENSP00000439645:T538P;ENSP00000354712:T531P;ENSP00000359072:T531P;ENSP00000355380:T536P	ENSP00000355380:T536P	T	-	1	0	L1CAM	152787048	0.693000	0.27728	0.294000	0.24946	0.924000	0.55760	0.849000	0.27723	1.898000	0.54952	0.430000	0.28490	ACC	L1CAM	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000198910		0.597	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	100	0.00	0	T	NM_024003		153133854	153133854	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	missense	70	14.63	12	SNP	0.877	G
LAMB4	22798	genome.wustl.edu	37	7	107717415	107717415	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:107717415C>T	ENST00000388781.3	-	17	2181	c.2098G>A	c.(2098-2100)Gct>Act	p.A700T	LAMB4_ENST00000205386.4_Missense_Mutation_p.A700T|LAMB4_ENST00000414450.2_Missense_Mutation_p.A700T|LAMB4_ENST00000388780.3_Missense_Mutation_p.A700T|LAMB4_ENST00000418464.1_Missense_Mutation_p.A700T	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	700	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.A700S(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TGTGAATGAGCGTGGGACTCT	0.418																																						dbGAP											1	Substitution - Missense(1)	lung(1)											111.0	113.0	113.0					7																	107717415		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2098G>A	7.37:g.107717415C>T	ENSP00000373433:p.Ala700Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.A700T	ENST00000388781.3	37	c.2098	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	1.440	-0.567907	0.03910	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.32272	1.47;1.47;1.5;1.46;1.53	5.3	0.207	0.15214	Laminin IV (1);	0.387023	0.21811	N	0.068775	T	0.18257	0.0438	L	0.39020	1.185	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.29852	-0.9998	10	0.15066	T	0.55	.	7.1886	0.25813	0.1063:0.4809:0.0:0.4128	.	700	A4D0S4	LAMB4_HUMAN	T	700	ENSP00000205386:A700T;ENSP00000373433:A700T;ENSP00000373432:A700T;ENSP00000402353:A700T;ENSP00000402265:A700T	ENSP00000205386:A700T	A	-	1	0	LAMB4	107504651	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	-0.572000	0.05881	-0.383000	0.07858	-1.851000	0.00568	GCT	LAMB4	-	pfscan_Laminin_IV	ENSG00000091128		0.418	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	28	0.00	0	C	XM_209857		107717415	107717415	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.001	T
LARGE	9215	genome.wustl.edu	37	22	33670434	33670434	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr22:33670434G>A	ENST00000354992.2	-	16	2821	c.2250C>T	c.(2248-2250)ctC>ctT	p.L750L	LARGE_ENST00000397394.2_Silent_p.L750L|LARGE_ENST00000437602.2_Silent_p.L701L|LARGE_ENST00000337431.2_Silent_p.L698L|LARGE_ENST00000402320.1_Silent_p.L698L|LARGE_ENST00000452586.2_Silent_p.L549L	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	750					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				TCTCGGCTGTGAGATATTTCA	0.547											OREG0026497	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(70;397 1175 4573 19089 45288)	dbGAP											0													124.0	114.0	117.0					22																	33670434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.2250C>T	22.37:g.33670434G>A		Somatic	841	WXS	Illumina GAIIx	Phase_IV	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Silent	SNP	pfam_Glyco_trans_8	p.L750	ENST00000354992.2	37	c.2250	CCDS13912.1	22																																																																																			LARGE	-	NULL	ENSG00000133424		0.547	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	78	0.00	0	G	NM_133642		33670434	33670434	-1	no_errors	ENST00000354992	ensembl	human	known	69_37n	silent	87	16.35	17	SNP	1.000	A
LINC00665	100506930	genome.wustl.edu	37	19	36821306	36821306	+	lincRNA	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:36821306C>G	ENST00000591372.1	-	0	291				AC092296.1_ENST00000410798.1_RNA					long intergenic non-protein coding RNA 665																		agctggctgtccttccggggg	0.607																																						dbGAP											0																																										-	-	-			0			AI282277, BC041949, BU071001		19q13.12	2012-10-12			ENSG00000232677	ENSG00000232677		"""Long non-coding RNAs"""	44323	non-coding RNA	RNA, long non-coding							Standard	NR_038278		Approved		uc002odu.2		OTTHUMG00000048145		19.37:g.36821306C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000591372.1	37	NULL		19																																																																																			LINC00665	-	-	ENSG00000232677		0.607	LINC00665-003	KNOWN	basic	lincRNA	LINC00665	HGNC	lincRNA	OTTHUMT00000109550.2	76	0.00	0	C	NR_038278		36821306	36821306	-1	no_errors	ENST00000412740	ensembl	human	known	69_37n	rna	74	10.84	9	SNP	0.307	G
LILRA1	11024	genome.wustl.edu	37	19	55107704	55107704	+	Missense_Mutation	SNP	G	G	T	rs145746243	byFrequency	TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:55107704G>T	ENST00000251372.3	+	7	1191	c.1009G>T	c.(1009-1011)Gcc>Tcc	p.A337S	LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000453777.1_Intron|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	337	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CCCCACGGTGGCCTCAGGAGA	0.622																																						dbGAP											0													71.0	69.0	70.0					19																	55107704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1009G>T	19.37:g.55107704G>T	ENSP00000251372:p.Ala337Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O75018|Q3MJA6	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.A337S	ENST00000251372.3	37	c.1009	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506700	0.26949	.	.	ENSG00000104974	ENST00000251372	T	0.02863	4.13	2.15	-4.31	0.03698	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.222630	0.06156	N	0.675110	T	0.06826	0.0174	M	0.78285	2.405	0.09310	N	1	P	0.37233	0.588	P	0.47941	0.562	T	0.25710	-1.0124	10	0.32370	T	0.25	.	2.8424	0.05533	0.3079:0.0:0.2311:0.461	.	337	O75019	LIRA1_HUMAN	S	337	ENSP00000251372:A337S	ENSP00000251372:A337S	A	+	1	0	LILRA1	59799516	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-3.927000	0.00332	-1.182000	0.02727	0.205000	0.17691	GCC	LILRA1	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000104974		0.622	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	HGNC	protein_coding	OTTHUMT00000140807.2	69	0.00	0	G	NM_006863		55107704	55107704	+1	no_errors	ENST00000251372	ensembl	human	known	69_37n	missense	69	22.47	20	SNP	0.000	T
LRIG2	9860	genome.wustl.edu	37	1	113642885	113642885	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:113642885C>G	ENST00000361127.5	+	10	1423	c.1225C>G	c.(1225-1227)Ctt>Gtt	p.L409V		NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	409					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		ATTCATTGGTCTTGAATCCCT	0.313																																						dbGAP											0													85.0	90.0	89.0					1																	113642885		2203	4293	6496	-	-	-	SO:0001583	missense	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1225C>G	1.37:g.113642885C>G	ENSP00000355396:p.Leu409Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSN2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L409V	ENST00000361127.5	37	c.1225	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	c	23.7	4.444881	0.83993	.	.	ENSG00000198799	ENST00000361127	T	0.33865	1.39	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.62527	0.2435	M	0.86573	2.825	0.58432	D	0.999999	D	0.69078	0.997	D	0.75020	0.985	T	0.67150	-0.5743	10	0.66056	D	0.02	.	20.0763	0.97746	0.0:1.0:0.0:0.0	.	409	O94898	LRIG2_HUMAN	V	409	ENSP00000355396:L409V	ENSP00000355396:L409V	L	+	1	0	LRIG2	113444408	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.549000	0.67261	2.756000	0.94617	0.655000	0.94253	CTT	LRIG2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000198799		0.313	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	52	0.00	0	C	NM_014813		113642885	113642885	+1	no_errors	ENST00000361127	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	1.000	G
NRROS	375387	genome.wustl.edu	37	3	196388546	196388546	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr3:196388546C>G	ENST00000328557.4	+	3	2235	c.2032C>G	c.(2032-2034)Ctg>Gtg	p.L678V		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	678					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TAAGAAGCCTCTGCTTCAGGT	0.587																																						dbGAP											0													90.0	95.0	93.0					3																	196388546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.2032C>G	3.37:g.196388546C>G	ENSP00000328625:p.Leu678Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L678V	ENST00000328557.4	37	c.2032	CCDS3319.1	3	.	.	.	.	.	.	.	.	.	.	C	14.91	2.674947	0.47781	.	.	ENSG00000174004	ENST00000328557	T	0.53206	0.63	5.66	2.89	0.33648	.	0.221342	0.37483	N	0.002074	T	0.60274	0.2256	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	P	0.61070	0.883	T	0.61257	-0.7099	10	0.72032	D	0.01	.	10.9181	0.47148	0.0:0.8014:0.0:0.1986	.	678	Q86YC3	LRC33_HUMAN	V	678	ENSP00000328625:L678V	ENSP00000328625:L678V	L	+	1	2	LRRC33	197872943	0.954000	0.32549	0.980000	0.43619	0.964000	0.63967	0.973000	0.29422	0.413000	0.25759	-0.157000	0.13467	CTG	LRRC33	-	NULL	ENSG00000174004		0.587	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC33	HGNC	protein_coding	OTTHUMT00000340676.1	52	0.00	0	C	NM_198565		196388546	196388546	+1	no_errors	ENST00000328557	ensembl	human	known	69_37n	missense	45	23.73	14	SNP	0.783	G
MARC1	64757	genome.wustl.edu	37	1	220970115	220970115	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:220970115C>G	ENST00000366910.5	+	3	766	c.580C>G	c.(580-582)Caa>Gaa	p.Q194E	MARC1_ENST00000496110.1_3'UTR	NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	194	MOSC. {ECO:0000255|PROSITE- ProRule:PRU00670}.				detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										ACGTCCTCATCAAATAGCAGA	0.597																																						dbGAP											0													74.0	51.0	59.0					1																	220970115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.580C>G	1.37:g.220970115C>G	ENSP00000355877:p.Gln194Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Nonsense_Mutation	SNP	pfam_MoCF_Sase_C,pfam_MOSC_N,superfamily_Pyrv_Knase-like_insert_dom	p.S102*	ENST00000366910.5	37	c.305	CCDS1526.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.038|0.038	-1.298692|-1.298692	0.01364|0.01364	.|.	.|.	ENSG00000186205|ENSG00000186205	ENST00000366910;ENST00000443880|ENST00000407981	T;T|.	0.34472|.	2.45;1.36|.	4.82|4.82	1.67|1.67	0.24075|0.24075	Pyruvate kinase-like, insert domain (1);Molybdenum cofactor sulfurase, C-terminal (1);|.	0.685684|.	0.13193|.	N|.	0.406565|.	T|.	0.22085|.	0.0532|.	N|N	0.16790|0.16790	0.44|0.44	0.09310|0.09310	N|N	1|1	B;B|.	0.14012|.	0.003;0.009|.	B;B|.	0.14023|.	0.004;0.01|.	T|.	0.24905|.	-1.0147|.	10|.	0.02654|.	T|.	1|.	-11.707|-11.707	8.0053|8.0053	0.30321|0.30321	0.3425:0.4047:0.2528:0.0|0.3425:0.4047:0.2528:0.0	.|.	194;194|.	Q5VT66-2;Q5VT66|.	.;MOSC1_HUMAN|.	E|X	194;7|102	ENSP00000355877:Q194E;ENSP00000409634:Q7E|.	ENSP00000355877:Q194E|.	Q|S	+|+	1|2	0|0	MOSC1|MOSC1	219036738|219036738	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.029000|0.029000	0.11900|0.11900	-0.012000|-0.012000	0.12699|0.12699	0.408000|0.408000	0.25621|0.25621	0.655000|0.655000	0.94253|0.94253	CAA|TCA	MARC1	-	superfamily_Pyrv_Knase-like_insert_dom	ENSG00000186205		0.597	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARC1	HGNC	protein_coding	OTTHUMT00000090904.1	30	0.00	0	C	NM_022746		220970115	220970115	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000407981	ensembl	human	putative	69_37n	nonsense	38	20.83	10	SNP	0.000	G
MEP1B	4225	genome.wustl.edu	37	18	29797730	29797730	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr18:29797730G>A	ENST00000269202.6	+	14	1940	c.1893G>A	c.(1891-1893)caG>caA	p.Q631Q	MEP1B_ENST00000581447.1_Silent_p.Q631Q	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	631	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCAGGTGCCAGTCAGGGGAAG	0.438																																						dbGAP											0													96.0	97.0	97.0					18																	29797730		1997	4174	6171	-	-	-	SO:0001819	synonymous_variant	0			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.1893G>A	18.37:g.29797730G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM35|B9EGL6|Q670J1	Silent	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MAM_dom,pfam_MATH,superfamily_TRAF-like,superfamily_ConA-like_lec_gl,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.Q631	ENST00000269202.6	37	c.1893	CCDS45846.1	18																																																																																			MEP1B	-	pirsf_Pept_M12A_Meprin,pfscan_EG-like_dom	ENSG00000141434		0.438	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MEP1B	HGNC	protein_coding	OTTHUMT00000447755.1	53	0.00	0	G	NM_005925		29797730	29797730	+1	no_errors	ENST00000269202	ensembl	human	known	69_37n	silent	20	41.18	14	SNP	0.000	A
WBSCR17	64409	genome.wustl.edu	37	7	70772665	70772665	+	Intron	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:70772665C>G	ENST00000333538.5	+	2	872				MIR3914-1_ENST00000584357.1_RNA|AC079398.1_ENST00000581603.1_RNA|WBSCR17_ENST00000498380.2_Intron	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17						protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CAGTAGAGTTCCTACTCAACT	0.448																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.239-27871C>G	7.37:g.70772665C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFV9|Q9NTA8	RNA	SNP	-	NULL	ENST00000333538.5	37	NULL	CCDS5540.1	7																																																																																			MIR3914-1	-	-	ENSG00000265878		0.448	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3914-1	HGNC	protein_coding	OTTHUMT00000252006.1	49	0.00	0	C	NM_022479		70772665	70772665	-1	no_errors	ENST00000584357	ensembl	human	known	69_37n	rna	30	37.50	18	SNP	0.000	G
MSLNL	401827	genome.wustl.edu	37	16	824291	824291	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr16:824291G>A	ENST00000442466.1	-	8	811	c.812C>T	c.(811-813)tCg>tTg	p.S271L	MSLNL_ENST00000293892.3_Missense_Mutation_p.S622L			Q96KJ4	MSLNL_HUMAN	mesothelin-like	271					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						CACCTGGCACGAAGCCACCAC	0.697																																						dbGAP											0													16.0	18.0	17.0					16																	824291		2058	4162	6220	-	-	-	SO:0001583	missense	0					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.812C>T	16.37:g.824291G>A	ENSP00000415767:p.Ser271Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mesothelin	p.S622L	ENST00000442466.1	37	c.1865		16	.	.	.	.	.	.	.	.	.	.	G	11.07	1.529656	0.27387	.	.	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	T;T;T	0.17370	2.28;2.28;2.28	3.64	1.45	0.22620	.	1.107710	0.06861	N	0.799114	T	0.13030	0.0316	.	.	.	0.09310	N	1	B	0.28801	0.223	B	0.22753	0.041	T	0.32079	-0.9920	9	0.56958	D	0.05	-0.336	7.9827	0.30194	0.0:0.0:0.5547:0.4453	.	271	Q96KJ4	MSLNL_HUMAN	L	321;271;622	ENSP00000441381:S321L;ENSP00000415767:S271L;ENSP00000293892:S622L	ENSP00000293892:S622L	S	-	2	0	MSLNL	764292	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.503000	0.06383	0.429000	0.26202	0.549000	0.68633	TCG	MSLNL	-	pfam_Mesothelin	ENSG00000162006		0.697	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	HGNC	protein_coding		19	0.00	0	G	NM_001025190		824291	824291	-1	no_errors	ENST00000293892	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	0.000	A
MSTO1	55154	genome.wustl.edu	37	1	155584255	155584255	+	3'UTR	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:155584255G>C	ENST00000245564.2	+	0	1928				MSTO1_ENST00000538143.1_Intron|MSTO1_ENST00000452804.2_Intron|MSTO1_ENST00000483734.1_3'UTR|MSTO1_ENST00000368341.4_3'UTR	NM_001256532.1|NM_001256533.1|NM_018116.3	NP_001243461.1|NP_001243462.1|NP_060586.2	Q9BUK6	MSTO1_HUMAN	misato 1, mitochondrial distribution and morphology regulator						mitochondrion distribution (GO:0048311)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)				breast(2)|endometrium(1)|lung(3)|skin(1)	7	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)					AAAAAGTAGAGAAAGGAGCTG	0.418																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BX537684	CCDS1114.1	1q22	2013-08-21	2013-08-21		ENSG00000125459	ENSG00000125459			29678	protein-coding gene	gene with protein product			"""misato homolog 1 (Drosophila)"""			16545939, 17349998	Standard	NM_018116		Approved	FLJ10504, LST005, MST, misato	uc001fky.4	Q9BUK6	OTTHUMG00000014014	ENST00000245564.2:c.*191G>C	1.37:g.155584255G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GR8|Q5CZ69|Q5T717|Q68CT6|Q7LBZ8|Q7Z3M7|Q7Z558|Q8TE05|Q9NQX2|Q9NVU4	RNA	SNP	-	NULL	ENST00000245564.2	37	NULL	CCDS1114.1	1																																																																																			MSTO1	-	-	ENSG00000125459		0.418	MSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSTO1	HGNC	protein_coding	OTTHUMT00000039408.1	14	0.00	0	G	NM_018116		155584255	155584255	+1	no_errors	ENST00000483734	ensembl	human	known	69_37n	rna	16	33.33	8	SNP	0.000	C
MUC5AC	4586	genome.wustl.edu	37	11	1162114	1162114	+	Splice_Site	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr11:1162114G>A	ENST00000356191.2	+	19	1696	c.1696G>A	c.(1696-1698)Ggt>Agt	p.G566S				P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming	569	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		GCAGACCTGCGGTAAGAGGGC	0.657																																						dbGAP											0													21.0	20.0	20.0					11																	1162114		867	1983	2850	-	-	-	SO:0001630	splice_region_variant	0			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000356191.2:c.1696+1G>A	11.37:g.1162114G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out	p.G569S	ENST00000356191.2	37	c.1705		11	.	.	.	.	.	.	.	.	.	.	g	28.0	4.882272	0.91740	.	.	ENSG00000215182	ENST00000534821;ENST00000356191	D;D	0.98732	-5.1;-5.1	3.18	3.18	0.36537	.	.	.	.	.	D	0.99471	0.9812	H	0.98629	4.285	.	.	.	D	0.89917	1.0	D	0.97110	1.0	D	0.97807	1.0248	8	0.87932	D	0	.	14.933	0.70933	0.0:0.0:1.0:0.0	.	569	A7Y9J9	.	S	569;566	ENSP00000435591:G569S;ENSP00000348519:G566S	ENSP00000348519:G566S	G	+	1	0	MUC5AC	1152114	1.000000	0.71417	0.723000	0.30687	0.278000	0.26855	6.151000	0.71806	1.821000	0.53095	0.282000	0.19409	GGT	MUC5AC	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000215182		0.657	MUC5AC-201	KNOWN	basic|appris_candidate	protein_coding	MUC5AC	HGNC	protein_coding		68	0.00	0	G	XM_001130382	Missense_Mutation	1162114	1162114	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000534821	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	0.999	A
MYH2	4620	genome.wustl.edu	37	17	10440751	10440751	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr17:10440751A>G	ENST00000245503.5	-	16	2080	c.1696T>C	c.(1696-1698)Ttc>Ctc	p.F566L	MYH2_ENST00000532183.2_Missense_Mutation_p.F566L|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.F566L|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	566	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GGCTTCTGGAAGTTGGCAGAC	0.527																																						dbGAP											0													127.0	125.0	126.0					17																	10440751		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1696T>C	17.37:g.10440751A>G	ENSP00000245503:p.Phe566Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F566L	ENST00000245503.5	37	c.1696	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	A	21.3	4.123967	0.77436	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.89415	-2.51;-2.51;-2.51	5.61	5.61	0.85477	Myosin head, motor domain (2);	0.000000	0.41500	U	0.000876	D	0.93171	0.7825	M	0.63208	1.945	0.58432	D	0.999997	D;B	0.56521	0.976;0.108	D;B	0.78314	0.991;0.386	D	0.93123	0.6526	10	0.49607	T	0.09	.	14.9835	0.71330	1.0:0.0:0.0:0.0	.	566;566	Q567P6;Q9UKX2	.;MYH2_HUMAN	L	566	ENSP00000433944:F566L;ENSP00000245503:F566L;ENSP00000380367:F566L	ENSP00000245503:F566L	F	-	1	0	MYH2	10381476	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.284000	0.95882	2.143000	0.66587	0.533000	0.62120	TTC	MYH2	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000125414		0.527	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	67	0.00	0	A	NM_017534		10440751	10440751	-1	no_errors	ENST00000245503	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	1.000	G
