#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48431572	48431572	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:48431572C>T	ENST00000435803.1	+	38	11733	c.11709C>T	c.(11707-11709)ggC>ggT	p.G3903G		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3903	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCATCAATGGCAAGAACCTAC	0.527																																						dbGAP											0													88.0	89.0	88.0					7																	48431572		1999	4164	6163	-	-	-	SO:0001819	synonymous_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11709C>T	7.37:g.48431572C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q169*	ENST00000435803.1	37	c.505	CCDS47584.1	7																																																																																			ABCA13	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000179869		0.527	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	82	0.00	0	C	NM_152701		48431572	48431572	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453246	ensembl	human	known	69_37n	nonsense	41	25.45	14	SNP	1.000	T
ACYP2	98	genome.wustl.edu	37	2	54532174	54532174	+	3'UTR	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:54532174G>A	ENST00000394666.3	+	0	730					NM_138448.3	NP_612457.1	P14621	ACYP2_HUMAN	acylphosphatase 2, muscle type						phosphate-containing compound metabolic process (GO:0006796)	mitochondrion (GO:0005739)	acylphosphatase activity (GO:0003998)			lung(1)	1						TATTTAGTGTGAACATTTAAT	0.239																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X84195	CCDS1850.1	2p16.2	2008-02-05			ENSG00000170634	ENSG00000170634	3.6.1.7		180	protein-coding gene	gene with protein product		102595				8268218	Standard	NM_138448		Approved		uc002rxq.4	P14621	OTTHUMG00000129287	ENST00000394666.3:c.*235G>A	2.37:g.54532174G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000394666.3	37	NULL	CCDS1850.1	2																																																																																			ACYP2	-	-	ENSG00000170634		0.239	ACYP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACYP2	HGNC	protein_coding	OTTHUMT00000251415.3	37	0.00	0	G			54532174	54532174	+1	no_errors	ENST00000494922	ensembl	human	known	69_37n	rna	38	13.64	6	SNP	0.000	A
ADAM12	8038	genome.wustl.edu	37	10	127806611	127806611	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:127806611C>A	ENST00000368679.4	-	6	917	c.608G>T	c.(607-609)aGa>aTa	p.R203I	ADAM12_ENST00000368676.4_Missense_Mutation_p.R203I	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	203					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.R203K(3)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CCTTACCCTTCTTGCCCATGT	0.488																																						dbGAP											3	Substitution - Missense(3)	lung(3)											192.0	173.0	179.0					10																	127806611		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.608G>T	10.37:g.127806611C>A	ENSP00000357668:p.Arg203Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.R203I	ENST00000368679.4	37	c.608	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	C	9.665	1.145078	0.21288	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.25749	4.54;1.78;3.52	4.89	2.97	0.34412	.	0.766324	0.12361	N	0.475613	T	0.13543	0.0328	N	0.08118	0	0.49915	D	0.999835	B;B;B;B;B	0.26672	0.097;0.156;0.156;0.005;0.029	B;B;B;B;B	0.29598	0.048;0.104;0.104;0.012;0.008	T	0.08848	-1.0702	10	0.37606	T	0.19	.	7.7512	0.28898	0.0:0.747:0.1617:0.0913	.	200;200;203;200;203	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	I	203;203;200	ENSP00000357668:R203I;ENSP00000357665:R203I;ENSP00000391268:R200I	ENSP00000357665:R203I	R	-	2	0	ADAM12	127796601	0.604000	0.26932	0.581000	0.28614	0.232000	0.25224	0.856000	0.27818	0.602000	0.29896	0.655000	0.94253	AGA	ADAM12	-	NULL	ENSG00000148848		0.488	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	66	0.00	0	C			127806611	127806611	-1	no_errors	ENST00000368679	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	0.829	A
ADAM21P1	145241	genome.wustl.edu	37	14	70713858	70713858	+	RNA	SNP	T	T	C	rs61979492	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:70713858T>C	ENST00000530196.1	-	0	660					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TCTGTTAAGCTACATCTCATA	0.448																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713858T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.448	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	41	0.00	0	T	NG_002467		70713858	70713858	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	41	10.87	5	SNP	0.649	C
ADRB3	155	genome.wustl.edu	37	8	37821534	37821534	+	3'UTR	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:37821534G>C	ENST00000345060.3	-	0	1924				ADRB3_ENST00000520341.1_5'UTR	NM_000025.2	NP_000016.1	P13945	ADRB3_HUMAN	adrenoceptor beta 3						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|aging (GO:0007568)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|diet induced thermogenesis (GO:0002024)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|generation of precursor metabolites and energy (GO:0006091)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of MAPK cascade (GO:0043410)|response to antibiotic (GO:0046677)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta-adrenergic receptor activity (GO:0004939)|beta3-adrenergic receptor activity (GO:0015052)|epinephrine binding (GO:0051379)|norepinephrine binding (GO:0051380)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)	9	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)		Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Bethanidine(DB00217)|Bopindolol(DB08807)|Bupranolol(DB08808)|Clenbuterol(DB01407)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Isoprenaline(DB01064)|Mephentermine(DB01365)|Mirabegron(DB08893)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Propranolol(DB00571)|Trimipramine(DB00726)	CTGGGGTTTAGAAAACATCTC	0.567																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY487247	CCDS6099.1	8p12	2012-08-08	2012-05-09			ENSG00000188778		"""GPCR / Class A : Adrenoceptors : beta"""	288	protein-coding gene	gene with protein product		109691	"""adrenergic, beta-3-, receptor"""			7898940, 15123695	Standard	NM_000025		Approved		uc003xkr.2	P13945		ENST00000345060.3:c.*202C>G	8.37:g.37821534G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JFT4	RNA	SNP	-	NULL	ENST00000345060.3	37	NULL	CCDS6099.1	8																																																																																			ADRB3	-	-	ENSG00000188778		0.567	ADRB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRB3	HGNC	protein_coding	OTTHUMT00000376826.1	23	0.00	0	G	NM_000025		37821534	37821534	-1	no_errors	ENST00000520341	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.001	C
AGAP7P	653268	genome.wustl.edu	37	10	51465650	51465650	+	Missense_Mutation	SNP	C	C	T	rs199898426	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:51465650C>T	ENST00000374095.5	-	7	931	c.806G>A	c.(805-807)cGa>cAa	p.R269Q		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		269	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						TTTCCCACTTCGCTTTAAGAG	0.478													-|||	1906	0.380591	0.09	0.5461	5008	,	,		18818	0.4653		0.5726	False		,,,				2504	0.3712					dbGAP											0													21.0	21.0	21.0					10																	51465650		1626	3492	5118	-	-	-	SO:0001583	missense	0																														ENST00000374095.5:c.806G>A	10.37:g.51465650C>T	ENSP00000363208:p.Arg269Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGH4	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.R269Q	ENST00000374095.5	37	c.806	CCDS41524.1	10	983	0.4500915750915751	50	0.1016260162601626	198	0.5469613259668509	290	0.506993006993007	445	0.5870712401055409	.	12.66	2.003257	0.35320	.	.	ENSG00000204169	ENST00000374095	T	0.75154	-0.91	.	.	.	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.064498	0.64402	N	0.000013	T	0.00012	0.0000	M	0.64080	1.96	0.39154	P	0.037721000000000005	D	0.60160	0.987	P	0.58820	0.846	T	0.47446	-0.9117	7	0.59425	D	0.04	.	.	.	.	.	269	Q5VUJ5	AGAP7_HUMAN	Q	269	ENSP00000363208:R269Q	ENSP00000363208:R269Q	R	-	2	0	AGAP7	51135656	0.999000	0.42202	0.141000	0.22245	0.141000	0.21300	1.796000	0.38794	-1.393000	0.02079	-1.417000	0.01113	CGA	AGAP7	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000204169		0.478	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	138	0.00	0	C			51465650	51465650	-1	no_errors	ENST00000374095	ensembl	human	known	69_37n	missense	78	13.19	12	SNP	0.999	T
ALPK1	80216	genome.wustl.edu	37	4	113332979	113332979	+	Intron	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:113332979C>G	ENST00000458497.1	+	5	555				ALPK1_ENST00000504176.2_Intron|ALPK1_ENST00000177648.9_Intron|ALPK1_ENST00000505912.1_3'UTR	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1								ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CGCTGTTCCTCCAGGCGTCCC	0.602																																						dbGAP											0													35.0	32.0	33.0					4																	113332979		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.277-4C>G	4.37:g.113332979C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	RNA	SNP	-	NULL	ENST00000458497.1	37	NULL	CCDS3697.1	4																																																																																			ALPK1	-	-	ENSG00000073331		0.602	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	HGNC	protein_coding	OTTHUMT00000256421.2	58	0.00	0	C	NM_025144		113332979	113332979	+1	no_errors	ENST00000505912	ensembl	human	known	69_37n	rna	38	11.63	5	SNP	0.003	G
ANKRD20A11P	391267	genome.wustl.edu	37	21	15289974	15289974	+	IGR	SNP	C	C	T	rs3115462	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr21:15289974C>T								CYP4F29P (69289 upstream) : ANKRD20A11P (26115 downstream)																							ACCATATTGTCTTCCATATGT	0.308													t|||	2975	0.59405	0.6104	0.6614	5008	,	,		14737	0.5357		0.5865	False		,,,				2504	0.592					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															21.37:g.15289974C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		21																																																																																			ANKRD20A11P	-	-	ENSG00000215559	0	0.308					ANKRD20A11P	HGNC			146	0.68	1	C			15289974	15289974	-1	no_errors	ENST00000442192	ensembl	human	known	69_37n	rna	102	13.56	16	SNP	0.005	T
ANKRD27	84079	genome.wustl.edu	37	19	33098718	33098718	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:33098718G>A	ENST00000306065.4	-	23	2354	c.2196C>T	c.(2194-2196)gcC>gcT	p.A732A	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	732					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CAAGCCCACTGGCAGGAACCT	0.622																																						dbGAP											0													18.0	19.0	18.0					19																	33098718		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2196C>T	19.37:g.33098718G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Silent	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.A732	ENST00000306065.4	37	c.2196	CCDS32986.1	19																																																																																			ANKRD27	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000105186		0.622	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	62	0.00	0	G	NM_032139		33098718	33098718	-1	no_errors	ENST00000306065	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	0.041	A
AP2A2	161	genome.wustl.edu	37	11	1010694	1010694	+	3'UTR	SNP	C	C	T	rs1128413	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:1010694C>T	ENST00000448903.2	+	0	3030				AP2A2_ENST00000534328.1_Missense_Mutation_p.P375L|AP2A2_ENST00000332231.5_3'UTR	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCTTCGTGGCCATCCTGCAGA	0.592													C|||	2142	0.427716	0.3502	0.6628	5008	,	,		15795	0.2946		0.5686	False		,,,				2504	0.3579					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.*69C>T	11.37:g.1010694C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold	p.P375L	ENST00000448903.2	37	c.1124	CCDS44512.1	11	998	0.45695970695970695	168	0.34146341463414637	227	0.6270718232044199	180	0.3146853146853147	423	0.558047493403694	C	7.740	0.701069	0.15172	.	.	ENSG00000183020	ENST00000534328	T	0.24538	1.85	2.85	0.944	0.19537	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.999999999946489E-6	.	.	.	.	.	.	T	0.39333	-0.9619	5	0.87932	D	0	.	6.847	0.23994	0.0:0.7675:0.0:0.2325	rs1128413;rs3185348;rs60783032;rs1128413	.	.	.	L	375	ENSP00000436059:P375L	ENSP00000436059:P375L	P	+	2	0	AP2A2	1000694	0.003000	0.15002	0.002000	0.10522	0.002000	0.02628	1.569000	0.36428	0.270000	0.21984	0.478000	0.44815	CCA	AP2A2	-	NULL	ENSG00000183020		0.592	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	HGNC	protein_coding	OTTHUMT00000385431.2	55	0.00	0	C	NM_012305		1010694	1010694	+1	no_errors	ENST00000534328	ensembl	human	putative	69_37n	missense	25	13.79	4	SNP	0.003	T
AP3D1	8943	genome.wustl.edu	37	19	2129159	2129159	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:2129159C>T	ENST00000345016.5	-	8	967	c.736G>A	c.(736-738)Ggt>Agt	p.G246S	AP3D1_ENST00000355272.6_Missense_Mutation_p.G246S|AP3D1_ENST00000590683.1_5'UTR|AP3D1_ENST00000350812.6_Intron|AP3D1_ENST00000356926.4_Intron	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	246					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTAAGAGCACCGAACTGTGGG	0.672																																						dbGAP											0													27.0	30.0	29.0					19																	2129159		1995	4164	6159	-	-	-	SO:0001583	missense	0			U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.736G>A	19.37:g.2129159C>T	ENSP00000344055:p.Gly246Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.G246S	ENST00000345016.5	37	c.736	CCDS42459.1	19	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791453	0.70452	.	.	ENSG00000065000	ENST00000345016;ENST00000355272;ENST00000343722	T;T	0.22743	1.94;1.94	4.33	4.33	0.51752	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47985	0.1475	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.972	T	0.51880	-0.8649	9	.	.	.	-16.7671	16.337	0.83067	0.0:1.0:0.0:0.0	.	246;246	O14617-5;O14617	.;AP3D1_HUMAN	S	246	ENSP00000344055:G246S;ENSP00000347416:G246S	.	G	-	1	0	AP3D1	2080159	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	7.249000	0.78278	2.396000	0.81511	0.655000	0.94253	GGT	AP3D1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	ENSG00000065000		0.672	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	HGNC	protein_coding	OTTHUMT00000450912.1	85	0.00	0	C			2129159	2129159	-1	no_errors	ENST00000355272	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	1.000	T
AP5M1	55745	genome.wustl.edu	37	14	57735954	57735954	+	5'UTR	SNP	T	T	C	rs7152744	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:57735954T>C	ENST00000261558.3	+	0	328				EXOC5_ENST00000340918.7_5'Flank|AP5M1_ENST00000431972.2_5'UTR|EXOC5_ENST00000413566.2_5'Flank	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit						endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											GTTAAGAGTCTGTCTGAGAAA	0.532													C|||	1393	0.278155	0.8487	0.0908	5008	,	,		18851	0.0665		0.0557	False		,,,				2504	0.0869					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.-79T>C	14.37:g.57735954T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O95354|Q6ZMD7|Q96DX3|Q9NVC5	RNA	SNP	-	NULL	ENST00000261558.3	37	NULL	CCDS9729.1	14																																																																																			AP5M1	-	-	ENSG00000053770		0.532	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5M1	HGNC	protein_coding	OTTHUMT00000276922.1	13	0.00	0	T	NM_018229		57735954	57735954	+1	no_errors	ENST00000554213	ensembl	human	putative	69_37n	rna	14	26.32	5	SNP	0.000	C
ARHGAP26	23092	genome.wustl.edu	37	5	142500691	142500691	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:142500691C>G	ENST00000274498.4	+	18	2055	c.1677C>G	c.(1675-1677)atC>atG	p.I559M	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.I559M	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	559	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCATTGAGATCCTAATAGAAA	0.443																																						dbGAP											0													118.0	109.0	112.0					5																	142500691		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1677C>G	5.37:g.142500691C>G	ENSP00000274498:p.Ile559Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_IRSp53/MIM_homology_IMD,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.I559M	ENST00000274498.4	37	c.1677	CCDS4277.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.42|15.42	2.828398|2.828398	0.50845|0.50845	.|.	.|.	ENSG00000145819|ENSG00000145819	ENST00000274498;ENST00000378004;ENST00000418668|ENST00000443674;ENST00000418236	T;T|.	0.22743|.	1.94;1.94|.	5.38|5.38	4.43|4.43	0.53597|0.53597	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58708|0.58708	0.2141|0.2141	L|L	0.56280|0.56280	1.765|1.765	0.58432|0.58432	D|D	0.999996|0.999996	D;D;P|.	0.89917|.	1.0;0.991;0.922|.	D;P;P|.	0.80764|.	0.994;0.852;0.774|.	T|T	0.56571|0.56571	-0.7957|-0.7957	10|5	0.87932|.	D|.	0|.	.|.	7.2656|7.2656	0.26227|0.26227	0.1637:0.684:0.0:0.1523|0.1637:0.684:0.0:0.1523	.|.	559;132;559|.	Q9UNA1;B3KT96;Q9UNA1-2|.	RHG26_HUMAN;.;.|.	M|C	559;559;132|178;131	ENSP00000274498:I559M;ENSP00000367243:I559M|.	ENSP00000274498:I559M|.	I|S	+|+	3|2	3|0	ARHGAP26|ARHGAP26	142480884|142480884	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	0.979000|0.979000	0.29500|0.29500	2.515000|2.515000	0.84797|0.84797	0.655000|0.655000	0.94253|0.94253	ATC|TCC	ARHGAP26	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000145819		0.443	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP26	HGNC	protein_coding	OTTHUMT00000132744.3	34	0.00	0	C	NM_015071		142500691	142500691	+1	no_errors	ENST00000274498	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	G
ARHGAP29	9411	genome.wustl.edu	37	1	94643605	94643605	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:94643605C>G	ENST00000260526.6	-	21	2781	c.2599G>C	c.(2599-2601)Gag>Cag	p.E867Q	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	867	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTTGAATACTCTGCAAGGGAG	0.443																																						dbGAP											0													139.0	132.0	134.0					1																	94643605		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2599G>C	1.37:g.94643605C>G	ENSP00000260526:p.Glu867Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.E867Q	ENST00000260526.6	37	c.2599	CCDS748.1	1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838330	0.51057	.	.	ENSG00000137962	ENST00000260526	T	0.23950	1.88	5.75	5.75	0.90469	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.186596	0.26265	N	0.025369	T	0.17789	0.0427	N	0.25789	0.76	0.80722	D	1	B;B	0.34329	0.449;0.286	B;B	0.40444	0.329;0.254	T	0.06215	-1.0839	10	0.72032	D	0.01	-13.8093	19.9382	0.97149	0.0:1.0:0.0:0.0	.	867;867	F8VWZ8;Q52LW3	.;RHG29_HUMAN	Q	867	ENSP00000260526:E867Q	ENSP00000260526:E867Q	E	-	1	0	ARHGAP29	94416193	1.000000	0.71417	0.845000	0.33349	0.128000	0.20619	7.487000	0.81328	2.720000	0.93068	0.563000	0.77884	GAG	ARHGAP29	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000137962		0.443	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	56	0.00	0	C	NM_004815		94643605	94643605	-1	no_errors	ENST00000260526	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	G
GPR75-ASB3	100302652	genome.wustl.edu	37	2	53897525	53897525	+	3'UTR	SNP	C	C	G	rs3930	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:53897525C>G	ENST00000263634.3	-	0	1806				GPR75-ASB3_ENST00000406687.1_3'UTR|GPR75-ASB3_ENST00000352846.3_3'UTR|GPR75-ASB3_ENST00000482829.1_5'UTR|GPR75-ASB3_ENST00000394717.2_3'UTR|ASB3_ENST00000406625.2_3'UTR	NM_016115.4	NP_057199.1			GPR75-ASB3 readthrough																		TAACCTATCTCACAATCAATA	0.299													C|||	1395	0.278554	0.1657	0.1484	5008	,	,		14971	0.4534		0.2048	False		,,,				2504	0.4192					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS54361.1	2p16	2013-01-23			ENSG00000115239	ENSG00000115239			40043	other	readthrough							Standard	NM_001164165		Approved				OTTHUMG00000129279	ENST00000263634.3:c.*115G>C	2.37:g.53897525C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000263634.3	37	NULL	CCDS1846.1	2																																																																																			ASB3	-	-	ENSG00000115239		0.299	GPR75-ASB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB3	HGNC	protein_coding	OTTHUMT00000251402.3	53	0.00	0	C			53897525	53897525	-1	no_errors	ENST00000482829	ensembl	human	known	69_37n	rna	60	10.45	7	SNP	0.000	G
ATF4	468	genome.wustl.edu	37	22	39918248	39918248	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:39918248C>G	ENST00000337304.2	+	2	1579	c.697C>G	c.(697-699)Cag>Gag	p.Q233E	ATF4_ENST00000404241.2_Missense_Mutation_p.Q233E|ATF4_ENST00000396680.1_Missense_Mutation_p.Q233E	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	233					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	GGGGTCTCCTCAGCACAGCCC	0.542																																						dbGAP											0													25.0	25.0	25.0					22																	39918248		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.697C>G	22.37:g.39918248C>G	ENSP00000336790:p.Gln233Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UH31	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.Q233E	ENST00000337304.2	37	c.697	CCDS13996.1	22	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410231	0.42715	.	.	ENSG00000128272	ENST00000404241;ENST00000337304;ENST00000396680	T;T;T	0.24538	1.85;1.85;1.85	5.24	4.21	0.49690	.	0.094208	0.45606	D	0.000356	T	0.36331	0.0963	M	0.71581	2.175	0.47037	D	0.999299	D	0.57899	0.981	P	0.46825	0.528	T	0.41627	-0.9498	10	0.87932	D	0	-18.0681	15.0995	0.72262	0.1429:0.8571:0.0:0.0	.	233	P18848	ATF4_HUMAN	E	233	ENSP00000384587:Q233E;ENSP00000336790:Q233E;ENSP00000379912:Q233E	ENSP00000336790:Q233E	Q	+	1	0	ATF4	38248194	0.999000	0.42202	0.954000	0.39281	0.383000	0.30230	5.010000	0.64004	1.171000	0.42768	0.462000	0.41574	CAG	ATF4	-	NULL	ENSG00000128272		0.542	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATF4	HGNC	protein_coding	OTTHUMT00000321305.1	64	0.00	0	C	NM_001675		39918248	39918248	+1	no_errors	ENST00000337304	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	G
ATM	472	genome.wustl.edu	37	11	108216491	108216491	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:108216491G>A	ENST00000452508.2	+	59	8629	c.8440G>A	c.(8440-8442)Gaa>Aaa	p.E2814K	C11orf65_ENST00000526725.1_Intron|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.E2814K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2814	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.K2810fs*1(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAAGTCTTTTGAAGAGAAATA	0.264			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)											96.0	101.0	100.0					11																	108216491		2200	4298	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8440G>A	11.37:g.108216491G>A	ENSP00000388058:p.Glu2814Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E2814K	ENST00000452508.2	37	c.8440	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654643	0.88056	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.01516	4.81;4.81	5.56	4.65	0.58169	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.049824	0.85682	D	0.000000	T	0.04048	0.0113	L	0.33189	0.99	0.80722	D	1	D	0.55800	0.973	P	0.54924	0.764	T	0.57365	-0.7824	10	0.46703	T	0.11	.	14.2859	0.66245	0.0715:0.0:0.9285:0.0	.	2814	Q13315	ATM_HUMAN	K	2814	ENSP00000278616:E2814K;ENSP00000388058:E2814K	ENSP00000278616:E2814K	E	+	1	0	ATM	107721701	1.000000	0.71417	0.999000	0.59377	0.890000	0.51754	6.374000	0.73132	1.352000	0.45808	0.650000	0.86243	GAA	ATM	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000149311		0.264	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	44	0.00	0	G	NM_000051		108216491	108216491	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	50	12.28	7	SNP	1.000	A
ATP10B	23120	genome.wustl.edu	37	5	160113187	160113187	+	Silent	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:160113187G>T	ENST00000327245.5	-	6	1215	c.369C>A	c.(367-369)gcC>gcA	p.A123A	ATP10B_ENST00000518411.1_5'Flank|CTC-529G1.1_ENST00000524198.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	123					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAGGACAATGGCCAATGGTA	0.443																																						dbGAP											0													100.0	94.0	96.0					5																	160113187		1929	4134	6063	-	-	-	SO:0001819	synonymous_variant	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.369C>A	5.37:g.160113187G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.A123	ENST00000327245.5	37	c.369	CCDS43394.1	5																																																																																			ATP10B	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.443	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	42	0.00	0	G	NM_025153		160113187	160113187	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	silent	34	10.26	4	SNP	1.000	T
ATP7A	538	genome.wustl.edu	37	X	77254129	77254129	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:77254129G>C	ENST00000341514.6	+	5	1646	c.1491G>C	c.(1489-1491)atG>atC	p.M497I	ATP7A_ENST00000343533.5_Missense_Mutation_p.M497I|ATP7A_ENST00000350425.4_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	497	HMA 5. {ECO:0000255|PROSITE- ProRule:PRU00280}.				blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TCACTGGCATGACTTGCGCTT	0.408																																						dbGAP											0													177.0	158.0	164.0					X																	77254129		2203	4296	6499	-	-	-	SO:0001583	missense	0			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.1491G>C	X.37:g.77254129G>C	ENSP00000345728:p.Met497Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_HG_scavenger,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.M497I	ENST00000341514.6	37	c.1491	CCDS35339.1	X	.	.	.	.	.	.	.	.	.	.	G	31	5.097152	0.94197	.	.	ENSG00000165240	ENST00000343533;ENST00000341514;ENST00000355691	D;D	0.91577	-2.87;-2.87	5.37	5.37	0.77165	Heavy metal-associated domain, HMA (3);Heavy metal-associated domain, copper ion-binding (1);Heavy-metal-associated, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.96312	0.8797	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;0.983	D;D	0.91635	0.999;0.91	D	0.96887	0.9650	10	0.66056	D	0.02	-1.0129	18.4269	0.90612	0.0:0.0:1.0:0.0	.	497;507	Q04656;Q59HD1	ATP7A_HUMAN;.	I	497;497;507	ENSP00000343026:M497I;ENSP00000345728:M497I	ENSP00000345728:M497I	M	+	3	0	ATP7A	77140785	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.761000	0.98940	2.379000	0.81126	0.600000	0.82982	ATG	ATP7A	-	pfam_HeavyMe-assoc_HMA,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,tigrfam_HMA_Cu_ion-bd	ENSG00000165240		0.408	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7A	HGNC	protein_coding	OTTHUMT00000057306.1	25	0.00	0	G	NM_000052		77254129	77254129	+1	no_errors	ENST00000341514	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	C
ATXN2	6311	genome.wustl.edu	37	12	111908400	111908400	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:111908400G>A	ENST00000377617.3	-	19	3306	c.3145C>T	c.(3145-3147)Cag>Tag	p.Q1049*	ATXN2_ENST00000389153.4_Nonsense_Mutation_p.Q786*|ATXN2_ENST00000542287.2_Nonsense_Mutation_p.Q784*|ATXN2_ENST00000550104.1_3'UTR|ATXN2_ENST00000535949.1_Nonsense_Mutation_p.Q760*|ATXN2_ENST00000608853.1_Nonsense_Mutation_p.Q889*	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	1049	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						ACAAGGGGCTGATTTGGGAAC	0.478																																						dbGAP											0													154.0	145.0	148.0					12																	111908400		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3145C>T	12.37:g.111908400G>A	ENSP00000366843:p.Gln1049*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLD4|Q6ZQZ7|Q99493	Nonsense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.Q1049*	ENST00000377617.3	37	c.3145	CCDS31902.1	12	.	.	.	.	.	.	.	.	.	.	G	40	8.033491	0.98621	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000482777;ENST00000542287;ENST00000535949	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-6.9124	19.888	0.96917	0.0:0.0:1.0:0.0	.	.	.	.	X	104;786;1049;68;784;760	.	ENSP00000366843:Q1049X	Q	-	1	0	ATXN2	110392783	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.476000	0.97823	2.720000	0.93068	0.591000	0.81541	CAG	ATXN2	-	NULL	ENSG00000204842		0.478	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	128	0.00	0	G	NM_002973		111908400	111908400	-1	no_errors	ENST00000377617	ensembl	human	known	69_37n	nonsense	67	10.53	8	SNP	1.000	A
BAI3	577	genome.wustl.edu	37	6	69703812	69703812	+	Silent	SNP	A	A	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:69703812A>G	ENST00000370598.1	+	11	2708	c.1887A>G	c.(1885-1887)acA>acG	p.T629T		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	629					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGACAGACACATTTAAAAGGG	0.443																																						dbGAP											0													114.0	114.0	114.0					6																	69703812		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1887A>G	6.37:g.69703812A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.T629	ENST00000370598.1	37	c.1887	CCDS4968.1	6																																																																																			BAI3	-	pfam_DUF3497,prints_GPCR_2_brain-spec_angio_inhib	ENSG00000135298		0.443	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	46	0.00	0	A			69703812	69703812	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.345	G
BCAS3	54828	genome.wustl.edu	37	17	59469713	59469713	+	3'UTR	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:59469713G>A	ENST00000390652.5	+	0	3045				RP11-332H18.4_ENST00000589814.1_RNA|RP11-332H18.5_ENST00000585765.1_RNA|RP11-332H18.4_ENST00000591313.1_RNA|RP11-332H18.4_ENST00000592009.1_RNA|BCAS3_ENST00000407086.3_3'UTR|BCAS3_ENST00000588874.1_3'UTR|BCAS3_ENST00000408905.3_3'UTR|RP11-332H18.4_ENST00000592377.1_RNA|BCAS3_ENST00000585812.1_3'UTR|RP11-332H18.4_ENST00000586706.1_RNA|BCAS3_ENST00000589222.1_3'UTR|RP11-332H18.4_ENST00000590421.1_RNA|BCAS3_ENST00000588462.1_3'UTR	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTGGCCAGGAGAGACTGTAGA	0.567																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.*227G>A	17.37:g.59469713G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000390652.5	37	NULL	CCDS45749.1	17																																																																																			BCAS3	-	-	ENSG00000141376		0.567	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449578.1	153	0.00	0	G	NM_017679		59469713	59469713	+1	no_errors	ENST00000585812	ensembl	human	known	69_37n	rna	78	18.75	18	SNP	0.652	A
BLOC1S2	282991	genome.wustl.edu	37	10	102046401	102046401	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:102046401C>T	ENST00000370372.2	-	1	68	c.16G>A	c.(16-18)Gag>Aag	p.E6K	BLOC1S2_ENST00000361832.2_5'UTR|BLOC1S2_ENST00000441611.1_5'Flank	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	6					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)			large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		AGTACGCCCTCGGCTGCCGCC	0.751																																						dbGAP											0													9.0	12.0	11.0					10																	102046401		2134	4207	6341	-	-	-	SO:0001583	missense	0			AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.16G>A	10.37:g.102046401C>T	ENSP00000359398:p.Glu6Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQV2|Q5W040|Q8WUI8	Missense_Mutation	SNP	pfam_BLOC1_su2	p.E6K	ENST00000370372.2	37	c.16	CCDS7490.1	10	.	.	.	.	.	.	.	.	.	.	-	15.17	2.754105	0.49362	.	.	ENSG00000196072	ENST00000358848	.	.	.	4.94	4.94	0.65067	.	0.371362	0.28730	N	0.014329	T	0.48466	0.1501	N	0.24115	0.695	0.36238	D	0.853064	D	0.56521	0.976	P	0.50825	0.651	T	0.60561	-0.7239	9	0.66056	D	0.02	-2.0709	13.5579	0.61770	0.0:1.0:0.0:0.0	.	6	Q6QNY1	BL1S2_HUMAN	K	6	.	ENSP00000351716:E6K	E	-	1	0	BLOC1S2	102036391	0.078000	0.21339	0.730000	0.30809	0.023000	0.10783	1.127000	0.31357	2.574000	0.86865	0.550000	0.68814	GAG	BLOC1S2	-	NULL	ENSG00000196072		0.751	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S2	HGNC	protein_coding	OTTHUMT00000049861.2	10	0.00	0	C	NM_173809		102046401	102046401	-1	no_errors	ENST00000370372	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.970	T
BTK	695	genome.wustl.edu	37	X	100629447	100629447	+	Intron	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:100629447C>G	ENST00000308731.7	-	3	404				BTK_ENST00000372880.1_Intron|BTK_ENST00000464567.1_5'UTR	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase						adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CATCACCAGTCTATTTACAGA	0.383									Agammaglobulinemia, X-linked																													dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.240+76G>C	X.37:g.100629447C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAW1|Q32ML5	RNA	SNP	-	NULL	ENST00000308731.7	37	NULL	CCDS14482.1	X																																																																																			BTK	-	-	ENSG00000010671		0.383	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	23	0.00	0	C	NM_000061		100629447	100629447	-1	no_errors	ENST00000464567	ensembl	human	known	69_37n	rna	11	21.43	3	SNP	0.000	G
C10orf128	170371	genome.wustl.edu	37	10	50374819	50374819	+	Intron	SNP	T	T	C	rs9418839	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:50374819T>C	ENST00000474718.1	-	3	261				C10orf128_ENST00000374148.1_Intron|C10orf128_ENST00000470884.1_5'UTR|C10orf128_ENST00000374151.3_Intron|C10orf128_ENST00000374153.2_Intron	NM_001010863.1	NP_001010863.1	Q5T292	CJ128_HUMAN	chromosome 10 open reading frame 128							integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3						GGCTCTGCGCTTGTGGGTTCA	0.557													T|||	1958	0.390974	0.3676	0.3674	5008	,	,		20170	0.4018		0.3519	False		,,,				2504	0.4683					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC031641	CCDS41519.1, CCDS73128.1	10q11.23	2012-06-13			ENSG00000204161	ENSG00000204161			27274	protein-coding gene	gene with protein product						12477932	Standard	NM_001010863		Approved	Em:AC084727.5	uc001jhn.4	Q5T292	OTTHUMG00000018188	ENST00000474718.1:c.238+94A>G	10.37:g.50374819T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6XND2|Q5T289|Q5T291	Silent	SNP	NULL	p.Q132	ENST00000474718.1	37	c.396	CCDS41519.1	10																																																																																			C10orf128	-	NULL	ENSG00000204161		0.557	C10orf128-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf128	HGNC	protein_coding	OTTHUMT00000047978.1	55	0.00	0	T	NM_001010863		50374819	50374819	-1	no_errors	ENST00000374156	ensembl	human	known	69_37n	silent	37	17.78	8	SNP	0.027	C