MYT1L	23040	genome.wustl.edu	37	2	1820415	1820415	+	Intron	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:1820415G>C	ENST00000399161.2	-	22	3828				MYT1L_ENST00000428368.2_Intron|MYT1L_ENST00000471668.1_5'UTR|MYT1L_ENST00000407844.1_Intron	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CGCATAAAATGAGGATGGACA	0.522																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3081-7476C>G	2.37:g.1820415G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	RNA	SNP	-	NULL	ENST00000399161.2	37	NULL		2																																																																																			MYT1L	-	-	ENSG00000186487		0.522	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	70	0.00	0	G	NM_015025		1820415	1820415	-1	no_errors	ENST00000471668	ensembl	human	known	69_37n	rna	62	23.46	19	SNP	0.000	C
NAA35	60560	genome.wustl.edu	37	9	88581515	88581515	+	Intron	SNP	C	C	T	rs114210731	byFrequency	TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr9:88581515C>T	ENST00000361671.5	+	6	649				NAA35_ENST00000376040.1_Intron	NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit						negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						TCTCAGATTTCGCGGCTCCTA	0.303													C|||	21	0.00419329	0.0151	0.0014	5008	,	,		15826	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.516+4420C>T	9.37:g.88581515C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZE6|Q9H631|Q9H703	Missense_Mutation	SNP	pfam_NatC_AcTrfase_Mak10	p.S174L	ENST00000361671.5	37	c.521	CCDS6673.1	9	7	0.003205128205128205	7	0.014227642276422764	0	0.0	0	0.0	0	0.0	C	5.932	0.355968	0.11239	.	.	ENSG00000135040	ENST00000416045	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	T	0.31765	0.0807	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35968	-0.9767	4	0.87932	D	0	.	.	.	.	.	.	.	.	L	174	.	ENSP00000399595:S174L	S	+	2	0	NAA35	87771335	0.028000	0.19301	0.017000	0.16124	0.095000	0.18619	0.298000	0.19120	0.300000	0.22699	0.305000	0.20034	TCG	NAA35	-	NULL	ENSG00000135040		0.303	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA35	HGNC	protein_coding	OTTHUMT00000052906.1	76	0.00	0	C	NM_024635		88581515	88581515	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000416045	ensembl	human	known	69_37n	missense	34	41.38	24	SNP	0.020	T
NADK	65220	genome.wustl.edu	37	1	1689962	1689962	+	Intron	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:1689962C>T	ENST00000341426.5	-	4	485				NADK_ENST00000492768.1_Intron|NADK_ENST00000378625.1_Intron|NADK_ENST00000344463.4_Intron|NADK_ENST00000341991.3_Intron|NADK_ENST00000342348.5_Silent_p.R3R	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase						ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		GAACACGCGGCCGCCCCATCG	0.582																																						dbGAP											0													35.0	33.0	33.0					1																	1689962		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.264-1213G>A	1.37:g.1689962C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Silent	SNP	pfam_polyP/ATP_NADK_prd,superfamily_ATP-NAD_kinase_PpnK-typ	p.R3	ENST00000341426.5	37	c.9	CCDS30565.1	1																																																																																			NADK	-	NULL	ENSG00000008130		0.582	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	NADK	HGNC	protein_coding	OTTHUMT00000002769.1	70	0.00	0	C	NM_023018		1689962	1689962	-1	no_errors	ENST00000342348	ensembl	human	known	69_37n	silent	54	16.92	11	SNP	0.001	T
NCOA5	57727	genome.wustl.edu	37	20	44693855	44693855	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr20:44693855C>G	ENST00000290231.6	-	6	806	c.642G>C	c.(640-642)gaG>gaC	p.E214D		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				GCCCCACAGACTCAGCATAGT	0.483																																						dbGAP											0													144.0	127.0	133.0					20																	44693855		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.642G>C	20.37:g.44693855C>G	ENSP00000290231:p.Glu214Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	superfamily_Anticodon-bd	p.E214D	ENST00000290231.6	37	c.642	CCDS13392.1	20	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753102	0.69648	.	.	ENSG00000124160	ENST00000290231	T	0.56444	0.46	5.38	-2.52	0.06346	Anticodon-binding (2);	0.093865	0.64402	D	0.000001	T	0.67107	0.2858	M	0.73598	2.24	0.54753	D	0.999989	P	0.45672	0.864	D	0.64776	0.929	T	0.70000	-0.4992	10	0.56958	D	0.05	-15.3634	14.2672	0.66126	0.0:0.773:0.0:0.227	.	214	Q9HCD5	NCOA5_HUMAN	D	214	ENSP00000290231:E214D	ENSP00000290231:E214D	E	-	3	2	NCOA5	44127262	0.999000	0.42202	0.992000	0.48379	0.944000	0.59088	0.612000	0.24283	-0.322000	0.08615	-0.379000	0.06801	GAG	NCOA5	-	superfamily_Anticodon-bd	ENSG00000124160		0.483	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA5	HGNC	protein_coding	OTTHUMT00000079559.1	47	0.00	0	C	NM_020967		44693855	44693855	-1	no_errors	ENST00000290231	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.997	G
NEB	4703	genome.wustl.edu	37	2	152506758	152506758	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:152506758T>A	ENST00000172853.10	-	54	7510	c.7363A>T	c.(7363-7365)Aag>Tag	p.K2455*	NEB_ENST00000397345.3_Nonsense_Mutation_p.K2455*|NEB_ENST00000604864.1_Nonsense_Mutation_p.K2455*|NEB_ENST00000603639.1_Nonsense_Mutation_p.K2455*|NEB_ENST00000409198.1_Nonsense_Mutation_p.K2455*|NEB_ENST00000427231.2_Nonsense_Mutation_p.K2455*			P20929	NEBU_HUMAN	nebulin	2455					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTGGTGAACTTGTTTCTGTCT	0.423																																						dbGAP											0													143.0	137.0	139.0					2																	152506758		1920	4131	6051	-	-	-	SO:0001587	stop_gained	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7363A>T	2.37:g.152506758T>A	ENSP00000172853:p.Lys2455*	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Nonsense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.K2455*	ENST00000172853.10	37	c.7363		2	.	.	.	.	.	.	.	.	.	.	T	49	16.046789	0.99852	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	.	.	.	5.22	4.06	0.47325	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5279	0.50591	0.1342:0.0:0.0:0.8658	.	.	.	.	X	2455	.	ENSP00000172853:K2455X	K	-	1	0	NEB	152215004	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	6.226000	0.72277	0.826000	0.34661	0.528000	0.53228	AAG	NEB	-	pfscan_Nebulin_35r-motif	ENSG00000183091		0.423	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		43	0.00	0	T	NM_004543		152506758	152506758	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	nonsense	41	19.61	10	SNP	1.000	A
NFATC4	4776	genome.wustl.edu	37	14	24847040	24847040	+	3'UTR	SNP	T	T	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:24847040T>A	ENST00000250373.4	+	0	2979				NFATC4_ENST00000539237.2_3'UTR|NFATC4_ENST00000556759.1_3'UTR|NFATC4_ENST00000413692.2_3'UTR|NFATC4_ENST00000555802.1_3'UTR|NFATC4_ENST00000554591.1_3'UTR|NFATC4_ENST00000553708.1_3'UTR|NFATC4_ENST00000557451.1_3'UTR|NFATC4_ENST00000422617.3_3'UTR|NFATC4_ENST00000555167.1_3'UTR|NFATC4_ENST00000555453.1_3'UTR|NFATC4_ENST00000424781.2_3'UTR|NFATC4_ENST00000554050.1_3'UTR|NFATC4_ENST00000555393.1_3'UTR	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4						cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		AGCTTCTGTCTGTCTCACTGT	0.657																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.*129T>A	14.37:g.24847040T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	RNA	SNP	-	NULL	ENST00000250373.4	37	NULL	CCDS9629.1	14																																																																																			NFATC4	-	-	ENSG00000100968		0.657	NFATC4-001	KNOWN	basic|CCDS	protein_coding	NFATC4	HGNC	protein_coding	OTTHUMT00000073206.6	14	0.00	0	T	NM_004554		24847040	24847040	+1	no_errors	ENST00000555821	ensembl	human	putative	69_37n	rna	21	22.22	6	SNP	0.000	A
NNMT	4837	genome.wustl.edu	37	11	114168854	114168854	+	Silent	SNP	C	C	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr11:114168854C>A	ENST00000535401.1	+	4	600	c.336C>A	c.(334-336)acC>acA	p.T112T	NNMT_ENST00000299964.3_Silent_p.T112T|NNMT_ENST00000541754.1_5'UTR|NNMT_ENST00000545255.1_5'Flank|RP11-64D24.2_ENST00000544925.1_RNA|NNMT_ENST00000542647.1_5'UTR			P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	112					methylation (GO:0032259)|organ regeneration (GO:0031100)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	nicotinamide N-methyltransferase activity (GO:0008112)			kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	CAGTGGTGACCTATGTGTGTG	0.498																																						dbGAP											0													112.0	114.0	113.0					11																	114168854		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			U08021	CCDS8368.1	11q23.1	2007-08-15					2.1.1.1		7861	protein-coding gene	gene with protein product		600008				8575745	Standard	NM_006169		Approved		uc001pos.1	P40261		ENST00000535401.1:c.336C>A	11.37:g.114168854C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.T112	ENST00000535401.1	37	c.336	CCDS8368.1	11																																																																																			NNMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	ENSG00000166741		0.498	NNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNMT	HGNC	protein_coding	OTTHUMT00000398951.1	93	0.00	0	C	NM_006169		114168854	114168854	+1	no_errors	ENST00000299964	ensembl	human	known	69_37n	silent	48	17.24	10	SNP	0.808	A
NPY2R	4887	genome.wustl.edu	37	4	156136013	156136013	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:156136013A>C	ENST00000329476.3	+	2	1411	c.922A>C	c.(922-924)Aca>Cca	p.T308P	NPY2R_ENST00000506608.1_Missense_Mutation_p.T308P	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	308					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	ACTCATCTTCACAGTGTTCCA	0.537																																						dbGAP											0													121.0	95.0	103.0					4																	156136013		2203	4300	6503	-	-	-	SO:0001583	missense	0			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.922A>C	4.37:g.156136013A>C	ENSP00000332591:p.Thr308Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_NPY2_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.T308P	ENST00000329476.3	37	c.922	CCDS3791.1	4	.	.	.	.	.	.	.	.	.	.	A	12.32	1.901228	0.33535	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.54675	0.56;0.56	5.86	4.66	0.58398	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.62600	0.2441	L	0.39326	1.205	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.60949	-0.7161	10	0.42905	T	0.14	.	12.4965	0.55931	0.8603:0.1397:0.0:0.0	.	308	P49146	NPY2R_HUMAN	P	308	ENSP00000332591:T308P;ENSP00000426366:T308P	ENSP00000332591:T308P	T	+	1	0	NPY2R	156355463	1.000000	0.71417	0.971000	0.41717	0.112000	0.19704	7.306000	0.78905	1.020000	0.39573	-0.332000	0.08345	ACA	NPY2R	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000185149		0.537	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY2R	HGNC	protein_coding	OTTHUMT00000365128.1	31	0.00	0	A	NM_000910		156136013	156136013	+1	no_errors	ENST00000329476	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	1.000	C
NRG2	9542	genome.wustl.edu	37	5	139422059	139422059	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr5:139422059T>G	ENST00000361474.1	-	1	820	c.596A>C	c.(595-597)gAg>gCg	p.E199A	NRG2_ENST00000545385.1_Missense_Mutation_p.E199A|NRG2_ENST00000358522.3_Missense_Mutation_p.E199A|NRG2_ENST00000394770.1_Missense_Mutation_p.E199A|NRG2_ENST00000289409.4_Missense_Mutation_p.E199A|NRG2_ENST00000289422.7_Missense_Mutation_p.E199A|NRG2_ENST00000541337.1_Missense_Mutation_p.E199A	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	199					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCGTGGGCTCCAGGAAAAA	0.592																																						dbGAP											0													29.0	31.0	30.0					5																	139422059		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.596A>C	5.37:g.139422059T>G	ENSP00000354910:p.Glu199Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_EG-like_dom,pfscan_Ig-like	p.E199A	ENST00000361474.1	37	c.596	CCDS4217.1	5	.	.	.	.	.	.	.	.	.	.	T	18.37	3.609775	0.66558	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000289409;ENST00000358522;ENST00000544729;ENST00000378238	T;T;T;T;T;T;T;T	0.75050	-0.57;-0.69;-0.66;-0.69;-0.73;-0.9;-0.7;-0.73	4.25	4.25	0.50352	.	0.105157	0.36234	U	0.002711	T	0.75095	0.3803	L	0.46157	1.445	0.45914	D	0.998752	B;P;D;P	0.60575	0.355;0.801;0.988;0.874	B;B;P;P	0.53062	0.226;0.344;0.717;0.546	T	0.76231	-0.3035	10	0.51188	T	0.08	-7.7811	11.6055	0.51029	0.0:0.0:0.0:1.0	.	199;199;199;199	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	A	199;199;199;199;199;199;199;199;107;199	ENSP00000444235:E199A;ENSP00000289422:E199A;ENSP00000354910:E199A;ENSP00000438753:E199A;ENSP00000378251:E199A;ENSP00000289409:E199A;ENSP00000351323:E199A;ENSP00000367483:E199A	ENSP00000289409:E199A	E	-	2	0	NRG2	139402243	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.055000	0.76656	1.564000	0.49628	0.254000	0.18369	GAG	NRG2	-	NULL	ENSG00000158458		0.592	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	HGNC	protein_coding	OTTHUMT00000251340.1	51	0.00	0	T	NM_013982		139422059	139422059	-1	no_errors	ENST00000545385	ensembl	human	known	69_37n	missense	54	27.03	20	SNP	1.000	G
NUP62	23636	genome.wustl.edu	37	19	50412334	50412334	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:50412334G>A	ENST00000596217.1	-	2	2618	c.731C>T	c.(730-732)aCc>aTc	p.T244I	IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000422090.2_Missense_Mutation_p.T244I|NUP62_ENST00000413454.1_Missense_Mutation_p.T244I|NUP62_ENST00000597723.1_Missense_Mutation_p.T244I|NUP62_ENST00000352066.3_Missense_Mutation_p.T244I|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000597029.1_Missense_Mutation_p.T244I|NUP62_ENST00000600583.1_5'Flank			P37198	NUP62_HUMAN	nucleoporin 62kDa	244	15 X 9 AA approximate repeats.|Ala-rich.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GCCCGCTGTGGTCACAGGGGT	0.622																																						dbGAP											0													85.0	82.0	83.0					19																	50412334		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.731C>T	19.37:g.50412334G>A	ENSP00000471191:p.Thr244Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	pfam_Nucleoporin_NSP1_C	p.T244I	ENST00000596217.1	37	c.731	CCDS12788.1	19	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199840	0.79015	.	.	ENSG00000213024	ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.44881	0.91;0.91;0.91	5.33	5.33	0.75918	Nucleoporin, NSP1-like, C-terminal (1);	0.404420	0.21660	U	0.071038	T	0.54334	0.1852	M	0.66939	2.045	0.30695	N	0.750894	D	0.53619	0.961	P	0.52758	0.708	T	0.58132	-0.7690	9	.	.	.	-17.521	15.2442	0.73493	0.0:0.0:1.0:0.0	.	244	P37198	NUP62_HUMAN	I	244	ENSP00000305503:T244I;ENSP00000407331:T244I;ENSP00000387991:T244I	.	T	-	2	0	NUP62	55104146	0.999000	0.42202	0.602000	0.28890	0.006000	0.05464	4.951000	0.63610	2.876000	0.98609	0.655000	0.94253	ACC	NUP62	-	NULL	ENSG00000213024		0.622	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUP62	HGNC	protein_coding	OTTHUMT00000464991.1	128	0.00	0	G	NM_153719		50412334	50412334	-1	no_errors	ENST00000352066	ensembl	human	known	69_37n	missense	156	16.13	30	SNP	0.654	A
OR9Q1	219956	genome.wustl.edu	37	11	57947558	57947558	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr11:57947558C>G	ENST00000335397.3	+	3	958	c.642C>G	c.(640-642)atC>atG	p.I214M		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I214I(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				TGGTGGTGATCTTGGTGTCCT	0.512																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											234.0	192.0	206.0					11																	57947558		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.642C>G	11.37:g.57947558C>G	ENSP00000334934:p.Ile214Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAN3|Q96RA7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I214M	ENST00000335397.3	37	c.642	CCDS31543.1	11	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244086	0.39697	.	.	ENSG00000186509	ENST00000335397	T	0.00333	8.07	4.83	0.81	0.18732	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000108	T	0.00784	0.0026	M	0.91354	3.2	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.42032	-0.9475	10	0.87932	D	0	-33.475	5.5215	0.16936	0.0:0.3444:0.148:0.5076	.	214	Q8NGQ5	OR9Q1_HUMAN	M	214	ENSP00000334934:I214M	ENSP00000334934:I214M	I	+	3	3	OR9Q1	57704134	0.000000	0.05858	0.941000	0.38009	0.881000	0.50899	-2.122000	0.01321	0.060000	0.16281	0.484000	0.47621	ATC	OR9Q1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186509		0.512	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9Q1	HGNC	protein_coding	OTTHUMT00000394538.2	42	0.00	0	C	NM_001005212		57947558	57947558	+1	no_errors	ENST00000335397	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.002	G
OTX2	5015	genome.wustl.edu	37	14	57280105	57280105	+	5'Flank	SNP	A	A	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:57280105A>T	ENST00000555006.1	-	0	0				OTX2-AS1_ENST00000554358.1_RNA|OTX2-AS1_ENST00000534909.2_RNA|OTX2_ENST00000339475.5_5'Flank|OTX2_ENST00000554559.1_5'Flank|OTX2-AS1_ENST00000554725.1_RNA|OTX2-AS1_ENST00000554428.1_RNA			P32243	OTX2_HUMAN	orthodenticle homeobox 2						axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					AAAGTTGCAAAATTGCTCTTC	0.458																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338		14.37:g.57280105A>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	RNA	SNP	-	NULL	ENST00000555006.1	37	NULL	CCDS41960.1	14																																																																																			OTX2-AS1	-	-	ENSG00000248550		0.458	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OTX2-AS1	HGNC	protein_coding	OTTHUMT00000411522.1	24	0.00	0	A	NM_021728.		57280105	57280105	+1	no_errors	ENST00000534909	ensembl	human	known	69_37n	rna	17	37.04	10	SNP	1.000	T
P2RX2	22953	genome.wustl.edu	37	12	133198228	133198228	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr12:133198228C>G	ENST00000389110.3	+	11	1123	c.1086C>G	c.(1084-1086)atC>atG	p.I362M	P2RX2_ENST00000352418.4_Missense_Mutation_p.I290M|P2RX2_ENST00000343948.4_Missense_Mutation_p.I388M|P2RX2_ENST00000351222.4_Missense_Mutation_p.I270M|P2RX2_ENST00000350048.5_Missense_Mutation_p.I338M|P2RX2_ENST00000348800.5_Missense_Mutation_p.I362M|P2RX2_ENST00000449132.2_Missense_Mutation_p.I328M	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	362					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		GCGACTGGATCTTGCTAACAT	0.577																																						dbGAP											0													69.0	72.0	71.0					12																	133198228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.1086C>G	12.37:g.133198228C>G	ENSP00000373762:p.Ile362Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.I388M	ENST00000389110.3	37	c.1164	CCDS31931.1	12	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403435	0.62288	.	.	ENSG00000187848	ENST00000389110;ENST00000449132;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222;ENST00000348800	T;T;T;T;T;T;T	0.11821	3.2;3.2;2.74;3.2;3.2;3.2;3.2	4.74	2.88	0.33553	.	0.056843	0.64402	D	0.000001	T	0.31827	0.0809	M	0.78916	2.43	0.51767	D	0.99993	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.996;1.0;1.0;0.997;0.988	D;D;D;D;D;D;P	0.83275	0.996;0.961;0.92;0.991;0.988;0.952;0.886	T	0.02821	-1.1106	10	0.87932	D	0	-27.3203	4.8901	0.13722	0.0:0.576:0.157:0.2669	.	328;270;290;338;388;362;362	Q9UBL9-7;Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2	.;.;.;.;.;P2RX2_HUMAN;.	M	362;328;388;290;338;270;362	ENSP00000373762:I362M;ENSP00000405531:I328M;ENSP00000343339:I388M;ENSP00000341419:I290M;ENSP00000343904:I338M;ENSP00000344502:I270M;ENSP00000345095:I362M	ENSP00000343339:I388M	I	+	3	3	P2RX2	131708301	0.952000	0.32445	1.000000	0.80357	0.973000	0.67179	0.863000	0.27913	0.585000	0.29608	0.561000	0.74099	ATC	P2RX2	-	prints_P2X2_purnocptor	ENSG00000187848		0.577	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	HGNC	protein_coding	OTTHUMT00000397542.1	62	0.00	0	C			133198228	133198228	+1	no_errors	ENST00000343948	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	G
PCP2	126006	genome.wustl.edu	37	19	7696678	7696678	+	Missense_Mutation	SNP	C	C	A	rs112367781	byFrequency	TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:7696678C>A	ENST00000311069.5	-	4	598	c.308G>T	c.(307-309)cGa>cTa	p.R103L	PCP2_ENST00000598935.1_Missense_Mutation_p.R87L|CTD-3214H19.6_ENST00000601797.1_RNA|CTD-3214H19.4_ENST00000595866.1_Intron|PET100_ENST00000594797.1_3'UTR|XAB2_ENST00000534844.1_5'Flank|XAB2_ENST00000358368.4_5'Flank	NM_174895.1	NP_777555.1	Q8IVA1	PCP2_HUMAN	Purkinje cell protein 2	103					rhodopsin mediated signaling pathway (GO:0016056)	neuronal cell body (GO:0043025)	GTPase regulator activity (GO:0030695)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|urinary_tract(1)	2						GGTCCCAGCTCGTTTCTGTGC	0.677																																						dbGAP											0													60.0	56.0	57.0					19																	7696678		2200	4286	6486	-	-	-	SO:0001583	missense	0			BC025387	CCDS32893.1, CCDS62521.1	19p13.3	2008-02-05				ENSG00000174788			30209	protein-coding gene	gene with protein product						12477932	Standard	NM_174895		Approved	MGC41903, GPSM4	uc031rjd.1	Q8IVA1		ENST00000311069.5:c.308G>T	19.37:g.7696678C>A	ENSP00000310585:p.Arg103Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	M0R2R7|Q3KRG7	Missense_Mutation	SNP	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif	p.R103L	ENST00000311069.5	37	c.308	CCDS32893.1	19	.	.	.	.	.	.	.	.	.	.	C	15.92	2.976599	0.53720	.	.	ENSG00000174788	ENST00000311069	.	.	.	4.1	4.1	0.47936	.	0.814986	0.10211	N	0.702148	T	0.35998	0.0951	N	0.19112	0.55	0.39058	D	0.96047	D	0.53151	0.958	P	0.46339	0.513	T	0.04320	-1.0960	9	0.11182	T	0.66	-9.1186	11.7167	0.51657	0.0:1.0:0.0:0.0	.	103	Q8IVA1	PCP2_HUMAN	L	103	.	ENSP00000310585:R103L	R	-	2	0	PCP2	7602678	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.099000	0.57755	2.127000	0.65507	0.561000	0.74099	CGA	PCP2	-	NULL	ENSG00000174788		0.677	PCP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCP2	HGNC	protein_coding	OTTHUMT00000461026.2	49	0.00	0	C	XM_058956		7696678	7696678	-1	no_errors	ENST00000311069	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	A
PCSK2	5126	genome.wustl.edu	37	20	17446041	17446041	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr20:17446041G>A	ENST00000262545.2	+	11	1588	c.1273G>A	c.(1273-1275)Gag>Aag	p.E425K	PCSK2_ENST00000459871.1_3'UTR|PCSK2_ENST00000377899.1_Missense_Mutation_p.E406K|PCSK2_ENST00000536609.1_Missense_Mutation_p.E390K	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	425	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GCTTCACGACGAGGTCCATCA	0.567																																						dbGAP											0													97.0	70.0	79.0					20																	17446041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1273G>A	20.37:g.17446041G>A	ENSP00000262545:p.Glu425Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.E425K	ENST00000262545.2	37	c.1273	CCDS13125.1	20	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021429	0.35701	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.42131	0.98;0.98;0.98	5.61	5.61	0.85477	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.044374	0.85682	D	0.000000	T	0.27169	0.0666	N	0.12443	0.215	0.80722	D	1	P;P;P	0.44006	0.64;0.64;0.824	B;B;B	0.40199	0.322;0.227;0.202	T	0.06162	-1.0842	10	0.11794	T	0.64	-29.5204	18.2039	0.89848	0.0:0.0:1.0:0.0	.	390;406;425	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	K	406;425;390	ENSP00000367131:E406K;ENSP00000262545:E425K;ENSP00000437458:E390K	ENSP00000262545:E425K	E	+	1	0	PCSK2	17394041	1.000000	0.71417	0.410000	0.26471	0.431000	0.31685	9.461000	0.97646	2.643000	0.89663	0.555000	0.69702	GAG	PCSK2	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000125851		0.567	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	HGNC	protein_coding	OTTHUMT00000078120.2	40	0.00	0	G	NM_002594		17446041	17446041	+1	no_errors	ENST00000262545	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	1.000	A
PDS5B	23047	genome.wustl.edu	37	13	33249987	33249987	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:33249987G>T	ENST00000315596.10	+	9	1039	c.853G>T	c.(853-855)Gat>Tat	p.D285Y		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	285					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TTAGAGCAATGATAATGAGGA	0.393																																						dbGAP											0													81.0	81.0	81.0					13																	33249987		1834	4087	5921	-	-	-	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.853G>T	13.37:g.33249987G>T	ENSP00000313851:p.Asp285Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D285Y	ENST00000315596.10	37	c.853	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711969	0.89112	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	T	0.72615	-0.67	5.33	5.33	0.75918	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84275	0.5436	M	0.74881	2.28	0.80722	D	1	D;D	0.69078	0.997;0.991	D;P	0.70935	0.971;0.891	D	0.85724	0.1327	10	0.87932	D	0	-16.9923	19.3925	0.94590	0.0:0.0:1.0:0.0	.	285;285	Q9NTI5;Q9NTI5-3	PDS5B_HUMAN;.	Y	285	ENSP00000313851:D285Y	ENSP00000313851:D285Y	D	+	1	0	PDS5B	32147987	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.700000	0.98707	2.669000	0.90835	0.591000	0.81541	GAT	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.393	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	70	0.00	0	G	NM_015032		33249987	33249987	+1	no_errors	ENST00000315596	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	T
PIKFYVE	200576	genome.wustl.edu	37	2	209180075	209180075	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:209180075G>T	ENST00000264380.4	+	15	2143	c.1985G>T	c.(1984-1986)cGt>cTt	p.R662L		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	662					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						ATGGATATCCGTCAGTTTGTC	0.428																																						dbGAP											0													105.0	88.0	93.0					2																	209180075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.1985G>T	2.37:g.209180075G>T	ENSP00000264380:p.Arg662Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.R662L	ENST00000264380.4	37	c.1985	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.543203	0.96474	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.14266	2.52;2.52	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.41558	0.1164	M	0.75085	2.285	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.85130	0.997;0.992	T	0.07366	-1.0776	10	0.52906	T	0.07	-16.0638	20.1663	0.98152	0.0:0.0:1.0:0.0	.	662;606	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	L	662;238;606	ENSP00000264380:R662L;ENSP00000405736:R606L	ENSP00000264380:R662L	R	+	2	0	PIKFYVE	208888320	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.773000	0.95371	0.585000	0.79938	CGT	PIKFYVE	-	pfam_Cpn60/TCP-1	ENSG00000115020		0.428	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	41	0.00	0	G	NM_015040		209180075	209180075	+1	no_errors	ENST00000264380	ensembl	human	known	69_37n	missense	31	38.00	19	SNP	1.000	T
PITRM1	10531	genome.wustl.edu	37	10	3205939	3205939	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr10:3205939G>T	ENST00000224949.4	-	7	803	c.769C>A	c.(769-771)Cac>Aac	p.H257N	PITRM1_ENST00000451104.2_Missense_Mutation_p.H225N|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.H257N			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	257					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GGGTGATAGTGAGTGGCATGA	0.463																																						dbGAP											0													132.0	131.0	131.0					10																	3205939		1957	4153	6110	-	-	-	SO:0001583	missense	0			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.769C>A	10.37:g.3205939G>T	ENSP00000224949:p.His257Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	pfam_Peptidase_M16C_assoc,pfam_Peptidase_M16_C,pfam_Pept_M16_N,superfamily_Metalloenz_metal-bd	p.H257N	ENST00000224949.4	37	c.769	CCDS59208.1	10	.	.	.	.	.	.	.	.	.	.	g	19.38	3.816632	0.70912	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000451104	T;T;T	0.08984	3.03;3.03;3.03	5.66	5.66	0.87406	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.27027	0.0662	L	0.60455	1.87	0.58432	D	0.999999	P;P;D;D;D;D	0.89917	0.584;0.597;1.0;0.991;0.991;0.991	B;P;D;P;P;P	0.83275	0.145;0.456;0.996;0.893;0.893;0.893	T	0.00274	-1.1857	10	0.27785	T	0.31	.	19.8283	0.96626	0.0:0.0:1.0:0.0	.	250;225;257;257;257;250	E9PDX6;E7ES23;Q5JRX3-2;C9JSL2;Q5JRX3;B4DH07	.;.;.;.;PREP_HUMAN;.	N	257;250;257;225	ENSP00000224949:H257N;ENSP00000370377:H257N;ENSP00000401201:H225N	ENSP00000224949:H257N	H	-	1	0	PITRM1	3195939	1.000000	0.71417	0.672000	0.29872	0.142000	0.21351	9.158000	0.94723	2.694000	0.91930	0.650000	0.86243	CAC	PITRM1	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	ENSG00000107959		0.463	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	34	0.00	0	G			3205939	3205939	-1	no_errors	ENST00000380989	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
PLA2R1	22925	genome.wustl.edu	37	2	160798454	160798454	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:160798454G>A	ENST00000283243.7	-	30	4433	c.4227C>T	c.(4225-4227)gtC>gtT	p.V1409V	PLA2R1_ENST00000460710.1_5'UTR	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1409					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TGGCCACAATGACTATCAGTG	0.423																																						dbGAP											0													105.0	104.0	104.0					2																	160798454		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.4227C>T	2.37:g.160798454G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.V1409	ENST00000283243.7	37	c.4227	CCDS33309.1	2																																																																																			PLA2R1	-	NULL	ENSG00000153246		0.423	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1	59	0.00	0	G			160798454	160798454	-1	no_errors	ENST00000283243	ensembl	human	known	69_37n	silent	54	20.59	14	SNP	0.000	A
PARP10	84875	genome.wustl.edu	37	8	145049453	145049453	+	IGR	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr8:145049453G>A	ENST00000313028.7	-	0	3497				PLEC_ENST00000527096.1_Silent_p.L29L|PLEC_ENST00000436759.2_Silent_p.L29L|PLEC_ENST00000356346.3_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10						negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTCCAGGGCAGTGTGTCCCCA	0.672											OREG0019050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													36.0	46.0	43.0					8																	145049453		2080	4197	6277	-	-	-	SO:0001628	intergenic_variant	0			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7			8.37:g.145049453G>A		Somatic	1691	WXS	Illumina GAIIx	Phase_IV	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.L29	ENST00000313028.7	37	c.85	CCDS34960.1	8																																																																																			PLEC	-	NULL	ENSG00000178209		0.672	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383866.1	75	0.00	0	G	NM_032789		145049453	145049453	-1	no_errors	ENST00000436759	ensembl	human	known	69_37n	silent	93	13.08	14	SNP	0.815	A
PLXNB1	5364	genome.wustl.edu	37	3	48454480	48454480	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr3:48454480G>A	ENST00000358536.4	-	24	4903	c.4634C>T	c.(4633-4635)aCa>aTa	p.T1545I	PLXNB1_ENST00000456774.1_Missense_Mutation_p.T1362I|PLXNB1_ENST00000465117.1_5'Flank|PLXNB1_ENST00000296440.6_Missense_Mutation_p.T1545I|PLXNB1_ENST00000358459.4_Missense_Mutation_p.T1362I|PLXNB1_ENST00000448774.2_Missense_Mutation_p.T156I	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1545					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGCCACACCTGTGAATTCCTT	0.567																																						dbGAP											0													129.0	129.0	129.0					3																	48454480		2203	4300	6503	-	-	-	SO:0001583	missense	0			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.4634C>T	3.37:g.48454480G>A	ENSP00000351338:p.Thr1545Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.T1545I	ENST00000358536.4	37	c.4634	CCDS2765.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.126947	0.94429	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	T;T;T;T;T	0.11821	3.93;3.96;3.93;2.74;3.96	5.29	5.29	0.74685	.	0.055638	0.64402	D	0.000001	T	0.43188	0.1236	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.986;0.998	T	0.44081	-0.9351	10	0.66056	D	0.02	.	17.9905	0.89168	0.0:0.0:1.0:0.0	.	1545;1362	O43157;O43157-2	PLXB1_HUMAN;.	I	1545;1362;1545;156;1362	ENSP00000296440:T1545I;ENSP00000351242:T1362I;ENSP00000351338:T1545I;ENSP00000389320:T156I;ENSP00000414199:T1362I	ENSP00000296440:T1545I	T	-	2	0	PLXNB1	48429484	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.767000	0.98960	2.479000	0.83701	0.558000	0.71614	ACA	PLXNB1	-	NULL	ENSG00000164050		0.567	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	HGNC	protein_coding	OTTHUMT00000344454.1	61	0.00	0	G	NM_002673		48454480	48454480	-1	no_errors	ENST00000296440	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	1.000	A
POM121L9P	29774	genome.wustl.edu	37	22	24648470	24648470	+	RNA	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr22:24648470A>G	ENST00000414583.2	+	0	675					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CTGTCTCTTCAGGTCACACCC	0.592																																						dbGAP											0																																										-	-	-			0			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24648470A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000414583.2	37	NULL		22																																																																																			POM121L9P	-	-	ENSG00000128262		0.592	POM121L9P-001	KNOWN	basic	processed_transcript	POM121L9P	HGNC	pseudogene	OTTHUMT00000319991.1	34	0.00	0	A	NM_014549		24648470	24648470	+1	no_errors	ENST00000414583	ensembl	human	known	69_37n	rna	33	25.00	11	SNP	0.000	G
PON3	5446	genome.wustl.edu	37	7	94989421	94989421	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:94989421A>C	ENST00000265627.5	-	9	939	c.929T>G	c.(928-930)tTg>tGg	p.L310W	PON3_ENST00000451904.1_3'UTR|PON1_ENST00000542556.1_Intron|PON3_ENST00000427422.1_Missense_Mutation_p.C240G	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	310					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	CTTCTCAGACAAAACATTCTG	0.453																																						dbGAP											0													108.0	105.0	106.0					7																	94989421		2203	4300	6503	-	-	-	SO:0001583	missense	0			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.929T>G	7.37:g.94989421A>C	ENSP00000265627:p.Leu310Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2	p.L310W	ENST00000265627.5	37	c.929	CCDS5639.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.93|11.93	1.785208|1.785208	0.31593|0.31593	.|.	.|.	ENSG00000105852|ENSG00000105852	ENST00000427422|ENST00000265627	T|T	0.30448|0.45276	1.53|0.9	4.7|4.7	4.7|4.7	0.59300|0.59300	.|Six-bladed beta-propeller, TolB-like (1);	.|0.124028	.|0.51477	.|D	.|0.000097	T|T	0.53077|0.53077	0.1774|0.1774	M|M	0.81497|0.81497	2.545|2.545	0.09310|0.09310	N|N	1|1	.|D	.|0.61697	.|0.99	.|P	.|0.51135	.|0.66	T|T	0.55515|0.55515	-0.8129|-0.8129	7|10	0.72032|0.72032	D|D	0.01|0.01	-11.1719|-11.1719	9.6884|9.6884	0.40114|0.40114	0.845:0.0:0.0:0.155|0.845:0.0:0.0:0.155	.|.	.|310	.|Q15166	.|PON3_HUMAN	G|W	240|310	ENSP00000413276:C240G|ENSP00000265627:L310W	ENSP00000413276:C240G|ENSP00000265627:L310W	C|L	-|-	1|2	0|0	PON3|PON3	94827357|94827357	0.935000|0.935000	0.31712|0.31712	0.009000|0.009000	0.14445|0.14445	0.061000|0.061000	0.15899|0.15899	2.357000|2.357000	0.44125|0.44125	2.114000|2.114000	0.64651|0.64651	0.533000|0.533000	0.62120|0.62120	TGT|TTG	PON3	-	NULL	ENSG00000105852		0.453	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON3	HGNC	protein_coding	OTTHUMT00000333007.1	40	0.00	0	A	NM_000940		94989421	94989421	-1	no_errors	ENST00000265627	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.231	C
PPRC1	23082	genome.wustl.edu	37	10	103904474	103904474	+	Intron	SNP	C	C	T	rs114459340	byFrequency	TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr10:103904474C>T	ENST00000278070.2	+	8	3647				PPRC1_ENST00000489648.1_Intron|PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000370012.1_Intron	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TTCTGCCAAGCATGTTCCCCT	0.493													C|||	26	0.00519169	0.0182	0.0029	5008	,	,		19872	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3609-303C>T	10.37:g.103904474C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	RNA	SNP	-	NULL	ENST00000278070.2	37	NULL	CCDS7529.1	10																																																																																			PPRC1	-	-	ENSG00000148840		0.493	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1	11	0.00	0	C	NM_015062		103904474	103904474	+1	no_errors	ENST00000462933	ensembl	human	known	69_37n	rna	6	50.00	6	SNP	0.144	T
ARL6IP6	151188	genome.wustl.edu	37	2	153573970	153573970	+	5'Flank	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:153573970C>G	ENST00000326446.5	+	0	0				PRPF40A_ENST00000486100.1_5'UTR|PRPF40A_ENST00000410080.1_5'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						AAGAAGCGATCTGAGTGGCTG	0.672																																						dbGAP											0													32.0	37.0	35.0					2																	153573970		1955	4149	6104	-	-	-	SO:0001631	upstream_gene_variant	0			AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		2.37:g.153573970C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	NULL	p.Q2H	ENST00000326446.5	37	c.6	CCDS2197.1	2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319093	0.81469	.	.	ENSG00000196504	ENST00000448428	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	T	0.76219	0.3957	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78615	-0.2135	5	0.87932	D	0	2.7864	16.0488	0.80740	0.0:1.0:0.0:0.0	.	.	.	.	T	1	.	ENSP00000406924:R1T	R	-	2	0	PRPF40A	153282216	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.678000	0.46900	2.778000	0.95560	0.655000	0.94253	AGA	PRPF40A	-	NULL	ENSG00000196504		0.672	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF40A	HGNC	protein_coding	OTTHUMT00000254852.3	39	0.00	0	C	NM_152522		153573970	153573970	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000354363	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	G
PSEN2	5664	genome.wustl.edu	37	1	227069694	227069694	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:227069694G>A	ENST00000366783.3	+	4	522	c.86G>A	c.(85-87)cGc>cAc	p.R29H	PSEN2_ENST00000422240.2_Missense_Mutation_p.R29H|PSEN2_ENST00000472139.2_5'Flank|PSEN2_ENST00000391872.2_Missense_Mutation_p.R62H|PSEN2_ENST00000340188.4_Missense_Mutation_p.R29H|PSEN2_ENST00000366782.1_Missense_Mutation_p.R62H	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	29					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				CCCACGCCGCGCTCCTGCCAG	0.637																																						dbGAP											0													49.0	48.0	48.0					1																	227069694		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.86G>A	1.37:g.227069694G>A	ENSP00000355747:p.Arg29His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Pept_A22A_PS2,prints_Peptidase_A22A	p.R62H	ENST00000366783.3	37	c.185	CCDS1556.1	1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323175	0.41096	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000495488;ENST00000422240;ENST00000366782;ENST00000391872	D;D;D;D;D;D	0.99766	-6.66;-6.4;-5.01;-6.67;-6.69;-6.69	5.4	2.41	0.29592	.	0.269581	0.41712	N	0.000830	D	0.98432	0.9478	L	0.27053	0.805	0.32608	N	0.525033	P;D	0.64830	0.943;0.994	B;P	0.47981	0.411;0.563	D	0.99533	1.0961	9	.	.	.	.	3.1401	0.06452	0.1602:0.2473:0.4788:0.1137	.	29;29	A8K8D4;P49810	.;PSN2_HUMAN	H	29;29;29;29;62;62	ENSP00000355747:R29H;ENSP00000339860:R29H;ENSP00000429682:R29H;ENSP00000403737:R29H;ENSP00000355746:R62H;ENSP00000375745:R62H	.	R	+	2	0	PSEN2	225136317	0.961000	0.32948	0.075000	0.20258	0.824000	0.46624	2.717000	0.47227	0.223000	0.20920	0.655000	0.94253	CGC	PSEN2	-	NULL	ENSG00000143801		0.637	PSEN2-001	KNOWN	basic|CCDS	protein_coding	PSEN2	HGNC	protein_coding	OTTHUMT00000091539.1	59	0.00	0	G	NM_000447		227069694	227069694	+1	no_errors	ENST00000391872	ensembl	human	known	69_37n	missense	66	16.46	13	SNP	0.959	A