C12orf50	160419	genome.wustl.edu	37	12	88420369	88420369	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:88420369G>T	ENST00000298699.2	-	3	209	c.29C>A	c.(28-30)tCa>tAa	p.S10*	C12orf50_ENST00000546547.1_5'Flank|C12orf50_ENST00000550553.1_Nonsense_Mutation_p.S10*	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	10								p.S10L(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						CCAGAAGCATGAAATGCTGCA	0.378																																						dbGAP											1	Substitution - Missense(1)	lung(1)											90.0	87.0	88.0					12																	88420369		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.29C>A	12.37:g.88420369G>T	ENSP00000298699:p.Ser10*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P674	Nonsense_Mutation	SNP	NULL	p.S10*	ENST00000298699.2	37	c.29	CCDS9031.1	12	.	.	.	.	.	.	.	.	.	.	G	38	6.932302	0.97944	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944;ENST00000551163	.	.	.	5.72	5.72	0.89469	.	0.117945	0.38837	N	0.001554	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	16.7818	0.85564	0.0:0.0:1.0:0.0	.	.	.	.	X	10;10;64;10	.	ENSP00000298699:S10X	S	-	2	0	C12orf50	86944500	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.835000	0.55805	2.686000	0.91538	0.563000	0.77884	TCA	C12orf50	-	NULL	ENSG00000165805		0.378	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf50	HGNC	protein_coding	OTTHUMT00000406328.1	44	0.00	0	G	NM_152589		88420369	88420369	-1	no_errors	ENST00000298699	ensembl	human	known	69_37n	nonsense	21	16.00	4	SNP	1.000	T
C3P1	388503	genome.wustl.edu	37	19	10181757	10181757	+	RNA	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:10181757G>C	ENST00000495140.1	+	0	2988							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						CGACTACTACGAGCCTTGTAA	0.627																																						dbGAP											0																																										-	-	-			0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10181757G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000495140.1	37	NULL		19																																																																																			C3P1	-	-	ENSG00000167798		0.627	C3P1-002	KNOWN	basic	processed_transcript	C3P1	HGNC	pseudogene	OTTHUMT00000351284.1	43	0.00	0	G	NR_027300		10181757	10181757	+1	no_errors	ENST00000495140	ensembl	human	known	69_37n	rna	23	20.00	6	SNP	0.687	C
C9orf72	203228	genome.wustl.edu	37	9	27547313	27547313	+	3'UTR	SNP	G	G	T	rs3739526	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr9:27547313G>T	ENST00000380003.3	-	0	2430				C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72						autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		TAATCTCAGAGTTGCAATGAT	0.333													g|||	1042	0.208067	0.0953	0.268	5008	,	,		16693	0.2917		0.161	False		,,,				2504	0.2802					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.*921C>A	9.37:g.27547313G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	RNA	SNP	-	NULL	ENST00000380003.3	37	NULL	CCDS6522.1	9																																																																																			C9orf72	-	-	ENSG00000147894		0.333	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf72	HGNC	protein_coding	OTTHUMT00000051969.1	32	0.00	0	G	NM_018325		27547313	27547313	-1	no_errors	ENST00000488117	ensembl	human	known	69_37n	rna	29	17.14	6	SNP	0.000	T
CABS1	85438	genome.wustl.edu	37	4	71201621	71201621	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:71201621G>A	ENST00000273936.5	+	1	939	c.865G>A	c.(865-867)Gaa>Aaa	p.E289K		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	289					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GCTAACTGATGAAGAAACTAC	0.403																																						dbGAP											0													105.0	98.0	100.0					4																	71201621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.865G>A	4.37:g.71201621G>A	ENSP00000273936:p.Glu289Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.E289K	ENST00000273936.5	37	c.865	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568183	0.45798	.	.	ENSG00000145309	ENST00000273936	T	0.37058	1.22	4.57	2.7	0.31948	.	0.166608	0.28538	N	0.014985	T	0.20861	0.0502	L	0.34521	1.04	0.25876	N	0.983654	P	0.36144	0.539	B	0.29598	0.104	T	0.13602	-1.0503	10	0.51188	T	0.08	-3.821	5.6375	0.17544	0.1071:0.2014:0.6915:0.0	.	289	Q96KC9	CABS1_HUMAN	K	289	ENSP00000273936:E289K	ENSP00000273936:E289K	E	+	1	0	CABS1	71236210	0.983000	0.35010	0.812000	0.32479	0.045000	0.14185	2.609000	0.46317	1.280000	0.44463	0.655000	0.94253	GAA	CABS1	-	NULL	ENSG00000145309		0.403	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	CABS1	HGNC	protein_coding	OTTHUMT00000251561.3	77	0.00	0	G	NM_033122		71201621	71201621	+1	no_errors	ENST00000273936	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	0.704	A
CASP8AP2	9994	genome.wustl.edu	37	6	90573055	90573055	+	RNA	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:90573055G>A	ENST00000551025.1	+	0	3064									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AATGAAAGCTGAGAGTGGTCC	0.348																																					Colon(187;1656 2025 17045 31481 39901)	dbGAP											0													26.0	28.0	27.0					6																	90573055		1817	4083	5900	-	-	-			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90573055G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.348	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		20	0.00	0	G	NM_001137667		90573055	90573055	+1	no_errors	ENST00000237177	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.090	A
CC2D2A	57545	genome.wustl.edu	37	4	15565037	15565037	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:15565037G>A	ENST00000503292.1	+	25	3254	c.3074G>A	c.(3073-3075)aGa>aAa	p.R1025K	RP11-799M12.2_ENST00000609724.1_RNA|CC2D2A_ENST00000389652.5_Missense_Mutation_p.R976K|CC2D2A_ENST00000413206.1_Missense_Mutation_p.R1025K|CC2D2A_ENST00000424120.1_Missense_Mutation_p.R1025K	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	1025					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						CGGCCAAGGAGAAAAGGTCGG	0.478																																						dbGAP											0													79.0	82.0	81.0					4																	15565037		1970	4156	6126	-	-	-	SO:0001583	missense	0			AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.3074G>A	4.37:g.15565037G>A	ENSP00000421809:p.Arg1025Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.R1025K	ENST00000503292.1	37	c.3074	CCDS47026.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.519741	0.96416	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.90317	0.6971	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.90198	0.4255	10	0.49607	T	0.09	.	19.2317	0.93842	0.0:0.0:1.0:0.0	.	1025;976	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	K	1025;1025;976;976;1025;976	ENSP00000403465:R1025K;ENSP00000398391:R1025K;ENSP00000421809:R1025K;ENSP00000374303:R976K	ENSP00000374303:R976K	R	+	2	0	CC2D2A	15174135	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	9.813000	0.99286	2.629000	0.89072	0.561000	0.74099	AGA	CC2D2A	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000048342		0.478	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CC2D2A	HGNC	protein_coding	OTTHUMT00000359906.2	61	0.00	0	G	NM_001080522		15565037	15565037	+1	no_errors	ENST00000413206	ensembl	human	known	69_37n	missense	32	10.81	4	SNP	1.000	A
CCDC101	112869	genome.wustl.edu	37	16	28601977	28601977	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:28601977G>C	ENST00000317058.3	+	8	779	c.592G>C	c.(592-594)Gaa>Caa	p.E198Q		NM_138414.2	NP_612423.1	Q96ES7	SGF29_HUMAN	coiled-coil domain containing 101	198	SGF29 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00851}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|SAGA-type complex (GO:0070461)	methylated histone binding (GO:0035064)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	10						CATCGATGAAGAAGGCAAAGA	0.577																																						dbGAP											0													187.0	171.0	177.0					16																	28601977		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK057008	CCDS10635.1	16p11.2	2010-08-03			ENSG00000176476	ENSG00000176476			25156	protein-coding gene	gene with protein product	"""SAGA-associated factor 29 homolog (yeast)"""	613374				17334388	Standard	NM_138414		Approved	FLJ32446, SGF29	uc002dqf.3	Q96ES7	OTTHUMG00000131763	ENST00000317058.3:c.592G>C	16.37:g.28601977G>C	ENSP00000316114:p.Glu198Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MF5	Missense_Mutation	SNP	pfam_SGF29_tudor-like_dom	p.E198Q	ENST00000317058.3	37	c.592	CCDS10635.1	16	.	.	.	.	.	.	.	.	.	.	.	17.30	3.355141	0.61293	.	.	ENSG00000176476	ENST00000317058	.	.	.	5.29	5.29	0.74685	SGF29 tudor-like domain (2);	0.124610	0.53938	D	0.000050	T	0.66228	0.2768	M	0.86420	2.815	0.80722	D	1	P	0.41524	0.753	B	0.34242	0.178	T	0.75388	-0.3335	9	0.66056	D	0.02	.	16.4172	0.83745	0.0:0.0:1.0:0.0	.	198	Q96ES7	SGF29_HUMAN	Q	198	.	ENSP00000316114:E198Q	E	+	1	0	CCDC101	28509478	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	6.770000	0.74990	2.480000	0.83734	0.655000	0.94253	GAA	CCDC101	-	pfam_SGF29_tudor-like_dom	ENSG00000176476		0.577	CCDC101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC101	HGNC	protein_coding	OTTHUMT00000254691.1	36	0.00	0	G	NM_138414		28601977	28601977	+1	no_errors	ENST00000317058	ensembl	human	known	69_37n	missense	42	12.24	6	SNP	1.000	C
CCDC152	100129792	genome.wustl.edu	37	5	42762647	42762647	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:42762647G>C	ENST00000361970.5	+	3	277	c.190G>C	c.(190-192)Gaa>Caa	p.E64Q	CCDC152_ENST00000388827.4_Missense_Mutation_p.E64Q	NM_001134848.1	NP_001128320.1	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152	64										endometrium(1)	1						CTCCATTAAAGAAGGTTAGTT	0.308																																						dbGAP											0													128.0	117.0	121.0					5																	42762647		692	1589	2281	-	-	-	SO:0001583	missense	0				CCDS47203.1	5p12	2008-07-14			ENSG00000198865	ENSG00000198865			34438	protein-coding gene	gene with protein product							Standard	NM_001134848		Approved	LOC100129792	uc003jmx.3	Q4G0S7	OTTHUMG00000162141	ENST00000361970.5:c.190G>C	5.37:g.42762647G>C	ENSP00000354888:p.Glu64Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXI4|B4E0P7|Q5BLP6	Missense_Mutation	SNP	NULL	p.E64Q	ENST00000361970.5	37	c.190	CCDS47203.1	5	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956109	0.34471	.	.	ENSG00000198865	ENST00000361970;ENST00000388827	T;T	0.56941	0.43;0.6	4.86	-0.128	0.13506	.	0.488362	0.18653	N	0.134950	T	0.34279	0.0892	L	0.31926	0.97	0.23528	N	0.99749	B;B	0.17852	0.024;0.024	B;B	0.17098	0.01;0.017	T	0.14172	-1.0482	10	0.37606	T	0.19	-1.7327	4.7038	0.12839	0.3521:0.1509:0.497:0.0	.	64;64	B4E0P7;Q4G0S7	.;CC152_HUMAN	Q	64	ENSP00000354888:E64Q;ENSP00000373479:E64Q	ENSP00000354888:E64Q	E	+	1	0	CCDC152	42798404	1.000000	0.71417	0.680000	0.29994	0.990000	0.78478	1.440000	0.35024	-0.378000	0.07918	0.555000	0.69702	GAA	CCDC152	-	NULL	ENSG00000198865		0.308	CCDC152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC152	HGNC	protein_coding	OTTHUMT00000367497.1	36	0.00	0	G	XM_001717416		42762647	42762647	+1	no_errors	ENST00000361970	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.943	C
CCDC57	284001	genome.wustl.edu	37	17	80071450	80071450	+	Intron	SNP	G	G	A	rs11653662	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:80071450G>A	ENST00000389641.4	-	18	2603				CCDC57_ENST00000392346.2_Nonsense_Mutation_p.R277*|CCDC57_ENST00000392347.1_Intron			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			ATTCCCCCTCGCATTCCTGGA	0.612													G|||	506	0.101038	0.0182	0.1239	5008	,	,		20004	0.0565		0.1998	False		,,,				2504	0.1411					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2567-11708C>T	17.37:g.80071450G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Nonsense_Mutation	SNP	NULL	p.R226*	ENST00000389641.4	37	c.676		17	262|262	0.11996336996336997|0.11996336996336997	11|11	0.022357723577235773|0.022357723577235773	53|53	0.1464088397790055|0.1464088397790055	39|39	0.06818181818181818|0.06818181818181818	159|159	0.20976253298153033|0.20976253298153033	G|G	8.375|8.375	0.836178|0.836178	0.16891|0.16891	.|.	.|.	ENSG00000176155|ENSG00000176155	ENST00000419322|ENST00000392346;ENST00000324808	.|.	.|.	.|.	0.78|0.78	-1.56|-1.56	0.08532|0.08532	.|.	.|.	.|.	.|.	.|.	T|.	0.00012|.	0.0000|.	.|.	.|.	.|.	0.09310|0.09310	P|P	0.99999826639|0.99999826639	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.21415|.	-1.0246|.	3|.	.|0.02654	.|T	.|1	.|.	6.6334|6.6334	0.22869|0.22869	0.3072:0.0:0.6928:0.0|0.3072:0.0:0.6928:0.0	rs11653662;rs56795972;rs11653662|rs11653662;rs56795972;rs11653662	.|.	.|.	.|.	V|X	376|277;226	.|.	.|ENSP00000315223:R226X	A|R	-|-	2|1	0|2	CCDC57|CCDC57	77664739|77664739	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.322000|-0.322000	0.08007|0.08007	-1.572000|-1.572000	0.01661|0.01661	-1.583000|-1.583000	0.00853|0.00853	GCG|CGA	CCDC57	-	NULL	ENSG00000176155		0.612	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	HGNC	protein_coding	OTTHUMT00000277182.3	80	0.00	0	G	NM_198082		80071450	80071450	-1	no_errors	ENST00000324808	ensembl	human	known	69_37n	nonsense	26	13.33	4	SNP	0.000	A
CCDC88A	55704	genome.wustl.edu	37	2	55539682	55539682	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:55539682C>G	ENST00000436346.1	-	23	4808	c.3967G>C	c.(3967-3969)Gaa>Caa	p.E1323Q	AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000594078.1_RNA|AC012358.8_ENST00000599475.1_RNA|CCDC88A_ENST00000263630.8_Missense_Mutation_p.E1323Q|AC012358.8_ENST00000366287.4_RNA|AC012358.8_ENST00000608103.1_RNA|CCDC88A_ENST00000413716.2_Missense_Mutation_p.E1322Q|AC012358.8_ENST00000599352.1_RNA|CCDC88A_ENST00000336838.6_Missense_Mutation_p.E1322Q	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1323					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TGCCGATTTTCTTCTTCTAAA	0.289																																						dbGAP											0													142.0	131.0	135.0					2																	55539682		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.3967G>C	2.37:g.55539682C>G	ENSP00000410608:p.Glu1323Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_t-SNARE	p.E1323Q	ENST00000436346.1	37	c.3967		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.3|29.3	4.993226|4.993226	0.93167|0.93167	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000412148;ENST00000413716;ENST00000426576|ENST00000456975	T;T;T;T;T;T|.	0.59906|.	0.23;0.23;0.23;0.23;0.23;0.23|.	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	0.000000|.	0.49305|.	U|.	0.000146|.	T|T	0.73721|0.73721	0.3623|0.3623	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;0.999;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	0.996;0.995;0.997;1.0;0.981;0.998|.	T|T	0.71702|0.71702	-0.4513|-0.4513	10|5	0.62326|.	D|.	0.03|.	-18.5112|-18.5112	19.1015|19.1015	0.93276|0.93276	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1322;1323;1268;1323;1322;1322|.	B7ZM78;Q3V6T2-2;D6W5D1;Q3V6T2;Q3V6T2-3;Q3V6T2-4|.	.;.;.;GRDN_HUMAN;.;.|.	Q|T	1322;1323;1323;368;1322;498|303	ENSP00000338728:E1322Q;ENSP00000263630:E1323Q;ENSP00000410608:E1323Q;ENSP00000390012:E368Q;ENSP00000404431:E1322Q;ENSP00000405080:E498Q|.	ENSP00000263630:E1323Q|.	E|R	-|-	1|2	0|0	CCDC88A|CCDC88A	55393186|55393186	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.818000|7.818000	0.86416|0.86416	2.516000|2.516000	0.84829|0.84829	0.655000|0.655000	0.94253|0.94253	GAA|AGA	CCDC88A	-	NULL	ENSG00000115355		0.289	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		34	0.00	0	C	NM_017571		55539682	55539682	-1	no_errors	ENST00000436346	ensembl	human	known	69_37n	missense	39	13.04	6	SNP	1.000	G
CCSAP	126731	genome.wustl.edu	37	1	229477852	229477852	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:229477852G>T	ENST00000366687.1	-	1	412	c.361C>A	c.(361-363)Ctg>Atg	p.L121M	CCSAP_ENST00000284617.2_Missense_Mutation_p.L121M|CCSAP_ENST00000366686.1_5'Flank|CCSAP_ENST00000452552.1_Missense_Mutation_p.L121M|CCSAP_ENST00000483092.1_5'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein	121					multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											GTACCTGGCAGAGccgcgtcc	0.731																																						dbGAP											0													4.0	5.0	5.0					1																	229477852		1240	2586	3826	-	-	-	SO:0001583	missense	0			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.361C>A	1.37:g.229477852G>T	ENSP00000355648:p.Leu121Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	Missense_Mutation	SNP	NULL	p.L121M	ENST00000366687.1	37	c.361	CCDS1577.1	1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219629	0.58560	.	.	ENSG00000154429	ENST00000366687;ENST00000284617;ENST00000452552	T;T;T	0.53640	0.9;0.9;0.61	4.68	-0.949	0.10376	.	1.110770	0.06913	U	0.807950	T	0.41926	0.1180	L	0.47716	1.5	0.80722	D	1	B	0.25809	0.135	B	0.35550	0.205	T	0.22695	-1.0209	10	0.40728	T	0.16	-25.0584	4.6772	0.12717	0.2713:0.2973:0.4314:0.0	.	121	Q6IQ19	CA096_HUMAN	M	121	ENSP00000355648:L121M;ENSP00000284617:L121M;ENSP00000392927:L121M	ENSP00000284617:L121M	L	-	1	2	C1orf96	227544475	0.004000	0.15560	0.000000	0.03702	0.538000	0.34931	0.413000	0.21148	-0.568000	0.06038	0.561000	0.74099	CTG	CCSAP	-	NULL	ENSG00000154429		0.731	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	HGNC	protein_coding	OTTHUMT00000091839.1	12	0.00	0	G	NM_145257		229477852	229477852	-1	no_errors	ENST00000284617	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.000	T
CD2BP2	10421	genome.wustl.edu	37	16	30364696	30364696	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:30364696C>T	ENST00000305596.3	-	5	976	c.801G>A	c.(799-801)caG>caA	p.Q267Q	CD2BP2_ENST00000569466.1_Silent_p.Q267Q|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	267					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)			breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CACCTCCTCTCTGGGTAGGGG	0.592																																						dbGAP											0													59.0	60.0	59.0					16																	30364696		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.801G>A	16.37:g.30364696C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDX2|Q9ULP2	Silent	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.Q267	ENST00000305596.3	37	c.801	CCDS10675.1	16																																																																																			CD2BP2	-	NULL	ENSG00000169217		0.592	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2BP2	HGNC	protein_coding	OTTHUMT00000255528.1	64	0.00	0	C	NM_006110		30364696	30364696	-1	no_errors	ENST00000305596	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	0.000	T
CDH8	1006	genome.wustl.edu	37	16	61851444	61851444	+	Missense_Mutation	SNP	G	G	C	rs375849945		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:61851444G>C	ENST00000577390.1	-	7	2170	c.1216C>G	c.(1216-1218)Cta>Gta	p.L406V	CDH8_ENST00000299345.6_Missense_Mutation_p.L406V|CDH8_ENST00000577730.1_Missense_Mutation_p.L406V|CDH8_ENST00000584337.1_Missense_Mutation_p.L406V	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.L406V(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ACGGAGTTTAGAGCAGCATTT	0.433																																						dbGAP											1	Substitution - Missense(1)	lung(1)											91.0	82.0	85.0					16																	61851444		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1216C>G	16.37:g.61851444G>C	ENSP00000462701:p.Leu406Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L406V	ENST00000577390.1	37	c.1216	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	G	0.750	-0.773182	0.02951	.	.	ENSG00000150394	ENST00000299345	T	0.48201	0.82	6.17	1.57	0.23409	Cadherin (3);Cadherin-like (1);	0.150230	0.64402	D	0.000019	T	0.19886	0.0478	N	0.11154	0.105	0.30740	N	0.746317	B;B	0.10296	0.003;0.0	B;B	0.11329	0.006;0.002	T	0.31833	-0.9929	10	0.02654	T	1	.	6.4463	0.21877	0.1681:0.0:0.4264:0.4055	.	222;406	Q3LID3;P55286	.;CADH8_HUMAN	V	406	ENSP00000299345:L406V	ENSP00000299345:L406V	L	-	1	2	CDH8	60408945	0.849000	0.29639	0.920000	0.36463	0.905000	0.53344	0.904000	0.28491	0.413000	0.25759	0.655000	0.94253	CTA	CDH8	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000150394		0.433	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	52	0.00	0	G	NM_001796		61851444	61851444	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.970	C
CDH1	999	genome.wustl.edu	37	16	68845600	68845600	+	Missense_Mutation	SNP	G	G	T	rs200932258		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:68845600G>T	ENST00000261769.5	+	7	1037	c.846G>T	c.(844-846)atG>atT	p.M282I	CDH1_ENST00000422392.2_Missense_Mutation_p.M282I|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	282	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.		M -> I (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:17224074}.		adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.E283fs*11(1)|p.M282I(1)|p.?(1)|p.E283fs*4(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CCTCTGTGATGGAGGTCACAG	0.502			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Deletion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)	breast(4)											96.0	86.0	90.0					16																	68845600		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.846G>T	16.37:g.68845600G>T	ENSP00000261769:p.Met282Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.M282I	ENST00000261769.5	37	c.846	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	17.00	3.275719	0.59649	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.50548	0.74;0.74	5.19	5.19	0.71726	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000007	T	0.49779	0.1577	N	0.11892	0.195	0.50813	D	0.999898	P;D	0.69078	0.609;0.997	B;D	0.65874	0.392;0.939	T	0.48625	-0.9019	10	0.24483	T	0.36	.	18.7077	0.91644	0.0:0.0:1.0:0.0	.	282;282	Q9UII8;P12830	.;CADH1_HUMAN	I	282	ENSP00000261769:M282I;ENSP00000414946:M282I	ENSP00000261769:M282I	M	+	3	0	CDH1	67403101	1.000000	0.71417	1.000000	0.80357	0.191000	0.23601	5.971000	0.70440	2.583000	0.87209	0.561000	0.74099	ATG	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.502	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	63	0.00	0	G	NM_004360		68845600	68845600	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
CELSR3	1951	genome.wustl.edu	37	3	48678786	48678786	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:48678786G>A	ENST00000164024.4	-	33	9276	c.8996C>T	c.(8995-8997)tCt>tTt	p.S2999F	CELSR3_ENST00000544264.1_Missense_Mutation_p.S3004F|MIR4793_ENST00000577502.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2999					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCGGCCCAGAGAAGTCTCATC	0.647																																						dbGAP											0													57.0	66.0	63.0					3																	48678786		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.8996C>T	3.37:g.48678786G>A	ENSP00000164024:p.Ser2999Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S3004F	ENST00000164024.4	37	c.9011	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214370	0.39102	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.71103	-0.54;-0.53	5.22	4.26	0.50523	.	.	.	.	.	T	0.66046	0.2750	N	0.24115	0.695	0.24652	N	0.993515	B;B;P	0.49961	0.001;0.001;0.93	B;B;P	0.48030	0.003;0.001;0.564	T	0.62576	-0.6825	9	0.59425	D	0.04	.	16.4531	0.83998	0.0:0.0:0.8597:0.1403	.	3004;2999;3097	Q9NYQ7-2;Q9NYQ7;Q5Y190	.;CELR3_HUMAN;.	F	2999;3004	ENSP00000164024:S2999F;ENSP00000445694:S3004F	ENSP00000164024:S2999F	S	-	2	0	CELSR3	48653790	1.000000	0.71417	0.945000	0.38365	0.962000	0.63368	3.626000	0.54245	2.436000	0.82500	0.514000	0.50259	TCT	CELSR3	-	NULL	ENSG00000008300		0.647	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	35	0.00	0	G	NM_001407		48678786	48678786	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.318	A
CES2	8824	genome.wustl.edu	37	16	66972118	66972118	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:66972118G>A	ENST00000317091.4	+	2	1431	c.447G>A	c.(445-447)gtG>gtA	p.V149V	CES2_ENST00000417689.1_Silent_p.V149V	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	85					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)			breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	GGAGTGGTGTGAGGGATGGAA	0.617																																					Ovarian(70;1230 1691 37888 38351)	dbGAP											0													76.0	69.0	71.0					16																	66972118		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.447G>A	16.37:g.66972118G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.V149	ENST00000317091.4	37	c.447	CCDS10825.1	16																																																																																			CES2	-	pfam_CarbesteraseB	ENSG00000172831		0.617	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CES2	HGNC	protein_coding	OTTHUMT00000268838.2	31	0.00	0	G	NM_003869		66972118	66972118	+1	no_errors	ENST00000317091	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	1.000	A
CHD3	1107	genome.wustl.edu	37	17	7802461	7802461	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:7802461G>A	ENST00000330494.7	+	14	2434	c.2284G>A	c.(2284-2286)Gag>Aag	p.E762K	CHD3_ENST00000380358.4_Missense_Mutation_p.E821K|CHD3_ENST00000358181.4_Missense_Mutation_p.E762K	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	762	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TCTAGCTGATGAGATGGGGCT	0.552																																						dbGAP											0													138.0	129.0	132.0					17																	7802461		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.2284G>A	17.37:g.7802461G>A	ENSP00000332628:p.Glu762Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E762K	ENST00000330494.7	37	c.2284	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011141	0.75046	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.95690	-3.78;-3.78;-3.78	5.47	5.47	0.80525	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.46758	D	0.000280	D	0.98485	0.9495	H	0.94542	3.55	0.80722	D	1	D;D;D	0.76494	0.996;0.997;0.999	D;D;D	0.81914	0.987;0.992;0.995	D	0.99201	1.0873	10	0.87932	D	0	-30.9039	19.6995	0.96047	0.0:0.0:1.0:0.0	.	762;762;821	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	K	821;762;762	ENSP00000369716:E821K;ENSP00000350907:E762K;ENSP00000332628:E762K	ENSP00000332628:E762K	E	+	1	0	CHD3	7743186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.790000	0.99075	2.744000	0.94065	0.561000	0.74099	GAG	CHD3	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000170004		0.552	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	60	0.00	0	G	NM_001005273		7802461	7802461	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	missense	34	16.67	7	SNP	1.000	A
CHMP2A	27243	genome.wustl.edu	37	19	59063478	59063478	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:59063478C>G	ENST00000600118.1	-	3	848	c.423G>C	c.(421-423)gaG>gaC	p.E141D	CHMP2A_ENST00000312547.2_Missense_Mutation_p.E141D|CHMP2A_ENST00000601220.1_Missense_Mutation_p.E141D			O43633	CHM2A_HUMAN	charged multivesicular body protein 2A	141	Interaction with VPS4B.				endosomal transport (GO:0016197)|establishment of protein localization (GO:0045184)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	7		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		CATTCATCATCTCCTCCTTCA	0.512																																						dbGAP											0													369.0	284.0	313.0					19																	59063478		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042384	CCDS12986.1	19q13.43	2014-09-04	2011-09-21		ENSG00000130724	ENSG00000130724		"""Charged multivesicular body proteins"""	30216	protein-coding gene	gene with protein product	"""putative breast adenocarcinoma marker (32kD)"", ""VPS2 homolog A (S. cerevisiae)"""	610893	"""chromatin modifying protein 2A"""			15173323, 11559748	Standard	XM_005258746		Approved	BC-2, CHMP2, VPS2, VPS2A	uc002qtk.3	O43633	OTTHUMG00000183547	ENST00000600118.1:c.423G>C	19.37:g.59063478C>G	ENSP00000469240:p.Glu141Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4W6|Q3ZTT0	Missense_Mutation	SNP	pfam_Snf7	p.E141D	ENST00000600118.1	37	c.423	CCDS12986.1	19	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550397	0.65311	.	.	ENSG00000130724	ENST00000312547	T	0.80214	-1.35	4.53	-0.206	0.13193	.	0.000000	0.85682	D	0.000000	D	0.84556	0.5498	M	0.85542	2.76	0.80722	D	1	P	0.44659	0.84	P	0.53062	0.717	T	0.81621	-0.0850	10	0.54805	T	0.06	.	7.4077	0.27000	0.0:0.4371:0.0:0.5629	.	141	O43633	CHM2A_HUMAN	D	141	ENSP00000310440:E141D	ENSP00000310440:E141D	E	-	3	2	CHMP2A	63755290	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	0.846000	0.27682	-0.030000	0.13804	0.650000	0.86243	GAG	CHMP2A	-	pfam_Snf7	ENSG00000130724		0.512	CHMP2A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHMP2A	HGNC	protein_coding	OTTHUMT00000467088.1	56	0.00	0	C	NM_014453		59063478	59063478	-1	no_errors	ENST00000312547	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	1.000	G
CHRNA6	8973	genome.wustl.edu	37	8	42611013	42611013	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:42611013C>T	ENST00000276410.2	-	5	1684	c.1329G>A	c.(1327-1329)atG>atA	p.M443I	CHRNA6_ENST00000534622.1_Missense_Mutation_p.M428I|CHRNA6_ENST00000530869.1_5'Flank	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	443					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	TGTGGCTCTTCATGTTTTCTG	0.483																																						dbGAP											0													279.0	251.0	261.0					8																	42611013		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.1329G>A	8.37:g.42611013C>T	ENSP00000276410:p.Met443Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V4|B4DQH1	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.M443I	ENST00000276410.2	37	c.1329	CCDS6135.1	8	.	.	.	.	.	.	.	.	.	.	c	11.97	1.798892	0.31777	.	.	ENSG00000147434	ENST00000276410;ENST00000534622	D;D	0.85088	-1.94;-1.94	5.84	5.84	0.93424	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.079475	0.85682	D	0.000000	D	0.82472	0.5044	L	0.52905	1.665	0.58432	D	0.999999	B;B	0.20988	0.05;0.05	B;B	0.25140	0.058;0.058	T	0.76277	-0.3018	10	0.22109	T	0.4	.	15.6114	0.76721	0.0:0.8632:0.1368:0.0	.	428;443	B4DQH1;Q15825	.;ACHA6_HUMAN	I	443;428	ENSP00000276410:M443I;ENSP00000433871:M428I	ENSP00000276410:M443I	M	-	3	0	CHRNA6	42730170	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	4.820000	0.62671	2.769000	0.95229	0.462000	0.41574	ATG	CHRNA6	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000147434		0.483	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA6	HGNC	protein_coding	OTTHUMT00000383156.1	37	0.00	0	C			42611013	42611013	-1	no_errors	ENST00000276410	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	1.000	T
CHRNA6	8973	genome.wustl.edu	37	8	42611024	42611024	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:42611024C>T	ENST00000276410.2	-	5	1673	c.1318G>A	c.(1318-1320)Gca>Aca	p.A440T	CHRNA6_ENST00000534622.1_Missense_Mutation_p.A425T|CHRNA6_ENST00000530869.1_5'Flank	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	440					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	ATGTTTTCTGCTATGAACTGA	0.473																																						dbGAP											0													267.0	238.0	248.0					8																	42611024		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.1318G>A	8.37:g.42611024C>T	ENSP00000276410:p.Ala440Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V4|B4DQH1	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.A440T	ENST00000276410.2	37	c.1318	CCDS6135.1	8	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951988	0.53293	.	.	ENSG00000147434	ENST00000276410;ENST00000534622	D;D	0.87809	-2.3;-2.3	5.84	4.96	0.65561	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.100290	0.64402	N	0.000002	D	0.87128	0.6100	L	0.57536	1.79	0.80722	D	1	B;B	0.18013	0.025;0.006	B;B	0.33799	0.17;0.084	D	0.83768	0.0218	10	0.41790	T	0.15	.	15.3329	0.74229	0.0:0.9322:0.0:0.0678	.	425;440	B4DQH1;Q15825	.;ACHA6_HUMAN	T	440;425	ENSP00000276410:A440T;ENSP00000433871:A425T	ENSP00000276410:A440T	A	-	1	0	CHRNA6	42730181	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	6.002000	0.70693	1.451000	0.47736	0.462000	0.41574	GCA	CHRNA6	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000147434		0.473	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA6	HGNC	protein_coding	OTTHUMT00000383156.1	39	0.00	0	C			42611024	42611024	-1	no_errors	ENST00000276410	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	T
CHRNA6	8973	genome.wustl.edu	37	8	42611806	42611806	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:42611806C>G	ENST00000276410.2	-	5	891	c.536G>C	c.(535-537)tGg>tCg	p.W179S	CHRNA6_ENST00000534622.1_Missense_Mutation_p.W164S|CHRNA6_ENST00000530869.1_5'Flank	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	179					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	GTCATACGTCCAGGAACCAAA	0.373																																						dbGAP											0													118.0	116.0	117.0					8																	42611806		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.536G>C	8.37:g.42611806C>G	ENSP00000276410:p.Trp179Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V4|B4DQH1	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.W179S	ENST00000276410.2	37	c.536	CCDS6135.1	8	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407927	0.83340	.	.	ENSG00000147434	ENST00000276410;ENST00000534622;ENST00000533810	T;T;T	0.79845	-1.31;-1.31;-1.31	5.93	5.93	0.95920	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.94092	0.8106	H	0.97758	4.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95345	0.8441	10	0.87932	D	0	.	20.4043	0.99006	0.0:1.0:0.0:0.0	.	164;179	B4DQH1;Q15825	.;ACHA6_HUMAN	S	179;164;100	ENSP00000276410:W179S;ENSP00000433871:W164S;ENSP00000434659:W100S	ENSP00000276410:W179S	W	-	2	0	CHRNA6	42730963	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.744000	0.85034	2.824000	0.97209	0.650000	0.86243	TGG	CHRNA6	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000147434		0.373	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA6	HGNC	protein_coding	OTTHUMT00000383156.1	30	0.00	0	C			42611806	42611806	-1	no_errors	ENST00000276410	ensembl	human	known	69_37n	missense	33	15.00	6	SNP	1.000	G
CIDEA	1149	genome.wustl.edu	37	18	12274135	12274135	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr18:12274135G>T	ENST00000320477.9	+	4	439	c.374G>T	c.(373-375)gGa>gTa	p.G125V	CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a	125					apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						AAGAGGTCGGGAATAGCGAGA	0.592																																						dbGAP											0													132.0	102.0	113.0					18																	12274135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.374G>T	18.37:g.12274135G>T	ENSP00000320209:p.Gly125Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIY7|Q6UPR7	Missense_Mutation	SNP	pfam_CAD,smart_CAD,pfscan_CAD	p.G125V	ENST00000320477.9	37	c.374	CCDS11856.1	18	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963133	0.53507	.	.	ENSG00000176194	ENST00000320477	T	0.79141	-1.24	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.88321	0.6405	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.89157	0.3527	10	0.72032	D	0.01	-20.9687	18.8424	0.92189	0.0:0.0:1.0:0.0	.	159;125	Q8N5P9;O60543	.;CIDEA_HUMAN	V	125	ENSP00000320209:G125V	ENSP00000320209:G125V	G	+	2	0	CIDEA	12264135	1.000000	0.71417	0.297000	0.24988	0.007000	0.05969	3.281000	0.51685	2.559000	0.86315	0.655000	0.94253	GGA	CIDEA	-	NULL	ENSG00000176194		0.592	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDEA	HGNC	protein_coding	OTTHUMT00000254599.2	35	0.00	0	G	NM_001279		12274135	12274135	+1	no_errors	ENST00000320477	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	T