PSG8	440533	genome.wustl.edu	37	19	43258545	43258545	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:43258545A>G	ENST00000306511.4	-	5	1280	c.1183T>C	c.(1183-1185)Tct>Cct	p.S395P	PSG8_ENST00000404209.4_Missense_Mutation_p.S395P|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000401467.2_Missense_Mutation_p.S302P|PSG8_ENST00000406636.3_Missense_Mutation_p.S273P	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	395	Ig-like C2-type 3.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				TTACGAACAGAGCAAGCATAG	0.448																																						dbGAP											0													187.0	202.0	197.0					19																	43258545		2203	4296	6499	-	-	-	SO:0001583	missense	0			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1183T>C	19.37:g.43258545A>G	ENSP00000305005:p.Ser395Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S395P	ENST00000306511.4	37	c.1183	CCDS33037.1	19	.	.	.	.	.	.	.	.	.	.	N	10.53	1.376718	0.24857	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.13657	2.57;2.57;2.57;2.57	1.04	-2.09	0.07232	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32585	0.0834	M	0.90082	3.085	0.09310	N	1	D;D;D;D;D;D	0.71674	0.997;0.997;0.997;0.993;0.997;0.998	D;D;D;D;D;D	0.73708	0.947;0.953;0.974;0.934;0.968;0.981	T	0.18429	-1.0337	9	0.36615	T	0.2	.	1.3865	0.02241	0.3569:0.0:0.3026:0.3405	.	273;302;395;302;395;395	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	P	395;177;273;302;207;302;395	ENSP00000385869:S395P;ENSP00000385081:S273P;ENSP00000386090:S302P;ENSP00000305005:S395P	ENSP00000292109:S177P	S	-	1	0	PSG8	47950385	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.209000	0.17435	-0.383000	0.07858	0.248000	0.18094	TCT	PSG8	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000124467		0.448	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	165	0.00	0	A			43258545	43258545	-1	no_errors	ENST00000306511	ensembl	human	known	69_37n	missense	128	21.95	36	SNP	0.000	G
PSMB10	5699	genome.wustl.edu	37	16	67970636	67970636	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr16:67970636A>G	ENST00000358514.4	-	1	354	c.17T>C	c.(16-18)cTg>cCg	p.L6P	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	6					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	TCGGGGCTCCAGGGCTGGCTT	0.657																																						dbGAP											0													6.0	8.0	7.0					16																	67970636		2069	4128	6197	-	-	-	SO:0001583	missense	0			Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.17T>C	16.37:g.67970636A>G	ENSP00000351314:p.Leu6Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5J4|Q5U098	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_bsu_C,prints_Pept_T1A_subB	p.L6P	ENST00000358514.4	37	c.17	CCDS10853.1	16	.	.	.	.	.	.	.	.	.	.	A	15.87	2.959612	0.53400	.	.	ENSG00000205220	ENST00000358514	T	0.33865	1.39	5.44	-3.69	0.04450	.	1.682400	0.02897	N	0.134933	T	0.16085	0.0387	N	0.08118	0	0.09310	N	0.999998	B	0.06786	0.001	B	0.10450	0.005	T	0.10451	-1.0629	10	0.39692	T	0.17	-13.1229	0.4463	0.00494	0.3672:0.2438:0.1511:0.2379	.	6	P40306	PSB10_HUMAN	P	6	ENSP00000351314:L6P	ENSP00000351314:L6P	L	-	2	0	PSMB10	66528137	0.000000	0.05858	0.002000	0.10522	0.168000	0.22595	-0.270000	0.08584	-0.473000	0.06871	0.448000	0.29417	CTG	PSMB10	-	NULL	ENSG00000205220		0.657	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB10	HGNC	protein_coding	OTTHUMT00000268887.1	26	0.00	0	A	NM_002801		67970636	67970636	-1	no_errors	ENST00000358514	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.000	G
RAF1	5894	genome.wustl.edu	37	3	12626146	12626146	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr3:12626146G>A	ENST00000251849.4	-	17	2253	c.1814C>T	c.(1813-1815)tCc>tTc	p.S605F	RAF1_ENST00000442415.2_Missense_Mutation_p.S625F|RAF1_ENST00000542177.1_Missense_Mutation_p.S524F|RAF1_ENST00000534997.1_Missense_Mutation_p.S390F	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	605	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	CAGCTCAATGGAAGACAGGAT	0.532			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																													dbGAP		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	0													136.0	121.0	126.0					3																	12626146		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1814C>T	3.37:g.12626146G>A	ENSP00000251849:p.Ser605Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.S625F	ENST00000251849.4	37	c.1874	CCDS2612.1	3	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345181	0.82022	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.98914	-5.23;-5.23;-5.23;-5.23;-5.23	5.51	5.51	0.81932	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98501	0.9500	L	0.33624	1.015	0.80722	D	1	P;P;D	0.69078	0.93;0.87;0.997	P;P;D	0.77004	0.892;0.845;0.989	D	0.99907	1.1183	10	0.87932	D	0	.	19.61	0.95602	0.0:0.0:1.0:0.0	.	524;390;605	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	F	605;625;484;390;524	ENSP00000251849:S605F;ENSP00000401888:S625F;ENSP00000398591:S484F;ENSP00000441186:S390F;ENSP00000443567:S524F	ENSP00000251849:S605F	S	-	2	0	RAF1	12601146	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.084000	0.94076	2.868000	0.98415	0.557000	0.71058	TCC	RAF1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000132155		0.532	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAF1	HGNC	protein_coding	OTTHUMT00000252015.2	66	0.00	0	G	NM_002880		12626146	12626146	-1	no_errors	ENST00000442415	ensembl	human	known	69_37n	missense	50	16.67	10	SNP	1.000	A
RASSF2	9770	genome.wustl.edu	37	20	4764893	4764893	+	3'UTR	SNP	T	T	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr20:4764893T>G	ENST00000379400.3	-	0	1202				RASSF2_ENST00000379376.2_3'UTR|RASSF2_ENST00000478553.1_5'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2						bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						GTTCCTGGGGTGCCCAGATCC	0.562																																					Melanoma(158;1891 3343 50738)	dbGAP											0													98.0	87.0	91.0					20																	4764893		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.*26A>C	20.37:g.4764893T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	RNA	SNP	-	NULL	ENST00000379400.3	37	NULL	CCDS13083.1	20																																																																																			RASSF2	-	-	ENSG00000101265		0.562	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	HGNC	protein_coding	OTTHUMT00000077828.1	52	0.00	0	T	NM_014737		4764893	4764893	-1	no_errors	ENST00000474232	ensembl	human	known	69_37n	rna	22	40.54	15	SNP	0.000	G
RNF148	378925	genome.wustl.edu	37	7	122342418	122342418	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:122342418G>C	ENST00000434824.1	-	1	603	c.387C>G	c.(385-387)atC>atG	p.I129M	RNF148_ENST00000447240.1_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000449022.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	129	PA.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						GATAGTTGTAGATGATCACCC	0.478																																						dbGAP											0													277.0	270.0	273.0					7																	122342418		2011	4186	6197	-	-	-	SO:0001583	missense	0			BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.387C>G	7.37:g.122342418G>C	ENSP00000388207:p.Ile129Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X4|Q8N308	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I129M	ENST00000434824.1	37	c.387	CCDS47692.1	7	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983705	0.53827	.	.	ENSG00000235631	ENST00000434824	T	0.10099	2.91	4.95	4.95	0.65309	Protease-associated domain, PA (1);	.	.	.	.	T	0.40570	0.1122	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.48885	-0.8995	9	0.87932	D	0	.	13.1583	0.59531	0.0:0.0:0.84:0.16	.	129	Q8N7C7	RN148_HUMAN	M	129	ENSP00000388207:I129M	ENSP00000388207:I129M	I	-	3	3	RNF148	122129654	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.446000	0.52928	2.446000	0.82766	0.555000	0.69702	ATC	RNF148	-	pfam_Protease-assoc_domain	ENSG00000235631		0.478	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF148	HGNC	protein_coding	OTTHUMT00000347424.1	80	0.00	0	G	NM_198085		122342418	122342418	-1	no_errors	ENST00000434824	ensembl	human	known	69_37n	missense	52	26.76	19	SNP	1.000	C
RPA4	29935	genome.wustl.edu	37	X	96139695	96139695	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chrX:96139695G>T	ENST00000373040.3	+	1	789	c.386G>T	c.(385-387)gGt>gTt	p.G129V	DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373061.3_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	129					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						AAAGTGTTTGGTATCCTCAAA	0.468								Other identified genes with known or suspected DNA repair function																														dbGAP											0													121.0	104.0	110.0					X																	96139695		2203	4300	6503	-	-	-	SO:0001583	missense	0			U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.386G>T	X.37:g.96139695G>T	ENSP00000362131:p.Gly129Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY03	Missense_Mutation	SNP	pfam_RPA_C,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pirsf_RPA32	p.G129V	ENST00000373040.3	37	c.386	CCDS35345.1	X	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544615	0.45280	.	.	ENSG00000204086	ENST00000373040	D	0.82803	-1.65	3.66	3.66	0.41972	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	.	.	.	.	D	0.89203	0.6648	M	0.71206	2.165	0.20975	N	0.999818	D	0.89917	1.0	D	0.97110	1.0	T	0.78971	-0.1993	9	0.87932	D	0	-9.6312	9.9108	0.41403	0.0:0.0:1.0:0.0	.	129	Q13156	RFA4_HUMAN	V	129	ENSP00000362131:G129V	ENSP00000362131:G129V	G	+	2	0	RPA4	96026351	0.000000	0.05858	0.003000	0.11579	0.030000	0.12068	0.528000	0.23002	2.088000	0.63022	0.600000	0.82982	GGT	RPA4	-	pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pirsf_RPA32	ENSG00000204086		0.468	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA4	HGNC	protein_coding	OTTHUMT00000057464.1	35	0.00	0	G	NM_013347		96139695	96139695	+1	no_errors	ENST00000373040	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.003	T
RPS6KL1	83694	genome.wustl.edu	37	14	75386605	75386605	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:75386605C>G	ENST00000555647.1	-	4	620	c.333G>C	c.(331-333)gaG>gaC	p.E111D	RPS6KL1_ENST00000354625.2_Missense_Mutation_p.E111D|RPS6KL1_ENST00000358328.4_Missense_Mutation_p.E111D|RPS6KL1_ENST00000557413.1_Missense_Mutation_p.E111D|RPS6KL1_ENST00000554900.1_5'UTR			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	111	MIT.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		TGAAGATCTCCTCTGCCCGCC	0.637																																						dbGAP											0													41.0	40.0	40.0					14																	75386605		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.333G>C	14.37:g.75386605C>G	ENSP00000452027:p.Glu111Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_MIT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_MIT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E111D	ENST00000555647.1	37	c.333	CCDS9834.2	14	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127355	0.77549	.	.	ENSG00000198208	ENST00000555647;ENST00000354625;ENST00000557413;ENST00000358328	T;T;T;T	0.50277	1.19;0.75;1.19;1.19	4.99	1.1	0.20463	MIT (2);	0.000000	0.85682	D	0.000000	T	0.62221	0.2410	M	0.70787	2.145	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.996	T	0.61959	-0.6955	10	0.87932	D	0	-24.4498	8.8234	0.35041	0.0:0.6126:0.0:0.3874	.	111;111;111	Q9Y6S9;Q9Y6S9-4;Q9Y6S9-2	RPKL1_HUMAN;.;.	D	111	ENSP00000452027:E111D;ENSP00000346644:E111D;ENSP00000450567:E111D;ENSP00000351086:E111D	ENSP00000346644:E111D	E	-	3	2	RPS6KL1	74456358	0.994000	0.37717	0.995000	0.50966	0.992000	0.81027	0.349000	0.20055	0.309000	0.22966	-0.137000	0.14449	GAG	RPS6KL1	-	pfam_MIT,smart_MIT	ENSG00000198208		0.637	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPS6KL1	HGNC	protein_coding	OTTHUMT00000413732.1	29	0.00	0	C			75386605	75386605	-1	no_errors	ENST00000358328	ensembl	human	known	69_37n	missense	9	47.06	8	SNP	0.997	G
SCARB1	949	genome.wustl.edu	37	12	125298822	125298822	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr12:125298822G>A	ENST00000415380.2	-	4	681	c.556C>T	c.(556-558)Ccc>Tcc	p.P186S	SCARB1_ENST00000544327.1_Missense_Mutation_p.P132S|SCARB1_ENST00000540495.1_Missense_Mutation_p.P149S|SCARB1_ENST00000339570.5_Missense_Mutation_p.P186S|SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000261693.6_Missense_Mutation_p.P186S|SCARB1_ENST00000546215.1_Missense_Mutation_p.P186S|SCARB1_ENST00000376788.1_Missense_Mutation_p.P86S|SCARB1_ENST00000541205.1_Missense_Mutation_p.P145S			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	186					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	TTCACAAGGGGGTCCTTGTAG	0.522																																						dbGAP											0													164.0	141.0	149.0					12																	125298822		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.556C>T	12.37:g.125298822G>A	ENSP00000414979:p.Pro186Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	pfam_CD36,prints_CD36,prints_CD36_antigen	p.P186S	ENST00000415380.2	37	c.556		12	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012987	0.54468	.	.	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000546215;ENST00000541205;ENST00000544327;ENST00000540495	T;T;T;T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	5.25	5.25	0.73442	.	0.221107	0.46145	D	0.000305	D	0.87849	0.6281	M	0.86028	2.79	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.77557	0.986;0.99;0.986;0.986;0.977;0.977	D	0.88639	0.3174	10	0.51188	T	0.08	-43.4585	18.8709	0.92313	0.0:0.0:1.0:0.0	.	145;186;186;186;186;186	B3KW46;B7ZKQ9;B4E3I1;Q8WTV0;F8W8N0;Q8WTV0-2	.;.;.;SCRB1_HUMAN;.;.	S	186;186;186;86;186;145;132;149	ENSP00000343795:P186S;ENSP00000414979:P186S;ENSP00000261693:P186S;ENSP00000365984:P86S;ENSP00000442862:P186S;ENSP00000446107:P145S;ENSP00000444851:P132S;ENSP00000443286:P149S	ENSP00000261693:P186S	P	-	1	0	SCARB1	123864775	1.000000	0.71417	0.958000	0.39756	0.039000	0.13416	3.201000	0.51059	2.455000	0.83008	0.561000	0.74099	CCC	SCARB1	-	pfam_CD36	ENSG00000073060		0.522	SCARB1-006	KNOWN	basic	protein_coding	SCARB1	HGNC	protein_coding	OTTHUMT00000400165.1	68	0.00	0	G	NM_005505		125298822	125298822	-1	no_errors	ENST00000415380	ensembl	human	known	69_37n	missense	54	10.00	6	SNP	1.000	A
SCN10A	6336	genome.wustl.edu	37	3	38802827	38802827	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr3:38802827C>A	ENST00000449082.2	-	6	738	c.739G>T	c.(739-741)Gct>Tct	p.A247S		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	247					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GTCACATCAGCCAGTTTCTTC	0.498																																						dbGAP											0													90.0	83.0	85.0					3																	38802827		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.739G>T	3.37:g.38802827C>A	ENSP00000390600:p.Ala247Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.A247S	ENST00000449082.2	37	c.739	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	C	2.576	-0.298465	0.05532	.	.	ENSG00000185313	ENST00000449082	D	0.98474	-4.95	4.69	2.91	0.33838	Ion transport (1);	0.173246	0.50627	D	0.000119	D	0.94974	0.8374	L	0.28400	0.85	0.25444	N	0.988062	P	0.41366	0.747	P	0.45195	0.473	D	0.88681	0.3202	10	0.02654	T	1	.	11.0495	0.47878	0.0:0.849:0.0:0.151	.	247	Q9Y5Y9	SCNAA_HUMAN	S	247	ENSP00000390600:A247S	ENSP00000390600:A247S	A	-	1	0	SCN10A	38777831	0.000000	0.05858	0.939000	0.37840	0.844000	0.47949	-0.405000	0.07196	0.713000	0.32060	-0.136000	0.14681	GCT	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.498	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	58	0.00	0	C	NM_006514		38802827	38802827	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.838	A
SCUBE1	80274	genome.wustl.edu	37	22	43634956	43634956	+	Silent	SNP	C	C	T	rs577168343		TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr22:43634956C>T	ENST00000360835.4	-	7	858	c.732G>A	c.(730-732)acG>acA	p.T244T	Z82214.2_ENST00000419643.1_RNA|SCUBE1_ENST00000290460.7_Silent_p.T274T	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	244	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TGACTGCGCACGTCTCTGGGG	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19571	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													50.0	44.0	46.0					22																	43634956		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.732G>A	22.37:g.43634956C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R336	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd	p.V98M	ENST00000360835.4	37	c.292	CCDS14048.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.431|9.431	1.085542|1.085542	0.20390|0.20390	.|.	.|.	ENSG00000159307|ENSG00000159307	ENST00000381243|ENST00000449304	.|.	.|.	.|.	5.57|5.57	-10.1|-10.1	0.00402|0.00402	.|.	.|.	.|.	.|.	.|.	T|T	0.50154|0.50154	0.1599|0.1599	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.62044|0.62044	-0.6937|-0.6937	5|4	0.87932|.	D|.	0|.	.|.	11.5975|11.5975	0.50981|0.50981	0.0817:0.4818:0.0:0.4364|0.0817:0.4818:0.0:0.4364	.|.	.|.	.|.	.|.	H|M	37|98	.|.	ENSP00000370642:R37H|.	R|V	-|-	2|1	0|0	SCUBE1|SCUBE1	41964900|41964900	0.000000|0.000000	0.05858|0.05858	0.797000|0.797000	0.32132|0.32132	0.626000|0.626000	0.37791|0.37791	-2.963000|-2.963000	0.00671|0.00671	-1.550000|-1.550000	0.01708|0.01708	-0.302000|-0.302000	0.09304|0.09304	CGT|GTG	SCUBE1	-	smart_EGF-like	ENSG00000159307		0.582	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	50	0.00	0	C	NM_173050		43634956	43634956	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000449304	ensembl	human	known	69_37n	missense	56	30.00	24	SNP	0.601	T
SDC3	9672	genome.wustl.edu	37	1	31347230	31347230	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:31347230C>T	ENST00000339394.6	-	4	1250	c.1076G>A	c.(1075-1077)gGc>gAc	p.G359D	SDC3_ENST00000336798.7_Missense_Mutation_p.G301D|SDC3_ENST00000471567.1_5'Flank	NM_014654.3	NP_055469.3	O75056	SDC3_HUMAN	syndecan 3	359					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		GTCCAGGAGGCCAGGGCCCGG	0.642																																						dbGAP											0													54.0	60.0	58.0					1																	31347230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF248634	CCDS30661.1	1p35.2	2013-09-19	2007-02-15		ENSG00000162512	ENSG00000162512		"""Proteoglycans / Cell Surface : Syndecans"""	10660	protein-coding gene	gene with protein product	"""syndecan proteoglycan 3"""	186357	"""syndecan 3 (N-syndecan)"""			1556152, 11527150	Standard	NM_014654		Approved	N-syndecan, SYND3	uc001bse.2	O75056	OTTHUMG00000043646	ENST00000339394.6:c.1076G>A	1.37:g.31347230C>T	ENSP00000344468:p.Gly359Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1Z6|Q5T1Z7|Q96CT3|Q96PR8	Missense_Mutation	SNP	pfam_Syndecan,smart_Neurexin-like	p.G359D	ENST00000339394.6	37	c.1076	CCDS30661.1	1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661283	0.67700	.	.	ENSG00000162512	ENST00000336798;ENST00000339394	T;T	0.23147	1.92;1.96	4.84	3.91	0.45181	.	0.178854	0.38005	N	0.001848	T	0.12987	0.0315	N	0.11560	0.145	0.51233	D	0.999919	B;B	0.22276	0.067;0.035	B;B	0.25506	0.044;0.061	T	0.07616	-1.0763	10	0.08381	T	0.77	-14.9186	13.5211	0.61568	0.0:0.923:0.0:0.077	.	359;301	O75056;D3DPN2	SDC3_HUMAN;.	D	301;359	ENSP00000338346:G301D;ENSP00000344468:G359D	ENSP00000338346:G301D	G	-	2	0	SDC3	31119817	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	2.649000	0.46656	2.535000	0.85469	0.563000	0.77884	GGC	SDC3	-	pfam_Syndecan	ENSG00000162512		0.642	SDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC3	HGNC	protein_coding	OTTHUMT00000102017.1	62	0.00	0	C	NM_014654		31347230	31347230	-1	no_errors	ENST00000339394	ensembl	human	known	69_37n	missense	36	33.33	18	SNP	1.000	T
SEC24B	10427	genome.wustl.edu	37	4	110454767	110454767	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:110454767G>T	ENST00000265175.5	+	22	3569	c.3514G>T	c.(3514-3516)Ggg>Tgg	p.G1172W	SEC24B_ENST00000399100.2_Missense_Mutation_p.G1137W|SEC24B_ENST00000504968.2_Missense_Mutation_p.G1202W	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	1172					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CATTTGGGTTGGGAAAGGCTG	0.299																																						dbGAP											0													181.0	165.0	170.0					4																	110454767		1807	4065	5872	-	-	-	SO:0001583	missense	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.3514G>T	4.37:g.110454767G>T	ENSP00000265175:p.Gly1172Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.G1172W	ENST00000265175.5	37	c.3514	CCDS47124.1	4	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541836	0.85917	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	D;D;D	0.81579	-1.51;-1.51;-1.51	5.98	5.98	0.97165	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	D	0.93446	0.7909	H	0.95294	3.65	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.94414	0.7634	10	0.87932	D	0	-17.546	20.4581	0.99154	0.0:0.0:1.0:0.0	.	1086;771;1202;1137;1172	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	W	1202;1137;1172	ENSP00000428564:G1202W;ENSP00000382051:G1137W;ENSP00000265175:G1172W	ENSP00000265175:G1172W	G	+	1	0	SEC24B	110674216	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.183000	0.77697	2.835000	0.97688	0.650000	0.86243	GGG	SEC24B	-	pfam_Gelsolin_dom	ENSG00000138802		0.299	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2	51	0.00	0	G			110454767	110454767	+1	no_errors	ENST00000265175	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	T
SERINC2	347735	genome.wustl.edu	37	1	31905815	31905815	+	Splice_Site	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:31905815C>T	ENST00000373709.3	+	9	1165	c.1015C>T	c.(1015-1017)Ctg>Ttg	p.L339L	SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000536859.1_Splice_Site_p.L343L|SERINC2_ENST00000373710.1_Splice_Site_p.L348L|SERINC2_ENST00000536384.1_Splice_Site_p.L343L	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	339					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CCCCTGCAGTCTGCGCTCCTC	0.612																																						dbGAP											0													22.0	19.0	20.0					1																	31905815		2200	4292	6492	-	-	-	SO:0001630	splice_region_variant	0			AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.1014-1C>T	1.37:g.31905815C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Silent	SNP	pfam_TMS_TDE	p.L348	ENST00000373709.3	37	c.1042	CCDS30662.1	1																																																																																			SERINC2	-	pfam_TMS_TDE	ENSG00000168528		0.612	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC2	HGNC	protein_coding	OTTHUMT00000010680.1	50	0.00	0	C	NM_018565	Silent	31905815	31905815	+1	no_errors	ENST00000373710	ensembl	human	known	69_37n	silent	28	26.32	10	SNP	0.990	T
SIPA1L3	23094	genome.wustl.edu	37	19	38689102	38689102	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:38689102G>A	ENST00000222345.6	+	19	5423	c.4914G>A	c.(4912-4914)ctG>ctA	p.L1638L	RN7SL663P_ENST00000578592.1_RNA|CTB-102L5.8_ENST00000598146.1_RNA	NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1638					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)	p.L1638L(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACCCTGGGCTGATGCCCCTGC	0.687																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											67.0	75.0	72.0					19																	38689102		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.4914G>A	19.37:g.38689102G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TV87	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.L1638	ENST00000222345.6	37	c.4914	CCDS33007.1	19																																																																																			SIPA1L3	-	pfam_DUF3401	ENSG00000105738		0.687	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	HGNC	protein_coding	OTTHUMT00000156294.2	31	0.00	0	G	XM_032278		38689102	38689102	+1	no_errors	ENST00000222345	ensembl	human	known	69_37n	silent	25	32.43	12	SNP	1.000	A
SIRT1	23411	genome.wustl.edu	37	10	69672314	69672314	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr10:69672314G>A	ENST00000212015.6	+	8	1494	c.1441G>A	c.(1441-1443)Gac>Aac	p.D481N	SIRT1_ENST00000403579.1_Missense_Mutation_p.D178N|SIRT1_ENST00000432464.1_Missense_Mutation_p.D186N|SIRT1_ENST00000406900.1_Missense_Mutation_p.D178N	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	481	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.|Interaction with CCAR2.				angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						GCTTCTTGGAGACTGTGATGT	0.368																																						dbGAP											0													107.0	108.0	108.0					10																	69672314		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.1441G>A	10.37:g.69672314G>A	ENSP00000212015:p.Asp481Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Missense_Mutation	SNP	pfam_NAD-dep_deAcase_sirtuin,pfscan_NAD-dep_deAcase_sirtuin	p.D481N	ENST00000212015.6	37	c.1441	CCDS7273.1	10	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880929	0.91740	.	.	ENSG00000096717	ENST00000212015;ENST00000432464;ENST00000406900;ENST00000403579	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.92	5.92	0.95590	.	0.099079	0.64402	D	0.000003	T	0.33614	0.0869	L	0.46947	1.48	0.80722	D	1	B;P	0.40515	0.243;0.719	B;P	0.48304	0.341;0.573	T	0.01030	-1.1475	10	0.66056	D	0.02	-14.1977	19.9317	0.97122	0.0:0.0:1.0:0.0	.	178;481	B0QZ35;Q96EB6	.;SIRT1_HUMAN	N	481;186;178;178	ENSP00000212015:D481N;ENSP00000409208:D186N;ENSP00000384508:D178N;ENSP00000384063:D178N	ENSP00000212015:D481N	D	+	1	0	SIRT1	69342320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.434000	0.97515	2.810000	0.96702	0.650000	0.86243	GAC	SIRT1	-	pfscan_NAD-dep_deAcase_sirtuin	ENSG00000096717		0.368	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT1	HGNC	protein_coding	OTTHUMT00000048296.1	37	0.00	0	G			69672314	69672314	+1	no_errors	ENST00000212015	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	A
SKOR1	390598	genome.wustl.edu	37	15	68114329	68114329	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr15:68114329A>C	ENST00000341418.5	+	2	91	c.91A>C	c.(91-93)Aaa>Caa	p.K31Q	SKOR1_ENST00000554240.1_5'Flank	NM_001258024.1	NP_001244953.1	P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	0					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						AAGTGGAGGAAAAGGGGAGAC	0.622																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000341418.5:c.91A>C	15.37:g.68114329A>C	ENSP00000343200:p.Lys31Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like	p.K31Q	ENST00000341418.5	37	c.91	CCDS58374.1	15	.	.	.	.	.	.	.	.	.	.	A	15.67	2.901481	0.52227	.	.	ENSG00000188779	ENST00000341418	T	0.75154	-0.91	3.76	1.44	0.22558	.	.	.	.	.	T	0.69744	0.3145	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.61969	-0.6953	6	0.87932	D	0	.	4.6838	0.12748	0.5371:0.0:0.4629:0.0	.	.	.	.	Q	31	ENSP00000343200:K31Q	ENSP00000343200:K31Q	K	+	1	0	SKOR1	65901383	0.007000	0.16637	0.001000	0.08648	0.086000	0.17979	0.724000	0.25954	0.096000	0.17463	0.247000	0.18012	AAA	SKOR1	-	NULL	ENSG00000188779		0.622	SKOR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SKOR1	HGNC	protein_coding	OTTHUMT00000410829.1	42	0.00	0	A	NM_001031807		68114329	68114329	+1	no_errors	ENST00000341418	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.001	C
SLC22A8	9376	genome.wustl.edu	37	11	62763237	62763237	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr11:62763237C>T	ENST00000336232.2	-	7	1075	c.940G>A	c.(940-942)Gca>Aca	p.A314T	SLC22A8_ENST00000311438.8_Missense_Mutation_p.A314T|SLC22A8_ENST00000535878.1_Missense_Mutation_p.A191T|SLC22A8_ENST00000430500.2_Missense_Mutation_p.A314T|SLC22A8_ENST00000542795.1_5'Flank|SLC22A8_ENST00000545207.1_Missense_Mutation_p.A223T	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	314					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AGGTCACTTGCGGTGTACTTG	0.597																																						dbGAP											0													172.0	157.0	162.0					11																	62763237		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.940G>A	11.37:g.62763237C>T	ENSP00000337335:p.Ala314Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.A314T	ENST00000336232.2	37	c.940	CCDS8042.1	11	.	.	.	.	.	.	.	.	.	.	C	9.319	1.057518	0.19907	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8	5.21	-10.0	0.00425	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.341700	0.05306	N	0.523915	T	0.60856	0.2301	L	0.51422	1.61	0.09310	N	1	B;B	0.13145	0.006;0.007	B;B	0.15870	0.008;0.014	T	0.39251	-0.9623	10	0.29301	T	0.29	.	7.3528	0.26703	0.237:0.1749:0.0:0.5881	.	314;314	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	T	314;300;223;191;314;314	ENSP00000337335:A314T;ENSP00000441658:A223T;ENSP00000443368:A191T;ENSP00000311463:A314T;ENSP00000398548:A314T	ENSP00000311463:A314T	A	-	1	0	SLC22A8	62519813	0.000000	0.05858	0.000000	0.03702	0.259000	0.26198	-3.159000	0.00578	-2.297000	0.00661	0.455000	0.32223	GCA	SLC22A8	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000149452		0.597	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A8	HGNC	protein_coding	OTTHUMT00000396191.1	29	0.00	0	C	NM_004254		62763237	62763237	-1	no_errors	ENST00000336232	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.000	T
SLITRK6	84189	genome.wustl.edu	37	13	86369675	86369675	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:86369675T>G	ENST00000400286.2	-	2	1567	c.969A>C	c.(967-969)caA>caC	p.Q323H		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	323	LRRNT 2.				adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GTCCTGGAAGTTGAGTGGATG	0.423																																						dbGAP											0													158.0	146.0	150.0					13																	86369675		1943	4142	6085	-	-	-	SO:0001583	missense	0			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.969A>C	13.37:g.86369675T>G	ENSP00000383143:p.Gln323His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Q323H	ENST00000400286.2	37	c.969	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	T	9.688	1.151057	0.21371	.	.	ENSG00000184564	ENST00000400286	T	0.57436	0.4	5.95	-3.05	0.05396	.	0.319657	0.28895	N	0.013797	T	0.19248	0.0462	N	0.08118	0	0.28574	N	0.910462	B	0.02656	0.0	B	0.01281	0.0	T	0.08806	-1.0704	10	0.14656	T	0.56	-5.6952	0.9021	0.01276	0.2314:0.2852:0.1188:0.3647	.	323	Q9H5Y7	SLIK6_HUMAN	H	323	ENSP00000383143:Q323H	ENSP00000383143:Q323H	Q	-	3	2	SLITRK6	85267676	0.829000	0.29322	0.980000	0.43619	0.982000	0.71751	-0.106000	0.10890	-0.358000	0.08162	0.528000	0.53228	CAA	SLITRK6	-	NULL	ENSG00000184564		0.423	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	79	0.00	0	T	NM_032229		86369675	86369675	-1	no_errors	ENST00000400286	ensembl	human	known	69_37n	missense	58	10.77	7	SNP	0.494	G
SMARCD2	6603	genome.wustl.edu	37	17	61912805	61912805	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr17:61912805C>G	ENST00000448276.2	-	5	955	c.690G>C	c.(688-690)tgG>tgC	p.W230C	SMARCD2_ENST00000323347.10_Missense_Mutation_p.W182C|SMARCD2_ENST00000225742.9_Missense_Mutation_p.W155C	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	230					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						CTCGGAGTTCCCAGGAAGCCA	0.572																																						dbGAP											0													57.0	61.0	60.0					17																	61912805		1876	4111	5987	-	-	-	SO:0001583	missense	0			U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.690G>C	17.37:g.61912805C>G	ENSP00000392617:p.Trp230Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.W230C	ENST00000448276.2	37	c.690	CCDS45756.1	17	.	.	.	.	.	.	.	.	.	.	.	20.7	4.026481	0.75390	.	.	ENSG00000108604	ENST00000448276;ENST00000225742;ENST00000450364;ENST00000323347	T;T	0.60424	0.19;0.19	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.82848	0.5126	H	0.95539	3.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.998	D	0.87893	0.2685	10	0.87932	D	0	0.0961	15.8147	0.78592	0.0:1.0:0.0:0.0	.	182;193;230	Q92925-3;B9EGA3;Q92925	.;.;SMRD2_HUMAN	C	230;172;193;182	ENSP00000392617:W230C;ENSP00000318451:W182C	ENSP00000225742:W172C	W	-	3	0	SMARCD2	59266537	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	7.651000	0.83577	2.600000	0.87896	0.655000	0.94253	TGG	SMARCD2	-	NULL	ENSG00000108604		0.572	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD2	HGNC	protein_coding	OTTHUMT00000444544.1	44	0.00	0	C	NM_001098426		61912805	61912805	-1	no_errors	ENST00000448276	ensembl	human	known	69_37n	missense	23	11.54	3	SNP	1.000	G
SMG5	23381	genome.wustl.edu	37	1	156220862	156220862	+	Intron	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:156220862G>T	ENST00000361813.5	-	21	2973				SMG5_ENST00000368267.5_Intron|PAQR6_ENST00000292291.5_5'Flank|PAQR6_ENST00000492619.1_5'Flank	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GATCTCCAGGGGACAGGGGCA	0.612																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2829-75C>A	1.37:g.156220862G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	RNA	SNP	-	NULL	ENST00000361813.5	37	NULL	CCDS1137.1	1																																																																																			SMG5	-	-	ENSG00000198952		0.612	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	16	0.00	0	G	NM_015327		156220862	156220862	-1	no_errors	ENST00000476954	ensembl	human	putative	69_37n	rna	23	32.35	11	SNP	0.099	T
SMYD3	64754	genome.wustl.edu	37	1	246490592	246490592	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:246490592C>G	ENST00000388985.4	-	5	441	c.442G>C	c.(442-444)Gta>Cta	p.V148L	SMYD3_ENST00000541742.1_Missense_Mutation_p.V89L|SMYD3_ENST00000403792.3_Missense_Mutation_p.V148L|SMYD3_ENST00000490107.1_Missense_Mutation_p.V89L			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	148	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		AATGTCATTACGAGTTGCCTG	0.363																																						dbGAP											0													152.0	140.0	144.0					1																	246490592		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.442G>C	1.37:g.246490592C>G	ENSP00000373637:p.Val148Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.V148L	ENST00000388985.4	37	c.442	CCDS53486.1	1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177263	0.38413	.	.	ENSG00000185420	ENST00000541742;ENST00000490107;ENST00000388985;ENST00000453676;ENST00000403792	T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59	5.88	4.97	0.65823	SET domain (2);	0.780759	0.11764	N	0.531792	T	0.09069	0.0224	N	0.14661	0.345	0.26472	N	0.975265	B	0.14012	0.009	B	0.13407	0.009	T	0.27673	-1.0067	10	0.09843	T	0.71	-36.6612	14.0689	0.64849	0.0:0.9282:0.0:0.0718	.	148	Q9H7B4	SMYD3_HUMAN	L	89;89;148;89;148	ENSP00000444184:V89L;ENSP00000419184:V89L;ENSP00000373637:V148L;ENSP00000408122:V89L;ENSP00000385380:V148L	ENSP00000373637:V148L	V	-	1	0	SMYD3	244557215	0.874000	0.30092	0.271000	0.24616	0.973000	0.67179	2.090000	0.41682	1.496000	0.48567	0.655000	0.94253	GTA	SMYD3	-	pfam_SET_dom,smart_SET_dom	ENSG00000185420		0.363	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD3	HGNC	protein_coding		56	0.00	0	C	NM_022743		246490592	246490592	-1	no_errors	ENST00000388985	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	0.931	G
ACOT8	10005	genome.wustl.edu	37	20	44470669	44470669	+	Intron	SNP	C	C	T	rs534425240		TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr20:44470669C>T	ENST00000217455.4	-	6	932				SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000342644.5_Intron	NM_005469.3	NP_005460.2	O14734	ACOT8_HUMAN	acyl-CoA thioesterase 8						acyl-CoA metabolic process (GO:0006637)|alpha-linolenic acid metabolic process (GO:0036109)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|dicarboxylic acid catabolic process (GO:0043649)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|peroxisome fission (GO:0016559)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|viral process (GO:0016032)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|choloyl-CoA hydrolase activity (GO:0033882)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			kidney(2)|large_intestine(3)|lung(4)|skin(1)	10		Myeloproliferative disorder(115;0.0122)				tttcctgaaacagagtctcac	0.557																																						dbGAP											0													48.0	67.0	60.0					20																	44470669		1327	2309	3636	-	-	-	SO:0001627	intron_variant	0			AF014404	CCDS13378.1	20q13.12	2012-05-16	2005-09-19	2005-09-19	ENSG00000101473	ENSG00000101473	3.1.2.27	"""Acyl CoA thioesterases"""	15919	protein-coding gene	gene with protein product	"""choloyl-CoA hydrolase"""	608123	"""peroxisomal acyl-CoA thioesterase"", ""peroxisomal acyl-CoA thioesterase 1"""	PTE1		10092594, 9153233, 16103133, 16940157	Standard	NM_005469		Approved	hACTE-III, hTE, PTE-2	uc002xqa.2	O14734	OTTHUMG00000033045	ENST00000217455.4:c.842-74G>A	20.37:g.44470669C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15261|Q17RX4	RNA	SNP	-	NULL	ENST00000217455.4	37	NULL	CCDS13378.1	20																																																																																			SNX21	-	-	ENSG00000124104		0.557	ACOT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX21	HGNC	protein_coding	OTTHUMT00000080338.2	37	0.00	0	C	NM_183386		44470669	44470669	+1	no_errors	ENST00000344780	ensembl	human	known	69_37n	rna	21	32.26	10	SNP	0.041	T
SORCS2	57537	genome.wustl.edu	37	4	7725558	7725558	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:7725558G>A	ENST00000507866.2	+	19	2668	c.2559G>A	c.(2557-2559)agG>agA	p.R853R	SORCS2_ENST00000329016.9_Silent_p.R681R	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	853	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						TGTCCGTCAGGGCAGAGAACA	0.592																																						dbGAP											0													66.0	68.0	67.0					4																	7725558		2049	4187	6236	-	-	-	SO:0001819	synonymous_variant	0			AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2559G>A	4.37:g.7725558G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L7	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.R853	ENST00000507866.2	37	c.2559	CCDS47008.1	4																																																																																			SORCS2	-	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	ENSG00000184985		0.592	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS2	HGNC	protein_coding	OTTHUMT00000358685.4	42	0.00	0	G	NM_020777		7725558	7725558	+1	no_errors	ENST00000507866	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	1.000	A
SPTBN4	57731	genome.wustl.edu	37	19	40978681	40978681	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:40978681G>A	ENST00000352632.3	+	2	239	c.153G>A	c.(151-153)cgG>cgA	p.R51R	SPTBN4_ENST00000598249.1_Silent_p.R51R|SPTBN4_ENST00000338932.3_Silent_p.R51R|SPTBN4_ENST00000344104.3_Silent_p.R51R|SPTBN4_ENST00000595535.1_Silent_p.R51R			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	51	Actin-binding.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGTGCTCCCGGATCAAGGCCT	0.692																																						dbGAP											0													14.0	14.0	14.0					19																	40978681		2195	4287	6482	-	-	-	SO:0001819	synonymous_variant	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.153G>A	19.37:g.40978681G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R51	ENST00000352632.3	37	c.153	CCDS12559.1	19																																																																																			SPTBN4	-	pirsf_Spectrin_bsu,superfamily_CH-domain	ENSG00000160460		0.692	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	30	0.00	0	G			40978681	40978681	+1	no_errors	ENST00000352632	ensembl	human	known	69_37n	silent	41	12.77	6	SNP	0.991	A