CNKSR2	22866	genome.wustl.edu	37	X	21444710	21444710	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:21444710G>T	ENST00000379510.3	+	2	196	c.160G>T	c.(160-162)Gat>Tat	p.D54Y	CNKSR2_ENST00000425654.2_Missense_Mutation_p.D54Y|CNKSR2_ENST00000543067.1_Missense_Mutation_p.D54Y|CNKSR2_ENST00000279451.4_Missense_Mutation_p.D54Y	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	54	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						GGAGCTAGAAGATCTGGGGGT	0.478																																						dbGAP											0													119.0	111.0	114.0					X																	21444710		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.160G>T	X.37:g.21444710G>T	ENSP00000368824:p.Asp54Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.D54Y	ENST00000379510.3	37	c.160	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585728	0.66105	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.33	5.33	0.75918	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.104106	0.64402	D	0.000005	T	0.71031	0.3292	M	0.81341	2.54	0.80722	D	1	D;D;B	0.76494	0.999;0.987;0.151	D;P;B	0.71870	0.975;0.905;0.266	T	0.75889	-0.3158	10	0.72032	D	0.01	-7.5265	18.0544	0.89360	0.0:0.0:1.0:0.0	.	54;54;54	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	Y	54	ENSP00000397906:D54Y;ENSP00000444633:D54Y;ENSP00000279451:D54Y;ENSP00000368824:D54Y	ENSP00000279451:D54Y	D	+	1	0	CNKSR2	21354631	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.397000	0.97276	2.199000	0.70637	0.594000	0.82650	GAT	CNKSR2	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000149970		0.478	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	68	0.00	0	G	NM_014927		21444710	21444710	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	T
CNKSR2	22866	genome.wustl.edu	37	X	21444778	21444778	+	Splice_Site	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:21444778G>A	ENST00000379510.3	+	2	264	c.228G>A	c.(226-228)ttG>ttA	p.L76L	CNKSR2_ENST00000425654.2_Splice_Site_p.L76L|CNKSR2_ENST00000543067.1_Splice_Site_p.L76L|CNKSR2_ENST00000279451.4_Splice_Site_p.L76L	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	76	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						TGTGTGCATTGGTAAGGACAT	0.433																																						dbGAP											0													118.0	110.0	113.0					X																	21444778		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.228+1G>A	X.37:g.21444778G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.L76	ENST00000379510.3	37	c.228	CCDS14198.1	X																																																																																			CNKSR2	-	superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000149970		0.433	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	68	0.00	0	G	NM_014927	Silent	21444778	21444778	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	silent	56	18.84	13	SNP	1.000	A
CNR2	1269	genome.wustl.edu	37	1	24201912	24201912	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:24201912G>A	ENST00000374472.4	-	2	357	c.196C>T	c.(196-198)Cgg>Tgg	p.R66W	CNR2_ENST00000536471.1_Missense_Mutation_p.R66W	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	66					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	GAGGGCTTCCGGCGGAGTTGG	0.547																																						dbGAP											0													58.0	69.0	66.0					1																	24201912		2203	4300	6503	-	-	-	SO:0001583	missense	0			X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.196C>T	1.37:g.24201912G>A	ENSP00000363596:p.Arg66Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Canbinoid_rcpt_2,prints_Cnbnoid_rcpt,prints_7TM_GPCR_Rhodpsn	p.R66W	ENST00000374472.4	37	c.196	CCDS245.1	1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107217	0.37145	.	.	ENSG00000188822	ENST00000374472;ENST00000536471	T;T	0.80033	-1.33;-1.33	5.9	2.08	0.27032	GPCR, rhodopsin-like superfamily (1);	0.246311	0.46145	D	0.000302	D	0.88592	0.6478	M	0.82323	2.585	0.32360	N	0.557293	D	0.76494	0.999	D	0.67900	0.954	D	0.90559	0.4514	10	0.72032	D	0.01	.	13.4321	0.61062	0.0:0.0:0.3882:0.6118	.	66	P34972	CNR2_HUMAN	W	66	ENSP00000363596:R66W;ENSP00000442830:R66W	ENSP00000363596:R66W	R	-	1	2	CNR2	24074499	0.007000	0.16637	0.972000	0.41901	0.104000	0.19210	0.494000	0.22467	0.463000	0.27118	-0.397000	0.06425	CGG	CNR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Cnbnoid_rcpt	ENSG00000188822		0.547	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR2	HGNC	protein_coding	OTTHUMT00000038949.1	30	0.00	0	G	NM_001841		24201912	24201912	-1	no_errors	ENST00000374472	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.994	A
COL16A1	1307	genome.wustl.edu	37	1	32137254	32137254	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:32137254G>T	ENST00000373672.3	-	48	3628	c.3112C>A	c.(3112-3114)Cct>Act	p.P1038T	COL16A1_ENST00000271069.6_Missense_Mutation_p.P1038T	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1038	Collagen-like 6.|Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTCATGCCAGGCGGACCCTGC	0.602																																					Colon(143;498 1786 21362 25193 36625)	dbGAP											0													42.0	49.0	47.0					1																	32137254		1913	4114	6027	-	-	-	SO:0001583	missense	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3112C>A	1.37:g.32137254G>T	ENSP00000362776:p.Pro1038Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.P1038T	ENST00000373672.3	37	c.3112	CCDS41297.1	1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960900	0.53400	.	.	ENSG00000084636	ENST00000373672;ENST00000271069	D;D	0.96651	-4.08;-4.08	5.21	5.21	0.72293	.	0.062960	0.64402	D	0.000006	D	0.96873	0.8979	L	0.45285	1.41	0.40058	D	0.975864	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.96980	0.9714	10	0.51188	T	0.08	.	14.6242	0.68608	0.0:0.0:1.0:0.0	.	1038;1038	Q07092;Q07092-2	COGA1_HUMAN;.	T	1038	ENSP00000362776:P1038T;ENSP00000271069:P1038T	ENSP00000271069:P1038T	P	-	1	0	COL16A1	31909841	1.000000	0.71417	0.928000	0.36995	0.991000	0.79684	5.429000	0.66495	2.599000	0.87857	0.655000	0.94253	CCT	COL16A1	-	pfam_Collagen	ENSG00000084636		0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2	39	0.00	0	G	NM_001856		32137254	32137254	-1	no_errors	ENST00000271069	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.985	T
COL24A1	255631	genome.wustl.edu	37	1	86620323	86620323	+	Intron	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:86620323G>A	ENST00000370571.2	-	1	423				COL24A1_ENST00000485434.1_5'UTR|COL24A1_ENST00000436319.1_Intron	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1						extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTCTGGGAGCGTCTGGAAGGG	0.488																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.56+1700C>T	1.37:g.86620323G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	RNA	SNP	-	NULL	ENST00000370571.2	37	NULL	CCDS41353.1	1																																																																																			COL24A1	-	-	ENSG00000171502		0.488	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	HGNC	protein_coding	OTTHUMT00000029335.4	49	0.00	0	G	NM_152890		86620323	86620323	-1	no_errors	ENST00000485434	ensembl	human	known	69_37n	rna	28	15.15	5	SNP	0.998	A
COL6A3	1293	genome.wustl.edu	37	2	238283134	238283134	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:238283134G>A	ENST00000295550.4	-	8	4052	c.3600C>T	c.(3598-3600)gtC>gtT	p.V1200V	COL6A3_ENST00000346358.4_Silent_p.V1000V|COL6A3_ENST00000472056.1_Silent_p.V593V|COL6A3_ENST00000409809.1_Silent_p.V994V|COL6A3_ENST00000347401.3_Silent_p.V999V|COL6A3_ENST00000353578.4_Silent_p.V994V|COL6A3_ENST00000392003.2_Silent_p.V793V|COL6A3_ENST00000392004.3_Silent_p.V994V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1200	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCTCAGAGATGACCTGTTGGA	0.612																																						dbGAP											0													71.0	62.0	65.0					2																	238283134		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3600C>T	2.37:g.238283134G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.V1200	ENST00000295550.4	37	c.3600	CCDS33412.1	2																																																																																			COL6A3	-	smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.612	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	22	0.00	0	G	NM_004369		238283134	238283134	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	0.791	A
CRIPAK	285464	genome.wustl.edu	37	4	1389156	1389156	+	Missense_Mutation	SNP	T	T	C	rs71614972	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:1389156T>C	ENST00000324803.4	+	1	3817	c.857T>C	c.(856-858)aTg>aCg	p.M286T		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	286					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CATGTGCCGATGTGGAGTGCC	0.677													T|||	3799	0.758586	0.9349	0.7954	5008	,	,		13659	0.7014		0.6392	False		,,,				2504	0.6759					dbGAP											0													131.0	131.0	131.0					4																	1389156		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.857T>C	4.37:g.1389156T>C	ENSP00000323978:p.Met286Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Missense_Mutation	SNP	smart_Post-SET_dom	p.M286T	ENST00000324803.4	37	c.857	CCDS3349.1	4	.	.	.	.	.	.	.	.	.	.	T	0.854	-0.737538	0.03111	.	.	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.17691	2.26	0.815	-1.63	0.08345	Post-SET domain (1);	.	.	.	.	T	0.06826	0.0174	N	0.08118	0	0.80722	P	0.0	B	0.12630	0.006	B	0.06405	0.002	T	0.38067	-0.9678	8	0.25106	T	0.35	.	5.1474	0.14993	0.0:0.3546:0.0:0.6454	.	286	Q8N1N5	CRPAK_HUMAN	T	286;228	ENSP00000323978:M286T	ENSP00000323978:M286T	M	+	2	0	CRIPAK	1379156	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.361000	0.01083	-0.674000	0.05253	-0.530000	0.04314	ATG	CRIPAK	-	smart_Post-SET_dom	ENSG00000179979		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	87	0.00	0	T	NM_175918		1389156	1389156	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	0.000	C
CSPG4	1464	genome.wustl.edu	37	15	75982428	75982428	+	Silent	SNP	C	C	T	rs7182906	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:75982428C>T	ENST00000308508.5	-	3	1070	c.978G>A	c.(976-978)ggG>ggA	p.G326G		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	326	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CTGCATCCAGCCCCCCGAGAA	0.632													C|||	1423	0.284145	0.2277	0.4006	5008	,	,		20377	0.1865		0.3817	False		,,,				2504	0.2781					dbGAP											0													20.0	18.0	18.0					15																	75982428		2192	4291	6483	-	-	-	SO:0001819	synonymous_variant	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.978G>A	15.37:g.75982428C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW77|Q92675	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.G326	ENST00000308508.5	37	c.978	CCDS10284.1	15																																																																																			CSPG4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000173546		0.632	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	123	0.81	1	C	NM_001897		75982428	75982428	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	silent	95	11.93	13	SNP	0.969	T
CXXC1	30827	genome.wustl.edu	37	18	47811201	47811201	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr18:47811201C>T	ENST00000285106.6	-	8	1635	c.921G>A	c.(919-921)atG>atA	p.M307I	CXXC1_ENST00000587396.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.M307I|CXXC1_ENST00000412036.2_Missense_Mutation_p.M307I	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	307	Asp/Glu-rich (acidic).				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CTGTGTCGCTCATCCAGGGCT	0.587																																						dbGAP											0													87.0	75.0	79.0					18																	47811201		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.921G>A	18.37:g.47811201C>T	ENSP00000285106:p.Met307Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	pfam_CpG-bd_C,pfam_Znf_CXXC,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.M307I	ENST00000285106.6	37	c.921	CCDS11945.1	18	.	.	.	.	.	.	.	.	.	.	C	8.775	0.926856	0.18056	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.21191	2.02;2.02	4.29	4.29	0.51040	.	0.541353	0.19369	N	0.115956	T	0.12135	0.0295	N	0.14661	0.345	0.30621	N	0.758533	B;B;B;B	0.20780	0.028;0.048;0.028;0.015	B;B;B;B	0.16289	0.005;0.015;0.005;0.003	T	0.06338	-1.0832	10	0.31617	T	0.26	-23.2639	10.6548	0.45669	0.0:0.8045:0.1955:0.0	.	307;307;307;174	B2RC03;Q9P0U4-2;Q9P0U4;Q59EC8	.;.;CXXC1_HUMAN;.	I	307	ENSP00000285106:M307I;ENSP00000390475:M307I	ENSP00000285106:M307I	M	-	3	0	CXXC1	46065199	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.749000	0.26320	2.121000	0.65114	0.549000	0.68633	ATG	CXXC1	-	NULL	ENSG00000154832		0.587	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	HGNC	protein_coding	OTTHUMT00000255927.2	48	0.00	0	C	NM_014593		47811201	47811201	-1	no_errors	ENST00000412036	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	1.000	T
CYBB	1536	genome.wustl.edu	37	X	37670093	37670093	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:37670093C>G	ENST00000378588.4	+	13	1703	c.1636C>G	c.(1636-1638)Ctg>Gtg	p.L546V	CYBB_ENST00000536160.1_Missense_Mutation_p.L279V|CYBB_ENST00000545017.1_Missense_Mutation_p.L514V|TM4SF2_ENST00000465127.1_Intron	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	546			L -> P (in CGD; dbSNP:rs151344492). {ECO:0000269|PubMed:10089913}.		antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	GGCTGAAACCCTGAGTAAACA	0.418																																						dbGAP											0													69.0	62.0	65.0					X																	37670093		2202	4300	6502	-	-	-	SO:0001583	missense	0			X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.1636C>G	X.37:g.37670093C>G	ENSP00000367851:p.Leu546Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K138|Q2PP16	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.L546V	ENST00000378588.4	37	c.1636	CCDS14242.1	X	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649369	0.67358	.	.	ENSG00000165168	ENST00000378588;ENST00000545017;ENST00000536160	D;D;D	0.93019	-3.15;-3.15;-3.15	5.56	5.56	0.83823	Ferric reductase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.95452	0.8523	L	0.60957	1.885	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.984;0.999	D	0.95266	0.8373	10	0.54805	T	0.06	.	12.8276	0.57728	0.0:0.9199:0.0:0.0801	.	514;546	F5GWD2;P04839	.;CY24B_HUMAN	V	546;514;279	ENSP00000367851:L546V;ENSP00000441896:L514V;ENSP00000441958:L279V	ENSP00000367851:L546V	L	+	1	2	CYBB	37555037	0.969000	0.33509	0.993000	0.49108	0.942000	0.58702	2.320000	0.43797	2.324000	0.78689	0.544000	0.68410	CTG	CYBB	-	pfam_Fe_red_NAD-bd_6,prints_Cyt_b245_heavy_chain	ENSG00000165168		0.418	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	HGNC	protein_coding	OTTHUMT00000080881.1	55	0.00	0	C			37670093	37670093	+1	no_errors	ENST00000378588	ensembl	human	known	69_37n	missense	55	24.32	18	SNP	0.997	G
CYP4F22	126410	genome.wustl.edu	37	19	15662126	15662126	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:15662126C>T	ENST00000269703.3	+	14	1639	c.1440C>T	c.(1438-1440)ttC>ttT	p.F480F	CYP4F22_ENST00000601005.2_Silent_p.F480F	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	480						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						GACAGAGCTTCGCCATGGCCG	0.617																																						dbGAP											0													49.0	36.0	41.0					19																	15662126		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.1440C>T	19.37:g.15662126C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8H4	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.F480	ENST00000269703.3	37	c.1440	CCDS12331.1	19																																																																																			CYP4F22	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	ENSG00000171954		0.617	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F22	HGNC	protein_coding	OTTHUMT00000461338.2	55	0.00	0	C	NM_173483		15662126	15662126	+1	no_errors	ENST00000269703	ensembl	human	known	69_37n	silent	52	14.75	9	SNP	1.000	T
DBR1	51163	genome.wustl.edu	37	3	137892403	137892403	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:137892403G>C	ENST00000260803.4	-	2	416	c.263C>G	c.(262-264)tCa>tGa	p.S88*	DBR1_ENST00000463982.2_5'UTR|DBR1_ENST00000505015.2_5'UTR	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	88					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						CAAATGATTTGAGGCTTCATG	0.408																																						dbGAP											0													130.0	131.0	131.0					3																	137892403		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.263C>G	3.37:g.137892403G>C	ENSP00000260803:p.Ser88*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GH0|Q9NXQ6	Nonsense_Mutation	SNP	pfam_DBR1_C,pfam_Metallo_PEstase_dom	p.S88*	ENST00000260803.4	37	c.263	CCDS33863.1	3	.	.	.	.	.	.	.	.	.	.	G	38	6.798921	0.97845	.	.	ENSG00000138231	ENST00000260803	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.9287	17.4199	0.87512	0.0:0.0:1.0:0.0	.	.	.	.	X	88	.	ENSP00000260803:S88X	S	-	2	0	DBR1	139375093	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.451000	0.97610	2.707000	0.92482	0.655000	0.94253	TCA	DBR1	-	pfam_Metallo_PEstase_dom	ENSG00000138231		0.408	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBR1	HGNC	protein_coding	OTTHUMT00000357585.1	20	0.00	0	G			137892403	137892403	-1	no_errors	ENST00000260803	ensembl	human	known	69_37n	nonsense	15	21.05	4	SNP	1.000	C
DDX11	1663	genome.wustl.edu	37	12	31236969	31236969	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:31236969G>C	ENST00000407793.2	+	3	618	c.367G>C	c.(367-369)Gag>Cag	p.E123Q	DDX11_ENST00000350437.4_Missense_Mutation_p.E123Q|DDX11_ENST00000542838.1_Missense_Mutation_p.E123Q|DDX11_ENST00000228264.6_Missense_Mutation_p.E97Q|DDX11_ENST00000251758.5_Missense_Mutation_p.E123Q|DDX11_ENST00000545668.1_Missense_Mutation_p.E123Q	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	123	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GAAGAAAGAAGAGAGGGACCT	0.577										Multiple Myeloma(12;0.14)																												dbGAP											0													49.0	61.0	57.0					12																	31236969		2200	4299	6499	-	-	-	SO:0001583	missense	0			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.367G>C	12.37:g.31236969G>C	ENSP00000384703:p.Glu123Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.E123Q	ENST00000407793.2	37	c.367	CCDS44856.1	12	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481299	0.63849	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000251758;ENST00000228264;ENST00000438391;ENST00000415475;ENST00000545668;ENST00000350437;ENST00000535317	T;T;T;T;T;T;T;T;T	0.59906	4.04;4.04;4.04;4.04;0.23;4.04;4.04;4.04;4.04	4.57	3.65	0.41850	Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.000000	0.85682	D	0.000000	T	0.63873	0.2548	L	0.45352	1.415	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.997;0.999;0.999	T	0.56896	-0.7903	10	0.20046	T	0.44	.	10.9109	0.47108	0.0965:0.0:0.9035:0.0	.	123;123;123;123	B4DZY1;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	Q	123;123;123;97;123;97;123;123;159	ENSP00000443426:E123Q;ENSP00000384703:E123Q;ENSP00000251758:E123Q;ENSP00000228264:E97Q;ENSP00000407646:E123Q;ENSP00000406457:E97Q;ENSP00000440402:E123Q;ENSP00000309965:E123Q;ENSP00000440171:E159Q	ENSP00000228264:E97Q	E	+	1	0	DDX11	31128236	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	5.190000	0.65104	2.377000	0.81083	0.505000	0.49811	GAG	DDX11	-	smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3	ENSG00000013573		0.577	DDX11-202	KNOWN	basic|CCDS	protein_coding	DDX11	HGNC	protein_coding	OTTHUMT00000399728.1	86	0.00	0	G	NM_030653		31236969	31236969	+1	no_errors	ENST00000407793	ensembl	human	known	69_37n	missense	85	21.10	23	SNP	1.000	C
DET1	55070	genome.wustl.edu	37	15	89074361	89074361	+	Silent	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:89074361G>T	ENST00000268148.8	-	2	721	c.576C>A	c.(574-576)tcC>tcA	p.S192S	DET1_ENST00000564406.1_Silent_p.S203S|DET1_ENST00000558413.1_Intron|DET1_ENST00000444300.1_Silent_p.S203S|DET1_ENST00000559656.1_5'Flank	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	192						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGATATGGAGGGAATAGTCTT	0.507																																						dbGAP											0													59.0	58.0	59.0					15																	89074361		1949	4128	6077	-	-	-	SO:0001819	synonymous_variant	0			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.576C>A	15.37:g.89074361G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNN6|Q2VPC0|Q9NWD5	Silent	SNP	pfam_De-etiolated_protein_1_Det1	p.S203	ENST00000268148.8	37	c.609	CCDS45344.1	15																																																																																			DET1	-	pfam_De-etiolated_protein_1_Det1	ENSG00000140543		0.507	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DET1	HGNC	protein_coding	OTTHUMT00000415442.2	45	0.00	0	G	NM_017996		89074361	89074361	-1	no_errors	ENST00000444300	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	0.836	T
DEXI	28955	genome.wustl.edu	37	16	11035432	11035432	+	3'UTR	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:11035432C>T	ENST00000331808.4	-	0	885				CLEC16A_ENST00000409790.1_5'Flank|RP11-876N24.5_ENST00000570440.1_RNA|DEXI_ENST00000469379.1_5'UTR|RP11-876N24.4_ENST00000573379.1_RNA	NM_014015.3	NP_054734.2	O95424	DEXI_HUMAN	Dexi homolog (mouse)											endometrium(2)|lung(1)	3						TTACAGGCCTCGGAGGCAGGG	0.667																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF108145	CCDS10545.1	16p13.13	2010-02-17			ENSG00000182108	ENSG00000182108			13267	protein-coding gene	gene with protein product	"""dexamethasone-induced transcript"""					11306815, 11472984	Standard	NM_014015		Approved	MYLE	uc002dal.3	O95424	OTTHUMG00000129785	ENST00000331808.4:c.*143G>A	16.37:g.11035432C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAA7	RNA	SNP	-	NULL	ENST00000331808.4	37	NULL	CCDS10545.1	16																																																																																			DEXI	-	-	ENSG00000182108		0.667	DEXI-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	DEXI	HGNC	protein_coding	OTTHUMT00000252009.1	44	0.00	0	C	NM_014015		11035432	11035432	-1	no_errors	ENST00000469379	ensembl	human	known	69_37n	rna	39	22.00	11	SNP	0.011	T
DGKI	9162	genome.wustl.edu	37	7	137075847	137075847	+	3'UTR	SNP	T	T	A	rs1731951	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:137075847T>A	ENST00000288490.5	-	0	3317				DGKI_ENST00000446122.1_3'UTR|DGKI_ENST00000424189.2_3'UTR|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000453654.2_3'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CTCAGGTAGATTCTTGCAGGA	0.488													T|||	1868	0.373003	0.267	0.4193	5008	,	,		19747	0.3899		0.4513	False		,,,				2504	0.3855					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.*119A>T	7.37:g.137075847T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q9|Q9NZ49	RNA	SNP	-	NULL	ENST00000288490.5	37	NULL	CCDS5845.1	7																																																																																			DGKI	-	-	ENSG00000157680		0.488	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	57	0.00	0	T	NM_004717		137075847	137075847	-1	no_errors	ENST00000477835	ensembl	human	known	69_37n	rna	36	22.92	11	SNP	1.000	A
DGKI	9162	genome.wustl.edu	37	7	137148264	137148264	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:137148264C>T	ENST00000288490.5	-	28	2730	c.2730G>A	c.(2728-2730)ctG>ctA	p.L910L	DGKI_ENST00000446122.1_Silent_p.L892L|DGKI_ENST00000424189.2_Silent_p.L923L|DGKI_ENST00000453654.2_Intron	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	910					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TGAGATCTTTCAGATCTGAGT	0.527																																						dbGAP											0													114.0	100.0	105.0					7																	137148264		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2730G>A	7.37:g.137148264C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q9|Q9NZ49	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L913	ENST00000288490.5	37	c.2739	CCDS5845.1	7																																																																																			DGKI	-	NULL	ENSG00000157680		0.527	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	38	0.00	0	C	NM_004717		137148264	137148264	-1	no_errors	ENST00000424189	ensembl	human	known	69_37n	silent	20	28.57	8	SNP	0.975	T
DHX58	79132	genome.wustl.edu	37	17	40256858	40256858	+	Missense_Mutation	SNP	C	C	G	rs149021265		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:40256858C>G	ENST00000251642.3	-	11	1711	c.1489G>C	c.(1489-1491)Gag>Cag	p.E497Q		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	497	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Repressor domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCCAGCGCCTCGTTGATCAGC	0.622																																						dbGAP											0													58.0	50.0	53.0					17																	40256858		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.1489G>C	17.37:g.40256858C>G	ENSP00000251642:p.Glu497Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAM6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E497Q	ENST00000251642.3	37	c.1489	CCDS11416.1	17	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514369	0.64522	.	.	ENSG00000108771	ENST00000251642;ENST00000423748	T	0.04551	3.6	5.81	4.82	0.62117	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.11665	0.0284	L	0.31207	0.915	0.39481	D	0.967885	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.952	T	0.39121	-0.9629	10	0.17832	T	0.49	.	15.8	0.78447	0.0:0.8636:0.1364:0.0	.	490;497	B7Z455;Q96C10	.;DHX58_HUMAN	Q	497;460	ENSP00000251642:E497Q	ENSP00000251642:E497Q	E	-	1	0	DHX58	37510384	0.998000	0.40836	0.983000	0.44433	0.279000	0.26890	4.871000	0.63042	1.427000	0.47276	0.563000	0.77884	GAG	DHX58	-	pfscan_Helicase_C	ENSG00000108771		0.622	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX58	HGNC	protein_coding	OTTHUMT00000257396.1	38	0.00	0	C	NM_024119		40256858	40256858	-1	no_errors	ENST00000251642	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	G
DNAJB12	54788	genome.wustl.edu	37	10	74104777	74104777	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:74104777G>A	ENST00000444643.2	-	2	574	c.242C>T	c.(241-243)tCg>tTg	p.S81L	DNAJB12_ENST00000394903.2_Missense_Mutation_p.S115L|DNAJB12_ENST00000461919.1_Intron|DNAJB12_ENST00000338820.3_Missense_Mutation_p.S115L			Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	81						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|skin(1)	4						ACCGTTGGCCGAGGGGGCATC	0.612																																						dbGAP											0													187.0	190.0	189.0					10																	74104777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000034	CCDS7316.2	10q22	2011-09-02			ENSG00000148719	ENSG00000148719		"""Heat shock proteins / DNAJ (HSP40)"""	14891	protein-coding gene	gene with protein product		608376				11147971	Standard	NM_001002762		Approved	DJ10, FLJ20027	uc001jta.2	Q9NXW2	OTTHUMG00000018436	ENST00000444643.2:c.242C>T	10.37:g.74104777G>A	ENSP00000403313:p.Ser81Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7I3|Q9H6H0	Missense_Mutation	SNP	pfam_DUF1977_DnaJ-like,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.S115L	ENST00000444643.2	37	c.344		10	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901259	0.72754	.	.	ENSG00000148719	ENST00000338820;ENST00000394903;ENST00000444643	T;T;T	0.67865	-0.29;-0.29;-0.27	5.29	5.29	0.74685	.	0.554252	0.19877	N	0.104053	T	0.54822	0.1882	L	0.38175	1.15	0.54753	D	0.999981	P;P	0.46020	0.871;0.618	B;B	0.30495	0.116;0.023	T	0.64188	-0.6466	10	0.59425	D	0.04	-10.8218	18.9743	0.92730	0.0:0.0:1.0:0.0	.	81;81	Q9NXW2-2;Q9NXW2	.;DJB12_HUMAN	L	115;115;81	ENSP00000345575:S115L;ENSP00000378363:S115L;ENSP00000403313:S81L	ENSP00000345575:S115L	S	-	2	0	DNAJB12	73774783	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	6.658000	0.74407	2.490000	0.84030	0.585000	0.79938	TCG	DNAJB12	-	NULL	ENSG00000148719		0.612	DNAJB12-001	KNOWN	basic|appris_principal	protein_coding	DNAJB12	HGNC	protein_coding	OTTHUMT00000048581.2	22	0.00	0	G			74104777	74104777	-1	no_errors	ENST00000338820	ensembl	human	known	69_37n	missense	19	23.08	6	SNP	0.996	A
DOPEY2	9980	genome.wustl.edu	37	21	37635944	37635944	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr21:37635944C>G	ENST00000399151.3	+	25	5501	c.5416C>G	c.(5416-5418)Ctc>Gtc	p.L1806V		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1806					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTTTCTGCTTCTCAGGTATCA	0.408																																						dbGAP											0													104.0	106.0	105.0					21																	37635944		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.5416C>G	21.37:g.37635944C>G	ENSP00000382104:p.Leu1806Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.L1806V	ENST00000399151.3	37	c.5416	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729518	0.69074	.	.	ENSG00000142197	ENST00000399151	T	0.70516	-0.49	5.83	4.02	0.46733	.	0.000000	0.85682	D	0.000000	D	0.82815	0.5119	M	0.85197	2.74	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.81733	-0.0798	10	0.49607	T	0.09	.	7.9914	0.30242	0.0:0.7305:0.1323:0.1373	.	1806;1806	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	V	1806	ENSP00000382104:L1806V	ENSP00000382104:L1806V	L	+	1	0	DOPEY2	36557814	1.000000	0.71417	0.988000	0.46212	0.932000	0.56968	5.257000	0.65473	0.811000	0.34303	0.650000	0.86243	CTC	DOPEY2	-	NULL	ENSG00000142197		0.408	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	43	0.00	0	C	NM_005128		37635944	37635944	+1	no_errors	ENST00000399151	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.986	G
DPY19L2	283417	genome.wustl.edu	37	12	64057543	64057543	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:64057543C>T	ENST00000324472.4	-	3	628	c.445G>A	c.(445-447)Gaa>Aaa	p.E149K	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	149					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)	p.E149*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		CTAACCATTTCAGTGCGAAAA	0.333																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											58.0	55.0	56.0					12																	64057543		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.445G>A	12.37:g.64057543C>T	ENSP00000315988:p.Glu149Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	pfam_Dpy-19	p.E149K	ENST00000324472.4	37	c.445	CCDS31851.1	12	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990830	0.54041	.	.	ENSG00000177990	ENST00000324472;ENST00000538147	T;T	0.68331	-0.32;-0.32	2.5	2.5	0.30297	.	0.000000	0.85682	U	0.000000	T	0.81230	0.4779	M	0.86740	2.835	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.83031	-0.0162	9	.	.	.	.	10.7323	0.46104	0.0:1.0:0.0:0.0	.	149	Q6NUT2	D19L2_HUMAN	K	149;6	ENSP00000315988:E149K;ENSP00000439567:E6K	.	E	-	1	0	DPY19L2	62343810	1.000000	0.71417	0.999000	0.59377	0.753000	0.42808	6.967000	0.76079	1.389000	0.46526	0.184000	0.17185	GAA	DPY19L2	-	pfam_Dpy-19	ENSG00000177990		0.333	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	HGNC	protein_coding	OTTHUMT00000400689.2	29	0.00	0	C	NM_173812		64057543	64057543	-1	no_errors	ENST00000324472	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	T
DYNC1H1	1778	genome.wustl.edu	37	14	102449769	102449769	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:102449769G>C	ENST00000360184.4	+	7	1448	c.1284G>C	c.(1282-1284)gaG>gaC	p.E428D		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	428	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ATGAGTATGAGAAACTTCAGG	0.398																																						dbGAP											0													87.0	89.0	88.0					14																	102449769		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1284G>C	14.37:g.102449769G>C	ENSP00000348965:p.Glu428Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.E428D	ENST00000360184.4	37	c.1284	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308635	0.40895	.	.	ENSG00000197102	ENST00000360184	T	0.55413	0.52	5.58	4.67	0.58626	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.27697	0.0681	N	0.03304	-0.355	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.13335	-1.0513	10	0.11182	T	0.66	.	14.2084	0.65748	0.0722:0.0:0.9278:0.0	.	428	Q14204	DYHC1_HUMAN	D	428	ENSP00000348965:E428D	ENSP00000348965:E428D	E	+	3	2	DYNC1H1	101519522	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.365000	0.73090	2.784000	0.95788	0.591000	0.81541	GAG	DYNC1H1	-	pfam_Dynein_heavy_dom-1	ENSG00000197102		0.398	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	32	0.00	0	G	NM_001376		102449769	102449769	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	C
EDA2R	60401	genome.wustl.edu	37	X	65819498	65819498	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:65819498G>A	ENST00000374719.3	-	6	778	c.722C>T	c.(721-723)tCa>tTa	p.S241L	EDA2R_ENST00000456230.2_Missense_Mutation_p.S241L|EDA2R_ENST00000253392.5_Missense_Mutation_p.S262L|EDA2R_ENST00000450752.1_Missense_Mutation_p.S262L|EDA2R_ENST00000396050.1_Missense_Mutation_p.S241L|EDA2R_ENST00000451436.2_Missense_Mutation_p.S117L	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	241					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GTGGCTCTCTGAGGTGCAGGA	0.562																																						dbGAP											0													58.0	45.0	49.0					X																	65819498		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.722C>T	X.37:g.65819498G>A	ENSP00000363851:p.Ser241Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_27,pfscan_TNFR/NGFR_Cys_rich_reg	p.S262L	ENST00000374719.3	37	c.785	CCDS14386.1	X	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293317	0.60086	.	.	ENSG00000131080	ENST00000374719;ENST00000396050;ENST00000451436;ENST00000253392;ENST00000456230;ENST00000450752	D;D;D;D;D	0.89875	-2.45;-2.45;-2.58;-2.45;-2.58	3.59	2.72	0.32119	.	0.337445	0.20579	N	0.089580	D	0.89114	0.6623	L	0.29908	0.895	0.32477	N	0.541991	D;D;D	0.89917	0.989;1.0;0.998	D;D;D	0.83275	0.978;0.996;0.981	D	0.88012	0.2763	10	0.59425	D	0.04	-1.1059	7.9151	0.29814	0.1285:0.0:0.8715:0.0	.	117;262;241	E7EUS4;Q9HAV5-2;Q9HAV5	.;.;TNR27_HUMAN	L	241;241;117;262;241;262	ENSP00000363851:S241L;ENSP00000379365:S241L;ENSP00000253392:S262L;ENSP00000393935:S241L;ENSP00000402929:S262L	ENSP00000253392:S262L	S	-	2	0	EDA2R	65736223	1.000000	0.71417	0.820000	0.32676	0.840000	0.47671	3.264000	0.51553	0.566000	0.29273	0.523000	0.50628	TCA	EDA2R	-	prints_TNFR_27	ENSG00000131080		0.562	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDA2R	HGNC	protein_coding	OTTHUMT00000057002.1	48	0.00	0	G	NM_021783		65819498	65819498	-1	no_errors	ENST00000253392	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.928	A
EGFEM1P	93556	genome.wustl.edu	37	3	168538993	168538993	+	RNA	SNP	A	A	G	rs603638	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:168538993A>G	ENST00000483846.1	+	0	560					NR_021485.2		Q0D2K5	EGFEM_HUMAN	EGF-like and EMI domain containing 1, pseudogene																		TGTCTCGAGGATGCCTACGGA	0.458													G|||	4273	0.853235	0.8646	0.8545	5008	,	,		19258	0.9603		0.7167	False		,,,				2504	0.8671					dbGAP											0																																										-	-	-			0			AF086185		3q26.2	2010-09-24	2010-09-24	2010-09-24	ENSG00000206120	ENSG00000206120			25149	pseudogene	pseudogene			"""chromosome 3 open reading frame 50"", ""non-protein coding RNA 259"""	C3orf50, NCRNA00259		12477932	Standard	NR_021485		Approved		uc003ffh.4	Q0D2K5	OTTHUMG00000154721		3.37:g.168538993A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000483846.1	37	NULL		3																																																																																			EGFEM1P	-	-	ENSG00000206120		0.458	EGFEM1P-007	KNOWN	basic	processed_transcript	EGFEM1P	HGNC	pseudogene	OTTHUMT00000351389.1	67	0.00	0	A	NR_021485		168538993	168538993	+1	no_errors	ENST00000382864	ensembl	human	known	69_37n	rna	55	13.85	9	SNP	1.000	G