SRSF12	135295	genome.wustl.edu	37	6	89808454	89808454	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:89808454G>T	ENST00000452027.2	-	5	822	c.629C>A	c.(628-630)tCa>tAa	p.S210*		NM_080743.4	NP_542781.3	Q8WXF0	SRS12_HUMAN	serine/arginine-rich splicing factor 12	210	Arg/Ser-rich (RS domain).				cytoplasmic transport (GO:0016482)|mRNA 5'-splice site recognition (GO:0000395)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|spliceosomal tri-snRNP complex assembly (GO:0000244)	nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RS domain binding (GO:0050733)|unfolded protein binding (GO:0051082)	p.S211*(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)	8						ATGTGATCTTGATTTTGTTCC	0.413																																						dbGAP											1	Substitution - Nonsense(1)	endometrium(1)											295.0	274.0	281.0					6																	89808454		1919	4138	6057	-	-	-	SO:0001587	stop_gained	0			AF449428	CCDS47459.1	6q16.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000154548	ENSG00000154548		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	21220	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 19"", ""SR splicing factor 12"""		"""splicing factor, arginine/serine-rich 13B"""	SFRS13B		11684676, 20516191	Standard	NM_080743		Approved	SRrp35, SFRS19	uc021zcq.1	Q8WXF0	OTTHUMG00000015192	ENST00000452027.2:c.629C>A	6.37:g.89808454G>T	ENSP00000414302:p.Ser210*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA22|Q5T7K0|Q8WW25	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S210*	ENST00000452027.2	37	c.629	CCDS47459.1	6	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935269	0.92458	.	.	ENSG00000154548	ENST00000452027	.	.	.	5.22	5.22	0.72569	.	0.113519	0.39020	N	0.001481	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.719	0.88345	0.0:0.0:1.0:0.0	.	.	.	.	X	210	.	ENSP00000414302:S210X	S	-	2	0	SRSF12	89865173	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.044000	0.49830	2.724000	0.93272	0.591000	0.81541	TCA	SRSF12	-	NULL	ENSG00000154548		0.413	SRSF12-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SRSF12	HGNC	protein_coding	OTTHUMT00000041474.2	111	0.00	0	G	NM_080743		89808454	89808454	-1	no_errors	ENST00000452027	ensembl	human	known	69_37n	nonsense	73	16.09	14	SNP	1.000	T
STAG3L1	54441	genome.wustl.edu	37	7	74991324	74991324	+	RNA	SNP	T	T	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:74991324T>G	ENST00000402225.5	+	0	400							P0CL83	ST3L1_HUMAN	stromal antigen 3-like 1 (pseudogene)							nucleus (GO:0005634)											AATGATCTTTTCAATGCTGCG	0.443																																						dbGAP											0													1.0	3.0	2.0					7																	74991324		531	1742	2273	-	-	-			0					7q11.23	2013-06-26	2013-06-26		ENSG00000205583	ENSG00000205583			33852	pseudogene	pseudogene			"""stromal antigen 3-like 1"""				Standard	NR_040583		Approved	DKFZP434A0131, STAG3L1P	uc022agf.1	P0CL83	OTTHUMG00000155940		7.37:g.74991324T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	RNA	SNP	-	NULL	ENST00000402225.5	37	NULL		7	.	.	.	.	.	.	.	.	.	.	T	3.104	-0.184115	0.06340	.	.	ENSG00000205583	ENST00000339898;ENST00000402225;ENST00000338421;ENST00000437344	.	.	.	.	.	.	.	0.257569	0.27764	N	0.017947	T	0.15435	0.0372	.	.	.	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.39623	-0.9605	5	0.02654	T	1	.	.	.	.	.	4	P0CL83	ST3L1_HUMAN	A	4	.	ENSP00000344075:S4A	S	+	1	0	STAG3L1	74829260	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	1.268000	0.33062	0.000000	0.14550	0.000000	0.15137	TCA	STAG3L1	-	-	ENSG00000205583		0.443	STAG3L1-012	KNOWN	basic	processed_transcript	STAG3L1	HGNC	pseudogene	OTTHUMT00000437242.1	11	0.00	0	T	NM_001002840		74991324	74991324	+1	no_errors	ENST00000402225	ensembl	human	known	69_37n	rna	2	50.00	2	SNP	0.956	G
STK24	8428	genome.wustl.edu	37	13	99114109	99114109	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:99114109G>C	ENST00000376547.3	-	8	1153	c.1008C>G	c.(1006-1008)gaC>gaG	p.D336E	STK24_ENST00000539966.1_Missense_Mutation_p.D305E|STK24_ENST00000397517.2_Missense_Mutation_p.D324E	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	336	Nuclear export signal (NES).				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TGAAGATCCAGTCCCCAGAAT	0.527																																						dbGAP											0													125.0	119.0	121.0					13																	99114109		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.1008C>G	13.37:g.99114109G>C	ENSP00000365730:p.Asp336Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O14840|Q5JV92	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D336E	ENST00000376547.3	37	c.1008	CCDS9488.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.342|2.342	-0.350902|-0.350902	0.05173|0.05173	.|.	.|.	ENSG00000102572|ENSG00000102572	ENST00000397517;ENST00000376554;ENST00000376547;ENST00000376541;ENST00000539966;ENST00000418038;ENST00000376533;ENST00000543110|ENST00000444574	T;T;T;T;T|.	0.70631|.	-0.47;3.97;-0.47;-0.5;1.6|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.432580|.	0.19203|.	U|.	0.120131|.	T|T	0.33352|0.33352	0.0860|0.0860	N|N	0.12611|0.12611	0.24|0.24	0.47308|0.47308	D|D	0.999387|0.999387	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.001;0.001|.	T|T	0.16100|0.16100	-1.0414|-1.0414	10|5	0.02654|.	T|.	1|.	.|.	5.1901|5.1901	0.15205|0.15205	0.0798:0.1446:0.626:0.1496|0.0798:0.1446:0.626:0.1496	.|.	305;324;336|.	B4DR80;Q5U0E6;Q9Y6E0|.	.;.;STK24_HUMAN|.	E|V	324;125;336;139;305;46;312;324|242	ENSP00000380651:D324E;ENSP00000365737:D125E;ENSP00000365730:D336E;ENSP00000442539:D305E;ENSP00000402810:D46E|.	ENSP00000365716:D312E|.	D|L	-|-	3|1	2|2	STK24|STK24	97912110|97912110	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	0.387000|0.387000	0.20718|0.20718	2.278000|2.278000	0.76064|0.76064	0.467000|0.467000	0.42956|0.42956	GAC|CTG	STK24	-	NULL	ENSG00000102572		0.527	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STK24	HGNC	protein_coding	OTTHUMT00000045549.2	77	0.00	0	G	NM_003576		99114109	99114109	-1	no_errors	ENST00000376547	ensembl	human	known	69_37n	missense	26	57.38	35	SNP	1.000	C
TAF4B	6875	genome.wustl.edu	37	18	23865876	23865878	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr18:23865876_23865878delCCT	ENST00000269142.5	+	7	2001_2003	c.1003_1005delCCT	c.(1003-1005)cctdel	p.P335del	TAF4B_ENST00000400466.2_In_Frame_Del_p.P335del|TAF4B_ENST00000578121.1_In_Frame_Del_p.P335del	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	335	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			ACAACTTCTGCCTAACTCCCAGA	0.424																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.1003_1005delCCT	18.37:g.23865876_23865878delCCT	ENSP00000269142:p.Pro335del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q29YA4|Q29YA5	In_Frame_Del	DEL	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.P335in_frame_del	ENST00000269142.5	37	c.1003_1005	CCDS42421.1	18																																																																																			TAF4B	-	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1	ENSG00000141384		0.424	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF4B	HGNC	protein_coding	OTTHUMT00000446260.3	64	0.00	0	CCT	NM_005640		23865876	23865878	+1	no_errors	ENST00000269142	ensembl	human	known	69_37n	in_frame_del	39	11.36	5	DEL	1.000:1.000:0.932	-
TGDS	23483	genome.wustl.edu	37	13	95248285	95248285	+	Intron	SNP	C	C	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:95248285C>A	ENST00000261296.5	-	1	207				TGDS_ENST00000498294.1_5'UTR	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase						nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CACTGCTTGGCTAGCGGCGCC	0.607																																						dbGAP											0													31.0	35.0	34.0					13																	95248285		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.86+19G>T	13.37:g.95248285C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	RNA	SNP	-	NULL	ENST00000261296.5	37	NULL	CCDS9471.1	13																																																																																			TGDS	-	-	ENSG00000088451		0.607	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGDS	HGNC	protein_coding	OTTHUMT00000106904.2	38	0.00	0	C	NM_014305		95248285	95248285	-1	no_errors	ENST00000498294	ensembl	human	known	69_37n	rna	44	10.20	5	SNP	0.001	A
THEM5	284486	genome.wustl.edu	37	1	151826027	151826027	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:151826027G>A	ENST00000368817.5	-	1	146	c.15C>T	c.(13-15)tgC>tgT	p.C5C		NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	5					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CCACCTGGAAGCATCTCCTTA	0.587																																						dbGAP											0													102.0	102.0	102.0					1																	151826027		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.15C>T	1.37:g.151826027G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1C3	Silent	SNP	pfam_Thioestr_supf	p.C5	ENST00000368817.5	37	c.15	CCDS1005.1	1																																																																																			THEM5	-	NULL	ENSG00000196407		0.587	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	47	0.00	0	G	NM_182578		151826027	151826027	-1	no_errors	ENST00000368817	ensembl	human	known	69_37n	silent	37	54.32	44	SNP	0.001	A
TIMM17A	10440	genome.wustl.edu	37	1	201926929	201926929	+	Intron	DEL	T	T	-			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:201926929delT	ENST00000367287.4	+	3	226					NM_006335.2	NP_006326.1	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17 homolog A (yeast)						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|lung(3)|stomach(1)	5						CACTCGGTGATTTTTTTTTTT	0.408																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF106622	CCDS1417.1	1q32.1	2008-05-23			ENSG00000134375	ENSG00000134375			17315	protein-coding gene	gene with protein product		605057				8893850, 10339406	Standard	NM_006335		Approved	TIM17, TIM17A	uc001gxc.3	Q99595	OTTHUMG00000035806	ENST00000367287.4:c.190+227T>-	1.37:g.201926929delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDM5|Q9BWF5	RNA	DEL	-	NULL	ENST00000367287.4	37	NULL	CCDS1417.1	1																																																																																			TIMM17A	-	-	ENSG00000134375		0.408	TIMM17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM17A	HGNC	protein_coding	OTTHUMT00000087092.1	9	0.00	0	T	NM_006335		201926929	201926929	+1	no_errors	ENST00000484647	ensembl	human	known	69_37n	rna	10	23.08	3	DEL	0.000	-
TMCO3	55002	genome.wustl.edu	37	13	114156090	114156090	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:114156090G>A	ENST00000434316.2	+	5	1199	c.840G>A	c.(838-840)ctG>ctA	p.L280L	TMCO3_ENST00000375391.1_Silent_p.L280L|TMCO3_ENST00000474393.1_3'UTR	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	280						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			TAGGAATGCTGTCCTTGCCTT	0.413																																						dbGAP											0													168.0	166.0	167.0					13																	114156090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.840G>A	13.37:g.114156090G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Silent	SNP	pfam_Cation/H_exchanger	p.L280	ENST00000434316.2	37	c.840	CCDS9537.1	13																																																																																			TMCO3	-	pfam_Cation/H_exchanger	ENSG00000150403		0.413	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO3	HGNC	protein_coding	OTTHUMT00000045931.3	86	0.00	0	G	NM_017905		114156090	114156090	+1	no_errors	ENST00000434316	ensembl	human	known	69_37n	silent	98	16.24	19	SNP	1.000	A
TMEM151B	441151	genome.wustl.edu	37	6	44241109	44241109	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:44241109A>C	ENST00000451188.2	+	2	719	c.442A>C	c.(442-444)Agt>Cgt	p.S148R	RP11-444E17.6_ENST00000505802.1_Missense_Mutation_p.Q60P|TMEM151B_ENST00000438774.2_Missense_Mutation_p.S148R	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	148						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						TGATGTGAGCAGTGTGCGGGA	0.632																																						dbGAP											0													115.0	97.0	103.0					6																	44241109		692	1591	2283	-	-	-	SO:0001583	missense	0			AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.442A>C	6.37:g.44241109A>C	ENSP00000393161:p.Ser148Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T9V7	Missense_Mutation	SNP	NULL	p.S148R	ENST00000451188.2	37	c.442	CCDS47437.1	6	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640534	0.87859	.	.	ENSG00000178233	ENST00000451188;ENST00000438774;ENST00000430110	.	.	.	4.71	4.71	0.59529	.	0.046613	0.85682	D	0.000000	T	0.69070	0.3070	M	0.74258	2.255	0.46317	D	0.998983	D;D	0.71674	0.996;0.998	P;P	0.59703	0.823;0.862	T	0.74383	-0.3683	9	0.62326	D	0.03	.	14.3647	0.66799	1.0:0.0:0.0:0.0	.	148;148	Q8IW70;Q8IW70-2	T151B_HUMAN;.	R	148	.	ENSP00000410997:S148R	S	+	1	0	TMEM151B	44349087	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.210000	0.65214	1.979000	0.57680	0.363000	0.22086	AGT	TMEM151B	-	NULL	ENSG00000178233		0.632	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TMEM151B	HGNC	protein_coding	OTTHUMT00000040740.2	29	0.00	0	A	NM_001039704		44241109	44241109	+1	no_errors	ENST00000451188	ensembl	human	known	69_37n	missense	37	33.93	19	SNP	1.000	C
TMEM165	55858	genome.wustl.edu	37	4	56283243	56283243	+	Silent	SNP	G	G	A			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:56283243G>A	ENST00000381334.5	+	3	671	c.438G>A	c.(436-438)ttG>ttA	p.L146L	TMEM165_ENST00000506198.1_Intron|TMEM165_ENST00000514904.1_3'UTR|TMEM165_ENST00000542052.1_Silent_p.L83L	NM_018475.4	NP_060945.2	Q9HC07	TM165_HUMAN	transmembrane protein 165	146					cellular calcium ion homeostasis (GO:0006874)|Golgi calcium ion transport (GO:0032472)|protein N-linked glycosylation (GO:0006487)|regulation of lysosomal lumen pH (GO:0035751)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(1)|kidney(1)|large_intestine(2)	4	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			TTCCAGTTTTGTTTGGCTATG	0.363																																						dbGAP											0													111.0	99.0	103.0					4																	56283243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF183409	CCDS3499.1	4q12	2014-03-13			ENSG00000134851	ENSG00000134851			30760	protein-coding gene	gene with protein product	"""TPA regulated locus"""	614726				3202867, 22683087, 23575229	Standard	NM_018475		Approved	TMPT27, TPARL, GDT1	uc003hax.3	Q9HC07	OTTHUMG00000128735	ENST00000381334.5:c.438G>A	4.37:g.56283243G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3P8|B4DHW1|Q9BTN9|Q9NZ34	Silent	SNP	pfam_UPF0016	p.L146	ENST00000381334.5	37	c.438	CCDS3499.1	4																																																																																			TMEM165	-	pfam_UPF0016	ENSG00000134851		0.363	TMEM165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM165	HGNC	protein_coding	OTTHUMT00000250646.4	36	0.00	0	G	NM_018475		56283243	56283243	+1	no_errors	ENST00000381334	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	1.000	A
TMEM91	641649	genome.wustl.edu	37	19	41889658	41889658	+	Silent	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:41889658A>G	ENST00000392002.2	+	4	1059	c.399A>G	c.(397-399)gcA>gcG	p.A133A	CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000544232.1_Intron|TMEM91_ENST00000604123.1_Intron|TMEM91_ENST00000539627.1_3'UTR|CTC-435M10.3_ENST00000540732.1_Intron|TMEM91_ENST00000542945.1_3'UTR|TMEM91_ENST00000413014.2_Intron|TMEM91_ENST00000356385.4_3'UTR|TMEM91_ENST00000436170.2_Intron|BCKDHA_ENST00000595085.1_Intron|TMEM91_ENST00000447302.2_Intron	NM_001098821.1	NP_001092291.1	Q6ZNR0	TMM91_HUMAN	transmembrane protein 91	133					hematopoietic progenitor cell differentiation (GO:0002244)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	5						TCCAGGGGGCAGGGGCCGCCT	0.692																																						dbGAP											0													25.0	31.0	29.0					19																	41889658		2051	4165	6216	-	-	-	SO:0001819	synonymous_variant	0			AK130820, BC063705	CCDS42571.1, CCDS42572.1, CCDS46082.1, CCDS46083.1, CCDS46084.1	19q13.2	2009-10-16							32393	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 6"""					12477932	Standard	NM_001098824		Approved	FLJ27310, IFITMD6		Q6ZNR0		ENST00000392002.2:c.399A>G	19.37:g.41889658A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J9D1|C9JZ62|C9K046|Q6P434	Silent	SNP	pfam_Interferon-induced_TM_protein	p.A133	ENST00000392002.2	37	c.399	CCDS42571.1	19																																																																																			TMEM91	-	pfam_Interferon-induced_TM_protein	ENSG00000142046		0.692	TMEM91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM91	HGNC	protein_coding	OTTHUMT00000398302.2	36	0.00	0	A			41889658	41889658	+1	no_errors	ENST00000392002	ensembl	human	known	69_37n	silent	26	36.59	15	SNP	0.994	G
TPRX1	284355	genome.wustl.edu	37	19	48305574	48305574	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:48305574A>G	ENST00000322175.3	-	2	849	c.694T>C	c.(694-696)Tca>Cca	p.S232P	TPRX1_ENST00000535759.1_Missense_Mutation_p.S329P|TPRX1_ENST00000543508.1_Missense_Mutation_p.S222P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	232	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		ttcgggcctgagattgggcct	0.657																																					Esophageal Squamous(123;175 2281 3051 32395)	dbGAP											0													5.0	5.0	5.0					19																	48305574		1828	3608	5436	-	-	-	SO:0001583	missense	0				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.694T>C	19.37:g.48305574A>G	ENSP00000323455:p.Ser232Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8Y3|B2RPL5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S329P	ENST00000322175.3	37	c.985	CCDS33066.1	19	.	.	.	.	.	.	.	.	.	.	a	0.014	-1.590862	0.00864	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.91521	-1.71;-2.86	0.401	-0.802	0.10889	.	.	.	.	.	T	0.74291	0.3697	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.56282	-0.8005	8	0.07990	T	0.79	.	.	.	.	.	232	Q8N7U7	TPRX1_HUMAN	P	232;329;222	ENSP00000323455:S232P;ENSP00000438832:S329P	ENSP00000323455:S232P	S	-	1	0	TPRX1	52997386	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.396000	0.07278	-2.360000	0.00610	-2.389000	0.00228	TCA	TPRX1	-	NULL	ENSG00000178928		0.657	TPRX1-001	KNOWN	basic|CCDS	protein_coding	TPRX1	HGNC	protein_coding	OTTHUMT00000409868.1	85	0.00	0	A	NM_198479		48305574	48305574	-1	no_errors	ENST00000535759	ensembl	human	known	69_37n	missense	125	15.44	23	SNP	0.000	G