EML2	24139	genome.wustl.edu	37	19	46137704	46137704	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:46137704G>A	ENST00000245925.3	-	4	255	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W	EML2_ENST00000589876.1_Missense_Mutation_p.R69W|EML2_ENST00000587152.1_Missense_Mutation_p.R270W|EML2_ENST00000536630.1_Missense_Mutation_p.R216W|EML2_ENST00000586902.1_5'Flank	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	69	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		AGGTTGGCCCGGCAGTCTCGG	0.507																																						dbGAP											0													43.0	32.0	36.0					19																	46137704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.205C>T	19.37:g.46137704G>A	ENSP00000245925:p.Arg69Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R270W	ENST00000245925.3	37	c.808	CCDS12670.1	19	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894423	0.72639	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	T;T;T	0.59772	0.24;0.24;0.24	4.74	1.05	0.20165	HELP (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	H	0.94698	3.57	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.83239	-0.0059	10	0.87932	D	0	-25.8686	12.5673	0.56316	0.0:0.0:0.6212:0.3788	.	69;235;216;227;69	B7Z918;B7Z3Q9;B7Z3I2;B7Z872;O95834	.;.;.;.;EMAL2_HUMAN	W	216;69;270;227	ENSP00000442365:R216W;ENSP00000245925:R69W;ENSP00000382503:R227W	ENSP00000245925:R69W	R	-	1	2	EML2	50829544	1.000000	0.71417	0.999000	0.59377	0.909000	0.53808	2.250000	0.43178	0.070000	0.16634	0.462000	0.41574	CGG	EML2	-	pfam_HELP,superfamily_Quinonprotein_ADH-like	ENSG00000125746		0.507	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	95	0.00	0	G	NM_012155		46137704	46137704	-1	no_errors	ENST00000587152	ensembl	human	known	69_37n	missense	68	14.81	12	SNP	1.000	A
MTRNR2L1	100462977	genome.wustl.edu	37	17	22024590	22024590	+	IGR	SNP	A	A	C	rs58966318	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:22024590A>C	ENST00000540040.1	+	0	1555				MTND1P15_ENST00000579693.1_RNA|RP11-846F4.12_ENST00000483901.2_RNA	NM_001190452.1	NP_001177381.1			MT-RNR2-like 1																		ACTACTCCTAACATCATGACC	0.408													-|||	2707	0.540535	0.6861	0.5375	5008	,	,		18044	0.5099		0.4423	False		,,,				2504	0.4785					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			CR612552	CCDS54097.1	17p11.2	2014-02-18			ENSG00000256618	ENSG00000256618			37155	protein-coding gene	gene with protein product	"""humanin-like 1"""					19477263	Standard	NM_001190452		Approved		uc002gzb.2	P0CJ68	OTTHUMG00000179068		17.37:g.22024590A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000540040.1	37	NULL	CCDS54097.1	17																																																																																			RP11-846F4.12	-	-	ENSG00000243655		0.408	MTRNR2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000243655	Clone_based_vega_gene	protein_coding	OTTHUMT00000444600.2	32	0.00	0	A	NM_001190452		22024590	22024590	-1	no_errors	ENST00000483901	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.002	C
ENTPD4	9583	genome.wustl.edu	37	8	23305236	23305236	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:23305236C>T	ENST00000358689.4	-	4	604	c.369G>A	c.(367-369)atG>atA	p.M123I	ENTPD4_ENST00000356206.6_Missense_Mutation_p.M123I|ENTPD4_ENST00000417069.2_Missense_Mutation_p.M123I	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	123					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		TTTTATCCCTCATTTGCCTGA	0.468																																						dbGAP											0													321.0	297.0	305.0					8																	23305236		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.369G>A	8.37:g.23305236C>T	ENSP00000351520:p.Met123Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSS3|O15092	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.M123I	ENST00000358689.4	37	c.369	CCDS6041.1	8	.	.	.	.	.	.	.	.	.	.	C	29.8	5.036913	0.93630	.	.	ENSG00000197217	ENST00000356206;ENST00000358689;ENST00000417069;ENST00000518718	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	N	0.24115	0.695	0.80722	D	1	P;P;P;P	0.50819	0.885;0.885;0.925;0.939	P;P;P;P	0.58130	0.771;0.833;0.743;0.833	T	0.03566	-1.1024	10	0.25106	T	0.35	-31.2441	18.7307	0.91734	0.0:1.0:0.0:0.0	.	123;123;123;123	B4DU21;Q8NE73;Q9Y227-2;Q9Y227	.;.;.;ENTP4_HUMAN	I	123;123;123;89	ENSP00000348536:M123I;ENSP00000351520:M123I;ENSP00000408573:M123I;ENSP00000429455:M89I	ENSP00000348536:M123I	M	-	3	0	ENTPD4	23361181	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.424000	0.80242	2.770000	0.95276	0.650000	0.86243	ATG	ENTPD4	-	pfam_GDA1_CD39_NTPase	ENSG00000197217		0.468	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1	197	0.51	1	C	NM_004901		23305236	23305236	-1	no_errors	ENST00000358689	ensembl	human	known	69_37n	missense	100	15.97	19	SNP	1.000	T
EPB41	2035	genome.wustl.edu	37	1	29443675	29443675	+	3'UTR	SNP	T	T	C	rs502393	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:29443675T>C	ENST00000343067.4	+	0	3073				EPB41_ENST00000398863.2_3'UTR|EPB41_ENST00000460378.1_3'UTR|EPB41_ENST00000356093.2_3'UTR|EPB41_ENST00000373798.1_3'UTR	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		ACAGGGTCCATGGAATTCTTC	0.488													C|||	2903	0.579673	0.357	0.6614	5008	,	,		17900	0.5089		0.7883	False		,,,				2504	0.681					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.*351T>C	1.37:g.29443675T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	RNA	SNP	-	NULL	ENST00000343067.4	37	NULL	CCDS53288.1	1																																																																																			EPB41	-	-	ENSG00000159023		0.488	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	9	0.00	0	T	NM_203342		29443675	29443675	+1	no_errors	ENST00000460378	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.011	C
EPG5	57724	genome.wustl.edu	37	18	43437878	43437878	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr18:43437878C>G	ENST00000282041.5	-	42	7416	c.7382G>C	c.(7381-7383)aGa>aCa	p.R2461T	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2461					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						AGAGCTGAGTCTCTCCTCAGC	0.512																																						dbGAP											0													75.0	79.0	78.0					18																	43437878		1910	4116	6026	-	-	-	SO:0001583	missense	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7382G>C	18.37:g.43437878C>G	ENSP00000282041:p.Arg2461Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.R2461T	ENST00000282041.5	37	c.7382	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558875	0.86231	.	.	ENSG00000152223	ENST00000282041;ENST00000540322;ENST00000308403	T	0.12255	2.7	5.64	5.64	0.86602	.	.	.	.	.	T	0.37919	0.1021	M	0.61703	1.905	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.02047	-1.1223	9	0.51188	T	0.08	-8.3776	19.6884	0.95987	0.0:1.0:0.0:0.0	.	2461	Q9HCE0	EPG5_HUMAN	T	2461;389;1336	ENSP00000282041:R2461T	ENSP00000282041:R2461T	R	-	2	0	EPG5	41691876	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	7.420000	0.80191	2.658000	0.90341	0.561000	0.74099	AGA	EPG5	-	NULL	ENSG00000152223		0.512	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	35	0.00	0	C	NM_020964		43437878	43437878	-1	no_errors	ENST00000282041	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	G
EPHX2	2053	genome.wustl.edu	37	8	27399018	27399018	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:27399018G>C	ENST00000521400.1	+	16	1838	c.1408G>C	c.(1408-1410)Gaa>Caa	p.E470Q	EPHX2_ENST00000380476.3_Missense_Mutation_p.E417Q|EPHX2_ENST00000521780.1_Missense_Mutation_p.E404Q|EPHX2_ENST00000517536.1_Missense_Mutation_p.E287Q|EPHX2_ENST00000518379.1_Missense_Mutation_p.E438Q	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	470	Epoxide hydrolase.		E -> G (no effect on phosphatase activity and epoxyde hydrolase activity; dbSNP:rs68053459). {ECO:0000269|Ref.6}.		arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		CCGAAACATGGAAAGGAACTG	0.547																																						dbGAP											0													117.0	100.0	106.0					8																	27399018		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.1408G>C	8.37:g.27399018G>C	ENSP00000430269:p.Glu470Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,prints_Epox_hydrolase-like,prints_Haloacid_DH/epoxide_hydro,prints_AB_hydrolase_1,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA_v3	p.E470Q	ENST00000521400.1	37	c.1408	CCDS6060.1	8	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978705	0.34942	.	.	ENSG00000120915	ENST00000521400;ENST00000517536;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	5.92	4.05	0.47172	Alpha/beta hydrolase fold-1 (1);	0.801389	0.12125	N	0.497323	T	0.61850	0.2380	L	0.56396	1.775	0.09310	N	1	B;P	0.38195	0.416;0.622	B;B	0.42163	0.378;0.17	T	0.52162	-0.8612	10	0.46703	T	0.11	-8.6118	9.3677	0.38234	0.0:0.1575:0.6788:0.1637	.	438;470	E5RFU2;P34913	.;HYES_HUMAN	Q	470;287;404;417;417;438	ENSP00000430269:E470Q;ENSP00000428875:E287Q;ENSP00000430302:E404Q;ENSP00000369843:E417Q;ENSP00000427956:E438Q	ENSP00000369843:E417Q	E	+	1	0	EPHX2	27454935	0.260000	0.24053	0.038000	0.18304	0.877000	0.50540	1.550000	0.36223	0.756000	0.33013	0.557000	0.71058	GAA	EPHX2	-	pfam_AB_hydrolase_1	ENSG00000120915		0.547	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX2	HGNC	protein_coding	OTTHUMT00000219954.4	63	0.00	0	G			27399018	27399018	+1	no_errors	ENST00000521400	ensembl	human	known	69_37n	missense	49	10.91	6	SNP	0.129	C
FAM154A	158297	genome.wustl.edu	37	9	19033006	19033006	+	5'UTR	SNP	G	G	T	rs10963921	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr9:19033006G>T	ENST00000380534.4	-	0	180				FAM154A_ENST00000380530.1_5'UTR|FAM154A_ENST00000542071.1_5'UTR|FAM154A_ENST00000583128.1_5'UTR	NM_153707.2	NP_714918.2	Q8IYX7	F154A_HUMAN	family with sequence similarity 154, member A											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|skin(1)	26				GBM - Glioblastoma multiforme(50;6.53e-16)		CAGGCTCGAGGGTCTTGGCAG	0.597													G|||	2074	0.414137	0.6611	0.3343	5008	,	,		17642	0.2073		0.3976	False		,,,				2504	0.3671					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC033489	CCDS6487.1, CCDS75819.1, CCDS75820.1	9p22.1	2012-03-23	2008-02-21	2008-02-21	ENSG00000155875	ENSG00000155875			28566	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 138"""	C9orf138		12477932	Standard	NM_153707		Approved	MGC35182	uc003zni.2	Q8IYX7	OTTHUMG00000019609	ENST00000380534.4:c.-100C>A	9.37:g.19033006G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VY58	RNA	SNP	-	NULL	ENST00000380534.4	37	NULL	CCDS6487.1	9																																																																																			FAM154A	-	-	ENSG00000155875		0.597	FAM154A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM154A	HGNC	protein_coding	OTTHUMT00000051811.1	33	0.00	0	G	NM_153707		19033006	19033006	-1	no_errors	ENST00000583128	ensembl	human	known	69_37n	rna	13	22.22	4	SNP	0.003	T
NUTM2A	728118	genome.wustl.edu	37	10	88992641	88992641	+	Missense_Mutation	SNP	G	G	A	rs145500179	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:88992641G>A	ENST00000381707.2	+	5	2016	c.1633G>A	c.(1633-1635)Ggc>Agc	p.G545S	NUTM2A-AS1_ENST00000456104.1_RNA|NUTM2A_ENST00000381689.4_Missense_Mutation_p.G545S|NUTM2A-AS1_ENST00000451940.2_RNA	NM_001099338.1	NP_001092808.1	Q8IVF1	NTM2A_HUMAN	NUT family member 2A	545																	ACGGGAAGAGGGCGAAGTGAA	0.617													.|||	3976	0.79393	0.6974	0.8256	5008	,	,		17238	0.9563		0.7734	False		,,,				2504	0.7556					dbGAP											0													7.0	9.0	8.0					10																	88992641		1545	3107	4652	-	-	-	SO:0001583	missense	0				CCDS44452.1	10q23.2	2013-03-15	2013-03-14	2013-03-14	ENSG00000184923	ENSG00000184923			23438	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member A"""	FAM22A			Standard	NM_001099338		Approved		uc001kek.3	Q8IVF1	OTTHUMG00000018670	ENST00000381707.2:c.1633G>A	10.37:g.88992641G>A	ENSP00000371126:p.Gly545Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMX5|C9JDI1|Q5VZW1	Missense_Mutation	SNP	NULL	p.G545S	ENST00000381707.2	37	c.1633	CCDS44452.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	8.454|8.454	0.853843|0.853843	0.17106|0.17106	.|.	.|.	ENSG00000184923|ENSG00000184923	ENST00000451286|ENST00000381689;ENST00000381707;ENST00000416901;ENST00000432986	.|T;T	.|0.24723	.|1.84;2.64	1.18|1.18	1.18|1.18	0.20946|0.20946	.|Nuclear Testis protein, C-terminal (1);	1.216050|1.216050	0.05733|0.05733	N|N	0.599879|0.599879	T|T	0.26085|0.26085	0.0636|0.0636	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	P|P	0.0|0.0	.|P	.|0.43287	.|0.802	.|B	.|0.42959	.|0.403	T|T	0.31558|0.31558	-0.9939|-0.9939	5|9	.|0.37606	.|T	.|0.19	.|.	5.8963|5.8963	0.18941|0.18941	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|545	.|Q8IVF1	.|FA22A_HUMAN	E|S	322|545;545;472;22	.|ENSP00000371107:G545S;ENSP00000371126:G545S	.|ENSP00000371107:G545S	G|G	+|+	2|1	0|0	FAM22A|FAM22A	88982621|88982621	0.007000|0.007000	0.16637|0.16637	0.006000|0.006000	0.13384|0.13384	0.008000|0.008000	0.06430|0.06430	2.120000|2.120000	0.41968|0.41968	1.015000|1.015000	0.39444|0.39444	0.374000|0.374000	0.22700|0.22700	GGG|GGC	FAM22A	-	NULL	ENSG00000184923		0.617	NUTM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM22A	HGNC	protein_coding	OTTHUMT00000049198.2	27	0.00	0	G	NM_001099338		88992641	88992641	+1	no_errors	ENST00000381707	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.007	A
FAM86DP	692099	genome.wustl.edu	37	3	75471889	75471889	+	RNA	SNP	A	A	T	rs3763578	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:75471889A>T	ENST00000459803.1	-	0	1252					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		CATGTCTGATATATGGTGATT	0.448													.|||	983	0.196286	0.4236	0.1772	5008	,	,		19607	0.0218		0.1839	False		,,,				2504	0.0951					dbGAP											0																																										-	-	-			0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471889A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.448	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1	47	0.00	0	A	NR_024241		75471889	75471889	-1	no_errors	ENST00000459803	ensembl	human	known	69_37n	rna	47	11.32	6	SNP	0.000	T
LOC101927905	101927905	genome.wustl.edu	37	12	8393255	8393255	+	lincRNA	SNP	G	G	A	rs11044215	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:8393255G>A	ENST00000304751.9	+	0	1590				FAM86FP_ENST00000427893.2_RNA																							AAAATATCCCGCAGCAGCTCA	0.498													.|||	1331	0.265775	0.3585	0.3055	5008	,	,		-128	0.1399		0.2396	False		,,,				2504	0.2689					dbGAP											0																																										-	-	-			0																															12.37:g.8393255G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000304751.9	37	NULL		12																																																																																			FAM86FP	-	-	ENSG00000164845		0.498	RP11-266K4.9-001	KNOWN	basic	lincRNA	FAM86FP	HGNC	lincRNA	OTTHUMT00000400464.1	144	0.69	1	G			8393255	8393255	-1	no_errors	ENST00000427893	ensembl	human	known	69_37n	rna	105	13.93	17	SNP	0.965	A
LOC101927905	101927905	genome.wustl.edu	37	12	8393268	8393268	+	lincRNA	SNP	A	A	G	rs11044216	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:8393268A>G	ENST00000304751.9	+	0	1590				FAM86FP_ENST00000427893.2_RNA																							GCAGCTCAGAATCTGATGAGT	0.483													.|||	721	0.14397	0.1649	0.2089	5008	,	,		-128	0.0496		0.2058	False		,,,				2504	0.1033					dbGAP											0																																										-	-	-			0																															12.37:g.8393268A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000304751.9	37	NULL		12																																																																																			FAM86FP	-	-	ENSG00000164845		0.483	RP11-266K4.9-001	KNOWN	basic	lincRNA	FAM86FP	HGNC	lincRNA	OTTHUMT00000400464.1	152	0.00	0	A			8393268	8393268	-1	no_errors	ENST00000427893	ensembl	human	known	69_37n	rna	103	13.45	16	SNP	0.234	G
FBN1	2200	genome.wustl.edu	37	15	48802320	48802320	+	Silent	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:48802320G>T	ENST00000316623.5	-	14	2090	c.1635C>A	c.(1633-1635)cgC>cgA	p.R545R		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	545	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		R -> C (in MFS). {ECO:0000269|PubMed:11700157, ECO:0000269|PubMed:9338581}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TGTTGATGCAGCGTCCATTAT	0.363																																						dbGAP											0													104.0	93.0	97.0					15																	48802320		2197	4296	6493	-	-	-	SO:0001819	synonymous_variant	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1635C>A	15.37:g.48802320G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.R545	ENST00000316623.5	37	c.1635	CCDS32232.1	15																																																																																			FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.363	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	43	0.00	0	G			48802320	48802320	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.889	T
FCGR3A	2214	genome.wustl.edu	37	1	161565479	161565479	+	Intron	SNP	G	G	A	rs111504845	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:161565479G>A	ENST00000540048.1	-	2	94				FCGR2C_ENST00000466542.2_RNA|RP11-25K21.6_ENST00000537821.2_RNA|FCGR2C_ENST00000543859.1_RNA|FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR2C_ENST00000473530.2_RNA			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	aatggagactgggcctgaaaa	0.418													.|||	2213	0.441893	0.3298	0.5144	5008	,	,		18739	0.62		0.331	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+34678C>T	1.37:g.161565479G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Silent	SNP	NULL	p.L45	ENST00000540048.1	37	c.135		1																																																																																			FCGR2C	-	NULL	ENSG00000244682		0.418	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	FCGR2C	HGNC	protein_coding		57	0.00	0	G	NM_000569		161565479	161565479	+1	no_start_codon	ENST00000543859	ensembl	human	known	69_37n	silent	42	18.52	10	SNP	0.301	A
FEZ1	9638	genome.wustl.edu	37	11	125324076	125324076	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:125324076G>C	ENST00000278919.3	-	7	1204	c.970C>G	c.(970-972)Ctg>Gtg	p.L324V	FEZ1_ENST00000527350.1_5'UTR	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	324					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CCACTCTGCAGAATGTTGGAG	0.552																																					Melanoma(180;509 2033 10762 15939 24711)	dbGAP											0													119.0	96.0	104.0					11																	125324076		2201	4299	6500	-	-	-	SO:0001583	missense	0			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.970C>G	11.37:g.125324076G>C	ENSP00000278919:p.Leu324Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O00679|O00728|Q6IBI7	Missense_Mutation	SNP	pfam_FEZ	p.L324V	ENST00000278919.3	37	c.970	CCDS31716.1	11	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565056	0.45694	.	.	ENSG00000149557	ENST00000278919	T	0.03152	4.03	5.63	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.04137	0.0115	L	0.56769	1.78	0.80722	D	1	P	0.43857	0.819	B	0.32724	0.151	T	0.52578	-0.8557	10	0.13853	T	0.58	-22.0273	13.5831	0.61915	0.0764:0.0:0.9236:0.0	.	324	Q99689	FEZ1_HUMAN	V	324	ENSP00000278919:L324V	ENSP00000278919:L324V	L	-	1	2	FEZ1	124829286	0.999000	0.42202	0.999000	0.59377	0.990000	0.78478	1.436000	0.34980	1.371000	0.46172	0.563000	0.77884	CTG	FEZ1	-	NULL	ENSG00000149557		0.552	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZ1	HGNC	protein_coding	OTTHUMT00000386875.1	55	0.00	0	G	NM_005103		125324076	125324076	-1	no_errors	ENST00000278919	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	1.000	C
FEZ2	9637	genome.wustl.edu	37	2	36781401	36781401	+	Intron	SNP	T	T	C	rs1533946	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:36781401T>C	ENST00000405912.3	-	8	1045				FEZ2_ENST00000305852.7_Intron|FEZ2_ENST00000487919.1_Intron|FEZ2_ENST00000379245.4_Intron|AC007401.2_ENST00000406220.1_5'Flank	NM_005102.2	NP_005093.2	Q9UHY8	FEZ2_HUMAN	fasciculation and elongation protein zeta 2 (zygin II)						axon guidance (GO:0007411)|nervous system development (GO:0007399)|signal transduction (GO:0007165)					breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	7		all_hematologic(82;0.21)				TTCACAATTATAGTCCTAGGT	0.438													C|||	2223	0.44389	0.4939	0.3386	5008	,	,		18933	0.624		0.3907	False		,,,				2504	0.32					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U60061	CCDS46257.1, CCDS46258.1	2p21	2008-05-15			ENSG00000171055	ENSG00000171055			3660	protein-coding gene	gene with protein product		604826				9096408	Standard	NM_005102		Approved		uc002rpg.2	Q9UHY8	OTTHUMG00000152148	ENST00000405912.3:c.1046-1079A>G	2.37:g.36781401T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5EBN3|Q76LN0|Q99690	Missense_Mutation	SNP	NULL	p.I70V	ENST00000405912.3	37	c.208	CCDS46257.1	2																																																																																			FEZ2	-	NULL	ENSG00000171055		0.438	FEZ2-002	KNOWN	basic|CCDS	protein_coding	FEZ2	HGNC	protein_coding	OTTHUMT00000325432.1	30	0.00	0	T			36781401	36781401	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000432869	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.000	C
FGF20	26281	genome.wustl.edu	37	8	16850631	16850631	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:16850631C>T	ENST00000180166.5	-	3	734	c.586G>A	c.(586-588)Gat>Aat	p.D196N		NM_019851.2	NP_062825.1	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	196					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of cardiac muscle cell proliferation (GO:0060043)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	11				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CTTTCTGGATCCACTGGTCTA	0.438																																						dbGAP											0													174.0	155.0	161.0					8																	16850631		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB030648	CCDS5998.1	8p22	2008-05-15			ENSG00000078579	ENSG00000078579			3677	protein-coding gene	gene with protein product		605558				10913340	Standard	NM_019851		Approved		uc003wxc.1	Q9NP95	OTTHUMG00000096964	ENST00000180166.5:c.586G>A	8.37:g.16850631C>T	ENSP00000180166:p.Asp196Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPH5	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.D196N	ENST00000180166.5	37	c.586	CCDS5998.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.228778|5.228778	0.95173|0.95173	.|.	.|.	ENSG00000078579|ENSG00000078579	ENST00000180166|ENST00000519941	T|.	0.66638|.	-0.22|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.046425|.	0.85682|.	D|.	0.000000|.	T|T	0.81721|0.81721	0.4882|0.4882	M|M	0.79614|0.79614	2.46|2.46	0.80722|0.80722	D|D	1|1	P|.	0.52061|.	0.95|.	P|.	0.47251|.	0.542|.	T|T	0.80415|0.80415	-0.1392|-0.1392	10|5	0.59425|.	D|.	0.04|.	.|.	20.3271|20.3271	0.98704|0.98704	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	196|.	Q9NP95|.	FGF20_HUMAN|.	N|E	196|97	ENSP00000180166:D196N|.	ENSP00000180166:D196N|.	D|G	-|-	1|2	0|0	FGF20|FGF20	16895002|16895002	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.487000|7.487000	0.81328|0.81328	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GAT|GGA	FGF20	-	superfamily_Cytokine_IL1-like	ENSG00000078579		0.438	FGF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF20	HGNC	protein_coding	OTTHUMT00000214030.1	45	0.00	0	C			16850631	16850631	-1	no_errors	ENST00000180166	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	T
FLAD1	80308	genome.wustl.edu	37	1	154965445	154965445	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:154965445G>C	ENST00000292180.3	+	7	2018	c.1696G>C	c.(1696-1698)Gga>Cga	p.G566R	FLAD1_ENST00000368432.1_3'UTR|FLAD1_ENST00000295530.2_3'UTR|FLAD1_ENST00000368428.1_Missense_Mutation_p.G107R|FLAD1_ENST00000405236.2_3'UTR|LENEP_ENST00000392487.1_5'Flank|FLAD1_ENST00000315144.10_Missense_Mutation_p.G469R	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	566					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GAGCCCAGGAGGACACCCCAC	0.617																																						dbGAP											0													81.0	68.0	72.0					1																	154965445		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.1696G>C	1.37:g.154965445G>C	ENSP00000292180:p.Gly566Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	pfam_Mopterin-bd,pfam_PAPS_reduct,superfamily_Mopterin-bd,smart_Mopterin-bd,pirsf_FAD_synth_Mopterin-bd	p.G566R	ENST00000292180.3	37	c.1696	CCDS1078.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991592	0.74703	.	.	ENSG00000160688	ENST00000315144;ENST00000292180;ENST00000368428	.	.	.	5.2	5.2	0.72013	.	0.107945	0.64402	D	0.000006	T	0.72867	0.3514	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.75374	-0.3340	9	0.66056	D	0.02	-12.6283	12.9005	0.58123	0.0788:0.0:0.9212:0.0	.	566	Q8NFF5	FAD1_HUMAN	R	469;566;107	.	ENSP00000292180:G566R	G	+	1	0	FLAD1	153232069	1.000000	0.71417	0.992000	0.48379	0.526000	0.34562	6.824000	0.75288	2.715000	0.92844	0.511000	0.50034	GGA	FLAD1	-	pirsf_FAD_synth_Mopterin-bd	ENSG00000160688		0.617	FLAD1-001	NOVEL	basic|CCDS	protein_coding	FLAD1	HGNC	protein_coding	OTTHUMT00000091089.1	50	0.00	0	G	NM_025207		154965445	154965445	+1	no_errors	ENST00000292180	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	C
FLII	2314	genome.wustl.edu	37	17	18149365	18149365	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:18149365C>T	ENST00000327031.4	-	26	3504	c.3279G>A	c.(3277-3279)gaG>gaA	p.E1093E	FLII_ENST00000578558.1_Intron|FLII_ENST00000379450.4_Silent_p.E1007E|FLII_ENST00000579294.1_Silent_p.E1082E|FLII_ENST00000545457.2_Silent_p.E1038E	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	1093					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					TGTCCTCACTCTCAAAGGGAA	0.607																																						dbGAP											0													79.0	75.0	76.0					17																	18149365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.3279G>A	17.37:g.18149365C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIL0|F5H407|J3QLG3	Silent	SNP	pfam_Gelsolin_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Gelsolin,prints_Gelsolin	p.E1093	ENST00000327031.4	37	c.3279	CCDS11192.1	17																																																																																			FLII	-	smart_Gelsolin	ENSG00000177731		0.607	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLII	HGNC	protein_coding	OTTHUMT00000132032.2	43	0.00	0	C	NM_002018		18149365	18149365	-1	no_errors	ENST00000327031	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	1.000	T
FLYWCH1	84256	genome.wustl.edu	37	16	2980496	2980496	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:2980496G>T	ENST00000253928.9	+	4	816	c.411G>T	c.(409-411)aaG>aaT	p.K137N	FLYWCH1_ENST00000399667.2_Missense_Mutation_p.K137N|FLYWCH1_ENST00000416288.2_Missense_Mutation_p.K136N			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	137						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						AGCAGGAGAAGGCAGTGGGGG	0.667																																						dbGAP											0													14.0	16.0	15.0					16																	2980496		1949	4137	6086	-	-	-	SO:0001583	missense	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.411G>T	16.37:g.2980496G>T	ENSP00000253928:p.Lys137Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Missense_Mutation	SNP	pfam_Znf_FLYWCH	p.K137N	ENST00000253928.9	37	c.411		16	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444409	0.43429	.	.	ENSG00000059122	ENST00000399667;ENST00000253928;ENST00000416288	.	.	.	3.42	1.47	0.22746	Zinc finger, FLYWCH-type (1);	.	.	.	.	T	0.55305	0.1912	M	0.64997	1.995	0.27807	N	0.942284	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.943	T	0.43196	-0.9406	8	0.87932	D	0	.	5.6108	0.17404	0.2497:0.0:0.7503:0.0	.	137;136	Q4VC44;Q4VC44-2	FWCH1_HUMAN;.	N	137;137;136	.	ENSP00000253928:K137N	K	+	3	2	FLYWCH1	2920497	0.950000	0.32346	0.996000	0.52242	0.817000	0.46193	1.003000	0.29809	0.465000	0.27167	0.655000	0.94253	AAG	FLYWCH1	-	pfam_Znf_FLYWCH	ENSG00000059122		0.667	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	HGNC	protein_coding	OTTHUMT00000436479.1	50	0.00	0	G	NM_032296		2980496	2980496	+1	no_errors	ENST00000399667	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.996	T
FOXJ3	22887	genome.wustl.edu	37	1	42645444	42645444	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:42645444C>G	ENST00000372572.1	-	15	2117	c.1806G>C	c.(1804-1806)caG>caC	p.Q602H	FOXJ3_ENST00000372571.1_Missense_Mutation_p.Q116H|FOXJ3_ENST00000545068.1_Missense_Mutation_p.Q602H|FOXJ3_ENST00000361346.1_Missense_Mutation_p.Q602H|FOXJ3_ENST00000361776.1_Missense_Mutation_p.Q568H|FOXJ3_ENST00000372573.1_Missense_Mutation_p.Q602H	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	602					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AACGCCGCATCTGGAAGGCTT	0.507																																						dbGAP											0													178.0	162.0	168.0					1																	42645444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.1806G>C	1.37:g.42645444C>G	ENSP00000361653:p.Gln602His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.Q602H	ENST00000372572.1	37	c.1806	CCDS30689.1	1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650897	0.29336	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000372571;ENST00000361346;ENST00000361776;ENST00000545068	D;D;D;D;D	0.93659	-3.25;-3.25;-3.25;-3.26;-3.25	5.79	4.88	0.63580	.	0.136094	0.49305	D	0.000144	D	0.86686	0.5992	N	0.22421	0.69	0.41073	D	0.985461	B	0.06786	0.001	B	0.06405	0.002	T	0.81992	-0.0678	10	0.48119	T	0.1	.	8.3407	0.32241	0.0:0.7621:0.1559:0.082	.	602	Q9UPW0	FOXJ3_HUMAN	H	602;602;116;602;568;602	ENSP00000361654:Q602H;ENSP00000361653:Q602H;ENSP00000354620:Q602H;ENSP00000354449:Q568H;ENSP00000439044:Q602H	ENSP00000354620:Q602H	Q	-	3	2	FOXJ3	42418031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.621000	0.46418	1.457000	0.47850	0.655000	0.94253	CAG	FOXJ3	-	NULL	ENSG00000198815		0.507	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FOXJ3	HGNC	protein_coding	OTTHUMT00000018310.1	60	0.00	0	C	NM_014947		42645444	42645444	-1	no_errors	ENST00000361346	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	G
FOXL2	668	genome.wustl.edu	37	3	138665213	138665213	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:138665213C>T	ENST00000330315.3	-	1	769	c.352G>A	c.(352-354)Gag>Aag	p.E118K	C3orf72_ENST00000383165.3_5'Flank|RP11-548O1.3_ENST00000495287.1_lincRNA	NM_023067.3	NP_075555.1	P58012	FOXL2_HUMAN	forkhead box L2	118					apoptotic DNA fragmentation (GO:0006309)|cell differentiation (GO:0030154)|embryonic eye morphogenesis (GO:0048048)|extraocular skeletal muscle development (GO:0002074)|female somatic sex determination (GO:0019101)|granulosa cell differentiation (GO:0060014)|menstruation (GO:0042703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	cysteine-type endopeptidase regulator activity involved in apoptotic process (GO:0043028)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin conjugating enzyme binding (GO:0031624)			large_intestine(1)|lung(1)|ovary(333)|skin(1)	336						CCGCCGCCCTCGCGCGGCACC	0.612			Mis		granulosa-cell tumour of the ovary		"""Blepharophimosis, ptosis and epicanthus inversus Types I, II; Premature ovarian failure type III"""																															dbGAP		Dom	yes		3	3q23	668	forkhead box L2	yes	O	0			GRCh37	CM082718	FOXL2	M							47.0	48.0	48.0					3																	138665213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF301906	CCDS3105.1	3q23	2008-04-10			ENSG00000183770	ENSG00000183770		"""Forkhead boxes"""	1092	protein-coding gene	gene with protein product		605597		BPES		1941972	Standard	NM_023067		Approved	BPES1	uc003esw.3	P58012	OTTHUMG00000159889	ENST00000330315.3:c.352G>A	3.37:g.138665213C>T	ENSP00000333188:p.Glu118Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZGJ3	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.E118K	ENST00000330315.3	37	c.352	CCDS3105.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.083596	0.94050	.	.	ENSG00000183770	ENST00000330315;ENST00000542203	D	0.95412	-3.7	4.07	4.07	0.47477	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	U	0.000000	D	0.95978	0.8690	L	0.39467	1.215	0.80722	D	1	D	0.64830	0.994	D	0.63488	0.915	D	0.96857	0.9629	10	0.87932	D	0	.	16.6195	0.84926	0.0:1.0:0.0:0.0	.	118	P58012	FOXL2_HUMAN	K	118	ENSP00000333188:E118K	ENSP00000333188:E118K	E	-	1	0	FOXL2	140147903	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.254000	0.78329	1.970000	0.57323	0.505000	0.49811	GAG	FOXL2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000183770		0.612	FOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXL2	HGNC	protein_coding	OTTHUMT00000357999.1	88	0.00	0	C			138665213	138665213	-1	no_errors	ENST00000330315	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	1.000	T
FRMD4A	55691	genome.wustl.edu	37	10	13852855	13852855	+	Silent	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:13852855C>G	ENST00000357447.2	-	4	533	c.165G>C	c.(163-165)ctG>ctC	p.L55L	FRMD4A_ENST00000378503.1_Silent_p.L55L|FRMD4A_ENST00000358621.4_Silent_p.L40L|FRMD4A_ENST00000342409.2_Silent_p.L71L	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	55	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						CCTTTTCCTTCAGATTGAAGT	0.478																																						dbGAP											0													74.0	67.0	70.0					10																	13852855		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.165G>C	10.37:g.13852855C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	Silent	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.L55	ENST00000357447.2	37	c.165	CCDS7101.1	10																																																																																			FRMD4A	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000151474		0.478	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	49	0.00	0	C	NM_018027		13852855	13852855	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	silent	41	19.23	10	SNP	1.000	G
FRMPD2	143162	genome.wustl.edu	37	10	49388901	49388901	+	Missense_Mutation	SNP	C	C	T	rs61840030	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:49388901C>T	ENST00000374201.3	-	21	3037	c.2735G>A	c.(2734-2736)gGg>gAg	p.G912E	FRMPD2_ENST00000407470.4_Missense_Mutation_p.G880E|FRMPD2_ENST00000305531.3_Missense_Mutation_p.G887E|FRMPD2_ENST00000463706.1_5'Flank	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	912					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		GCTCTGCACCCCAGCCATGTC	0.483																																						dbGAP											0													1.0	1.0	1.0					10																	49388901		70	202	272	-	-	-	SO:0001583	missense	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2735G>A	10.37:g.49388901C>T	ENSP00000363317:p.Gly912Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.G912E	ENST00000374201.3	37	c.2735	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	C	5.948	0.358910	0.11239	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.62788	0.03;0.0;0.0	5.13	-10.3	0.00346	.	.	.	.	.	T	0.29190	0.0726	N	0.14661	0.345	0.80722	P	0.0	B;B;B	0.27450	0.103;0.179;0.103	B;B;B	0.25140	0.058;0.033;0.058	T	0.08351	-1.0726	8	0.07813	T	0.8	.	3.5111	0.07708	0.1915:0.103:0.1445:0.561	.	887;912;880	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	E	912;887;880	ENSP00000363317:G912E;ENSP00000307079:G887E;ENSP00000384339:G880E	ENSP00000307079:G887E	G	-	2	0	FRMPD2	49058907	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.517000	0.02248	-3.272000	0.00199	-0.145000	0.13849	GGG	FRMPD2	-	NULL	ENSG00000170324		0.483	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	71	0.00	0	C	NM_152428		49388901	49388901	-1	no_errors	ENST00000374201	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.000	T
FRY	10129	genome.wustl.edu	37	13	32768304	32768304	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr13:32768304G>T	ENST00000380250.3	+	29	4112	c.3616G>T	c.(3616-3618)Gtt>Ttt	p.V1206F		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1206						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CTGCGAAGTTGTTGTCTTGCT	0.383																																						dbGAP											0													156.0	147.0	150.0					13																	32768304		1879	4112	5991	-	-	-	SO:0001583	missense	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.3616G>T	13.37:g.32768304G>T	ENSP00000369600:p.Val1206Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V1206F	ENST00000380250.3	37	c.3616	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	G	32	5.113585	0.94339	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.65364	-0.15	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.81645	0.4866	M	0.82630	2.6	0.80722	D	1	D	0.67145	0.996	D	0.73380	0.98	D	0.83599	0.0127	10	0.72032	D	0.01	.	19.6764	0.95936	0.0:0.0:1.0:0.0	.	1206	Q5TBA9	FRY_HUMAN	F	1206;45	ENSP00000369600:V1206F	ENSP00000369600:V1206F	V	+	1	0	FRY	31666304	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	9.648000	0.98483	2.715000	0.92844	0.563000	0.77884	GTT	FRY	-	superfamily_ARM-type_fold	ENSG00000073910		0.383	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	47	0.00	0	G	NM_023037		32768304	32768304	+1	no_errors	ENST00000380250	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	1.000	T
GGTLC2	91227	genome.wustl.edu	37	22	22988911	22988911	+	Silent	SNP	G	G	A	rs9612135	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:22988911G>A	ENST00000480559.1	+	1	96	c.96G>A	c.(94-96)ccG>ccA	p.P32P	POM121L1P_ENST00000402027.1_RNA|GGTLC2_ENST00000448514.1_Silent_p.P32P	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2	32					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)	p.P32P(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		TCTACACGCCGGTTGATGGGG	0.617													.|||	1847	0.36881	0.1505	0.6124	5008	,	,		7239	0.5109		0.4056	False		,,,				2504	0.3067					dbGAP											1	Substitution - coding silent(1)	prostate(1)											32.0	17.0	22.0					22																	22988911		2173	3963	6136	-	-	-	SO:0001819	synonymous_variant	0			X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.96G>A	22.37:g.22988911G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A516|A2VCM9|Q5NV76|Q6ISH0	Silent	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.P32	ENST00000480559.1	37	c.96	CCDS13802.2	22																																																																																			GGTLC2	-	pfam_GGT_peptidase	ENSG00000100121		0.617	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	GGTLC2	HGNC	protein_coding	OTTHUMT00000321662.1	80	0.00	0	G	NM_199127		22988911	22988911	+1	no_errors	ENST00000448514	ensembl	human	known	69_37n	silent	43	17.31	9	SNP	0.990	A
GIMAP6	474344	genome.wustl.edu	37	7	150325503	150325503	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:150325503G>A	ENST00000328902.5	-	3	399	c.183C>T	c.(181-183)ctC>ctT	p.L61L	GIMAP6_ENST00000493969.1_Intron	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	61	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGTCCCTGCCGAGGATGCTGT	0.552																																						dbGAP											0													254.0	257.0	256.0					7																	150325503		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.183C>T	7.37:g.150325503G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Silent	SNP	pfam_AIG1	p.L61	ENST00000328902.5	37	c.183	CCDS34778.1	7																																																																																			GIMAP6	-	pfam_AIG1	ENSG00000133561		0.552	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP6	HGNC	protein_coding	OTTHUMT00000353457.1	61	0.00	0	G	NM_024711		150325503	150325503	-1	no_errors	ENST00000328902	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	0.763	A
GK	2710	genome.wustl.edu	37	X	30714176	30714176	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:30714176C>T	ENST00000378943.3	+	7	749	c.570C>T	c.(568-570)gtC>gtT	p.V190V	GK_ENST00000427190.1_5'UTR|RP11-242C19.2_ENST00000497961.1_RNA|GK_ENST00000378945.3_Silent_p.V190V|GK_ENST00000378946.3_Silent_p.V190V	NM_001128127.2	NP_001121599.1	P32189	GLPK_HUMAN	glycerol kinase	190					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						CAGGAGGAGTCAATGGAGGTG	0.363																																						dbGAP											0													85.0	74.0	78.0					X																	30714176		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378943.3:c.570C>T	X.37:g.30714176C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Silent	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.V190	ENST00000378943.3	37	c.570	CCDS48090.1	X																																																																																			GK	-	pfam_Carb_kinase_FGGY_N,tigrfam_Glycerol_kin	ENSG00000198814		0.363	GK-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GK	HGNC	protein_coding	OTTHUMT00000056170.1	88	0.00	0	C	NM_000167		30714176	30714176	+1	no_errors	ENST00000378943	ensembl	human	known	69_37n	silent	35	27.08	13	SNP	0.355	T
TTC41P	253724	genome.wustl.edu	37	12	104286891	104286891	+	IGR	SNP	T	T	C	rs7314790	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:104286891T>C								RP11-650K20.3 (48449 upstream) : RP11-642P15.1 (20913 downstream)																							GTTGATTCTATATTCTTTCAA	0.448													C|||	2924	0.583866	0.7239	0.4741	5008	,	,		20461	0.5337		0.5795	False		,,,				2504	0.5286					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.104286891T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		12																																																																																			RP11-642P15.1	-	-	ENSG00000214198	0	0.448					GNN	Clone_based_vega_gene			72	0.00	0	T			104286891	104286891	-1	no_errors	ENST00000548520	ensembl	human	known	69_37n	rna	51	15.00	9	SNP	0.795	C
TTC41P	253724	genome.wustl.edu	37	12	104286956	104286956	+	IGR	SNP	C	C	T	rs7298655	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:104286956C>T								RP11-650K20.3 (48514 upstream) : RP11-642P15.1 (20848 downstream)																							TTTTCCTCAACGCCTGTGTGC	0.398													C|||	2925	0.584065	0.7239	0.4741	5008	,	,		21206	0.5337		0.5795	False		,,,				2504	0.5297					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.104286956C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		12																																																																																			RP11-642P15.1	-	-	ENSG00000214198	0	0.398					GNN	Clone_based_vega_gene			68	0.00	0	C			104286956	104286956	-1	no_errors	ENST00000548520	ensembl	human	known	69_37n	rna	54	10.00	6	SNP	0.000	T
GPR152	390212	genome.wustl.edu	37	11	67220135	67220135	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:67220135C>G	ENST00000312457.2	-	1	65	c.61G>C	c.(61-63)Gat>Cat	p.D21H	CABP4_ENST00000542025.2_3'UTR|CABP4_ENST00000325656.5_5'Flank|CABP4_ENST00000438189.2_Intron	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			TCCTCATCATCAAGCTCTGTG	0.642																																					Pancreas(102;800 1581 2723 7382 33622)	dbGAP											0													56.0	57.0	57.0					11																	67220135		2191	4280	6471	-	-	-	SO:0001583	missense	0			AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.61G>C	11.37:g.67220135C>G	ENSP00000310255:p.Asp21His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VD88|Q86SM0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.D21H	ENST00000312457.2	37	c.61	CCDS8165.1	11	.	.	.	.	.	.	.	.	.	.	C	7.088	0.571507	0.13623	.	.	ENSG00000175514	ENST00000312457	T	0.16073	2.37	5.28	4.36	0.52297	.	0.544585	0.15163	N	0.277027	T	0.15089	0.0364	N	0.19112	0.55	0.23089	N	0.998314	P	0.52170	0.951	P	0.47206	0.541	T	0.07347	-1.0777	10	0.46703	T	0.11	.	10.8323	0.46667	0.0:0.907:0.0:0.093	.	21	Q8TDT2	GP152_HUMAN	H	21	ENSP00000310255:D21H	ENSP00000310255:D21H	D	-	1	0	GPR152	66976711	0.000000	0.05858	0.009000	0.14445	0.010000	0.07245	0.326000	0.19646	1.432000	0.47375	0.561000	0.74099	GAT	GPR152	-	NULL	ENSG00000175514		0.642	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR152	HGNC	protein_coding	OTTHUMT00000397623.1	38	0.00	0	C			67220135	67220135	-1	no_errors	ENST00000312457	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.007	G
GPR158	57512	genome.wustl.edu	37	10	25890341	25890341	+	3'UTR	SNP	C	C	T	rs3802512	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:25890341C>T	ENST00000376351.3	+	0	6145				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TCTTTGTGAACTGGGTTGGAA	0.353													T|||	1839	0.367212	0.6543	0.2752	5008	,	,		19825	0.2619		0.1799	False		,,,				2504	0.3456					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*2138C>T	10.37:g.25890341C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6QR81|Q9ULT3	RNA	SNP	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																			GPR158	-	-	ENSG00000151025		0.353	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	20	0.00	0	C	XM_166110		25890341	25890341	+1	no_errors	ENST00000490549	ensembl	human	known	69_37n	rna	16	20.00	4	SNP	0.000	T
GSTA3	2940	genome.wustl.edu	37	6	52770567	52770567	+	Silent	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:52770567G>T	ENST00000211122.3	-	2	131	c.66C>A	c.(64-66)ctC>ctA	p.L22L	GSTA3_ENST00000370968.1_Intron	NM_000847.4	NP_000838.3	Q16772	GSTA3_HUMAN	glutathione S-transferase alpha 3	22	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)	10	Lung NSC(77;0.0912)				Glutathione(DB00143)	CTGCAGCCAAGAGCCACCGGA	0.448																																						dbGAP											0													90.0	82.0	85.0					6																	52770567		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF020919	CCDS4947.1	6p12.2	2012-06-21	2008-11-26		ENSG00000174156	ENSG00000174156	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4628	protein-coding gene	gene with protein product		605449	"""glutathione S-transferase A3"""			8307579, 9480897	Standard	NM_000847		Approved		uc003pbb.3	Q16772	OTTHUMG00000014865	ENST00000211122.3:c.66C>A	6.37:g.52770567G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43468|Q068V6|Q8WWA8|Q9H415	Silent	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_alpha	p.L22	ENST00000211122.3	37	c.66	CCDS4947.1	6																																																																																			GSTA3	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold,prints_GST_alpha	ENSG00000174156		0.448	GSTA3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTA3	HGNC	protein_coding	OTTHUMT00000040933.1	42	0.00	0	G			52770567	52770567	-1	no_errors	ENST00000211122	ensembl	human	known	69_37n	silent	26	13.33	4	SNP	0.995	T
HAUS6	54801	genome.wustl.edu	37	9	19060087	19060087	+	Splice_Site	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr9:19060087C>G	ENST00000380502.3	-	15	2231	c.1764G>C	c.(1762-1764)ttG>ttC	p.L588F	HAUS6_ENST00000380496.1_Splice_Site_p.L452F	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	588					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TTAACTTACTCAAGTTTTCTG	0.378																																						dbGAP											0													54.0	51.0	52.0					9																	19060087		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.1765+1G>C	9.37:g.19060087C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	NULL	p.L588F	ENST00000380502.3	37	c.1764	CCDS6489.1	9	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146692	0.57151	.	.	ENSG00000147874	ENST00000380502;ENST00000380496;ENST00000415524	T;T;T	0.66099	0.78;0.76;-0.19	5.78	2.87	0.33458	.	0.063498	0.64402	D	0.000004	T	0.72399	0.3455	M	0.61703	1.905	0.48975	D	0.999733	D;D;D;D	0.89917	0.986;0.986;1.0;0.986	P;P;D;P	0.75484	0.683;0.683;0.986;0.683	T	0.70828	-0.4766	10	0.87932	D	0	-12.5602	8.1764	0.31285	0.0:0.6856:0.0:0.3144	.	553;588;452;588	Q7Z4H7-3;Q7Z4H7-2;Q5VY60;Q7Z4H7	.;.;.;HAUS6_HUMAN	F	588;452;104	ENSP00000369871:L588F;ENSP00000369865:L452F;ENSP00000409615:L104F	ENSP00000369865:L452F	L	-	3	2	HAUS6	19050087	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.235000	0.43044	0.332000	0.23536	0.591000	0.81541	TTG	HAUS6	-	NULL	ENSG00000147874		0.378	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS6	HGNC	protein_coding	OTTHUMT00000051825.1	29	0.00	0	C	NM_017645	Missense_Mutation	19060087	19060087	-1	no_errors	ENST00000380502	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	1.000	G
MROH2A	339766	genome.wustl.edu	37	2	234703136	234703136	+	Missense_Mutation	SNP	T	T	C	rs6431634	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:234703136T>C	ENST00000389758.3	+	8	1116	c.950T>C	c.(949-951)gTg>gCg	p.V317A				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	347																	AGTCTGGAGGTGCTCTTCGTC	0.632													C|||	3207	0.640375	0.7277	0.6556	5008	,	,		17678	0.6925		0.5656	False		,,,				2504	0.5348					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.950T>C	2.37:g.234703136T>C	ENSP00000374408:p.Val317Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V317A	ENST00000389758.3	37	c.950		2	1420	0.6501831501831502	342	0.6951219512195121	229	0.6325966850828729	412	0.7202797202797203	437	0.5765171503957783	C	0.225	-1.025280	0.02061	.	.	ENSG00000185038	ENST00000389758	T	0.04317	3.65	5.32	5.32	0.75619	.	0.222820	0.22908	N	0.054168	T	0.00012	0.0000	.	.	.	0.49051	P	2.5200000000003E-4	.	.	.	.	.	.	T	0.01345	-1.1379	6	0.06757	T	0.87	.	10.501	0.44806	0.0:0.9096:0.0:0.0904	rs6431634;rs52799814;rs56522011;rs58363724;rs6431634	.	.	.	A	317	ENSP00000374408:V317A	ENSP00000374408:V317A	V	+	2	0	HEATR7B1	234367875	0.963000	0.33076	0.867000	0.34043	0.006000	0.05464	2.250000	0.43178	1.396000	0.46663	-0.215000	0.12644	GTG	HEATR7B1	-	superfamily_ARM-type_fold	ENSG00000185038		0.632	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	44	0.00	0	T	XM_291007		234703136	234703136	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	missense	29	19.44	7	SNP	0.948	C
HERC2P3	283755	genome.wustl.edu	37	15	20588458	20588458	+	RNA	SNP	G	G	C	rs2291971	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:20588458G>C	ENST00000428453.1	-	0	4292							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						TGCTGGCCATGACTGCAGTGC	0.458																																						dbGAP											0																																										-	-	-			0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20588458G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.458	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	21	0.00	0	G	NG_008269		20588458	20588458	-1	no_errors	ENST00000428453	ensembl	human	known	69_37n	rna	13	27.78	5	SNP	0.002	C
HHAT	55733	genome.wustl.edu	37	1	210804430	210804430	+	Intron	SNP	G	G	A	rs4951682	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:210804430G>A	ENST00000367010.1	+	11	1617				HHAT_ENST00000391905.3_Missense_Mutation_p.V494I|HHAT_ENST00000308852.6_Intron|HHAT_ENST00000545154.1_Intron|HHAT_ENST00000261458.3_Intron|HHAT_ENST00000367009.1_Intron|HHAT_ENST00000413764.2_Intron|HHAT_ENST00000545781.1_Intron|HHAT_ENST00000541565.1_Intron|HHAT_ENST00000537898.1_Intron	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)			breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		acaaacagaggtactggctac	0.378													G|||	1019	0.203474	0.2005	0.1974	5008	,	,		19235	0.2609		0.2137	False		,,,				2504	0.1421					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.1390+7416G>A	1.37:g.210804430G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	pfam_MBOAT_fam	p.V494I	ENST00000367010.1	37	c.1480	CCDS1495.1	1	512	0.23443223443223443	102	0.2073170731707317	80	0.22099447513812154	173	0.30244755244755245	157	0.20712401055408972	G	8.628	0.893110	0.17613	.	.	ENSG00000054392	ENST00000391905	T	0.17691	2.26	1.73	-2.32	0.06745	.	0.117169	0.64402	D	0.000018	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.37979	-0.9682	6	0.49607	T	0.09	.	5.6681	0.17707	0.6375:0.0:0.3625:0.0	rs4951682;rs61049862;rs4951682	.	.	.	I	494	ENSP00000375773:V494I	ENSP00000375773:V494I	V	+	1	0	HHAT	208871053	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.910000	0.04054	-0.682000	0.05197	-0.199000	0.12753	GTA	HHAT	-	NULL	ENSG00000054392		0.378	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HHAT	HGNC	protein_coding	OTTHUMT00000088662.1	69	0.00	0	G	NM_018194		210804430	210804430	+1	no_errors	ENST00000391905	ensembl	human	known	69_37n	missense	90	11.76	12	SNP	0.001	A
HLA-V	352962	genome.wustl.edu	37	6	29759811	29759811	+	RNA	SNP	C	C	G	rs1611204	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:29759811C>G	ENST00000457107.1	+	0	0									major histocompatibility complex, class I, V (pseudogene)																		CAGCGCTGGGCATTCCCCATC	0.622													g|||	1868	0.373003	0.5734	0.3516	5008	,	,		15321	0.1944		0.3012	False		,,,				2504	0.3753					dbGAP											0																																										-	-	-			0			M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29759811C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			HLA-P	-	-	ENSG00000181126		0.622	HLA-V-003	KNOWN	basic	processed_transcript	HLA-P	HGNC	pseudogene	OTTHUMT00000105231.1	35	0.00	0	C	NG_002729		29759811	29759811	+1	no_errors	ENST00000476601	ensembl	human	known	69_37n	rna	36	12.20	5	SNP	0.016	G
HLA-V	352962	genome.wustl.edu	37	6	29759823	29759823	+	RNA	SNP	T	T	C	rs1611205|rs386698459	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:29759823T>C	ENST00000457107.1	+	0	0									major histocompatibility complex, class I, V (pseudogene)																		TTCCCCATCTTTGCAGGGTTT	0.612													N|||	1869	0.373203	0.5734	0.3516	5008	,	,		15389	0.1954		0.3012	False		,,,				2504	0.3753					dbGAP											0																																										-	-	-			0			M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29759823T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			HLA-P	-	-	ENSG00000181126		0.612	HLA-V-003	KNOWN	basic	processed_transcript	HLA-P	HGNC	pseudogene	OTTHUMT00000105231.1	44	0.00	0	T	NG_002729		29759823	29759823	+1	no_errors	ENST00000476601	ensembl	human	known	69_37n	rna	44	11.76	6	SNP	0.001	C
HLA-V	352962	genome.wustl.edu	37	6	29759876	29759876	+	RNA	SNP	G	G	A	rs1611207	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:29759876G>A	ENST00000457107.1	+	0	0									major histocompatibility complex, class I, V (pseudogene)																		TTCTTCCTGGGTACTCACCGG	0.582													a|||	1926	0.384585	0.5991	0.3703	5008	,	,		15482	0.1954		0.3111	False		,,,				2504	0.3753					dbGAP											0																																										-	-	-			0			M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29759876G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			HLA-P	-	-	ENSG00000181126		0.582	HLA-V-003	KNOWN	basic	processed_transcript	HLA-P	HGNC	pseudogene	OTTHUMT00000105231.1	101	0.00	0	G	NG_002729		29759876	29759876	+1	no_errors	ENST00000399243	ensembl	human	known	69_37n	rna	60	10.45	7	SNP	0.001	A
HLA-A	3105	genome.wustl.edu	37	6	29912315	29912315	+	Missense_Mutation	SNP	A	A	C	rs41554316	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:29912315A>C	ENST00000396634.1	+	7	1275	c.934A>C	c.(934-936)Att>Ctt	p.I312L	HLA-A_ENST00000376809.5_Missense_Mutation_p.I312L|HLA-A_ENST00000376806.5_Missense_Mutation_p.I312L|HLA-A_ENST00000376802.2_Intron			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	312					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CGTGGGCATCATTGCTGGCCT	0.607									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												dbGAP											0													106.0	100.0	102.0					6																	29912315		1510	2709	4219	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.934A>C	6.37:g.29912315A>C	ENSP00000379873:p.Ile312Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.I312L	ENST00000396634.1	37	c.934	CCDS34373.1	6	278	0.12728937728937728	107	0.21747967479674796	53	0.1464088397790055	87	0.1520979020979021	31	0.040897097625329816	.	6.803	0.517242	0.13005	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809	T;T;T	0.00695	5.86;5.83;5.86	3.69	-7.38	0.01407	.	0.936076	0.08704	U	0.905960	T	0.00440	0.0014	M	0.78049	2.395	0.09310	N	1	B;B;B;B;B	0.18461	0.028;0.0;0.018;0.0;0.0	B;B;B;B;B	0.22753	0.004;0.003;0.041;0.003;0.002	T	0.34079	-0.9843	10	0.87932	D	0	.	7.9928	0.30250	0.3199:0.1368:0.5432:0.0	rs41554316	191;312;312;312;312	B4DVB9;P16188;Q5SRN5;P30455;P04439	.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	L	312	ENSP00000379873:I312L;ENSP00000366002:I312L;ENSP00000366005:I312L	ENSP00000366002:I312L	I	+	1	0	HLA-A	30020294	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.381000	0.00491	-1.707000	0.01402	-1.766000	0.00665	ATT	HLA-A	-	NULL	ENSG00000206503		0.607	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	91	0.00	0	A	NM_002116		29912315	29912315	+1	no_errors	ENST00000376806	ensembl	human	known	69_37n	missense	70	10.26	8	SNP	0.000	C
HPS4	89781	genome.wustl.edu	37	22	26853885	26853885	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:26853885G>T	ENST00000398145.2	-	13	2511	c.1895C>A	c.(1894-1896)gCc>gAc	p.A632D	HPS4_ENST00000493455.2_5'UTR|HPS4_ENST00000402105.3_Missense_Mutation_p.A627D|HPS4_ENST00000398141.1_Missense_Mutation_p.A645D|HPS4_ENST00000336873.5_Missense_Mutation_p.A632D	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	632					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)	p.A645D(2)|p.A632D(2)		breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						CAGGCTGACGGCCTGGAGGAA	0.592									Hermansky-Pudlak syndrome																													dbGAP											4	Substitution - Missense(4)	prostate(2)|kidney(2)											53.0	51.0	51.0					22																	26853885		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1895C>A	22.37:g.26853885G>T	ENSP00000381213:p.Ala632Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Missense_Mutation	SNP	NULL	p.A645D	ENST00000398145.2	37	c.1934	CCDS13835.1	22	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778402	0.90195	.	.	ENSG00000100099	ENST00000398145;ENST00000398141;ENST00000402105;ENST00000336873	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.53238	0.1784	M	0.77103	2.36	0.46564	D	0.9991	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	T	0.58470	-0.7631	10	0.87932	D	0	-23.3461	16.0907	0.81088	0.0:0.0:1.0:0.0	.	632;632;632;645;627	Q6P1K3;Q9NQG7;A8K2E6;Q9NQG7-4;Q9NQG7-3	.;HPS4_HUMAN;.;.;.	D	632;645;627;632	ENSP00000381213:A632D;ENSP00000381210:A645D;ENSP00000384185:A627D;ENSP00000338457:A632D	ENSP00000338457:A632D	A	-	2	0	HPS4	25183885	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.216000	0.72212	2.390000	0.81377	0.655000	0.94253	GCC	HPS4	-	NULL	ENSG00000100099		0.592	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPS4	HGNC	protein_coding	OTTHUMT00000320778.1	74	0.00	0	G	NM_022081		26853885	26853885	-1	no_errors	ENST00000398141	ensembl	human	known	69_37n	missense	56	13.43	9	SNP	0.999	T
HSD17B7	51478	genome.wustl.edu	37	1	162760551	162760551	+	5'UTR	SNP	C	C	T	rs1704754	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:162760551C>T	ENST00000254521.3	+	0	16				HSD17B7_ENST00000485405.1_3'UTR|HSD17B7_ENST00000367913.1_5'Flank|HSD17B7_ENST00000367917.3_5'UTR|HSD17B7_ENST00000367915.1_5'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7						cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					AAAGCAGCGGCGGTGTTTGCT	0.602													C|||	2661	0.53135	0.1944	0.562	5008	,	,		12025	0.5764		0.7813	False		,,,				2504	0.6616					dbGAP											0													22.0	19.0	20.0					1																	162760551		2201	4278	6479	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.-40C>T	1.37:g.162760551C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	RNA	SNP	-	NULL	ENST00000254521.3	37	NULL	CCDS1242.1	1																																																																																			HSD17B7	-	-	ENSG00000132196		0.602	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B7	HGNC	protein_coding	OTTHUMT00000083207.1	51	0.00	0	C	NM_016371		162760551	162760551	+1	no_errors	ENST00000463037	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.000	T
HSDL1	83693	genome.wustl.edu	37	16	84163866	84163866	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:84163866C>G	ENST00000219439.4	-	4	567	c.391G>C	c.(391-393)Gag>Cag	p.E131Q	HSDL1_ENST00000434463.3_Intron	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	131						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						AGGTAGATCTCACGACCGCTG	0.463																																						dbGAP											0													146.0	133.0	137.0					16																	84163866		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.391G>C	16.37:g.84163866C>G	ENSP00000219439:p.Glu131Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.E131Q	ENST00000219439.4	37	c.391	CCDS10942.1	16	.	.	.	.	.	.	.	.	.	.	C	12.55	1.971650	0.34754	.	.	ENSG00000103160	ENST00000219439	T	0.50548	0.74	5.25	5.25	0.73442	NAD(P)-binding domain (1);	0.198648	0.52532	D	0.000074	T	0.46210	0.1381	L	0.41573	1.285	0.80722	D	1	B	0.26445	0.149	B	0.32393	0.145	T	0.38650	-0.9651	10	0.45353	T	0.12	.	19.2008	0.93711	0.0:1.0:0.0:0.0	.	131	Q3SXM5	HSDL1_HUMAN	Q	131	ENSP00000219439:E131Q	ENSP00000219439:E131Q	E	-	1	0	HSDL1	82721367	0.999000	0.42202	0.961000	0.40146	0.206000	0.24218	4.291000	0.59025	2.606000	0.88127	0.655000	0.94253	GAG	HSDL1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000103160		0.463	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSDL1	HGNC	protein_coding	OTTHUMT00000269076.3	57	0.00	0	C	NM_031463		84163866	84163866	-1	no_errors	ENST00000219439	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.998	G
HSF1	3297	genome.wustl.edu	37	8	145533280	145533280	+	Intron	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:145533280G>A	ENST00000528838.1	+	3	523				HSF1_ENST00000400780.4_Intron	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1						cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			TGACCAGTGTGAGTGCCGGCC	0.652																																						dbGAP											0													107.0	103.0	104.0					8																	145533280		2203	4296	6499	-	-	-	SO:0001627	intron_variant	0			M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604	ENST00000528838.1:c.363+3G>A	8.37:g.145533280G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4L0|A8MW26|Q53XT4	RNA	SNP	-	NULL	ENST00000528838.1	37	NULL	CCDS6419.1	8																																																																																			HSF1	-	-	ENSG00000185122		0.652	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF1	HGNC	protein_coding	OTTHUMT00000382053.1	49	0.00	0	G	NM_005526		145533280	145533280	+1	no_errors	ENST00000528988	ensembl	human	known	69_37n	rna	17	22.73	5	SNP	0.994	A
IGHG4	3503	genome.wustl.edu	37	14	106091504	106091504	+	RNA	SNP	A	A	G	rs1042306	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:106091504A>G	ENST00000390543.2	-	0	389							P01861	IGHG4_HUMAN	immunoglobulin heavy constant gamma 4 (G4m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										AGATCATGAGAGTGTCCTTGG	0.617													N|||	1323	0.264177	0.0847	0.2061	5008	,	,		23526	0.5179		0.2952	False		,,,				2504	0.2546					dbGAP											0													76.0	92.0	87.0					14																	106091504		2031	4191	6222	-	-	-			0			K01316		14q32.33	2012-10-02			ENSG00000211892	ENSG00000211892		"""Immunoglobulins / IGH locus"""	5528	other	immunoglobulin gene		147130					Standard	NG_001019		Approved			P01861	OTTHUMG00000152481		14.37:g.106091504A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.T130	ENST00000390543.2	37	c.390		14																																																																																			IGHG4	-	pfam_Ig_C1-set,pfscan_Ig-like	ENSG00000211892		0.617	IGHG4-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG4	HGNC	IG_C_gene	OTTHUMT00000326390.1	34	0.00	0	A	NG_001019		106091504	106091504	-1	no_start_codon	ENST00000390543	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	0.020	G
IQGAP1	8826	genome.wustl.edu	37	15	90991897	90991897	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:90991897C>G	ENST00000268182.5	+	10	1130	c.1006C>G	c.(1006-1008)Cga>Gga	p.R336G	IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	336					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CCTGGGGCTTCGAGGACTGCA	0.493																																						dbGAP											0													58.0	57.0	58.0					15																	90991897		2198	4298	6496	-	-	-	SO:0001583	missense	0			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.1006C>G	15.37:g.90991897C>G	ENSP00000268182:p.Arg336Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBM3	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_Rsp5_WWP,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,smart_CH-domain,smart_WW_Rsp5_WWP,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.R336G	ENST00000268182.5	37	c.1006	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	C	12.35	1.910901	0.33721	.	.	ENSG00000140575	ENST00000268182	T	0.48201	0.82	5.32	5.32	0.75619	.	0.163420	0.42821	D	0.000647	T	0.49695	0.1572	M	0.74881	2.28	0.49798	D	0.99982	B	0.24258	0.1	B	0.29716	0.106	T	0.47394	-0.9121	10	0.39692	T	0.17	-6.8538	11.5658	0.50805	0.0:0.9196:0.0:0.0804	.	336	P46940	IQGA1_HUMAN	G	336	ENSP00000268182:R336G	ENSP00000268182:R336G	R	+	1	2	IQGAP1	88792901	0.984000	0.35163	0.580000	0.28601	0.687000	0.40016	2.997000	0.49457	2.767000	0.95098	0.563000	0.77884	CGA	IQGAP1	-	NULL	ENSG00000140575		0.493	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1	31	0.00	0	C	NM_003870		90991897	90991897	+1	no_errors	ENST00000268182	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.145	G
IQSEC2	23096	genome.wustl.edu	37	X	53267461	53267461	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:53267461G>C	ENST00000375368.5	-	11	3313	c.3113C>G	c.(3112-3114)tCt>tGt	p.S1038C	IQSEC2_ENST00000375365.2_Missense_Mutation_p.S843C|IQSEC2_ENST00000396435.3_Missense_Mutation_p.S1048C			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1038	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						AGGTACTGCAGACAGCAACTT	0.532																																						dbGAP											0													80.0	55.0	63.0					X																	53267461		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3113C>G	X.37:g.53267461G>C	ENSP00000364517:p.Ser1038Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.S1048C	ENST00000375368.5	37	c.3143		X	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373749	0.82573	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.65549	-0.16;-0.16;-0.16	4.81	4.81	0.61882	.	0.130376	0.53938	D	0.000058	T	0.74061	0.3667	L	0.52126	1.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.979;0.985	T	0.77222	-0.2667	10	0.87932	D	0	.	15.7894	0.78343	0.0:0.0:1.0:0.0	.	1048;843	Q5JU85-2;Q5JU85-3	.;.	C	1048;1038;843	ENSP00000379712:S1048C;ENSP00000364517:S1038C;ENSP00000364514:S843C	ENSP00000364514:S843C	S	-	2	0	IQSEC2	53284186	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.604000	0.98317	2.240000	0.73641	0.517000	0.50305	TCT	IQSEC2	-	smart_Pleckstrin_homology	ENSG00000124313		0.532	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		19	0.00	0	G	XM_291345		53267461	53267461	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	C
IRF4	3662	genome.wustl.edu	37	6	395968	395968	+	Intron	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:395968G>C	ENST00000380956.4	+	4	618				IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4						cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CCCTGAGGGCGAGGCTGTGTG	0.612			T	IGH@	MM																																	dbGAP		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	0													65.0	44.0	51.0					6																	395968		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.492+33G>C	6.37:g.395968G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI7|Q99660	RNA	SNP	-	NULL	ENST00000380956.4	37	NULL	CCDS4469.1	6																																																																																			IRF4	-	-	ENSG00000137265		0.612	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF4	HGNC	protein_coding	OTTHUMT00000043638.1	17	0.00	0	G			395968	395968	+1	no_errors	ENST00000468485	ensembl	human	known	69_37n	rna	16	20.00	4	SNP	0.000	C
IVNS1ABP	10625	genome.wustl.edu	37	1	185267114	185267114	+	3'UTR	SNP	A	A	G	rs10174	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:185267114A>G	ENST00000367498.3	-	0	2604				IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_3'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein						negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						GTGTACCTCTACTAACCATAA	0.363													A|||	2195	0.438299	0.621	0.3314	5008	,	,		19602	0.247		0.4225	False		,,,				2504	0.4806					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.*53T>C	1.37:g.185267114A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	RNA	SNP	-	NULL	ENST00000367498.3	37	NULL	CCDS1368.1	1																																																																																			IVNS1ABP	-	-	ENSG00000116679		0.363	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	56	0.00	0	A	NM_006469		185267114	185267114	-1	no_errors	ENST00000459929	ensembl	human	known	69_37n	rna	72	12.20	10	SNP	1.000	G
IVNS1ABP	10625	genome.wustl.edu	37	1	185267385	185267385	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:185267385G>C	ENST00000367498.3	-	15	2333	c.1711C>G	c.(1711-1713)Cat>Gat	p.H571D	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Missense_Mutation_p.H353D	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	571					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						CTGATGGCATGAGAACCATCA	0.388																																						dbGAP											0													147.0	126.0	133.0					1																	185267385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1711C>G	1.37:g.185267385G>C	ENSP00000356468:p.His571Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.H571D	ENST00000367498.3	37	c.1711	CCDS1368.1	1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337735	0.60963	.	.	ENSG00000116679	ENST00000367498;ENST00000392007	T;T	0.77877	-1.13;-1.13	5.38	5.38	0.77491	Galactose oxidase, beta-propeller (1);	0.043669	0.85682	D	0.000000	T	0.79441	0.4446	N	0.20357	0.565	0.58432	D	0.999999	D;D	0.63046	0.972;0.992	P;P	0.60286	0.835;0.872	T	0.80826	-0.1209	10	0.49607	T	0.09	.	19.5013	0.95095	0.0:0.0:1.0:0.0	.	353;571	A8MVR0;Q9Y6Y0	.;NS1BP_HUMAN	D	571;353	ENSP00000356468:H571D;ENSP00000375864:H353D	ENSP00000356468:H571D	H	-	1	0	IVNS1ABP	183534008	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.637000	0.83313	2.677000	0.91161	0.563000	0.77884	CAT	IVNS1ABP	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000116679		0.388	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	33	0.00	0	G	NM_006469		185267385	185267385	-1	no_errors	ENST00000367498	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	C