TPT1	7178	genome.wustl.edu	37	13	45913711	45913711	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr13:45913711C>G	ENST00000530705.1	-	4	620	c.320G>C	c.(319-321)aGa>aCa	p.R107T	TPT1_ENST00000379055.1_Missense_Mutation_p.R73T|TPT1_ENST00000379060.4_Missense_Mutation_p.R95T|TPT1_ENST00000529421.1_5'UTR|TPT1_ENST00000309246.5_Missense_Mutation_p.R107T|TPT1-AS1_ENST00000523506.1_RNA|SNORA31_ENST00000362607.1_RNA|TPT1-AS1_ENST00000520310.1_RNA|TPT1-AS1_ENST00000521336.1_RNA|TPT1_ENST00000379056.1_Missense_Mutation_p.R73T|TPT1-AS1_ENST00000412946.2_RNA|TPT1-AS1_ENST00000517509.1_RNA|TPT1-AS1_ENST00000520622.1_RNA|RP11-290D2.6_ENST00000610057.1_RNA|TPT1-AS1_ENST00000520590.1_RNA			P13693	TCTP_HUMAN	tumor protein, translationally-controlled 1	107					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ectoderm development (GO:2000384)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|regulation of apoptotic process (GO:0042981)|response to virus (GO:0009615)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|multivesicular body (GO:0005771)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			lung(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000232)		TCTTTCTGGTCTCTGTTCTTC	0.318																																						dbGAP											0													100.0	101.0	101.0					13																	45913711		2203	4299	6502	-	-	-	SO:0001583	missense	0			X16064	CCDS9397.1, CCDS66538.1, CCDS73566.1	13q14	2010-08-18			ENSG00000133112	ENSG00000133112			12022	protein-coding gene	gene with protein product		600763				2813067, 10343127	Standard	NM_001286273		Approved	TCTP, fortilin	uc001uzy.1	P13693	OTTHUMG00000016845	ENST00000530705.1:c.320G>C	13.37:g.45913711C>G	ENSP00000431872:p.Arg107Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7E5|Q6YLS2|Q7Z4J4|Q8TBK7|Q96EE2|Q9UC70	Missense_Mutation	SNP	pfam_Translational_control_tumour_p,superfamily_Mss4-like,prints_Translational_control_tumour_p	p.R107T	ENST00000530705.1	37	c.320	CCDS9397.1	13	.	.	.	.	.	.	.	.	.	.	.	14.16	2.451371	0.43531	.	.	ENSG00000133112	ENST00000379056;ENST00000530705;ENST00000379060;ENST00000379055;ENST00000309246;ENST00000527226	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	4.79	0.788	0.18601	Mss4-like (1);Mss4/translationally controlled tumour-associated TCTP (1);	0.320592	0.35970	N	0.002868	T	0.48132	0.1483	M	0.70275	2.135	0.26138	N	0.980325	B	0.25563	0.129	P	0.45712	0.491	T	0.48692	-0.9013	10	0.20046	T	0.44	.	6.6211	0.22804	0.0:0.3405:0.0:0.6595	.	107	P13693	TCTP_HUMAN	T	73;107;95;73;107;106	ENSP00000368345:R73T;ENSP00000431872:R107T;ENSP00000368350:R95T;ENSP00000368344:R73T;ENSP00000339051:R107T;ENSP00000433738:R106T	ENSP00000339051:R107T	R	-	2	0	TPT1	44811711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.592000	0.36676	0.315000	0.23110	0.655000	0.94253	AGA	TPT1	-	pfam_Translational_control_tumour_p,superfamily_Mss4-like	ENSG00000133112		0.318	TPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPT1	HGNC	protein_coding	OTTHUMT00000044758.3	32	0.00	0	C			45913711	45913711	-1	no_errors	ENST00000530705	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.999	G
TRIML1	339976	genome.wustl.edu	37	4	189068232	189068232	+	Silent	SNP	A	A	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:189068232A>C	ENST00000332517.3	+	6	1253	c.1113A>C	c.(1111-1113)ccA>ccC	p.P371P	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	371	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TCCCCAAGCCACCTGGGGACC	0.532																																					Melanoma(31;213 1036 16579 23968 32372)	dbGAP											0													93.0	94.0	94.0					4																	189068232		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.1113A>C	4.37:g.189068232A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BE5	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.P371	ENST00000332517.3	37	c.1113	CCDS3851.1	4																																																																																			TRIML1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000184108		0.532	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	HGNC	protein_coding	OTTHUMT00000359813.1	52	0.00	0	A	NM_178556		189068232	189068232	+1	no_errors	ENST00000332517	ensembl	human	known	69_37n	silent	48	14.29	8	SNP	0.000	C
TSPAN16	26526	genome.wustl.edu	37	19	11417278	11417278	+	Splice_Site	SNP	A	A	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:11417278A>T	ENST00000316737.1	+	5	600		c.e5-1		TSPAN16_ENST00000592955.1_Splice_Site|TSPAN16_ENST00000590327.1_Splice_Site|CTC-510F12.4_ENST00000586356.1_RNA	NM_012466.2	NP_036598.1	Q9UKR8	TSN16_HUMAN	tetraspanin 16							integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	12						TCCTCTCTATAGCTAAAGTGC	0.433																																						dbGAP											0													86.0	82.0	83.0					19																	11417278		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC029908	CCDS12256.1, CCDS62549.1, CCDS62550.1	19p13.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000130167	ENSG00000130167		"""Tetraspanins"""	30725	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 16"""	TM4SF16		10500248	Standard	NM_012466		Approved	TM4-B, TM-8	uc002mqv.1	Q9UKR8	OTTHUMG00000180833	ENST00000316737.1:c.451-1A>T	19.37:g.11417278A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	K7EN22|K7EPD8|Q8N6J7	Splice_Site	SNP	-	e5-2	ENST00000316737.1	37	c.451-2	CCDS12256.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.73|11.73	1.727037|1.727037	0.30593|0.30593	.|.	.|.	ENSG00000130167|ENSG00000130167	ENST00000316737|ENST00000337994	.|.	.|.	.|.	3.25|3.25	3.25|3.25	0.37280|0.37280	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.53005|0.53005	D|D	0.999963|0.999963	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.2478|8.2478	0.31700|0.31700	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	.|L	-1|161	.|.	.|.	.|X	+|+	.|2	.|0	TSPAN16|TSPAN16	11278278|11278278	0.997000|0.997000	0.39634|0.39634	0.221000|0.221000	0.23827|0.23827	0.666000|0.666000	0.39218|0.39218	3.976000|3.976000	0.56867|0.56867	1.714000|1.714000	0.51371|0.51371	0.459000|0.459000	0.35465|0.35465	.|TAG	TSPAN16	-	-	ENSG00000130167		0.433	TSPAN16-001	KNOWN	basic|CCDS	protein_coding	TSPAN16	HGNC	protein_coding	OTTHUMT00000453204.1	113	0	0	A	NM_012466	Intron	11417278	11417278	+1	no_errors	ENST00000316737	ensembl	human	known	69_37n	splice_site	55	39.56	36	SNP	0.266	T
TSPAN16	26526	genome.wustl.edu	37	19	11417278	11417278	+	Splice_Site	SNP	A	A	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:11417278A>T	ENST00000316737.1	+	5	600		c.e5-1		TSPAN16_ENST00000592955.1_Splice_Site|TSPAN16_ENST00000590327.1_Splice_Site|CTC-510F12.4_ENST00000586356.1_RNA	NM_012466.2	NP_036598.1	Q9UKR8	TSN16_HUMAN	tetraspanin 16							integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	12						TCCTCTCTATAGCTAAAGTGC	0.433																																						dbGAP											0													86.0	82.0	83.0					19																	11417278		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC029908	CCDS12256.1, CCDS62549.1, CCDS62550.1	19p13.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000130167	ENSG00000130167		"""Tetraspanins"""	30725	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 16"""	TM4SF16		10500248	Standard	NM_012466		Approved	TM4-B, TM-8	uc002mqv.1	Q9UKR8	OTTHUMG00000180833	ENST00000316737.1:c.451-1A>T	19.37:g.11417278A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	K7EN22|K7EPD8|Q8N6J7	Splice_Site	SNP	-	e5-2	ENST00000316737.1	37	c.451-2	CCDS12256.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.73|11.73	1.727037|1.727037	0.30593|0.30593	.|.	.|.	ENSG00000130167|ENSG00000130167	ENST00000316737|ENST00000337994	.|.	.|.	.|.	3.25|3.25	3.25|3.25	0.37280|0.37280	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.53005|0.53005	D|D	0.999963|0.999963	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.2478|8.2478	0.31700|0.31700	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	.|L	-1|161	.|.	.|.	.|X	+|+	.|2	.|0	TSPAN16|TSPAN16	11278278|11278278	0.997000|0.997000	0.39634|0.39634	0.221000|0.221000	0.23827|0.23827	0.666000|0.666000	0.39218|0.39218	3.976000|3.976000	0.56867|0.56867	1.714000|1.714000	0.51371|0.51371	0.459000|0.459000	0.35465|0.35465	.|TAG	TSPAN16	-	-	ENSG00000130167		0.433	TSPAN16-001	KNOWN	basic|CCDS	protein_coding	TSPAN16	HGNC	protein_coding	OTTHUMT00000453204.1	113	0.00	0	A	NM_012466	Intron	11417278	11417278	+1	no_errors	ENST00000316737	ensembl	human	known	69_37n	splice_site	55	39.56	36	SNP	0.266	T
TTLL10	254173	genome.wustl.edu	37	1	1111032	1111032	+	Intron	SNP	G	G	A	rs371060248		TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:1111032G>A	ENST00000379290.1	+	3	146				TTLL10-AS1_ENST00000379317.1_RNA|TTLL10_ENST00000379289.1_Intron			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10						cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGCAgactgcgcagtgtgtgg	0.587																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.-28+1163G>A	1.37:g.1111032G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	RNA	SNP	-	NULL	ENST00000379290.1	37	NULL	CCDS44036.1	1																																																																																			TTLL10-AS1	-	-	ENSG00000205231		0.587	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10-AS1	HGNC	protein_coding	OTTHUMT00000002421.3	70	0.00	0	G	NM_153254		1111032	1111032	-1	no_errors	ENST00000379317	ensembl	human	known	69_37n	rna	71	18.39	16	SNP	0.064	A
TTN	7273	genome.wustl.edu	37	2	179399058	179399058	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:179399058T>G	ENST00000591111.1	-	308	97585	c.97361A>C	c.(97360-97362)cAc>cCc	p.H32454P	TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.H25222P|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.H31527P|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.H34095P|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.H25030P|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.H25155P|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32454					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATCAGGGTGTGGTAATAACG	0.468																																						dbGAP											0													131.0	125.0	127.0					2																	179399058		1920	4145	6065	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.97361A>C	2.37:g.179399058T>G	ENSP00000465570:p.His32454Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.H31527P	ENST00000591111.1	37	c.94580		2	.	.	.	.	.	.	.	.	.	.	T	12.52	1.961323	0.34565	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.78	5.78	0.91487	Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.27278	0.0669	N	0.08118	0	0.48830	D	0.999715	B;B;B;B	0.22604	0.072;0.072;0.072;0.072	B;B;B;B	0.20767	0.031;0.031;0.031;0.031	T	0.10520	-1.0626	9	0.87932	D	0	.	15.1002	0.72269	0.0:0.0:0.0:1.0	.	25030;25155;25222;32454	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	31527;25030;25222;25155;25027	ENSP00000343764:H31527P;ENSP00000434586:H25030P;ENSP00000340554:H25222P;ENSP00000352154:H25155P	ENSP00000340554:H25222P	H	-	2	0	TTN	179107304	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.015000	0.88690	2.213000	0.71641	0.454000	0.30748	CAC	TTN	-	superfamily_Kinase-like_dom,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.468	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	40	0.00	0	T	NM_133378		179399058	179399058	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	G
UBE2G2	7327	genome.wustl.edu	37	21	46191243	46191243	+	3'UTR	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr21:46191243G>C	ENST00000345496.2	-	0	817				UBE2G2_ENST00000477954.1_5'UTR|UBE2G2_ENST00000330942.5_3'UTR	NM_003343.5	NP_003334.2	P60604	UB2G2_HUMAN	ubiquitin-conjugating enzyme E2G 2						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K48-linked ubiquitination (GO:0070936)|protein N-linked glycosylation via asparagine (GO:0018279)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|central_nervous_system(1)|lung(1)	5				Colorectal(79;0.0638)		TGCCGGGGGAGAATGCTGAGC	0.512																																						dbGAP											0													61.0	51.0	55.0					21																	46191243		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC008351	CCDS13714.1, CCDS33586.1	21q22.3	2011-05-19	2011-05-19		ENSG00000184787	ENSG00000184787		"""Ubiquitin-conjugating enzymes E2"""	12483	protein-coding gene	gene with protein product		603124	"""ubiquitin-conjugating enzyme E2G 2 (homologous to yeast UBC7)"", ""ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)"""			9693041, 9925943	Standard	NM_003343		Approved	UBC7	uc002zfy.3	P60604	OTTHUMG00000089179	ENST00000345496.2:c.*49C>G	21.37:g.46191243G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMQ7|A8K3L4|D3DSL7|P56554	RNA	SNP	-	NULL	ENST00000345496.2	37	NULL	CCDS13714.1	21																																																																																			UBE2G2	-	-	ENSG00000184787		0.512	UBE2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2G2	HGNC	protein_coding	OTTHUMT00000202647.2	30	0.00	0	G	NM_182688		46191243	46191243	-1	no_errors	ENST00000477954	ensembl	human	known	69_37n	rna	30	18.92	7	SNP	0.000	C
UGT2A1	10941	genome.wustl.edu	37	4	70512828	70512828	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:70512828C>T	ENST00000503640.1	-	1	590	c.535G>A	c.(535-537)Gtg>Atg	p.V179M	UGT2A1_ENST00000286604.4_Missense_Mutation_p.V179M|UGT2A1_ENST00000514019.1_Missense_Mutation_p.V179M|UGT2A1_ENST00000512704.1_Missense_Mutation_p.V179M	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	179					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TGCTTTTCCACTGTTGAGGCT	0.423																																						dbGAP											0													94.0	82.0	86.0					4																	70512828		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.535G>A	4.37:g.70512828C>T	ENSP00000424478:p.Val179Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V179M	ENST00000503640.1	37	c.535	CCDS3529.1	4	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641946	0.29157	.	.	ENSG00000173610	ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T	0.60299	0.23;0.2;0.23;0.23	5.78	4.88	0.63580	.	0.218949	0.40302	N	0.001136	T	0.59307	0.2184	N	0.17474	0.49	.	.	.	D;P;P;P	0.71674	0.998;0.828;0.954;0.884	D;B;P;P	0.73380	0.98;0.437;0.828;0.715	T	0.64433	-0.6409	9	0.37606	T	0.19	.	13.3287	0.60475	0.1586:0.8414:0.0:0.0	.	179;179;179;179	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1	.;.;.;UD2A1_HUMAN	M	179	ENSP00000424478:V179M;ENSP00000421432:V179M;ENSP00000425497:V179M;ENSP00000286604:V179M	ENSP00000286604:V179M	V	-	1	0	UGT2A1	70547417	0.045000	0.20229	1.000000	0.80357	0.972000	0.66771	0.270000	0.18607	2.744000	0.94065	0.591000	0.81541	GTG	UGT2A1	-	pfam_UDP_glucos_trans	ENSG00000173610		0.423	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A1	HGNC	protein_coding	OTTHUMT00000251554.3	59	0.00	0	C	NM_006798		70512828	70512828	-1	no_errors	ENST00000503640	ensembl	human	known	69_37n	missense	42	28.81	17	SNP	0.994	T
UMODL1	89766	genome.wustl.edu	37	21	43557583	43557583	+	Silent	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr21:43557583C>T	ENST00000408910.2	+	22	3810	c.3810C>T	c.(3808-3810)gcC>gcT	p.A1270A	UMODL1_ENST00000400427.1_Silent_p.A1326A|UMODL1_ENST00000400424.2_Silent_p.A1198A|UMODL1_ENST00000408989.2_Silent_p.A1398A|UMODL1_ENST00000400423.2_3'UTR	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1270					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GCCTGGGTGCCGGTTATGTGG	0.572																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	dbGAP											0													167.0	176.0	173.0					21																	43557583		2071	4218	6289	-	-	-	SO:0001819	synonymous_variant	0				CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3810C>T	21.37:g.43557583C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_SEA,pfam_EGF-like_Ca-bd,pfam_EMI_domain,pfam_Whey_acidic_protein_4-diS_core,superfamily_Fibronectin_type3,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_EGF-like_Ca-bd,smart_Fibronectin_type3,smart_Zona_pellucida_Endoglin/CD105,pfscan_EG-like_dom,pfscan_EMI_domain,pfscan_Fibronectin_type3,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.A1398	ENST00000408910.2	37	c.4194	CCDS42936.1	21																																																																																			UMODL1	-	NULL	ENSG00000177398		0.572	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UMODL1	HGNC	protein_coding	OTTHUMT00000195292.2	78	0.00	0	C			43557583	43557583	+1	no_errors	ENST00000408989	ensembl	human	known	69_37n	silent	50	15.25	9	SNP	0.000	T
USH2A	7399	genome.wustl.edu	37	1	216424381	216424381	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:216424381C>G	ENST00000307340.3	-	12	2417	c.2031G>C	c.(2029-2031)caG>caC	p.Q677H	USH2A_ENST00000366942.3_Missense_Mutation_p.Q677H|USH2A_ENST00000366943.2_Missense_Mutation_p.Q677H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	677	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGAATCCATTCTGGCACTGAT	0.438										HNSCC(13;0.011)																												dbGAP											0													143.0	120.0	128.0					1																	216424381		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2031G>C	1.37:g.216424381C>G	ENSP00000305941:p.Gln677His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.Q677H	ENST00000307340.3	37	c.2031	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	7.968	0.748471	0.15710	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.62788	0.0;0.0;0.0	5.26	2.28	0.28536	EGF-like, laminin (4);	0.171581	0.27668	N	0.018351	T	0.50905	0.1643	L	0.56124	1.755	0.39406	D	0.966664	B;B	0.15141	0.012;0.002	B;B	0.16289	0.015;0.011	T	0.45160	-0.9280	10	0.54805	T	0.06	.	4.2826	0.10839	0.1303:0.6036:0.126:0.1401	.	677;677	O75445-2;O75445	.;USH2A_HUMAN	H	677	ENSP00000305941:Q677H;ENSP00000355910:Q677H;ENSP00000355909:Q677H	ENSP00000305941:Q677H	Q	-	3	2	USH2A	214491004	1.000000	0.71417	0.379000	0.26080	0.999000	0.98932	1.389000	0.34453	0.194000	0.20326	0.655000	0.94253	CAG	USH2A	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000042781		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	33	0.00	0	C	NM_007123		216424381	216424381	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.985	G
USP11	8237	genome.wustl.edu	37	X	47098833	47098833	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chrX:47098833G>T	ENST00000218348.3	+	3	499	c.499G>T	c.(499-501)Gtc>Ttc	p.V167F	USP11_ENST00000377107.2_Missense_Mutation_p.V124F	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	167	DUSP. {ECO:0000255|PROSITE- ProRule:PRU00613}.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						GCATTACCTGGTCAGCTGGTA	0.577																																						dbGAP											0													60.0	50.0	54.0					X																	47098833		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.499G>T	X.37:g.47098833G>T	ENSP00000218348:p.Val167Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.V167F	ENST00000218348.3	37	c.499	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726006	0.69074	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.25579	1.83;1.79	5.84	3.91	0.45181	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (3);	0.468250	0.20137	N	0.098465	T	0.43656	0.1257	M	0.70275	2.135	0.36735	D	0.881932	D	0.64830	0.994	D	0.65233	0.933	T	0.50294	-0.8845	10	0.49607	T	0.09	-17.9799	7.8368	0.29374	0.0852:0.3064:0.6084:0.0	.	167	P51784	UBP11_HUMAN	F	124;167	ENSP00000366311:V124F;ENSP00000218348:V167F	ENSP00000218348:V167F	V	+	1	0	USP11	46983777	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.042000	0.41222	1.168000	0.42723	0.597000	0.82753	GTC	USP11	-	pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP	ENSG00000102226		0.577	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		73	0.00	0	G	NM_004651		47098833	47098833	+1	no_errors	ENST00000218348	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	T
VNN2	8875	genome.wustl.edu	37	6	133078957	133078957	+	Silent	SNP	A	A	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr6:133078957A>T	ENST00000326499.6	-	1	190	c.66T>A	c.(64-66)acT>acA	p.T22T	VNN2_ENST00000525270.1_Intron|VNN2_ENST00000525289.1_Silent_p.T22T|VNN2_ENST00000526192.1_5'UTR	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	22					cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		AACTGTCCTGAGTACCAACCT	0.413																																						dbGAP											0													103.0	104.0	104.0					6																	133078957		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.66T>A	6.37:g.133078957A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Silent	SNP	pirsf_Biotinidase_euk,pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.T22	ENST00000326499.6	37	c.66	CCDS5161.1	6																																																																																			VNN2	-	pirsf_Biotinidase_euk	ENSG00000112303		0.413	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VNN2	HGNC	protein_coding	OTTHUMT00000042264.2	29	0.00	0	A			133078957	133078957	-1	no_errors	ENST00000326499	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.000	T