KAT6B	23522	genome.wustl.edu	37	10	76788543	76788543	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:76788543C>G	ENST00000287239.4	+	18	4450	c.3961C>G	c.(3961-3963)Caa>Gaa	p.Q1321E	KAT6B_ENST00000372724.1_Missense_Mutation_p.Q1029E|KAT6B_ENST00000372725.1_Missense_Mutation_p.Q1029E|KAT6B_ENST00000372714.1_Missense_Mutation_p.Q1029E|KAT6B_ENST00000372711.1_Missense_Mutation_p.Q1138E	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1321					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CCTGTTGCCTCAAGAGGAAAA	0.483																																						dbGAP											0													81.0	78.0	79.0					10																	76788543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3961C>G	10.37:g.76788543C>G	ENSP00000287239:p.Gln1321Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.Q1321E	ENST00000287239.4	37	c.3961	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.275782	0.00254	.	.	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0	4.49	2.55	0.30701	.	1.207870	0.06278	N	0.696850	T	0.55497	0.1924	N	0.19112	0.55	0.09310	N	1	B;B;B	0.12630	0.002;0.0;0.006	B;B;B	0.14023	0.004;0.0;0.01	T	0.38693	-0.9649	10	0.09843	T	0.71	2.2966	4.3475	0.11139	0.1613:0.5972:0.1559:0.0857	.	1138;1029;1321	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	E	1029;1029;1321;1029;1138	ENSP00000361810:Q1029E;ENSP00000361809:Q1029E;ENSP00000287239:Q1321E;ENSP00000361799:Q1029E;ENSP00000361796:Q1138E	ENSP00000287239:Q1321E	Q	+	1	0	KAT6B	76458549	0.104000	0.21937	0.253000	0.24343	0.020000	0.10135	2.267000	0.43329	0.306000	0.22856	0.561000	0.74099	CAA	KAT6B	-	NULL	ENSG00000156650		0.483	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	40	0.00	0	C	NM_012330		76788543	76788543	+1	no_errors	ENST00000287239	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.002	G
KCTD10	83892	genome.wustl.edu	37	12	109889591	109889591	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:109889591C>T	ENST00000228495.6	-	7	1032	c.751G>A	c.(751-753)Gag>Aag	p.E251K	KCTD10_ENST00000540411.1_Missense_Mutation_p.E225K|KCTD10_ENST00000540089.1_Missense_Mutation_p.E70K|KCTD10_ENST00000538161.1_5'UTR|KCTD10_ENST00000424763.2_Missense_Mutation_p.E70K	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN	potassium channel tetramerization domain containing 10	251					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						AGGGTCTCCTCATAAATCCGG	0.607																																						dbGAP											0													31.0	34.0	33.0					12																	109889591		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040062	CCDS9128.1	12q24.12	2013-06-20	2013-06-20		ENSG00000110906	ENSG00000110906		"""BTB/POZ domain containing"""	23236	protein-coding gene	gene with protein product		613421	"""potassium channel tetramerisation domain containing 10"""			12477932	Standard	XM_005253946		Approved	MSTP028, BTBD28	uc001toi.1	Q9H3F6	OTTHUMG00000169253	ENST00000228495.6:c.751G>A	12.37:g.109889591C>T	ENSP00000228495:p.Glu251Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HN2|Q59FV1|Q6PL47|Q96SU0	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.E251K	ENST00000228495.6	37	c.751	CCDS9128.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.477513|5.477513	0.96291|0.96291	.|.	.|.	ENSG00000110906|ENSG00000110906	ENST00000228495;ENST00000540089;ENST00000545759;ENST00000424763;ENST00000540411;ENST00000542954;ENST00000535546;ENST00000540402;ENST00000540355|ENST00000538161	T;T|.	0.60424|.	0.42;0.19|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79986|0.79986	0.4541|0.4541	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.999|.	D;D;D|.	0.79108|.	0.986;0.992;0.957|.	T|T	0.81669|0.81669	-0.0828|-0.0828	10|5	0.87932|.	D|.	0|.	-32.0387|-32.0387	17.765|17.765	0.88475|0.88475	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	225;228;251|.	F5GWA4;Q9H3F6-2;Q9H3F6|.	.;.;BACD3_HUMAN|.	K|I	251;70;93;70;225;70;70;70;70|216	ENSP00000228495:E251K;ENSP00000441672:E225K|.	ENSP00000228495:E251K|.	E|M	-|-	1|3	0|0	KCTD10|KCTD10	108373974|108373974	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.622000|7.622000	0.83099|0.83099	2.757000|2.757000	0.94681|0.94681	0.655000|0.655000	0.94253|0.94253	GAG|ATG	KCTD10	-	NULL	ENSG00000110906		0.607	KCTD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD10	HGNC	protein_coding	OTTHUMT00000403099.1	66	0.00	0	C	NM_031954		109889591	109889591	-1	no_errors	ENST00000228495	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	T
KCTD17	79734	genome.wustl.edu	37	22	37457643	37457643	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:37457643C>T	ENST00000403888.3	+	8	871	c.870C>T	c.(868-870)ctC>ctT	p.L290L	KCTD17_ENST00000402077.3_Silent_p.L266L	NM_001282684.1	NP_001269613.1	Q8N5Z5	KCD17_HUMAN	potassium channel tetramerization domain containing 17	290	Pro-rich.				protein homooligomerization (GO:0051260)		identical protein binding (GO:0042802)			NS(1)|breast(1)|endometrium(1)|lung(1)|prostate(1)	5						CTCGGCCCCTCGCCCGCCCCC	0.647																																						dbGAP											0													41.0	33.0	36.0					22																	37457643		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025403	CCDS13940.2, CCDS74854.1, CCDS74855.1	22q12.3	2013-06-20	2013-06-20		ENSG00000100379	ENSG00000100379			25705	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 17"""			12477932	Standard	XM_005261741		Approved	FLJ12242	uc011amv.2	Q8N5Z5	OTTHUMG00000150532	ENST00000403888.3:c.870C>T	22.37:g.37457643C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYA9|B0QYB0|O95517	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.L290	ENST00000403888.3	37	c.870		22																																																																																			KCTD17	-	NULL	ENSG00000100379		0.647	KCTD17-002	KNOWN	basic	protein_coding	KCTD17	HGNC	protein_coding	OTTHUMT00000318781.1	28	0.00	0	C	NM_024681		37457643	37457643	+1	no_errors	ENST00000403888	ensembl	human	known	69_37n	silent	38	17.39	8	SNP	1.000	T
RABGEF1	27342	genome.wustl.edu	37	7	66240224	66240224	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:66240224G>A	ENST00000284957.5	+	3	267	c.190G>A	c.(190-192)Gag>Aag	p.E64K	KCTD7_ENST00000510829.2_Missense_Mutation_p.E64K|RABGEF1_ENST00000439720.2_Missense_Mutation_p.E77K|KCTD7_ENST00000380828.2_Missense_Mutation_p.E104K|KCTD7_ENST00000451741.2_Missense_Mutation_p.E64K|RABGEF1_ENST00000437078.2_Missense_Mutation_p.E78K|RABGEF1_ENST00000484547.2_3'UTR|RABGEF1_ENST00000450873.2_Missense_Mutation_p.E64K			Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	242					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein targeting to membrane (GO:0006612)	early endosome (GO:0005769)	DNA binding (GO:0003677)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|stomach(1)	27						ACTCCAGCGGGAGGAAGAAGA	0.463																																						dbGAP											0													30.0	32.0	31.0					7																	66240224		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ250042	CCDS5535.1, CCDS69308.1, CCDS75610.1	7q11.21	2010-07-09			ENSG00000154710	ENSG00000154710			17676	protein-coding gene	gene with protein product		609700				12505986, 11098082	Standard	NM_014504		Approved	rabex-5, RABEX5	uc003tvh.3	Q9UJ41	OTTHUMG00000129547	ENST00000284957.5:c.190G>A	7.37:g.66240224G>A	ENSP00000284957:p.Glu64Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZM7|Q3HKR2|Q3HKR3|Q53FG0	Missense_Mutation	SNP	pfam_VPS9,pfam_Znf_A20,smart_Znf_A20,smart_VPS9_subgr,pfscan_VPS9,pfscan_Znf_A20	p.E104K	ENST00000284957.5	37	c.310	CCDS5535.1	7	.	.	.	.	.	.	.	.	.	.	.	19.44	3.828572	0.71258	.	.	ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000243335;ENSG00000154710;ENSG00000154710;ENSG00000154710;ENSG00000154710	ENST00000380827;ENST00000380828;ENST00000510829;ENST00000451741;ENST00000539561;ENST00000284957;ENST00000450873;ENST00000439720;ENST00000437078	T;T;T;T;T;T;T	0.47869	1.63;0.84;0.84;0.84;0.84;0.83;0.83	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.55497	0.1924	L	0.56769	1.78	0.80722	D	1	D	0.58268	0.982	P	0.51777	0.679	T	0.47674	-0.9099	10	0.17832	T	0.49	-22.2887	18.5215	0.90954	0.0:0.0:1.0:0.0	.	78	B4DZM7	.	K	109;104;64;64;64;64;64;77;78	ENSP00000370208:E104K;ENSP00000421124:E64K;ENSP00000398177:E64K;ENSP00000284957:E64K;ENSP00000415815:E64K;ENSP00000403429:E77K;ENSP00000390480:E78K	ENSP00000370207:E109K	E	+	1	0	RABGEF1;KCTD7	65877659	1.000000	0.71417	1.000000	0.80357	0.124000	0.20399	9.435000	0.97529	2.616000	0.88540	0.650000	0.86243	GAG	KCTD7	-	NULL	ENSG00000243335		0.463	RABGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD7	HGNC	protein_coding	OTTHUMT00000251737.3	85	0.00	0	G	NM_014504		66240224	66240224	+1	no_errors	ENST00000380828	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	1.000	A
KIR3DL1	3811	genome.wustl.edu	37	19	55317456	55317456	+	Intron	SNP	G	G	A	rs1051454	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:55317456G>A	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000346587.4_Missense_Mutation_p.A43T|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000359085.4_Missense_Mutation_p.A138T|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000357494.4_Missense_Mutation_p.A138T|KIR2DL4_ENST00000345540.5_Missense_Mutation_p.A138T|KIR2DL4_ENST00000396293.1_Missense_Mutation_p.A43T|KIR2DL4_ENST00000396284.2_Missense_Mutation_p.A136T			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CACGGTTCGCGCAGGAGAGAA	0.572													g|||	2584	0.515974	0.6218	0.5346	5008	,	,		10988	0.6597		0.3181	False		,,,				2504	0.4151					dbGAP											0													5.0	5.0	5.0					19																	55317456		1384	2896	4280	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-11533G>A	19.37:g.55317456G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.A136T	ENST00000538269.1	37	c.406		19	.	.	.	.	.	.	.	.	.	.	g	0.205	-1.041256	0.02013	.	.	ENSG00000189013	ENST00000396284;ENST00000359085;ENST00000345540;ENST00000357494;ENST00000396293;ENST00000346587;ENST00000396289	T;T;T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52;2.52;2.52	1.05	-2.09	0.07232	Immunoglobulin-like fold (1);	2.533670	0.02635	N	0.104796	T	0.11665	0.0284	M	0.71871	2.18	0.80722	P	0.0	B;B;B;B;P;B;B;B	0.38473	0.009;0.027;0.03;0.023;0.633;0.021;0.023;0.036	B;B;B;B;B;B;B;B	0.25506	0.002;0.003;0.007;0.011;0.061;0.008;0.016;0.004	T	0.24941	-1.0146	9	0.27785	T	0.31	.	0.2251	0.00173	0.3874:0.1718:0.2067:0.2341	rs1051454;rs3191841;rs17173108	138;136;138;138;138;43;138;43	Q99706;E7EST5;Q8N741;Q99706-4;Q99706-2;Q8N736;Q99706-3;Q8N738	KI2L4_HUMAN;.;.;.;.;.;.;.	T	136;138;138;138;43;43;136	ENSP00000379580:A136T;ENSP00000351988:A138T;ENSP00000339634:A138T;ENSP00000350088:A138T;ENSP00000379588:A43T;ENSP00000345331:A43T;ENSP00000379584:A136T	ENSP00000339634:A138T	A	+	1	0	KIR2DL4	60009268	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.310000	0.01129	-3.168000	0.00226	-2.559000	0.00174	GCA	KIR2DL4	-	smart_Ig_sub	ENSG00000189013		0.572	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL4	HGNC	protein_coding		14	0.00	0	G	NM_013289		55317456	55317456	+1	no_errors	ENST00000396284	ensembl	human	known	69_37n	missense	6	33.33	3	SNP	0.000	A
KLHL25	64410	genome.wustl.edu	37	15	86311422	86311422	+	Silent	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:86311422G>C	ENST00000337975.5	-	2	1894	c.1620C>G	c.(1618-1620)ctC>ctG	p.L540L	KLHL25_ENST00000536947.1_Silent_p.L540L|MIR1276_ENST00000408707.1_RNA|KLHL25_ENST00000559131.1_Intron	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	540					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)				breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						CGACCACATAGAGCTTGTTGC	0.572																																						dbGAP											0													114.0	102.0	106.0					15																	86311422		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.1620C>G	15.37:g.86311422G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDH2|B3KRT7	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L540	ENST00000337975.5	37	c.1620	CCDS10339.1	15																																																																																			KLHL25	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000183655		0.572	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL25	HGNC	protein_coding	OTTHUMT00000309023.1	81	0.00	0	G	NM_022480		86311422	86311422	-1	no_errors	ENST00000337975	ensembl	human	known	69_37n	silent	38	22.45	11	SNP	0.992	C
KMO	8564	genome.wustl.edu	37	1	241718933	241718933	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:241718933G>C	ENST00000366559.4	+	5	645	c.334G>C	c.(334-336)Gaa>Caa	p.E112Q	KMO_ENST00000366557.4_Missense_Mutation_p.E112Q|KMO_ENST00000366558.3_Missense_Mutation_p.E112Q|KMO_ENST00000484628.1_3'UTR	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TGTAAGCAGAGAAAATCTAAA	0.308																																						dbGAP											0													92.0	94.0	93.0					1																	241718933		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.334G>C	1.37:g.241718933G>C	ENSP00000355517:p.Glu112Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_mOase_FAD-bd,prints_Rng_hydrolase-like	p.E112Q	ENST00000366559.4	37	c.334	CCDS1618.1	1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757198	0.49468	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	T;T;T	0.51071	0.72;0.72;0.72	5.54	3.67	0.42095	Monooxygenase, FAD-binding (1);	0.153153	0.56097	D	0.000028	T	0.39279	0.1072	L	0.37697	1.125	0.27150	N	0.961446	P;P;P	0.44877	0.845;0.754;0.813	B;P;B	0.45506	0.403;0.483;0.281	T	0.16247	-1.0409	10	0.20519	T	0.43	.	9.9147	0.41427	0.1664:0.0:0.8336:0.0	.	112;112;112	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	Q	112	ENSP00000355517:E112Q;ENSP00000355516:E112Q;ENSP00000355515:E112Q	ENSP00000355515:E112Q	E	+	1	0	KMO	239785556	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.876000	0.63079	0.700000	0.31782	0.591000	0.81541	GAA	KMO	-	pfam_mOase_FAD-bd	ENSG00000117009		0.308	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	HGNC	protein_coding	OTTHUMT00000095612.1	79	0.00	0	G	NM_003679		241718933	241718933	+1	no_errors	ENST00000366559	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	1.000	C
KRTAP5-10	387273	genome.wustl.edu	37	11	71276831	71276831	+	Silent	SNP	C	C	G	rs71473841	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:71276831C>G	ENST00000398531.1	+	1	223	c.198C>G	c.(196-198)tcC>tcG	p.S66S	KRTAP5-10_ENST00000376536.4_Silent_p.S66S	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	66	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GCTGTGGCTCCTGTGGGGGCT	0.682													c|||	2364	0.472045	0.5008	0.5735	5008	,	,		8057	0.5754		0.4503	False		,,,				2504	0.2771					dbGAP											0													61.0	82.0	75.0					11																	71276831		2177	4250	6427	-	-	-	SO:0001819	synonymous_variant	0			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.198C>G	11.37:g.71276831C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EHA4	Silent	SNP	NULL	p.S66	ENST00000398531.1	37	c.198	CCDS41684.1	11																																																																																			KRTAP5-10	-	NULL	ENSG00000204572		0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP5-10	HGNC	protein_coding	OTTHUMT00000127968.2	78	0.00	0	C			71276831	71276831	+1	no_errors	ENST00000398531	ensembl	human	known	69_37n	silent	65	13.33	10	SNP	0.922	G
LCN8	138307	genome.wustl.edu	37	9	139650060	139650060	+	5'UTR	SNP	C	C	A	rs2784068	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr9:139650060C>A	ENST00000482893.1	-	0	1485				LCN8_ENST00000371688.3_Intron			Q6JVE9	LCN8_HUMAN	lipocalin 8						response to hormone (GO:0009725)|transport (GO:0006810)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	10	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		ATCCTGCCCCCACCCAGTCCC	0.587													C|||	2726	0.544329	0.3011	0.5504	5008	,	,		20982	0.7143		0.6909	False		,,,				2504	0.5429					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK124003	CCDS35183.1	9q34.3	2011-10-24	2005-01-11		ENSG00000204001	ENSG00000204001		"""Lipocalins"""	27038	protein-coding gene	gene with protein product		612902	"""chromosome 9 open reading frame 137"", ""lipocalin 5"""	LCN5			Standard	XM_005266058		Approved		uc004cjb.1	Q6JVE9	OTTHUMG00000020942	ENST00000482893.1:c.-1140G>T	9.37:g.139650060C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4A8|A6NMN9|Q5T5R4	RNA	SNP	-	NULL	ENST00000482893.1	37	NULL		9																																																																																			LCN8	-	-	ENSG00000204001		0.587	LCN8-003	KNOWN	basic	processed_transcript	LCN8	HGNC	protein_coding	OTTHUMT00000055111.1	70	0.00	0	C	NM_178469		139650060	139650060	-1	no_errors	ENST00000479767	ensembl	human	known	69_37n	rna	55	14.06	9	SNP	0.000	A
LEPR	3953	genome.wustl.edu	37	1	66062146	66062146	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:66062146C>T	ENST00000349533.6	+	7	904	c.719C>T	c.(718-720)cCa>cTa	p.P240L	LEPR_ENST00000371060.3_Missense_Mutation_p.P240L|LEPR_ENST00000371059.3_Missense_Mutation_p.P240L|LEPR_ENST00000344610.8_Missense_Mutation_p.P240L|LEPR_ENST00000371058.1_Missense_Mutation_p.P240L|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000462765.1_3'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CCTGATCCACCATTAGGTTTG	0.308																																						dbGAP											0													76.0	79.0	78.0					1																	66062146		2203	4299	6502	-	-	-	SO:0001583	missense	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.719C>T	1.37:g.66062146C>T	ENSP00000330393:p.Pro240Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHL5	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P240L	ENST00000349533.6	37	c.719	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239770	0.58995	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35	5.51	5.51	0.81932	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.098808	0.64402	D	0.000001	D	0.92685	0.7675	H	0.95224	3.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.94339	0.7569	10	0.87932	D	0	-13.4399	19.3934	0.94594	0.0:1.0:0.0:0.0	.	240;240;240	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	L	240	ENSP00000340884:P240L;ENSP00000330393:P240L;ENSP00000360099:P240L;ENSP00000360098:P240L;ENSP00000360097:P240L	ENSP00000340884:P240L	P	+	2	0	LEPR	65834734	0.998000	0.40836	0.951000	0.38953	0.190000	0.23558	5.019000	0.64060	2.600000	0.87896	0.591000	0.81541	CCA	LEPR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116678		0.308	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	41	0.00	0	C	NM_002303		66062146	66062146	+1	no_errors	ENST00000349533	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.994	T
LINC00032	158035	genome.wustl.edu	37	9	27258725	27258725	+	lincRNA	SNP	A	A	T	rs10967818	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr9:27258725A>T	ENST00000425633.1	-	0	2572					NR_026679.1		P0C843	CI014_HUMAN	long intergenic non-protein coding RNA 32																		GATCCAAGGAAACCTCCACAA	0.478													A|||	557	0.111222	0.0726	0.2248	5008	,	,		15269	0.002		0.1899	False		,,,				2504	0.1145					dbGAP											0																																										-	-	-			0			AF418573		9p21	2012-10-12	2011-08-10	2011-08-10	ENSG00000231459	ENSG00000231459		"""Long non-coding RNAs"""	16506	non-coding RNA	RNA, long non-coding			"""chromosome 9 open reading frame 14"", ""non-protein coding RNA 32"""	C9orf14, NCRNA00032			Standard	NR_026679		Approved		uc010mjd.2	P0C843	OTTHUMG00000019711		9.37:g.27258725A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425633.1	37	NULL		9																																																																																			LINC00032	-	-	ENSG00000231459		0.478	LINC00032-001	KNOWN	basic	lincRNA	LINC00032	HGNC	lincRNA	OTTHUMT00000051963.1	50	0.00	0	A	NR_026679		27258725	27258725	-1	no_errors	ENST00000425633	ensembl	human	known	69_37n	rna	27	15.62	5	SNP	0.014	T
TUNAR	100507043	genome.wustl.edu	37	14	96389173	96389173	+	lincRNA	SNP	A	A	G	rs7160831	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:96389173A>G	ENST00000503525.2	+	0	462					NR_038861.1																						ATCACTAGTGAAAATGATGAA	0.408													G|||	1700	0.339457	0.6785	0.2161	5008	,	,		24107	0.1905		0.1312	False		,,,				2504	0.3364					dbGAP											0																																										-	-	-			0																															14.37:g.96389173A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000503525.2	37	NULL		14																																																																																			LINC00617	-	-	ENSG00000250366		0.408	LINC00617-002	KNOWN	basic	lincRNA	LINC00617	HGNC	lincRNA	OTTHUMT00000413257.1	56	0.00	0	A			96389173	96389173	+1	no_errors	ENST00000503525	ensembl	human	known	69_37n	rna	44	10.20	5	SNP	1.000	G
LINC00667	339290	genome.wustl.edu	37	18	5233105	5233105	+	lincRNA	SNP	C	C	G	rs3887348	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr18:5233105C>G	ENST00000579933.1	-	0	746																											GTTTACTTGGCCCTCTGCCTC	0.532													A|||	1972	0.39377	0.6589	0.3271	5008	,	,		17375	0.0734		0.3857	False		,,,				2504	0.4213					dbGAP											0																																										-	-	-			0																															18.37:g.5233105C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000579933.1	37	NULL		18																																																																																			LINC00667	-	-	ENSG00000263753		0.532	RP11-835E18.5-001	KNOWN	basic	lincRNA	LINC00667	HGNC	lincRNA	OTTHUMT00000444199.1	32	0.00	0	C			5233105	5233105	+1	no_errors	ENST00000458396	ensembl	human	known	69_37n	rna	14	17.65	3	SNP	1.000	G
LPAL2	80350	genome.wustl.edu	37	6	160906846	160906846	+	RNA	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:160906846C>T	ENST00000335388.5	-	0	850					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		CAAAGACGTACGCATTTGGGT	0.463																																						dbGAP											0																																										-	-	-			0			U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160906846C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5B4	Splice_Site	SNP	-	NULL	ENST00000335388.5	37	c.NULL		6																																																																																			LPAL2	-	-	ENSG00000213071		0.463	LPAL2-003	KNOWN	basic	processed_transcript	LPAL2	HGNC	pseudogene	OTTHUMT00000042950.1	142	0.00	0	C	NM_024492		160906846	160906846	-1	no_errors	ENST00000335388	ensembl	human	known	69_37n	splice_site	65	15.58	12	SNP	0.969	T
LRCH4	4034	genome.wustl.edu	37	7	100179964	100179964	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:100179964G>A	ENST00000310300.6	-	2	391	c.339C>T	c.(337-339)ctC>ctT	p.L113L	LRCH4_ENST00000497245.1_5'UTR	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	113					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGAGGGCTGTGAGATTCCCCA	0.627																																						dbGAP											0													84.0	78.0	80.0					7																	100179964		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.339C>T	7.37:g.100179964G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2D5|Q8WV85|Q96ID0	Silent	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.L113	ENST00000310300.6	37	c.339	CCDS34706.1	7																																																																																			LRCH4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000077454		0.627	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRCH4	HGNC	protein_coding	OTTHUMT00000356110.1	70	0.00	0	G	NM_002319		100179964	100179964	-1	no_errors	ENST00000310300	ensembl	human	known	69_37n	silent	52	14.52	9	SNP	1.000	A
LRRK1	79705	genome.wustl.edu	37	15	101549163	101549163	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:101549163C>T	ENST00000388948.3	+	7	1243	c.884C>T	c.(883-885)tCg>tTg	p.S295L	LRRK1_ENST00000284395.5_Missense_Mutation_p.S292L	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACCCTCCCCTCGGTTATCCCC	0.592											OREG0023521	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													81.0	83.0	82.0					15																	101549163		2014	4157	6171	-	-	-	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.884C>T	15.37:g.101549163C>T	ENSP00000373600:p.Ser295Leu	Somatic	1359	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.S295L	ENST00000388948.3	37	c.884	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	C	17.17	3.319972	0.60634	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.25912	1.77;1.77	5.43	4.51	0.55191	.	0.066324	0.64402	D	0.000008	T	0.34919	0.0914	L	0.32530	0.975	0.58432	D	0.999994	D	0.89917	1.0	D	0.66497	0.944	T	0.04495	-1.0947	10	0.13853	T	0.58	.	14.6356	0.68686	0.1467:0.8533:0.0:0.0	.	295	Q38SD2	LRRK1_HUMAN	L	295;292	ENSP00000373600:S295L;ENSP00000284395:S292L	ENSP00000284395:S292L	S	+	2	0	LRRK1	99366686	1.000000	0.71417	0.478000	0.27316	0.139000	0.21198	7.300000	0.78841	1.262000	0.44165	-0.314000	0.08810	TCG	LRRK1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000154237		0.592	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	53	0.00	0	C	NM_024652		101549163	101549163	+1	no_errors	ENST00000388948	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	0.996	T
LY6G6F	259215	genome.wustl.edu	37	6	31675666	31675666	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:31675666G>C	ENST00000375832.4	+	3	423	c.401G>C	c.(400-402)aGg>aCg	p.R134T	MEGT1_ENST00000503322.1_Missense_Mutation_p.R134T|XXbac-BPG32J3.20_ENST00000461287.1_Intron|LY6G6F_ENST00000556581.1_Missense_Mutation_p.R134T	NM_001003693.1	NP_001003693.1	Q5SQ64	LY66F_HUMAN	lymphocyte antigen 6 complex, locus G6F	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	12						TTATCTGCAAGGGCTGCAGAT	0.602																																						dbGAP											0													69.0	66.0	67.0					6																	31675666		1511	2709	4220	-	-	-	SO:0001583	missense	0				CCDS34403.1	6p21	2013-01-11	2008-05-21	2008-05-21		ENSG00000204424		"""Immunoglobulin superfamily / V-set domain containing"""	13933	protein-coding gene	gene with protein product		611404	"""chromosome 6 open reading frame 21"""	LY6G6D, C6orf21		12852788	Standard	NM_001003693		Approved	G6f, NG32	uc003nwa.1	Q5SQ64	OTTHUMG00000031252	ENST00000375832.4:c.401G>C	6.37:g.31675666G>C	ENSP00000364992:p.Arg134Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0UXB7|O95869|Q7Z5H2|Q96QC7|Q9NZJ1	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.R134T	ENST00000375832.4	37	c.401	CCDS34403.1	6	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750657	0.31046	.	.	ENSG00000204424;ENSG00000204424;ENSG00000250641	ENST00000556581;ENST00000375832;ENST00000503322	T;T;T	0.20069	2.36;2.1;2.36	4.97	-0.861	0.10676	.	0.495822	0.20668	N	0.087882	T	0.08179	0.0204	L	0.57536	1.79	0.09310	N	1	B;B	0.26635	0.155;0.155	B;B	0.28916	0.096;0.096	T	0.29119	-1.0022	10	0.72032	D	0.01	-15.8182	7.9225	0.29854	0.5849:0.0:0.4151:0.0	.	134;134	Q9NZJ1;Q5SQ64	.;LY66F_HUMAN	T	134	ENSP00000452432:R134T;ENSP00000364992:R134T;ENSP00000421232:R134T	ENSP00000364992:R134T	R	+	2	0	XXbac-BPG32J3.19;LY6G6F	31783645	0.029000	0.19370	0.148000	0.22405	0.972000	0.66771	0.150000	0.16263	-0.048000	0.13401	-0.216000	0.12614	AGG	LY6G6F	-	NULL	ENSG00000204424		0.602	LY6G6F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6G6F	HGNC	protein_coding	OTTHUMT00000076532.2	46	0.00	0	G	NM_001003693		31675666	31675666	+1	no_errors	ENST00000556581	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.045	C
LYPLAL1	127018	genome.wustl.edu	37	1	219352498	219352498	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:219352498G>T	ENST00000366928.5	+	2	148	c.101G>T	c.(100-102)gGa>gTa	p.G34V	LYPLAL1_ENST00000366927.3_Missense_Mutation_p.G34V|LYPLAL1_ENST00000483635.1_3'UTR	NM_138794.3	NP_620149	Q5VWZ2	LYPL1_HUMAN	lysophospholipase-like 1	34					negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|protein depalmitoylation (GO:0002084)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	lysophospholipase activity (GO:0004622)			large_intestine(1)|lung(5)	6				GBM - Glioblastoma multiforme(131;0.055)|all cancers(67;0.105)|OV - Ovarian serous cystadenocarcinoma(81;0.116)		GGTGATTCTGGACAAGGATTA	0.308																																						dbGAP											0													64.0	64.0	64.0					1																	219352498		2202	4296	6498	-	-	-	SO:0001583	missense	0			BC016711	CCDS1522.1, CCDS73032.1	1q41	2008-02-05			ENSG00000143353	ENSG00000143353			20440	protein-coding gene	gene with protein product							Standard	XM_005273046		Approved	Q96AV0	uc001hlq.4	Q5VWZ2	OTTHUMG00000037141	ENST00000366928.5:c.101G>T	1.37:g.219352498G>T	ENSP00000355895:p.Gly34Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K677|Q5VWZ3|Q7Z4A3|Q96AV0	Missense_Mutation	SNP	pfam_PLipase/COase/thioEstase,pfam_Dienelactn_hydro,pfam_Esterase_put	p.G34V	ENST00000366928.5	37	c.101	CCDS1522.1	1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925349	0.73213	.	.	ENSG00000143353	ENST00000366928;ENST00000366927	T;T	0.26373	1.74;1.74	5.77	5.77	0.91146	Phospholipase/carboxylesterase/thioesterase (1);	0.000000	0.85682	D	0.000000	T	0.64271	0.2583	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72704	-0.4213	10	0.87932	D	0	.	19.133	0.93415	0.0:0.0:1.0:0.0	.	34;34	Q5VWZ2-2;Q5VWZ2	.;LYPL1_HUMAN	V	34	ENSP00000355895:G34V;ENSP00000355894:G34V	ENSP00000355894:G34V	G	+	2	0	LYPLAL1	217419121	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	5.887000	0.69751	2.885000	0.99019	0.655000	0.94253	GGA	LYPLAL1	-	pfam_PLipase/COase/thioEstase	ENSG00000143353		0.308	LYPLAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPLAL1	HGNC	protein_coding	OTTHUMT00000090208.1	41	0.00	0	G	NM_138794		219352498	219352498	+1	no_errors	ENST00000366928	ensembl	human	known	69_37n	missense	54	11.29	7	SNP	1.000	T
LZTR1	8216	genome.wustl.edu	37	22	21343956	21343956	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:21343956C>T	ENST00000215739.8	+	7	995	c.636C>T	c.(634-636)ctC>ctT	p.L212L	LZTR1_ENST00000389355.3_Silent_p.L193L|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	212					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			ACCGAGAGCTCACCTGCTggg	0.642																																						dbGAP											0													65.0	50.0	55.0					22																	21343956		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.636C>T	22.37:g.21343956C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14776|Q20WK0	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.L212	ENST00000215739.8	37	c.636	CCDS33606.1	22																																																																																			LZTR1	-	NULL	ENSG00000099949		0.642	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	31	0.00	0	C	NM_006767		21343956	21343956	+1	no_errors	ENST00000215739	ensembl	human	known	69_37n	silent	16	15.79	3	SNP	1.000	T
MACC1	346389	genome.wustl.edu	37	7	20198202	20198202	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:20198202C>T	ENST00000400331.5	-	5	2090	c.1782G>A	c.(1780-1782)gtG>gtA	p.V594V	MACC1_ENST00000332878.4_Silent_p.V594V|MACC1_ENST00000589011.1_Silent_p.V594V	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	594	SH3.				positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						ACCATTCTTTCACTTTGGACT	0.388																																						dbGAP											0													172.0	170.0	170.0					7																	20198202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1782G>A	7.37:g.20198202C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Silent	SNP	pfam_SH3_2,superfamily_DEATH-like	p.V594	ENST00000400331.5	37	c.1782	CCDS5369.1	7																																																																																			MACC1	-	pfam_SH3_2	ENSG00000183742		0.388	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MACC1	HGNC	protein_coding	OTTHUMT00000250202.5	48	0.00	0	C	NM_182762		20198202	20198202	-1	no_errors	ENST00000332878	ensembl	human	known	69_37n	silent	35	22.22	10	SNP	0.975	T
MACF1	23499	genome.wustl.edu	37	1	39951984	39951984	+	3'UTR	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:39951984G>C	ENST00000372915.3	+	0	22772				MACF1_ENST00000361689.2_3'UTR|MACF1_ENST00000289893.4_3'UTR|MACF1_ENST00000539005.1_3'UTR|MACF1_ENST00000564288.1_3'UTR|MACF1_ENST00000317713.7_3'UTR|MACF1_ENST00000567887.1_3'UTR|MACF1_ENST00000545844.1_3'UTR			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATGTTTTGTGATTTTTAGCT	0.368																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.*518G>C	1.37:g.39951984G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	RNA	SNP	-	NULL	ENST00000372915.3	37	NULL		1																																																																																			MACF1	-	-	ENSG00000127603		0.368	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	56	0.00	0	G	NM_033044		39951984	39951984	+1	no_errors	ENST00000497807	ensembl	human	known	69_37n	rna	42	14.29	7	SNP	0.977	C
MAEL	84944	genome.wustl.edu	37	1	166963267	166963267	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:166963267G>T	ENST00000367872.4	+	5	728	c.484G>T	c.(484-486)Gaa>Taa	p.E162*	MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Nonsense_Mutation_p.E131*	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	162					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						TATTATAGGTGAAATTCCACG	0.348																																						dbGAP											0													80.0	83.0	82.0					1																	166963267		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.484G>T	1.37:g.166963267G>T	ENSP00000356846:p.Glu162*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_CH-domain	p.E162*	ENST00000367872.4	37	c.484	CCDS1257.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.196214	0.94960	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624	.	.	.	4.97	4.07	0.47477	.	0.182265	0.38272	N	0.001741	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	12.6479	0.56746	0.0813:0.0:0.9187:0.0	.	.	.	.	X	162;131;131	.	ENSP00000356844:E131X	E	+	1	0	MAEL	165229891	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	4.310000	0.59141	1.332000	0.45431	-0.194000	0.12790	GAA	MAEL	-	superfamily_CH-domain	ENSG00000143194		0.348	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	HGNC	protein_coding	OTTHUMT00000083239.1	47	0.00	0	G	NM_032858		166963267	166963267	+1	no_errors	ENST00000367872	ensembl	human	known	69_37n	nonsense	43	10.42	5	SNP	1.000	T
MAN2A1	4124	genome.wustl.edu	37	5	109183374	109183374	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:109183374C>T	ENST00000261483.4	+	19	3911	c.2859C>T	c.(2857-2859)atC>atT	p.I953I		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	953					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		TTGAAGTTATCATGGATCGAA	0.353																																						dbGAP											0													88.0	82.0	84.0					5																	109183374		2197	4296	6493	-	-	-	SO:0001819	synonymous_variant	0				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.2859C>T	5.37:g.109183374C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16767	Silent	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.I953	ENST00000261483.4	37	c.2859	CCDS34209.1	5																																																																																			MAN2A1	-	pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd	ENSG00000112893		0.353	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A1	HGNC	protein_coding	OTTHUMT00000370680.1	44	0.00	0	C			109183374	109183374	+1	no_errors	ENST00000261483	ensembl	human	known	69_37n	silent	22	21.43	6	SNP	1.000	T
MAN2B2	23324	genome.wustl.edu	37	4	6612852	6612852	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:6612852G>A	ENST00000285599.3	+	15	2446	c.2410G>A	c.(2410-2412)Gac>Aac	p.D804N	MAN2B2_ENST00000504248.1_Missense_Mutation_p.D753N	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	804					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						CTTCGACTGGGACCTGGGCTA	0.652																																						dbGAP											0													59.0	58.0	58.0					4																	6612852		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.2410G>A	4.37:g.6612852G>A	ENSP00000285599:p.Asp804Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.D804N	ENST00000285599.3	37	c.2410	CCDS33951.1	4	.	.	.	.	.	.	.	.	.	.	G	4.383	0.070626	0.08436	.	.	ENSG00000013288	ENST00000285599;ENST00000504248	D;D	0.83163	-1.69;-1.69	4.87	1.12	0.20585	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.492020	0.24611	N	0.037045	T	0.68284	0.2984	L	0.34521	1.04	0.38084	D	0.936777	B;B;B	0.16802	0.019;0.019;0.002	B;B;B	0.21360	0.022;0.034;0.007	T	0.51466	-0.8702	10	0.15499	T	0.54	-14.5551	5.2766	0.15653	0.2358:0.0:0.6216:0.1426	.	753;804;804	E9PCD7;Q9Y2E5;Q9Y2E5-2	.;MA2B2_HUMAN;.	N	804;753	ENSP00000285599:D804N;ENSP00000423129:D753N	ENSP00000285599:D804N	D	+	1	0	MAN2B2	6663753	1.000000	0.71417	0.004000	0.12327	0.655000	0.38815	1.846000	0.39289	-0.109000	0.12044	-0.266000	0.10368	GAC	MAN2B2	-	pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd	ENSG00000013288		0.652	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	29	0.00	0	G	NM_015274		6612852	6612852	+1	no_errors	ENST00000285599	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	A
MDN1	23195	genome.wustl.edu	37	6	90437589	90437589	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:90437589G>T	ENST00000369393.3	-	37	5550	c.5435C>A	c.(5434-5436)gCa>gAa	p.A1812E	MDN1_ENST00000428876.1_Missense_Mutation_p.A1812E			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1812					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTTCAAAGCTGCCAGTAAGGG	0.542																																						dbGAP											0													149.0	110.0	123.0					6																	90437589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.5435C>A	6.37:g.90437589G>T	ENSP00000358400:p.Ala1812Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.A1812E	ENST00000369393.3	37	c.5435	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099445	0.76983	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.53206	0.63;0.63	5.5	5.5	0.81552	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	L	0.31845	0.965	0.80722	D	1	B	0.32731	0.382	B	0.37304	0.246	T	0.14117	-1.0484	10	0.02654	T	1	.	18.9921	0.92796	0.0:0.0:1.0:0.0	.	1812	Q9NU22	MDN1_HUMAN	E	1812	ENSP00000358400:A1812E;ENSP00000413970:A1812E	ENSP00000358400:A1812E	A	-	2	0	MDN1	90494310	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.459000	0.97638	2.585000	0.87301	0.563000	0.77884	GCA	MDN1	-	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,smart_AAA+_ATPase,pirsf_Midasin	ENSG00000112159		0.542	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	59	0.00	0	G			90437589	90437589	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
MAP3K7	6885	genome.wustl.edu	37	6	91261893	91261893	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:91261893G>A	ENST00000369329.3	-	8	903	c.742C>T	c.(742-744)Cga>Tga	p.R248*	MAP3K7_ENST00000369325.3_Nonsense_Mutation_p.R248*|MAP3K7_ENST00000369327.3_Nonsense_Mutation_p.R248*|MAP3K7_ENST00000369320.1_5'UTR|MAP3K7_ENST00000369332.3_Nonsense_Mutation_p.R248*	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	248	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		AGTGGTGGTCGAGTACCTACA	0.398																																						dbGAP											0													99.0	99.0	99.0					6																	91261893		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.742C>T	6.37:g.91261893G>A	ENSP00000358335:p.Arg248*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Nonsense_Mutation	SNP	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R248*	ENST00000369329.3	37	c.742	CCDS5028.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.511319	0.97624	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000450832	.	.	.	5.56	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3677	0.74535	0.0:0.0:0.8461:0.1539	.	.	.	.	X	248;248;248;248;175	.	ENSP00000358331:R248X	R	-	1	2	MAP3K7	91318614	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.188000	0.58351	1.419000	0.47118	0.650000	0.86243	CGA	MAP3K7	-	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135341		0.398	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1	25	0.00	0	G	NM_145331		91261893	91261893	-1	no_errors	ENST00000369329	ensembl	human	known	69_37n	nonsense	32	23.81	10	SNP	1.000	A
MFSD12	126321	genome.wustl.edu	37	19	3547310	3547310	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:3547310G>C	ENST00000355415.2	-	6	1152	c.983C>G	c.(982-984)tCc>tGc	p.S328C	AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000398558.4_Missense_Mutation_p.S328C|MFSD12_ENST00000389395.3_Missense_Mutation_p.S328C|MFSD12_ENST00000591878.1_5'Flank	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	328					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						CATGAGGAAGGAGGACAAGAA	0.627																																						dbGAP											0													70.0	76.0	74.0					19																	3547310		2050	4191	6241	-	-	-	SO:0001583	missense	0			AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.983C>G	19.37:g.3547310G>C	ENSP00000347583:p.Ser328Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXP7|D6W615|E9PAJ8|Q8N459	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S328C	ENST00000355415.2	37	c.983	CCDS42465.1	19	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393299	0.62066	.	.	ENSG00000161091	ENST00000389395;ENST00000398558;ENST00000355415	D;D;D	0.87887	-2.31;-2.31;-2.31	5.11	4.07	0.47477	Major facilitator superfamily domain, general substrate transporter (1);	0.050792	0.85682	D	0.000000	D	0.93733	0.7997	M	0.89287	3.02	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.992;0.997	D	0.93715	0.7027	10	0.49607	T	0.09	-59.2088	12.8298	0.57740	0.0796:0.0:0.9204:0.0	.	328;319;328	Q6NUT3;Q6NUT3-2;A8MXP7	CS028_HUMAN;.;.	C	328	ENSP00000374046:S328C;ENSP00000381566:S328C;ENSP00000347583:S328C	ENSP00000347583:S328C	S	-	2	0	C19orf28	3498310	1.000000	0.71417	0.966000	0.40874	0.512000	0.34134	8.844000	0.92147	1.141000	0.42275	-0.300000	0.09419	TCC	MFSD12	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000161091		0.627	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MFSD12	HGNC	protein_coding	OTTHUMT00000452949.2	34	0.00	0	G	NM_174983		3547310	3547310	-1	no_errors	ENST00000398558	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	C
MFSD4	148808	genome.wustl.edu	37	1	205571467	205571467	+	3'UTR	SNP	C	C	T	rs16856019	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:205571467C>T	ENST00000367147.4	+	0	3516				MFSD4_ENST00000478555.1_3'UTR	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			gaaagagaaacgtggctcaag	0.507													C|||	1758	0.351038	0.1528	0.3948	5008	,	,		17769	0.6399		0.1849	False		,,,				2504	0.4611					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.*1878C>T	1.37:g.205571467C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	RNA	SNP	-	NULL	ENST00000367147.4	37	NULL	CCDS1455.1	1																																																																																			MFSD4	-	-	ENSG00000174514		0.507	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD4	HGNC	protein_coding	OTTHUMT00000090391.1	71	0.00	0	C	NM_181644		205571467	205571467	+1	no_errors	ENST00000478555	ensembl	human	known	69_37n	rna	52	11.86	7	SNP	0.000	T
CHRNE	1145	genome.wustl.edu	37	17	4799335	4799335	+	IGR	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:4799335C>T	ENST00000293780.4	-	0	2455				MINK1_ENST00000453408.3_Silent_p.L1114L|MINK1_ENST00000347992.7_Silent_p.L1105L|MINK1_ENST00000355280.6_Silent_p.L1134L	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	TCATCGCCCTCAAGAGCTCCG	0.587											OREG0024107	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													51.0	55.0	54.0					17																	4799335		1975	4143	6118	-	-	-	SO:0001628	intergenic_variant	0			X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778		17.37:g.4799335C>T		Somatic	621	WXS	Illumina GAIIx	Phase_IV	D3DTK6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.L1134	ENST00000293780.4	37	c.3402	CCDS11058.1	17																																																																																			MINK1	-	pfam_Citron,smart_Citron	ENSG00000141503		0.587	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000207560.3	38	0.00	0	C			4799335	4799335	+1	no_errors	ENST00000355280	ensembl	human	known	69_37n	silent	15	30.43	7	SNP	1.000	T
MORN1	79906	genome.wustl.edu	37	1	2303973	2303973	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:2303973G>A	ENST00000378531.3	-	8	865	c.692C>T	c.(691-693)tCt>tTt	p.S231F	RP4-740C4.9_ENST00000606642.1_RNA|MORN1_ENST00000378529.3_Missense_Mutation_p.S231F|MORN1_ENST00000606372.1_5'UTR	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	231										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		CGAGAAGGGAGACCCTTGGGC	0.547																																						dbGAP											0													133.0	108.0	116.0					1																	2303973		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.692C>T	1.37:g.2303973G>A	ENSP00000367792:p.Ser231Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKZ6|Q8WW30|Q9H852	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.S231F	ENST00000378531.3	37	c.692	CCDS40.1	1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588852	0.28357	.	.	ENSG00000116151	ENST00000378531;ENST00000378529;ENST00000419785;ENST00000378527	T;T	0.55052	0.78;0.54	4.87	1.8	0.24995	.	1.043520	0.07570	N	0.918517	T	0.55016	0.1894	M	0.67953	2.075	0.09310	N	1	B;P	0.34780	0.374;0.468	B;B	0.36186	0.219;0.156	T	0.50634	-0.8805	10	0.66056	D	0.02	.	12.4505	0.55675	0.0:0.5046:0.4954:0.0	.	231;231	Q5T089-2;Q5T089	.;MORN1_HUMAN	F	231;231;100;100	ENSP00000367792:S231F;ENSP00000367790:S231F	ENSP00000367788:S100F	S	-	2	0	MORN1	2293833	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.135000	0.15952	0.204000	0.20548	-0.273000	0.10243	TCT	MORN1	-	NULL	ENSG00000116151		0.547	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MORN1	HGNC	protein_coding	OTTHUMT00000004055.1	51	0.00	0	G	NM_024848		2303973	2303973	-1	no_errors	ENST00000378531	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.000	A
MOV10	4343	genome.wustl.edu	37	1	113242560	113242560	+	Silent	SNP	C	C	T	rs199523554		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:113242560C>T	ENST00000413052.2	+	19	3144	c.2754C>T	c.(2752-2754)atC>atT	p.I918I	MOV10_ENST00000369644.1_Silent_p.I862I|MOV10_ENST00000468624.1_3'UTR|RP11-426L16.10_ENST00000471038.2_5'Flank|MOV10_ENST00000369645.1_Silent_p.I918I|MOV10_ENST00000357443.2_Silent_p.I918I	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	918					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		TGCTCATCATCGTGGGGAACC	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18573	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													121.0	123.0	122.0					1																	113242560		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.2754C>T	1.37:g.113242560C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Silent	SNP	NULL	p.I918	ENST00000413052.2	37	c.2754	CCDS853.1	1																																																																																			MOV10	-	NULL	ENSG00000155363		0.587	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1	20	0.00	0	C	NM_020963		113242560	113242560	+1	no_errors	ENST00000357443	ensembl	human	known	69_37n	silent	15	25.00	5	SNP	0.020	T
MRPS18B	28973	genome.wustl.edu	37	6	30587740	30587740	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:30587740G>A	ENST00000259873.4	+	4	485	c.328G>A	c.(328-330)Gat>Aat	p.D110N	MRPS18B_ENST00000472229.1_3'UTR|MRPS18B_ENST00000506373.2_Missense_Mutation_p.D110N|PPP1R10_ENST00000376511.2_5'Flank|PPP1R10_ENST00000484449.1_5'Flank	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	110					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						CATCTGTCGAGATCACAAGTT	0.443																																						dbGAP											0													194.0	195.0	195.0					6																	30587740		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.328G>A	6.37:g.30587740G>A	ENSP00000259873:p.Asp110Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	pfam_Ribosomal_S18,superfamily_Ribosomal_S18	p.D110N	ENST00000259873.4	37	c.328	CCDS4682.1	6	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875992	0.91664	.	.	ENSG00000204568	ENST00000259873;ENST00000506373	T	0.52983	0.64	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.50480	0.1618	L	0.31926	0.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.51996	-0.8634	10	0.56958	D	0.05	.	15.6635	0.77206	0.0:0.0:1.0:0.0	.	110;110	B4DFG6;Q9Y676	.;RT18B_HUMAN	N	110	ENSP00000259873:D110N	ENSP00000259873:D110N	D	+	1	0	MRPS18B	30695719	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.068000	0.76748	2.677000	0.91161	0.579000	0.79373	GAT	MRPS18B	-	pfam_Ribosomal_S18,superfamily_Ribosomal_S18	ENSG00000204568		0.443	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18B	HGNC	protein_coding	OTTHUMT00000076584.2	79	0.00	0	G			30587740	30587740	+1	no_errors	ENST00000259873	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	1.000	A
TPTE2P2	644623	genome.wustl.edu	37	13	52809355	52809355	+	RNA	SNP	C	C	A	rs9535926	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr13:52809355C>A	ENST00000451298.1	-	0	856				TPTE2P2_ENST00000606973.1_RNA																							TCTTTCATACCTCTGCAGTTA	0.368													c|||	2081	0.415535	0.1392	0.4265	5008	,	,		17061	0.5903		0.6083	False		,,,				2504	0.4029					dbGAP											0																																										-	-	-			0																															13.37:g.52809355C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000451298.1	37	NULL		13																																																																																			RP11-64P12.8	-	-	ENSG00000217576		0.368	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	MRPS31P3	Clone_based_vega_gene	processed_transcript	OTTHUMT00000471093.1	38	0.00	0	C			52809355	52809355	-1	no_errors	ENST00000422308	ensembl	human	known	69_37n	rna	16	23.81	5	SNP	0.989	A
MTRR	4552	genome.wustl.edu	37	5	7886774	7886774	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:7886774C>T	ENST00000264668.2	+	8	1215	c.1185C>T	c.(1183-1185)ttC>ttT	p.F395F	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Silent_p.F368F	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	395	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CTCTCCAGTTCATTTTTACCT	0.373																																						dbGAP											0													128.0	123.0	125.0					5																	7886774		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1185C>T	5.37:g.7886774C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60471|Q32MA9|Q7Z4M8	Silent	SNP	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin,pfscan_Flavodoxin/NO_synth	p.F395	ENST00000264668.2	37	c.1185	CCDS3874.1	5																																																																																			MTRR	-	pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000124275		0.373	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	HGNC	protein_coding	OTTHUMT00000206931.1	65	0.00	0	C			7886774	7886774	+1	no_errors	ENST00000264668	ensembl	human	known	69_37n	silent	59	15.71	11	SNP	0.991	T
MUC19	283463	genome.wustl.edu	37	12	40938751	40938751	+	Intron	SNP	A	A	G	rs7304329	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:40938751A>G	ENST00000454784.4	+	55	17711							Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ATCTCCTCTGAAAATCTTTGT	0.333													G|||	999	0.199481	0.3207	0.1657	5008	,	,		18721	0.1706		0.1899	False		,,,				2504	0.0992					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.10890+66A>G	12.37:g.40938751A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	RNA	SNP	-	NULL	ENST00000454784.4	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.333	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	38	0.00	0	A	XM_003403524		40938751	40938751	+1	no_errors	ENST00000492952	ensembl	human	known	69_37n	rna	38	15.56	7	SNP	0.002	G
MYH16	84176	genome.wustl.edu	37	7	98861915	98861915	+	IGR	SNP	T	T	C	rs10281195	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:98861915T>C								MYH16 (6136 upstream) : ARPC1A (61605 downstream)																							TTCATGACAGTCTCCAATTTC	0.542													T|||	1133	0.226238	0.3956	0.2233	5008	,	,		17564	0.1915		0.1064	False		,,,				2504	0.1585					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															7.37:g.98861915T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		7																																																																																			MYH16	-	-	ENSG00000002079	0	0.542					MYH16	HGNC			44	0.00	0	T			98861915	98861915	+1	no_errors	ENST00000425880	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	1.000	C
MYO15B	80022	genome.wustl.edu	37	17	73586358	73586358	+	Intron	SNP	G	G	A	rs820242	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:73586358G>A	ENST00000578382.2	+	1	2186					NR_003587.2		Q96JP2	MY15B_HUMAN	myosin XVB pseudogene							cytoplasm (GO:0005737)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)										TGCCATCCCCGGCTCACAGCT	0.602													G|||	2948	0.588658	0.0802	0.7363	5008	,	,		17624	0.8462		0.7386	False		,,,				2504	0.7515					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					17q25.1	2014-07-16			ENSG00000266714	ENSG00000266714		"""Myosins / Myosin superfamily : Class XV"""	14083	pseudogene	pseudogene						11294886	Standard	NR_003587		Approved	MYO15BP	uc002jon.1	Q96JP2	OTTHUMG00000179794	ENST00000578382.2:c.2186+34G>A	17.37:g.73586358G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000578382.2	37	NULL		17																																																																																			MYO15B	-	-	ENSG00000266714		0.602	MYO15B-001	KNOWN	sequence_error|basic	processed_transcript	MYO15B	Clone_based_vega_gene	protein_coding	OTTHUMT00000448172.2	80	0.00	0	G	NR_003587		73586358	73586358	+1	no_errors	ENST00000584516	ensembl	human	known	69_37n	rna	34	17.07	7	SNP	0.001	A
MYOZ1	58529	genome.wustl.edu	37	10	75394302	75394302	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:75394302C>T	ENST00000359322.4	-	4	806	c.442G>A	c.(442-444)Gcg>Acg	p.A148T		NM_021245.3	NP_067068.1			myozenin 1											central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					GCCTGGCCCGCGGGACCACCT	0.632																																						dbGAP											0													52.0	55.0	54.0					10																	75394302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.442G>A	10.37:g.75394302C>T	ENSP00000352272:p.Ala148Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Calsarcin-bd	p.A148T	ENST00000359322.4	37	c.442	CCDS7330.1	10	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010641	0.54361	.	.	ENSG00000177791	ENST00000359322	T	0.63744	-0.06	6.05	6.05	0.98169	.	0.145405	0.64402	D	0.000007	T	0.50888	0.1642	N	0.19112	0.55	0.36626	D	0.87602	B	0.29552	0.248	B	0.32928	0.155	T	0.50709	-0.8796	10	0.15952	T	0.53	-4.1965	19.5968	0.95544	0.0:1.0:0.0:0.0	.	148	Q9NP98	MYOZ1_HUMAN	T	148	ENSP00000352272:A148T	ENSP00000352272:A148T	A	-	1	0	MYOZ1	75064308	1.000000	0.71417	1.000000	0.80357	0.270000	0.26580	3.663000	0.54518	2.880000	0.98712	0.655000	0.94253	GCG	MYOZ1	-	pfam_Calsarcin-bd	ENSG00000177791		0.632	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOZ1	HGNC	protein_coding	OTTHUMT00000048654.1	45	0.00	0	C			75394302	75394302	-1	no_errors	ENST00000359322	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
NAA25	80018	genome.wustl.edu	37	12	112492280	112492280	+	Silent	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:112492280G>T	ENST00000261745.4	-	14	1788	c.1540C>A	c.(1540-1542)Cga>Aga	p.R514R		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	514						cytoplasm (GO:0005737)		p.R514*(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						CAGTAGATTCGAACAAGCAGC	0.478																																						dbGAP											1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											132.0	110.0	117.0					12																	112492280		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.1540C>A	12.37:g.112492280G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Silent	SNP	pfam_N-acetylTrfase_B_cplx_non-cat,pfscan_TPR-contain_dom	p.R514	ENST00000261745.4	37	c.1540	CCDS9159.1	12																																																																																			NAA25	-	pfam_N-acetylTrfase_B_cplx_non-cat	ENSG00000111300		0.478	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA25	HGNC	protein_coding	OTTHUMT00000405205.1	39	0.00	0	G	NM_024953		112492280	112492280	-1	no_errors	ENST00000261745	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	1.000	T
NAP1L4	4676	genome.wustl.edu	37	11	2966776	2966776	+	3'UTR	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:2966776G>A	ENST00000380542.4	-	0	1401				NAP1L4_ENST00000469089.1_5'UTR|NAP1L4_ENST00000526115.1_3'UTR	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4						nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		GGCAAGGACCGAGGCCCCGCC	0.562																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.*133C>T	11.37:g.2966776G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6J4|F5HFY4	RNA	SNP	-	NULL	ENST00000380542.4	37	NULL	CCDS41599.1	11																																																																																			NAP1L4	-	-	ENSG00000205531		0.562	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L4	HGNC	protein_coding	OTTHUMT00000030273.3	49	0.00	0	G	NM_005969		2966776	2966776	-1	no_errors	ENST00000469089	ensembl	human	known	69_37n	rna	27	32.50	13	SNP	0.000	A
NBPF15	284565	genome.wustl.edu	37	1	148574903	148574903	+	5'UTR	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:148574903G>A	ENST00000442702.2	+	0	613				NBPF15_ENST00000464336.2_3'UTR|NBPF15_ENST00000369187.3_Intron	NM_001170755.1	NP_001164226.1	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15							cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					GACAAAGTTTGACCAGTCTTT	0.537																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000442702.2:c.-455G>A	1.37:g.148574903G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3BBV9|Q8IX77	RNA	SNP	-	NULL	ENST00000442702.2	37	NULL	CCDS932.1	1																																																																																			NBPF15	-	-	ENSG00000243452		0.537	NBPF15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF15	HGNC	protein_coding		37	0.00	0	G	NM_173638		148574903	148574903	+1	no_errors	ENST00000464336	ensembl	human	known	69_37n	rna	17	19.05	4	SNP	0.641	A
NEB	4703	genome.wustl.edu	37	2	152495886	152495886	+	Intron	SNP	C	C	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:152495886C>A	ENST00000172853.10	-	62	9037				NEB_ENST00000603639.1_Nonsense_Mutation_p.E2968*|NEB_ENST00000604864.1_Nonsense_Mutation_p.E2968*|NEB_ENST00000397345.3_Nonsense_Mutation_p.E2968*|NEB_ENST00000409198.1_Intron|NEB_ENST00000427231.2_Nonsense_Mutation_p.E2968*			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCCCAGGCTTCTGTGTATAAA	0.348																																						dbGAP											0													322.0	238.0	264.0					2																	152495886		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.8889+484G>T	2.37:g.152495886C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Nonsense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.E2968*	ENST00000172853.10	37	c.8902		2	.	.	.	.	.	.	.	.	.	.	C	52	18.751763	0.99910	.	.	ENSG00000183091	ENST00000397345;ENST00000427231	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	16.5909	0.84765	0.1307:0.8693:0.0:0.0	.	.	.	.	X	2968	.	ENSP00000380505:E2968X	E	-	1	0	NEB	152204132	0.008000	0.16893	1.000000	0.80357	0.997000	0.91878	0.200000	0.17257	2.812000	0.96745	0.557000	0.71058	GAA	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.348	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		76	0.00	0	C	NM_004543		152495886	152495886	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	nonsense	61	12.86	9	SNP	0.985	A
NFIA	4774	genome.wustl.edu	37	1	61921583	61921583	+	3'UTR	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:61921583C>T	ENST00000403491.3	+	0	2605				NFIA_ENST00000357977.5_3'UTR|NFIA_ENST00000371187.3_3'UTR	NM_001134673.3|NM_005595.4	NP_001128145.1|NP_005586.1	Q12857	NFIA_HUMAN	nuclear factor I/A						DNA replication (GO:0006260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to organic cyclic compound (GO:0014070)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		NFIA/EHF(2)	endometrium(1)|kidney(2)|large_intestine(8)|lung(20)|pancreas(1)|prostate(1)|skin(1)	34						GTTCAGCAGTCAGCAGTTAAG	0.353																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U07809	CCDS615.1, CCDS44156.1, CCDS53322.1, CCDS53321.1	1p31.3-p31.2	2008-02-05			ENSG00000162599	ENSG00000162599			7784	protein-coding gene	gene with protein product		600727				7590749	Standard	NM_001134673		Approved	NFI-L, KIAA1439	uc010oos.2	Q12857	OTTHUMG00000008618	ENST00000403491.3:c.*591C>T	1.37:g.61921583C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRJ3|B4DS53|F5H0R0|F8W8W3|Q8TA97|Q9H3X9|Q9P2A9	RNA	SNP	-	NULL	ENST00000403491.3	37	NULL	CCDS44156.1	1																																																																																			NFIA	-	-	ENSG00000162599		0.353	NFIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFIA	HGNC	protein_coding	OTTHUMT00000023799.3	66	0.00	0	C	NM_005595		61921583	61921583	+1	no_errors	ENST00000357977	ensembl	human	known	69_37n	rna	54	11.48	7	SNP	1.000	T
NIPBL	25836	genome.wustl.edu	37	5	37036544	37036544	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:37036544G>C	ENST00000282516.8	+	33	6425	c.5926G>C	c.(5926-5928)Gat>Cat	p.D1976H	NIPBL_ENST00000448238.2_Missense_Mutation_p.D1976H	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1976					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCAACTTGTTGATAACCTAGT	0.259																																						dbGAP											0													17.0	17.0	17.0					5																	37036544		2175	4245	6420	-	-	-	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5926G>C	5.37:g.37036544G>C	ENSP00000282516:p.Asp1976His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1976H	ENST00000282516.8	37	c.5926	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730498	0.89390	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.64618	-0.11;-0.11	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82458	0.5041	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.84641	0.0695	10	0.72032	D	0.01	-13.3432	19.5724	0.95427	0.0:0.0:1.0:0.0	.	1976;1976	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	H	1976	ENSP00000282516:D1976H;ENSP00000406266:D1976H	ENSP00000282516:D1976H	D	+	1	0	NIPBL	37072301	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.438000	0.97539	2.624000	0.88883	0.650000	0.86243	GAT	NIPBL	-	superfamily_ARM-type_fold	ENSG00000164190		0.259	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	46	0.00	0	G	NM_015384		37036544	37036544	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	missense	53	15.62	10	SNP	1.000	C
NIPBL	25836	genome.wustl.edu	37	5	37045655	37045655	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:37045655C>T	ENST00000282516.8	+	37	6953	c.6454C>T	c.(6454-6456)Cgg>Tgg	p.R2152W	NIPBL_ENST00000448238.2_Missense_Mutation_p.R2152W	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2152					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGCACTATGTCGGCATTTTGA	0.358																																						dbGAP											0													208.0	214.0	212.0					5																	37045655		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6454C>T	5.37:g.37045655C>T	ENSP00000282516:p.Arg2152Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R2152W	ENST00000282516.8	37	c.6454	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378568	0.82682	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.66995	-0.24;-0.24	5.52	4.64	0.57946	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81465	0.4828	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84343	0.0528	10	0.87932	D	0	-7.466	15.901	0.79377	0.1366:0.8634:0.0:0.0	.	2152;2152	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	W	2152	ENSP00000282516:R2152W;ENSP00000406266:R2152W	ENSP00000282516:R2152W	R	+	1	2	NIPBL	37081412	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.383000	0.59600	1.428000	0.47296	0.557000	0.71058	CGG	NIPBL	-	superfamily_ARM-type_fold	ENSG00000164190		0.358	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	89	0.00	0	C	NM_015384		37045655	37045655	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	missense	52	27.78	20	SNP	1.000	T
NMT1	4836	genome.wustl.edu	37	17	43175799	43175799	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:43175799C>T	ENST00000592782.1	+	8	894	c.763C>T	c.(763-765)Cgt>Tgt	p.R255C	NMT1_ENST00000258960.2_Missense_Mutation_p.R255C|NMT1_ENST00000590114.1_3'UTR			P30419	NMT1_HUMAN	N-myristoyltransferase 1	255					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				CAAGAAGCTGCGTTCCAAGAG	0.512																																						dbGAP											0													144.0	141.0	142.0					17																	43175799		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.763C>T	17.37:g.43175799C>T	ENSP00000468424:p.Arg255Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C1|Q9UE09	Missense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.R255C	ENST00000592782.1	37	c.763	CCDS11494.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.339551	0.95783	.	.	ENSG00000136448	ENST00000258960	T	0.76839	-1.05	5.49	5.49	0.81192	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93119	0.7809	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95025	0.8164	10	0.87932	D	0	-7.3225	19.5755	0.95441	0.0:1.0:0.0:0.0	.	255	P30419	NMT1_HUMAN	C	255	ENSP00000258960:R255C	ENSP00000258960:R255C	R	+	1	0	NMT1	40531325	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.919000	0.70005	2.865000	0.98341	0.655000	0.94253	CGT	NMT1	-	pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	ENSG00000136448		0.512	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT1	HGNC	protein_coding	OTTHUMT00000449239.1	53	0.00	0	C	NM_021079		43175799	43175799	+1	no_errors	ENST00000258960	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
NOTCH1	4851	genome.wustl.edu	37	9	139402543	139402543	+	Missense_Mutation	SNP	G	G	A	rs200871631	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr9:139402543G>A	ENST00000277541.6	-	21	3449	c.3374C>T	c.(3373-3375)gCg>gTg	p.A1125V		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1125	EGF-like 29. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CGTGTTGCCCGCGTCCACACA	0.677			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)			G|||	3	0.000599042	0.0	0.0	5008	,	,		15496	0.0		0.0	False		,,,				2504	0.0031					dbGAP		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													27.0	33.0	31.0					9																	139402543		2079	4197	6276	-	-	-	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.3374C>T	9.37:g.139402543G>A	ENSP00000277541:p.Ala1125Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59ED8|Q5SXM3	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_1,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A1125V	ENST00000277541.6	37	c.3374	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	G	5.530	0.282742	0.10458	.	.	ENSG00000148400	ENST00000277541	D	0.87729	-2.29	5.01	-0.702	0.11265	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.418572	0.24922	N	0.034533	T	0.65417	0.2689	N	0.04880	-0.145	0.23174	N	0.998179	P	0.39696	0.683	B	0.36567	0.228	T	0.63795	-0.6556	10	0.18276	T	0.48	.	5.5418	0.17041	0.0679:0.1093:0.3537:0.4691	.	1125	P46531	NOTC1_HUMAN	V	1125	ENSP00000277541:A1125V	ENSP00000277541:A1125V	A	-	2	0	NOTCH1	138522364	0.253000	0.23982	0.000000	0.03702	0.033000	0.12548	1.860000	0.39428	-0.474000	0.06862	-0.182000	0.12963	GCG	NOTCH1	-	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF_extracell,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000148400		0.677	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	55	0.00	0	G	NM_017617		139402543	139402543	-1	no_errors	ENST00000277541	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	0.430	A
NRXN1	9378	genome.wustl.edu	37	2	51255012	51255012	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:51255012C>G	ENST00000406316.2	-	2	1876	c.400G>C	c.(400-402)Gag>Cag	p.E134Q	NRXN1_ENST00000401669.2_Missense_Mutation_p.E134Q|NRXN1_ENST00000405581.1_Missense_Mutation_p.E134Q|NRXN1_ENST00000405472.3_Missense_Mutation_p.E134Q|NRXN1_ENST00000406859.3_Missense_Mutation_p.E134Q|NRXN1_ENST00000402717.3_Missense_Mutation_p.E134Q|NRXN1_ENST00000404971.1_Missense_Mutation_p.E134Q	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	134	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CACTTGGCCTCCACCTGGTCG	0.687																																						dbGAP											0													29.0	35.0	33.0					2																	51255012		2135	4239	6374	-	-	-	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.400G>C	2.37:g.51255012C>G	ENSP00000384311:p.Glu134Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.E134Q	ENST00000406316.2	37	c.400	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	C	16.47	3.132439	0.56828	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	T;T;T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33	4.97	4.97	0.65823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.085622	0.08080	U	1.000000	T	0.78323	0.4265	L	0.45422	1.42	0.38578	D	0.950108	B;P;B	0.39940	0.391;0.696;0.265	B;B;B	0.38327	0.196;0.271;0.237	T	0.72547	-0.4260	10	0.28530	T	0.3	.	18.2347	0.89946	0.0:1.0:0.0:0.0	.	134;134;134	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	Q	134	ENSP00000385142:E134Q;ENSP00000384311:E134Q;ENSP00000434015:E134Q;ENSP00000385017:E134Q;ENSP00000385434:E134Q;ENSP00000385681:E134Q;ENSP00000385310:E134Q	ENSP00000385017:E134Q	E	-	1	0	NRXN1	51108516	1.000000	0.71417	0.788000	0.31933	0.975000	0.68041	4.551000	0.60740	2.293000	0.77203	0.563000	0.77884	GAG	NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000179915		0.687	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	18	0.00	0	C			51255012	51255012	-1	no_errors	ENST00000402717	ensembl	human	known	69_37n	missense	5	37.50	3	SNP	0.998	G
NTN1	9423	genome.wustl.edu	37	17	9086712	9086712	+	Intron	SNP	C	C	T	rs56113014	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:9086712C>T	ENST00000173229.2	+	5	1518				NTN1_ENST00000546090.1_Intron|NTN1_ENST00000538852.1_Intron	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						aggagctgggcgtgggggaga	0.567													C|||	1051	0.209864	0.0688	0.353	5008	,	,		16294	0.4097		0.175	False		,,,				2504	0.1288					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1411+426C>T	17.37:g.9086712C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL51	Missense_Mutation	SNP	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	p.A140V	ENST00000173229.2	37	c.419	CCDS11148.1	17	511	0.23397435897435898	34	0.06910569105691057	111	0.30662983425414364	235	0.41083916083916083	131	0.17282321899736147	C	8.041	0.763810	0.15914	.	.	ENSG00000065320	ENST00000436734	T	0.12147	2.71	3.7	-4.95	0.03048	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.40961	-0.9535	5	0.62326	D	0.03	.	7.5742	0.27926	0.2574:0.1636:0.579:0.0	rs56113014	.	.	.	V	140	ENSP00000389375:A140V	ENSP00000389375:A140V	A	+	2	0	NTN1	9027437	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.115000	0.10741	-0.976000	0.03542	-0.280000	0.10049	GCG	NTN1	-	NULL	ENSG00000065320		0.567	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN1	HGNC	protein_coding	OTTHUMT00000252583.1	35	0.00	0	C			9086712	9086712	+1	no_start_codon	ENST00000436734	ensembl	human	putative	69_37n	missense	36	10.00	4	SNP	0.000	T