VSTM2A	222008	genome.wustl.edu	37	7	54636793	54636793	+	3'UTR	DEL	T	T	-			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr7:54636793delT	ENST00000407838.3	+	0	1132				VSTM2A_ENST00000498834.1_Intron|VSTM2A_ENST00000404951.1_Intron|GS1-18A18.1_ENST00000456049.1_RNA|VSTM2A_ENST00000402613.3_Intron	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A							extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			AAGTGCTGACTTTTTTCCAAT	0.453																																						dbGAP											0													195.0	176.0	182.0					7																	54636793		1884	4120	6004	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.*15T>-	7.37:g.54636793delT		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2E9|B5MC94	RNA	DEL	-	NULL	ENST00000407838.3	37	NULL	CCDS5512.2	7																																																																																			VSTM2A	-	-	ENSG00000170419		0.453	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1	96	0.00	0	T	NM_182546		54636793	54636793	+1	no_errors	ENST00000466888	ensembl	human	known	69_37n	rna	89	30.47	39	DEL	1.000	-
WDFY3	23001	genome.wustl.edu	37	4	85696135	85696135	+	Splice_Site	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr4:85696135C>G	ENST00000295888.4	-	29	5000		c.e29-1		WDFY3_ENST00000322366.6_Splice_Site	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3						aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGAGGCTTCACTATAAGAGAA	0.368																																						dbGAP											0													108.0	116.0	113.0					4																	85696135		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.4593-1G>C	4.37:g.85696135C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Splice_Site	SNP	-	e26-1	ENST00000295888.4	37	c.4593-1	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673640	0.88445	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4007	0.94629	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDFY3	85915159	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.436000	0.80404	2.650000	0.89964	0.655000	0.94253	.	WDFY3	-	-	ENSG00000163625		0.368	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	61	0.00	0	C	NM_014991	Intron	85696135	85696135	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	splice_site	36	40.00	24	SNP	1.000	G
WDR26	80232	genome.wustl.edu	37	1	224581617	224581617	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:224581617T>C	ENST00000414423.2	-	13	2066	c.1873A>G	c.(1873-1875)Att>Gtt	p.I625V	WDR26_ENST00000366852.2_3'UTR|WDR26_ENST00000295024.6_Missense_Mutation_p.I478V	NM_001115113.2|NM_025160.6	NP_001108585.2|NP_079436.4	Q9H7D7	WDR26_HUMAN	WD repeat domain 26	625						cytoplasm (GO:0005737)|nucleus (GO:0005634)				biliary_tract(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	18				GBM - Glioblastoma multiforme(131;0.0104)		ATGGATGGAATCTGTGGGTTC	0.473																																						dbGAP											0													142.0	120.0	127.0					1																	224581617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024669	CCDS31037.1, CCDS31037.2	1q42.13	2013-01-09			ENSG00000162923	ENSG00000162923		"""WD repeat domain containing"""	21208	protein-coding gene	gene with protein product	"""GID complex subunit 7 homolog (S. cerevisiae)"""						Standard	NM_001115113		Approved	FLJ21016, GID7	uc001hop.4	Q9H7D7	OTTHUMG00000037636	ENST00000414423.2:c.1873A>G	1.37:g.224581617T>C	ENSP00000408108:p.Ile625Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0MNN3|Q4G100|Q59EC4|Q5GLZ9|Q86UY4|Q9H3C2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I625V	ENST00000414423.2	37	c.1873	CCDS31037.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.73|10.73	1.433468|1.433468	0.25813|0.25813	.|.	.|.	ENSG00000162923|ENSG00000162923	ENST00000480676|ENST00000414423;ENST00000295024	.|T;T	.|0.80824	.|-1.42;-1.42	5.85|5.85	4.73|4.73	0.59995|0.59995	.|.	.|0.216967	.|0.48286	.|D	.|0.000181	T|T	0.64594|0.64594	0.2612|0.2612	N|N	0.16368|0.16368	0.405|0.405	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.09377	.|0.004	T|T	0.55854|0.55854	-0.8075|-0.8075	5|10	.|0.18710	.|T	.|0.47	.|.	10.3089|10.3089	0.43697|0.43697	0.0:0.1358:0.0:0.8642|0.0:0.1358:0.0:0.8642	.|.	.|609	.|Q9H7D7-2	.|.	G|V	258|625;478	.|ENSP00000408108:I625V;ENSP00000295024:I478V	.|ENSP00000295024:I478V	D|I	-|-	2|1	0|0	WDR26|WDR26	222648240|222648240	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.999000|0.999000	0.98932|0.98932	1.435000|1.435000	0.34969|0.34969	1.037000|1.037000	0.40024|0.40024	0.533000|0.533000	0.62120|0.62120	GAT|ATT	WDR26	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000162923		0.473	WDR26-001	KNOWN	basic|CCDS	protein_coding	WDR26	HGNC	protein_coding	OTTHUMT00000091760.2	50	0.00	0	T	NM_025160		224581617	224581617	-1	no_errors	ENST00000414423	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	C
WDR64	128025	genome.wustl.edu	37	1	241912945	241912945	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr1:241912945T>G	ENST00000366552.2	+	13	1868	c.1661T>G	c.(1660-1662)cTc>cGc	p.L554R	WDR64_ENST00000437684.2_Missense_Mutation_p.L554R	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	554										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CTACGACGCCTCATTTTCCTC	0.527																																						dbGAP											0													153.0	148.0	150.0					1																	241912945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1661T>G	1.37:g.241912945T>G	ENSP00000355510:p.Leu554Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L554R	ENST00000366552.2	37	c.1661		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.29|15.29	2.790576|2.790576	0.50102|0.50102	.|.	.|.	ENSG00000162843|ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635|ENST00000425826	T;T;T|.	0.51817|.	0.69;0.69;0.69|.	6.06|6.06	6.06|6.06	0.98353|0.98353	WD40 repeat-like-containing domain (1);|.	0.285434|.	0.25197|.	N|.	0.032410|.	T|T	0.57359|0.57359	0.2048|0.2048	M|M	0.64997|0.64997	1.995|1.995	0.26561|0.26561	N|N	0.973736|0.973736	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.65443|.	0.935;0.915|.	T|T	0.55036|0.55036	-0.8203|-0.8203	10|5	0.10377|.	T|.	0.69|.	-9.0733|-9.0733	14.1325|14.1325	0.65263|0.65263	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	554;274|.	B1ANS9;D1MPS4|.	WDR64_HUMAN;.|.	R|A	554;554;325|33	ENSP00000355510:L554R;ENSP00000402446:L554R;ENSP00000406656:L325R|.	ENSP00000355510:L554R|.	L|S	+|+	2|1	0|0	WDR64|WDR64	239979568|239979568	0.944000|0.944000	0.32072|0.32072	0.949000|0.949000	0.38748|0.38748	0.007000|0.007000	0.05969|0.05969	4.633000|4.633000	0.61318|0.61318	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	CTC|TCA	WDR64	-	superfamily_WD40_repeat_dom	ENSG00000162843		0.527	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		46	0.00	0	T	NM_144625		241912945	241912945	+1	no_errors	ENST00000366552	ensembl	human	known	69_37n	missense	74	25.25	25	SNP	0.459	G
XKR6	286046	genome.wustl.edu	37	8	10782233	10782233	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr8:10782233C>T	ENST00000416569.2	-	2	898	c.872G>A	c.(871-873)cGc>cAc	p.R291H	XKR6_ENST00000304437.2_Missense_Mutation_p.R12H	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	291						integral component of membrane (GO:0016021)		p.R291H(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		CTCCAGGAGGCGCAGCATGTT	0.592																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											109.0	100.0	103.0					8																	10782233		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.872G>A	8.37:g.10782233C>T	ENSP00000416707:p.Arg291His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBA0	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.R291H	ENST00000416569.2	37	c.872	CCDS5978.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	24.4|24.4	4.531591|4.531591	0.85706|0.85706	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000382461|ENST00000304437;ENST00000416569	.|T;T	.|0.69926	.|-0.44;-0.44	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73908|0.73908	0.3647|0.3647	L|L	0.31845|0.31845	0.965|0.965	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.73959|0.73959	-0.3818|-0.3818	5|10	.|0.39692	.|T	.|0.17	-2.1414|-2.1414	16.9339|16.9339	0.86198|0.86198	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|291	.|Q5GH73	.|XKR6_HUMAN	T|H	68|12;291	.|ENSP00000307120:R12H;ENSP00000416707:R291H	.|ENSP00000307120:R12H	A|R	-|-	1|2	0|0	XKR6|XKR6	10819643|10819643	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.639000|7.639000	0.83342|0.83342	2.215000|2.215000	0.71742|0.71742	0.457000|0.457000	0.33378|0.33378	GCC|CGC	XKR6	-	pfam_Transport_prot_XK	ENSG00000171044		0.592	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR6	HGNC	protein_coding	OTTHUMT00000383958.1	71	0.00	0	C	NM_173683		10782233	10782233	-1	no_errors	ENST00000416569	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	T
YLPM1	56252	genome.wustl.edu	37	14	75245153	75245153	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:75245153C>G	ENST00000552421.1	+	2	1001	c.877C>G	c.(877-879)Cag>Gag	p.Q293E	YLPM1_ENST00000238571.3_Missense_Mutation_p.Q293E|YLPM1_ENST00000325680.7_Missense_Mutation_p.Q293E			P49750	YLPM1_HUMAN	YLP motif containing 1	293					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GTTGTAGGAACAGCAGCAGTA	0.403																																						dbGAP											0													60.0	57.0	58.0					14																	75245153		1914	4114	6028	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.877C>G	14.37:g.75245153C>G	ENSP00000447921:p.Gln293Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.Q293E	ENST00000552421.1	37	c.877		14	.	.	.	.	.	.	.	.	.	.	C	14.42	2.528677	0.44969	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680	T;T;T	0.21932	1.98;1.98;1.98	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000006	T	0.35248	0.0925	L	0.29908	0.895	0.31699	N	0.640911	D	0.61697	0.99	D	0.72982	0.979	T	0.13150	-1.0520	10	0.33141	T	0.24	-8.5471	17.9935	0.89176	0.0:1.0:0.0:0.0	.	293	P49750-4	.	E	293;293;293;6	ENSP00000447921:Q293E;ENSP00000324463:Q293E;ENSP00000238571:Q293E	ENSP00000238571:Q293E	Q	+	1	0	YLPM1	74314906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.271000	0.58902	2.683000	0.91414	0.591000	0.81541	CAG	YLPM1	-	NULL	ENSG00000119596		0.403	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404450.1	38	0.00	0	C	NM_019589		75245153	75245153	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	G
MAP3K19	80122	genome.wustl.edu	37	2	135741343	135741343	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr2:135741343G>C	ENST00000375845.3	-	8	3155	c.3125C>G	c.(3124-3126)tCa>tGa	p.S1042*	MAP3K19_ENST00000358371.4_Nonsense_Mutation_p.S929*|MAP3K19_ENST00000392918.3_Nonsense_Mutation_p.S224*|MAP3K19_ENST00000392915.1_Nonsense_Mutation_p.S1059*|MAP3K19_ENST00000375844.3_Nonsense_Mutation_p.S224*|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392917.3_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1042							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CTTTTCATTTGAGATGAGAAA	0.403																																						dbGAP											0													98.0	98.0	98.0					2																	135741343		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3125C>G	2.37:g.135741343G>C	ENSP00000365005:p.Ser1042*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S1042*	ENST00000375845.3	37	c.3125	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261237	0.59431	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392915;ENST00000437365	.	.	.	5.1	4.14	0.48551	.	0.589102	0.14187	N	0.335636	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	3.818	0.08824	0.1578:0.0:0.5004:0.3418	.	.	.	.	X	1042;929;224;224;1059;432	.	ENSP00000351140:S929X	S	-	2	0	YSK4	135457813	0.813000	0.29090	0.997000	0.53966	0.346000	0.29079	1.810000	0.38932	2.628000	0.89032	0.549000	0.68633	TCA	YSK4	-	NULL	ENSG00000176601		0.403	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	HGNC	protein_coding	OTTHUMT00000158244.1	33	0.00	0	G	NM_025052		135741343	135741343	-1	no_errors	ENST00000375845	ensembl	human	known	69_37n	nonsense	33	17.50	7	SNP	0.848	C
ZBED3-AS1	728723	genome.wustl.edu	37	5	76442555	76442555	+	RNA	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr5:76442555G>C	ENST00000508401.1	+	0	200				ZBED3-AS1_ENST00000511547.1_RNA|ZBED3-AS1_ENST00000513406.1_RNA|ZBED3-AS1_ENST00000515419.1_RNA|ZBED3-AS1_ENST00000513591.1_RNA|ZBED3-AS1_ENST00000512001.1_RNA|ZBED3-AS1_ENST00000503969.1_RNA|ZBED3-AS1_ENST00000514114.1_RNA|ZBED3-AS1_ENST00000515356.2_RNA					ZBED3 antisense RNA 1																		GTCTGCTAAAGAGAAAGGGAA	0.443																																						dbGAP											0																																										-	-	-			0					5q13.3	2012-10-12	2012-08-15		ENSG00000250802	ENSG00000250802		"""Long non-coding RNAs"""	44188	non-coding RNA	RNA, long non-coding			"""ZBED3 antisense RNA 1 (non-protein coding)"""				Standard	NR_024398		Approved		uc003kez.3		OTTHUMG00000162473		5.37:g.76442555G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000508401.1	37	NULL		5																																																																																			ZBED3-AS1	-	-	ENSG00000250802		0.443	ZBED3-AS1-016	KNOWN	basic|exp_conf	antisense	ZBED3-AS1	HGNC	antisense	OTTHUMT00000369077.2	16	0.00	0	G	NR_024398		76442555	76442555	+1	no_errors	ENST00000515356	ensembl	human	known	69_37n	rna	14	26.32	5	SNP	1.000	C
ZFHX2	85446	genome.wustl.edu	37	14	23995766	23995766	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:23995766G>C	ENST00000419474.3	-	9	3740	c.3385C>G	c.(3385-3387)Cca>Gca	p.P1129A	RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1129	Pro-rich.				adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						TCAGGGACTGGAGATGGGGCT	0.632																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.3385C>G	14.37:g.23995766G>C	ENSP00000413418:p.Pro1129Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UPU6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.P1129A	ENST00000419474.3	37	c.3385	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797892	0.31777	.	.	ENSG00000136367	ENST00000419474	T	0.77877	-1.13	5.8	5.8	0.92144	.	0.000000	0.39544	N	0.001324	D	0.82848	0.5126	L	0.54323	1.7	0.26095	N	0.980894	D	0.67145	0.996	P	0.61070	0.883	T	0.74275	-0.3718	10	0.18276	T	0.48	.	16.9734	0.86306	0.0:0.0:1.0:0.0	.	1129	Q9C0A1	ZFHX2_HUMAN	A	1129	ENSP00000413418:P1129A	ENSP00000413418:P1129A	P	-	1	0	ZFHX2	23065606	0.974000	0.33945	1.000000	0.80357	0.827000	0.46813	3.519000	0.53458	2.750000	0.94351	0.467000	0.42956	CCA	ZFHX2	-	NULL	ENSG00000136367		0.632	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	40	0.00	0	G	NM_014894		23995766	23995766	-1	no_errors	ENST00000419474	ensembl	human	known	69_37n	missense	28	45.10	23	SNP	0.999	C
ZFHX2	85446	genome.wustl.edu	37	14	24003350	24003350	+	Silent	SNP	G	G	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:24003350G>C	ENST00000419474.3	-	2	1540	c.1185C>G	c.(1183-1185)acC>acG	p.T395T	RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	395					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						CCTCCTTGGAGGTGGGTGAGC	0.652																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.1185C>G	14.37:g.24003350G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UPU6	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.T395	ENST00000419474.3	37	c.1185	CCDS55907.1	14																																																																																			ZFHX2	-	NULL	ENSG00000136367		0.652	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	40	0.00	0	G	NM_014894		24003350	24003350	-1	no_errors	ENST00000419474	ensembl	human	known	69_37n	silent	38	40.62	26	SNP	1.000	C
ZDHHC22	283576	genome.wustl.edu	37	14	77605777	77605777	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr14:77605777C>G	ENST00000319374.4	-	2	507	c.305G>C	c.(304-306)aGa>aCa	p.R102T	RP11-463C8.4_ENST00000557752.1_Intron|AC007375.1_ENST00000600936.1_5'Flank	NM_174976.2	NP_777636.2	Q8N966	ZDH22_HUMAN	zinc finger, DHHC-type containing 22	102					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)|urinary_tract(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		CAGGGTGACTCTGGCGCACAC	0.622																																						dbGAP											0													32.0	37.0	35.0					14																	77605777		2179	4268	6447	-	-	-	SO:0001583	missense	0			AK095612	CCDS45140.1	14q24.3	2008-08-06	2004-03-05	2004-03-10	ENSG00000177108	ENSG00000177108		"""Zinc fingers, DHHC-type"""	20106	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 59"""	C14orf59			Standard	NM_174976		Approved		uc010asp.3	Q8N966		ENST00000319374.4:c.305G>C	14.37:g.77605777C>G	ENSP00000318222:p.Arg102Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH02|B7Z2L5|Q149P4	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_SSD,pfscan_Znf_DHHC_palmitoyltrfase	p.R102T	ENST00000319374.4	37	c.305	CCDS45140.1	14	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433184	0.62844	.	.	ENSG00000177108	ENST00000319374;ENST00000555389	T	0.26223	1.75	5.57	5.57	0.84162	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.195575	0.44097	D	0.000481	T	0.36082	0.0954	L	0.50847	1.595	0.43569	D	0.995896	P	0.47545	0.897	P	0.48488	0.579	T	0.02037	-1.1225	10	0.40728	T	0.16	.	19.5542	0.95335	0.0:1.0:0.0:0.0	.	102	Q8N966	ZDH22_HUMAN	T	102	ENSP00000318222:R102T	ENSP00000318222:R102T	R	-	2	0	ZDHHC22	76675530	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.352000	0.66028	2.618000	0.88619	0.561000	0.74099	AGA	ZDHHC22	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000177108		0.622	ZDHHC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC22	HGNC	protein_coding	OTTHUMT00000414289.1	41	0.00	0	C	NM_174976		77605777	77605777	-1	no_errors	ENST00000319374	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	G
ZNF468	90333	genome.wustl.edu	37	19	53344462	53344462	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3W5-01A-11D-A228-09	TCGA-AC-A3W5-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	21da489e-0eea-4cb5-9b50-98ce50c9a617	b7bae67a-42a2-4fe7-b469-ef0725971eed	g.chr19:53344462T>C	ENST00000595646.1	-	4	1205	c.1085A>G	c.(1084-1086)aAa>aGa	p.K362R	ZNF468_ENST00000243639.4_3'UTR|ZNF28_ENST00000594602.1_Intron|ZNF468_ENST00000390651.4_Missense_Mutation_p.K309R|ZNF468_ENST00000396409.4_Missense_Mutation_p.K309R			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		ATTAAAAACTTTGCCACATTC	0.378																																						dbGAP											0													110.0	112.0	111.0					19																	53344462		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.1085A>G	19.37:g.53344462T>C	ENSP00000470381:p.Lys362Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K362R	ENST00000595646.1	37	c.1085	CCDS33094.1	19	.	.	.	.	.	.	.	.	.	.	-	17.12	3.308361	0.60305	.	.	ENSG00000204604	ENST00000243639;ENST00000396409;ENST00000390651;ENST00000393865	T;T	0.26223	1.75;1.75	1.92	1.92	0.25849	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35451	0.0932	L	0.42008	1.315	0.22701	N	0.998834	D	0.76494	0.999	D	0.67103	0.949	T	0.08534	-1.0717	9	0.72032	D	0.01	.	5.0464	0.14487	0.0:0.1699:0.0:0.8301	.	362	Q5VIY5	ZN468_HUMAN	R	362;309;309;112	ENSP00000379690:K309R;ENSP00000445669:K309R	ENSP00000243639:K362R	K	-	2	0	ZNF468	58036274	0.934000	0.31675	0.005000	0.12908	0.419000	0.31324	2.078000	0.41567	0.867000	0.35654	0.341000	0.21757	AAA	ZNF468	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204604		0.378	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF468	HGNC	protein_coding	OTTHUMT00000463098.1	51	0.00	0	T	NM_001008801		53344462	53344462	-1	no_errors	ENST00000243639	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.936	C