NUDCD3	23386	genome.wustl.edu	37	7	44524868	44524868	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:44524868C>G	ENST00000355451.7	-	2	487	c.208G>C	c.(208-210)Gac>Cac	p.D70H		NM_015332.3	NP_056147.2	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3	70										endometrium(2)|large_intestine(1)|lung(3)|skin(1)	7						GCCATGTGGTCAAAGGTTTTG	0.428																																						dbGAP											0													58.0	60.0	60.0					7																	44524868		2174	4280	6454	-	-	-	SO:0001583	missense	0			BC003691	CCDS5490.2	7p13-p12	2005-03-18			ENSG00000015676	ENSG00000015676			22208	protein-coding gene	gene with protein product		610296					Standard	NM_015332		Approved	KIAA1068	uc003tkz.3	Q8IVD9	OTTHUMG00000129174	ENST00000355451.7:c.208G>C	7.37:g.44524868C>G	ENSP00000347626:p.Asp70His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTI3|Q9H7W9|Q9UPT4	Missense_Mutation	SNP	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.D70H	ENST00000355451.7	37	c.208	CCDS5490.2	7	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064139	0.76187	.	.	ENSG00000015676	ENST00000355451	T	0.55760	0.5	5.55	5.55	0.83447	.	0.199284	0.52532	D	0.000069	T	0.50222	0.1603	N	0.24115	0.695	0.38028	D	0.935079	D	0.52996	0.957	P	0.51582	0.674	T	0.54774	-0.8243	10	0.49607	T	0.09	-2.1438	15.3384	0.74277	0.0:1.0:0.0:0.0	.	70	Q8IVD9	NUDC3_HUMAN	H	70	ENSP00000347626:D70H	ENSP00000347626:D70H	D	-	1	0	NUDCD3	44491393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.754000	0.62191	2.764000	0.94973	0.563000	0.77884	GAC	NUDCD3	-	NULL	ENSG00000015676		0.428	NUDCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD3	HGNC	protein_coding	OTTHUMT00000251248.3	38	0.00	0	C	NM_015332		44524868	44524868	-1	no_errors	ENST00000355451	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	1.000	G
IL18BP	10068	genome.wustl.edu	37	11	71715696	71715697	+	IGR	DNP	CC	CC	TT			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:71715696_71715697CC>TT	ENST00000393703.4	+	0	1788				NUMA1_ENST00000393695.3_Missense_Mutation_p.G1999K|NUMA1_ENST00000351960.6_Missense_Mutation_p.G863K|NUMA1_ENST00000358965.6_Missense_Mutation_p.G1985K	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein						cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						CTCAGGAGTTCCAGGGCCCTGG	0.639																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713	Exception_encountered	11.37:g.71715696_71715697delinsTT		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Missense_Mutation	SNP	superfamily_Prefoldin	p.G1999E|p.G1999R	ENST00000393703.4	37	c.5996|c.5995	CCDS8206.2	11																																																																																			NUMA1	-	NULL	ENSG00000137497		0.639	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUMA1	HGNC	protein_coding	OTTHUMT00000258012.2	25|24	0.00	0	C	NM_173042		71715696|71715697	71715696|71715697	-1	no_errors	ENST00000393695	ensembl	human	known	69_37n	missense	18|19	21.74|20.83	5	SNP	0.998|0.997	T
OBSCN	84033	genome.wustl.edu	37	1	228560591	228560591	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:228560591C>T	ENST00000422127.1	+	94	22156	c.22112C>T	c.(22111-22113)tCa>tTa	p.S7371L	OBSCN_ENST00000570156.2_Missense_Mutation_p.S8328L|OBSCN_ENST00000366707.4_Missense_Mutation_p.S5005L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7371					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACAGAGGAGTCAGAGGATGTG	0.682																																						dbGAP											0													18.0	23.0	21.0					1																	228560591		2196	4296	6492	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22112C>T	1.37:g.228560591C>T	ENSP00000409493:p.Ser7371Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S7371L	ENST00000422127.1	37	c.22112	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509233	0.44660	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.61980	0.06;0.1	4.92	2.98	0.34508	.	.	.	.	.	T	0.36963	0.0986	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06607	-1.0817	9	0.29301	T	0.29	.	7.0943	0.25301	0.1697:0.7425:0.0:0.0878	.	7371	Q5VST9	OBSCN_HUMAN	L	7371;5005	ENSP00000409493:S7371L;ENSP00000355668:S5005L	ENSP00000355668:S5005L	S	+	2	0	OBSCN	226627214	0.003000	0.15002	0.875000	0.34327	0.078000	0.17371	0.641000	0.24720	0.455000	0.26910	0.313000	0.20887	TCA	OBSCN	-	NULL	ENSG00000154358		0.682	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		55	0.00	0	C	NM_052843		228560591	228560591	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	0.985	T
OR2J2	26707	genome.wustl.edu	37	6	29141830	29141830	+	Missense_Mutation	SNP	C	C	A	rs191240319		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:29141830C>A	ENST00000377167.2	+	1	520	c.418C>A	c.(418-420)Cgt>Agt	p.R140S		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						CATGCACCCTCGTTTCTGCCA	0.468																																						dbGAP											0													322.0	300.0	307.0					6																	29141830		2035	4184	6219	-	-	-	SO:0001583	missense	0				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.418C>A	6.37:g.29141830C>A	ENSP00000366372:p.Arg140Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R140S	ENST00000377167.2	37	c.418	CCDS43434.1	6	.	.	.	.	.	.	.	.	.	.	C	2.029	-0.422767	0.04734	.	.	ENSG00000204700	ENST00000377167	T	0.40756	1.02	2.3	0.0186	0.14117	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.15046	0.0363	L	0.46819	1.47	0.09310	N	1	B	0.21452	0.056	B	0.23852	0.049	T	0.33445	-0.9868	9	0.62326	D	0.03	.	4.5067	0.11891	0.2784:0.5738:0.0:0.1478	.	140	O76002	OR2J2_HUMAN	S	140	ENSP00000366372:R140S	ENSP00000366372:R140S	R	+	1	0	OR2J2	29249809	0.000000	0.05858	0.452000	0.26994	0.123000	0.20343	-2.468000	0.00992	0.280000	0.22209	0.205000	0.17691	CGT	OR2J2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000204700		0.468	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J2	HGNC	protein_coding	OTTHUMT00000076131.2	96	0.00	0	C			29141830	29141830	+1	no_errors	ENST00000377167	ensembl	human	known	69_37n	missense	72	16.28	14	SNP	0.000	A
OR2M3	127062	genome.wustl.edu	37	1	248366476	248366476	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:248366476C>T	ENST00000456743.1	+	1	145	c.107C>T	c.(106-108)tCa>tTa	p.S36L		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCCATCTTTTCAGTGGCCTTC	0.537																																						dbGAP											0													213.0	212.0	213.0					1																	248366476		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.107C>T	1.37:g.248366476C>T	ENSP00000389625:p.Ser36Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH06|Q6IEY0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S36L	ENST00000456743.1	37	c.107	CCDS31107.1	1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.739403	0.00681	.	.	ENSG00000228198	ENST00000456743	T	0.00664	5.92	2.61	1.67	0.24075	.	2.525530	0.02469	U	0.087292	T	0.00271	0.0008	N	0.00082	-2.215	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48779	-0.9005	10	0.02654	T	1	.	4.8063	0.13321	0.0:0.5001:0.0:0.4999	.	36	Q8NG83	OR2M3_HUMAN	L	36	ENSP00000389625:S36L	ENSP00000389625:S36L	S	+	2	0	OR2M3	246433099	0.000000	0.05858	0.001000	0.08648	0.037000	0.13140	0.583000	0.23849	0.435000	0.26365	0.398000	0.26397	TCA	OR2M3	-	prints_7TM_GPCR_Rhodpsn	ENSG00000228198		0.537	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M3	HGNC	protein_coding	OTTHUMT00000097355.1	126	0.00	0	C	NM_001004689		248366476	248366476	+1	no_errors	ENST00000456743	ensembl	human	known	69_37n	missense	90	13.46	14	SNP	0.000	T
OR51J1	79470	genome.wustl.edu	37	11	5424170	5424170	+	Missense_Mutation	SNP	C	C	T	rs2647582	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:5424170C>T	ENST00000332043.1	+	1	344	c.344C>T	c.(343-345)gCc>gTc	p.A115V	HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron			Q9H342	O51J1_HUMAN	olfactory receptor, family 51, subfamily J, member 1 (gene/pseudogene)	115					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CATGATGGAGCCAGCTGTGCT	0.468													T|||	859	0.171526	0.3011	0.1153	5008	,	,		23077	0.1478		0.1113	False		,,,				2504	0.1227					dbGAP											0																																										-	-	-	SO:0001583	missense	0					11p15.4	2012-08-09	2008-06-12	2004-03-10	ENSG00000184321	ENSG00000184321		"""GPCR / Class A : Olfactory receptors"""	14856	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily J, member 1"""	OR51J2, OR51J1P			Standard	NG_002252		Approved			Q9H342	OTTHUMG00000066666	ENST00000332043.1:c.344C>T	11.37:g.5424170C>T	ENSP00000332473:p.Ala115Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A115V	ENST00000332043.1	37	c.344		11	347	0.15888278388278387	137	0.2784552845528455	46	0.1270718232044199	83	0.1451048951048951	81	0.10686015831134564	T	16.05	3.013869	0.54468	.	.	ENSG00000184321	ENST00000332043	T	0.00008	9.62	5.38	5.38	0.77491	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.44417	P	0.0026680000000000037	.	.	.	.	.	.	T	0.48163	-0.9059	5	0.87932	D	0	.	10.4262	0.44380	0.0:0.0768:0.0:0.9232	rs2647582;rs60754644;rs2647582	.	.	.	V	115	ENSP00000332473:A115V	ENSP00000332473:A115V	A	+	2	0	OR51J1	5380746	1.000000	0.71417	0.995000	0.50966	0.403000	0.30841	2.336000	0.43938	1.066000	0.40716	-0.254000	0.11334	GCC	OR51J1	-	pfscan_GPCR_Rhodpsn_supfam	ENSG00000184321		0.468	OR51J1-001	KNOWN	basic|appris_principal	protein_coding	OR51J1	HGNC	protein_coding	OTTHUMT00000142957.1	26	0.00	0	C	NG_002252		5424170	5424170	+1	no_errors	ENST00000332043	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.998	T
OR51J1	79470	genome.wustl.edu	37	11	5424232	5424232	+	Missense_Mutation	SNP	C	C	T	rs1909260	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:5424232C>T	ENST00000332043.1	+	1	406	c.406C>T	c.(406-408)Cac>Tac	p.H136Y	HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron			Q9H342	O51J1_HUMAN	olfactory receptor, family 51, subfamily J, member 1 (gene/pseudogene)	136					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CACTGAGCTACACAGCTATCC	0.502													T|||	859	0.171526	0.3011	0.1153	5008	,	,		22407	0.1478		0.1113	False		,,,				2504	0.1227					dbGAP											0																																										-	-	-	SO:0001583	missense	0					11p15.4	2012-08-09	2008-06-12	2004-03-10	ENSG00000184321	ENSG00000184321		"""GPCR / Class A : Olfactory receptors"""	14856	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily J, member 1"""	OR51J2, OR51J1P			Standard	NG_002252		Approved			Q9H342	OTTHUMG00000066666	ENST00000332043.1:c.406C>T	11.37:g.5424232C>T	ENSP00000332473:p.His136Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.H136Y	ENST00000332043.1	37	c.406		11	347	0.15888278388278387	137	0.2784552845528455	46	0.1270718232044199	83	0.1451048951048951	81	0.10686015831134564	T	0.003	-2.511974	0.00153	.	.	ENSG00000184321	ENST00000332043	T	0.00008	9.58	5.38	-2.31	0.06765	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.26018	-1.0115	5	0.87932	D	0	.	16.0085	0.80380	0.0:0.6741:0.0:0.3259	rs1909260;rs60289465;rs1909260	.	.	.	Y	136	ENSP00000332473:H136Y	ENSP00000332473:H136Y	H	+	1	0	OR51J1	5380808	0.000000	0.05858	0.061000	0.19648	0.021000	0.10359	-0.514000	0.06298	-0.969000	0.03573	-0.254000	0.11334	CAC	OR51J1	-	pfscan_GPCR_Rhodpsn_supfam	ENSG00000184321		0.502	OR51J1-001	KNOWN	basic|appris_principal	protein_coding	OR51J1	HGNC	protein_coding	OTTHUMT00000142957.1	33	0.00	0	C	NG_002252		5424232	5424232	+1	no_errors	ENST00000332043	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.024	T
OSBPL3	26031	genome.wustl.edu	37	7	24844008	24844008	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:24844008C>G	ENST00000313367.2	-	22	2944	c.2493G>C	c.(2491-2493)agG>agC	p.R831S	OSBPL3_ENST00000352860.1_Missense_Mutation_p.R800S|OSBPL3_ENST00000396431.1_Missense_Mutation_p.R800S|OSBPL3_ENST00000409069.1_Missense_Mutation_p.R764S|OSBPL3_ENST00000353930.1_Missense_Mutation_p.R795S|OSBPL3_ENST00000431825.2_Missense_Mutation_p.R764S|OSBPL3_ENST00000396429.1_Missense_Mutation_p.R795S|OSBPL3_ENST00000487020.1_5'UTR	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	831					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						GTTGTTCAATCCTCTGCTTTT	0.418																																						dbGAP											0													146.0	124.0	132.0					7																	24844008		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.2493G>C	7.37:g.24844008C>G	ENSP00000315410:p.Arg831Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R831S	ENST00000313367.2	37	c.2493	CCDS5390.1	7	.	.	.	.	.	.	.	.	.	.	C	18.95	3.732163	0.69189	.	.	ENSG00000070882	ENST00000313367;ENST00000352860;ENST00000353930;ENST00000431825;ENST00000396431;ENST00000396429;ENST00000409069	T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37	5.73	3.91	0.45181	.	0.043726	0.85682	D	0.000000	T	0.57080	0.2029	M	0.85099	2.735	0.80722	D	1	P;P;P;D	0.53885	0.64;0.768;0.768;0.963	P;P;P;P	0.61003	0.583;0.583;0.583;0.882	T	0.62464	-0.6849	10	0.87932	D	0	-25.2911	9.0019	0.36088	0.0:0.7192:0.0:0.2808	.	764;800;795;831	Q9H4L5-4;Q9H4L5-2;Q9H4L5-3;Q9H4L5	.;.;.;OSBL3_HUMAN	S	831;800;795;764;800;795;764	ENSP00000315410:R831S;ENSP00000315331:R800S;ENSP00000315277:R795S;ENSP00000389779:R764S;ENSP00000379708:R800S;ENSP00000379706:R795S;ENSP00000386953:R764S	ENSP00000315410:R831S	R	-	3	2	OSBPL3	24810533	0.997000	0.39634	1.000000	0.80357	0.705000	0.40729	0.499000	0.22546	1.414000	0.47017	0.655000	0.94253	AGG	OSBPL3	-	pfam_Oxysterol-bd	ENSG00000070882		0.418	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	HGNC	protein_coding	OTTHUMT00000214085.2	56	0.00	0	C			24844008	24844008	-1	no_errors	ENST00000313367	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	1.000	G
OTOG	340990	genome.wustl.edu	37	11	17663742	17663742	+	Silent	SNP	G	G	C	rs2023483	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:17663742G>C	ENST00000399391.2	+	52	8400	c.8400G>C	c.(8398-8400)ctG>ctC	p.L2800L	OTOG_ENST00000399397.1_Silent_p.L2727L	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	2800					adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						GTGCCGTGCTGGTCCGCTCTC	0.642													C|||	1834	0.366214	0.5424	0.2017	5008	,	,		21033	0.1835		0.3091	False		,,,				2504	0.4918					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.8400G>C	11.37:g.17663742G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.L2800	ENST00000399391.2	37	c.8400	CCDS59225.1	11																																																																																			OTOG	-	NULL	ENSG00000188162		0.642	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		52	0.00	0	G			17663742	17663742	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	silent	33	15.38	6	SNP	0.554	C
OTX2	5015	genome.wustl.edu	37	14	57268525	57268525	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:57268525C>A	ENST00000555006.1	-	4	1206	c.798G>T	c.(796-798)tgG>tgT	p.W266C	RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000339475.5_Missense_Mutation_p.W274C|OTX2_ENST00000408990.3_Missense_Mutation_p.W266C			P32243	OTX2_HUMAN	orthodenticle homeobox 2	266					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					AGTTAAGCTTCCAGGAGGCAG	0.448																																						dbGAP											0													84.0	88.0	86.0					14																	57268525		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.798G>T	14.37:g.57268525C>A	ENSP00000452336:p.Trp266Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	pfam_Otx_TF_C,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Otx2_TF,prints_Otx_TF,pfscan_Homeodomain	p.W274C	ENST00000555006.1	37	c.822	CCDS41960.1	14	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042094	0.55003	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006	D;D;D	0.93366	-3.21;-3.2;-3.2	5.25	5.25	0.73442	.	0.000000	0.41500	D	0.000870	D	0.97228	0.9094	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.979	D	0.97657	1.0158	10	0.72032	D	0.01	.	18.0319	0.89288	0.0:1.0:0.0:0.0	.	274;266	F1T0D1;P32243	.;OTX2_HUMAN	C	274;266;266	ENSP00000343819:W274C;ENSP00000386185:W266C;ENSP00000452336:W266C	ENSP00000343819:W274C	W	-	3	0	OTX2	56338278	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.640000	0.83355	2.730000	0.93505	0.655000	0.94253	TGG	OTX2	-	NULL	ENSG00000165588		0.448	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OTX2	HGNC	protein_coding	OTTHUMT00000411522.1	58	0.00	0	C	NM_021728.		57268525	57268525	-1	no_errors	ENST00000339475	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	A
OTX2	5015	genome.wustl.edu	37	14	57268551	57268551	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:57268551C>T	ENST00000555006.1	-	4	1180	c.772G>A	c.(772-774)Gat>Aat	p.D258N	RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000339475.5_Missense_Mutation_p.D266N|OTX2_ENST00000408990.3_Missense_Mutation_p.D258N|OTX2_ENST00000554788.1_3'UTR			P32243	OTX2_HUMAN	orthodenticle homeobox 2	258					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					TCCTTATAATCCAAGCAATCA	0.453																																						dbGAP											0													100.0	102.0	102.0					14																	57268551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.772G>A	14.37:g.57268551C>T	ENSP00000452336:p.Asp258Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	pfam_Otx_TF_C,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Otx2_TF,prints_Otx_TF,pfscan_Homeodomain	p.D266N	ENST00000555006.1	37	c.796	CCDS41960.1	14	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890693	0.72524	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006	D;D;D	0.93488	-3.23;-3.23;-3.23	5.46	5.46	0.80206	.	0.000000	0.45867	D	0.000340	D	0.96923	0.8995	M	0.87547	2.89	0.54753	D	0.999989	D;D	0.71674	0.998;0.994	P;D	0.64776	0.907;0.929	D	0.97139	0.9823	10	0.72032	D	0.01	.	18.4893	0.90841	0.0:1.0:0.0:0.0	.	266;258	F1T0D1;P32243	.;OTX2_HUMAN	N	266;258;258	ENSP00000343819:D266N;ENSP00000386185:D258N;ENSP00000452336:D258N	ENSP00000343819:D266N	D	-	1	0	OTX2	56338304	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.640000	0.83355	2.840000	0.97914	0.655000	0.94253	GAT	OTX2	-	prints_Otx_TF	ENSG00000165588		0.453	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OTX2	HGNC	protein_coding	OTTHUMT00000411522.1	57	0.00	0	C	NM_021728.		57268551	57268551	-1	no_errors	ENST00000339475	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	T
PHF1	5252	genome.wustl.edu	37	6	33381882	33381882	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:33381882C>T	ENST00000374516.3	+	8	1019	c.748C>T	c.(748-750)Cgc>Tgc	p.R250C	PHF1_ENST00000374512.3_Missense_Mutation_p.R250C	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	250					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				ACTACAGCTTCGCTGGTGAGC	0.532											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													114.0	111.0	112.0					6																	33381882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.748C>T	6.37:g.33381882C>T	ENSP00000363640:p.Arg250Cys	Somatic	839	WXS	Illumina GAIIx	Phase_IV	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R250C	ENST00000374516.3	37	c.748	CCDS4777.1	6	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236907	0.58886	.	.	ENSG00000112511	ENST00000374512;ENST00000374516	T;T	0.21734	1.99;1.99	5.44	5.44	0.79542	Zinc finger, FYVE/PHD-type (1);	0.203393	0.46758	D	0.000269	T	0.15739	0.0379	L	0.27053	0.805	0.42341	D	0.992335	P;D	0.76494	0.939;0.999	B;P	0.53401	0.247;0.725	T	0.00785	-1.1567	10	0.87932	D	0	-4.6183	12.3397	0.55087	0.0:0.8306:0.1694:0.0	.	250;250	O43189-2;O43189	.;PHF1_HUMAN	C	250	ENSP00000363636:R250C;ENSP00000363640:R250C	ENSP00000363636:R250C	R	+	1	0	PHF1	33489860	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.495000	0.35627	2.837000	0.97791	0.655000	0.94253	CGC	PHF1	-	superfamily_Znf_FYVE_PHD	ENSG00000112511		0.532	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF1	HGNC	protein_coding	OTTHUMT00000076175.3	54	0.00	0	C			33381882	33381882	+1	no_errors	ENST00000374516	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178917478	178917478	+	Splice_Site	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:178917478G>A	ENST00000263967.3	+	3	510	c.353G>A	c.(352-354)gGt>gAt	p.G118D		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	118			G -> D (in CWS5). {ECO:0000269|PubMed:23246288}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.G118D(26)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTTATTAAAGGTTTTGCTATC	0.338		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	26	Substitution - Missense(26)	endometrium(11)|breast(4)|large_intestine(3)|central_nervous_system(3)|lung(3)|prostate(2)											93.0	87.0	89.0					3																	178917478		1809	4071	5880	-	-	-	SO:0001630	splice_region_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.353-1G>A	3.37:g.178917478G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G118D	ENST00000263967.3	37	c.353	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954561	0.53293	.	.	ENSG00000121879	ENST00000263967	T	0.46451	0.87	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.58722	0.2142	M	0.63843	1.955	0.80722	D	1	D	0.61080	0.989	P	0.56398	0.797	T	0.53823	-0.8384	9	.	.	.	.	20.1236	0.97970	0.0:0.0:1.0:0.0	.	118	P42336	PK3CA_HUMAN	D	118	ENSP00000263967:G118D	.	G	+	2	0	PIK3CA	180400172	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	9.471000	0.97696	2.746000	0.94184	0.563000	0.77884	GGT	PIK3CA	-	NULL	ENSG00000121879		0.338	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	50	0.00	0	G		Missense_Mutation	178917478	178917478	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	A
PKD1	5310	genome.wustl.edu	37	16	2147213	2147213	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:2147213C>T	ENST00000262304.4	-	34	10643	c.10435G>A	c.(10435-10437)Gag>Aag	p.E3479K	PKD1_ENST00000423118.1_Missense_Mutation_p.E3478K|RP11-304L19.1_ENST00000570072.1_RNA|RP11-304L19.3_ENST00000565937.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3479					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGACCCCCTCGGCAAGGACC	0.637																																						dbGAP											0													37.0	31.0	33.0					16																	2147213		2178	4281	6459	-	-	-	SO:0001583	missense	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.10435G>A	16.37:g.2147213C>T	ENSP00000262304:p.Glu3479Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_LipOase_LH2,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like,pfscan_WSC_carb-bd,prints_PKD_1,tigrfam_Polycystin_cat	p.E3479K	ENST00000262304.4	37	c.10435	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	C	7.799	0.713308	0.15306	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.34667	1.35;1.35	4.7	3.74	0.42951	.	0.397927	0.24762	N	0.035820	T	0.32793	0.0841	L	0.60455	1.87	0.09310	N	1	D;P	0.53312	0.959;0.943	B;B	0.43536	0.423;0.163	T	0.14755	-1.0461	10	0.23302	T	0.38	.	8.5573	0.33489	0.0:0.7122:0.1303:0.1575	.	3478;3479	P98161-3;P98161	.;PKD1_HUMAN	K	3479;3478;2813	ENSP00000262304:E3479K;ENSP00000399501:E3478K	ENSP00000262304:E3479K	E	-	1	0	PKD1	2087214	0.107000	0.21998	0.323000	0.25347	0.009000	0.06853	2.415000	0.44635	0.439000	0.26476	-1.203000	0.01651	GAG	PKD1	-	NULL	ENSG00000008710		0.637	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	80	0.00	0	C			2147213	2147213	-1	no_errors	ENST00000262304	ensembl	human	known	69_37n	missense	51	21.54	14	SNP	0.019	T
PLEKHA8	84725	genome.wustl.edu	37	7	30118402	30118402	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:30118402G>A	ENST00000449726.1	+	14	1909	c.1559G>A	c.(1558-1560)tGa>tAa	p.*520*	PLEKHA8_ENST00000396257.2_Intron|PLEKHA8_ENST00000396259.1_Intron|PLEKHA8_ENST00000258679.7_Intron	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	0					ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						GAGGTGGTATGATGGCTGCTG	0.522																																						dbGAP											0													61.0	58.0	59.0					7																	30118402		876	1991	2867	-	-	-	SO:0001819	synonymous_variant	0			BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.1559G>A	7.37:g.30118402G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Silent	SNP	pfam_Glycolipid_transfer_prot_dom,pfam_Pleckstrin_homology,superfamily_Glycolipid_transfer_prot_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.*520	ENST00000449726.1	37	c.1559	CCDS56473.1	7																																																																																			PLEKHA8	-	NULL	ENSG00000106086		0.522	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA8	HGNC	protein_coding		63	0.00	0	G	NM_032639		30118402	30118402	+1	no_errors	ENST00000449726	ensembl	human	known	69_37n	silent	50	21.88	14	SNP	1.000	A
PLXNB2	23654	genome.wustl.edu	37	22	50728318	50728318	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:50728318G>A	ENST00000449103.1	-	3	836	c.696C>T	c.(694-696)ttC>ttT	p.F232F	PLXNB2_ENST00000359337.4_Silent_p.F232F			O15031	PLXB2_HUMAN	plexin B2	232	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCTGCTGGTTGAAGACAAAGA	0.612																																						dbGAP											0													52.0	58.0	56.0					22																	50728318		2076	4221	6297	-	-	-	SO:0001819	synonymous_variant	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.696C>T	22.37:g.50728318G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.F232	ENST00000449103.1	37	c.696	CCDS43035.1	22																																																																																			PLXNB2	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000196576		0.612	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	55	0.00	0	G	NM_012401		50728318	50728318	-1	no_errors	ENST00000359337	ensembl	human	known	69_37n	silent	38	23.53	12	SNP	0.998	A
PNCK	139728	genome.wustl.edu	37	X	152939728	152939728	+	5'Flank	SNP	C	C	T	rs5987128	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:152939728C>T	ENST00000370150.1	-	0	0				PNCK_ENST00000370145.4_5'Flank|PNCK_ENST00000393831.2_De_novo_Start_OutOfFrame|PNCK_ENST00000340888.3_5'Flank|PNCK_ENST00000370142.1_Splice_Site|PNCK_ENST00000475172.1_5'Flank|PNCK_ENST00000447676.2_De_novo_Start_OutOfFrame			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					taatccctcaccctcgctttc	0.562													C|||	400	0.10596	0.0598	0.0591	3775	,	,		10146	0.0685		0.0915	False		,,,				2504	0.1217					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216		X.37:g.152939728C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Splice_Site	SNP	-	e0+1	ENST00000370150.1	37	c.1+1		X																																																																																			PNCK	-	-	ENSG00000130822		0.562	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	PNCK	HGNC	protein_coding	OTTHUMT00000061044.2	46	0.00	0	C	NM_198452		152939728	152939728	-1	no_errors	ENST00000370142	ensembl	human	known	69_37n	splice_site	25	13.79	4	SNP	0.034	T
PNISR	25957	genome.wustl.edu	37	6	99853927	99853927	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:99853927C>A	ENST00000369239.5	-	8	1186	c.982G>T	c.(982-984)Gag>Tag	p.E328*	PNISR_ENST00000438806.1_Nonsense_Mutation_p.E328*	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	328						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TCTTTCTCCTCTTCAGTCATC	0.383																																						dbGAP											0													206.0	183.0	191.0					6																	99853927		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.982G>T	6.37:g.99853927C>A	ENSP00000358242:p.Glu328*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Nonsense_Mutation	SNP	NULL	p.E328*	ENST00000369239.5	37	c.982	CCDS5043.1	6	.	.	.	.	.	.	.	.	.	.	C	40	8.288547	0.98745	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.68	5.68	0.88126	.	0.044712	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.1467	0.98079	0.0:1.0:0.0:0.0	.	.	.	.	X	328	.	ENSP00000358242:E328X	E	-	1	0	PNISR	99960648	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	6.344000	0.72991	2.838000	0.97847	0.655000	0.94253	GAG	PNISR	-	NULL	ENSG00000132424		0.383	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1	54	0.00	0	C	NM_032870		99853927	99853927	-1	no_errors	ENST00000369239	ensembl	human	known	69_37n	nonsense	44	10.20	5	SNP	1.000	A
PNLIP	5406	genome.wustl.edu	37	10	118310640	118310640	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:118310640A>G	ENST00000369221.2	+	5	383	c.355A>G	c.(355-357)Atc>Gtc	p.I119V	PNLIP_ENST00000470562.1_3'UTR	NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	119					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	TGTGAACTGTATCTGTGTGGA	0.418																																						dbGAP											0													97.0	86.0	89.0					10																	118310640		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.355A>G	10.37:g.118310640A>G	ENSP00000358223:p.Ile119Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSQ2	Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase,prints_Lipase_panc	p.I119V	ENST00000369221.2	37	c.355	CCDS7594.1	10	.	.	.	.	.	.	.	.	.	.	A	8.963	0.970992	0.18659	.	.	ENSG00000175535	ENST00000369221	D	0.90788	-2.73	5.25	0.0781	0.14411	Lipase, N-terminal (1);	0.398719	0.25302	N	0.031644	D	0.86326	0.5906	M	0.72118	2.19	0.32643	N	0.520485	B	0.32939	0.391	B	0.37304	0.246	T	0.78252	-0.2276	10	0.28530	T	0.3	.	2.266	0.04078	0.4263:0.1288:0.0717:0.3732	.	119	P16233	LIPP_HUMAN	V	119	ENSP00000358223:I119V	ENSP00000358223:I119V	I	+	1	0	PNLIP	118300630	0.389000	0.25205	0.742000	0.31022	0.628000	0.37860	0.673000	0.25203	-0.073000	0.12842	-1.139000	0.01908	ATC	PNLIP	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	ENSG00000175535		0.418	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIP	HGNC	protein_coding	OTTHUMT00000050524.1	61	0.00	0	A	NM_000936		118310640	118310640	+1	no_errors	ENST00000369221	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	0.512	G
PODNL1	79883	genome.wustl.edu	37	19	14044771	14044771	+	Silent	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:14044771C>G	ENST00000339560.5	-	7	981	c.708G>C	c.(706-708)ctG>ctC	p.L236L	PODNL1_ENST00000538371.2_Silent_p.L234L|PODNL1_ENST00000254320.3_Silent_p.L154L|PODNL1_ENST00000538517.2_Silent_p.L145L	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	236	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			TCTGGCGGCTCAGGGCTCCTC	0.597																																						dbGAP											0													44.0	43.0	44.0					19																	14044771		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.708G>C	19.37:g.14044771C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z564|Q9H5G9	Nonstop_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.*73S	ENST00000339560.5	37	c.218	CCDS12300.1	19																																																																																			PODNL1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000132000		0.597	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	PODNL1	HGNC	protein_coding	OTTHUMT00000457967.1	47	0.00	0	C	NM_024825		14044771	14044771	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000588764	ensembl	human	putative	69_37n	nonstop	43	18.87	10	SNP	1.000	G
POLDIP2	26073	genome.wustl.edu	37	17	26677509	26677509	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:26677509G>A	ENST00000540200.1	-	10	863	c.864C>T	c.(862-864)ctC>ctT	p.L288L	POLDIP2_ENST00000003607.4_5'UTR	NM_015584.3	NP_056399.1	Q9Y2S7	PDIP2_HUMAN	polymerase (DNA-directed), delta interacting protein 2	289	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				mitochondrion morphogenesis (GO:0070584)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)					all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		AGGTGCCAGAGAGACTGAATA	0.582																																						dbGAP											0													64.0	66.0	66.0					17																	26677509		2016	4181	6197	-	-	-	SO:0001819	synonymous_variant	0			AF077203	CCDS74018.1	17q11.2	2008-02-05			ENSG00000004142	ENSG00000004142			23781	protein-coding gene	gene with protein product		611519				12522211	Standard	NM_015584		Approved	PDIP38, DKFZP586F1524	uc002haz.3	Q9Y2S7	OTTHUMG00000132065	ENST00000540200.1:c.864C>T	17.37:g.26677509G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R846|Q96JE4	RNA	SNP	-	NULL	ENST00000540200.1	37	NULL		17																																																																																			POLDIP2	-	-	ENSG00000004142		0.582	POLDIP2-201	KNOWN	basic|appris_principal	protein_coding	POLDIP2	HGNC	protein_coding		44	0.00	0	G	NM_015584		26677509	26677509	-1	no_errors	ENST00000003607	ensembl	human	known	69_37n	rna	18	25.00	6	SNP	0.799	A
POU4F1	5457	genome.wustl.edu	37	13	79176484	79176486	+	In_Frame_Del	DEL	TGG	TGG	-	rs371388366		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr13:79176484_79176486delTGG	ENST00000377208.5	-	2	535_537	c.324_326delCCA	c.(322-327)caccag>cag	p.H108del	RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000606124.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000560584.2_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	108	Poly-His.				axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)	p.H108delH(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TTCGAGCGCCtggtggtggtggt	0.729																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)	dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.324_326delCCA	13.37:g.79176493_79176495delTGG	ENSP00000366413:p.His108del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14986|Q15318|Q5T227	In_Frame_Del	DEL	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.H108in_frame_del	ENST00000377208.5	37	c.326_324	CCDS31996.1	13																																																																																			POU4F1	-	NULL	ENSG00000152192		0.729	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F1	HGNC	protein_coding	OTTHUMT00000045360.3	10	0.00	0	TGG			79176484	79176486	-1	no_errors	ENST00000377208	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	1.000:1.000:1.000	-
PPM1N	147699	genome.wustl.edu	37	19	46002814	46002814	+	Intron	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:46002814G>T	ENST00000451287.2	+	1	939				PPM1N_ENST00000396735.2_5'Flank|PPM1N_ENST00000396736.2_5'Flank|RTN2_ENST00000245923.4_5'Flank|PPM1N_ENST00000401593.1_5'Flank|PPM1N_ENST00000324688.4_Nonsense_Mutation_p.E284*|RTN2_ENST00000590526.1_5'Flank|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000344680.4_5'Flank|RTN2_ENST00000589384.1_5'Flank|PPM1N_ENST00000456399.2_Intron|PPM1N_ENST00000396737.2_Intron	NM_001080401.1	NP_001073870.1	Q8N819	PPM1N_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)								magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)	9						GGCGTGGCCTGAAGTGGGCAG	0.567																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK097444	CCDS46115.1	19q13.32	2012-04-17			ENSG00000213889	ENSG00000213889		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26845	protein-coding gene	gene with protein product							Standard	NM_001080401		Approved	FLJ40125	uc002pce.3	Q8N819	OTTHUMG00000140397	ENST00000451287.2:c.939+145G>T	19.37:g.46002814G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P662	Nonsense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.E284*	ENST00000451287.2	37	c.850	CCDS46115.1	19	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399363	0.62177	.	.	ENSG00000213889	ENST00000324688	.	.	.	2.44	2.44	0.29823	.	1.023320	0.07893	U	0.971436	.	.	.	.	.	.	0.58432	A	0.999997	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.5187	0.33262	0.0:0.0:1.0:0.0	.	.	.	.	X	284	.	ENSP00000321761:E284X	E	+	1	0	PPM1N	50694654	0.000000	0.05858	0.010000	0.14722	0.014000	0.08584	-0.097000	0.11042	1.714000	0.51371	0.467000	0.42956	GAA	PPM1N	-	NULL	ENSG00000213889		0.567	PPM1N-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PPM1N	HGNC	protein_coding	OTTHUMT00000326517.2	58	0.00	0	G	NM_001080401		46002814	46002814	+1	no_errors	ENST00000324688	ensembl	human	known	69_37n	nonsense	57	13.64	9	SNP	0.009	T
PRRC2C	23215	genome.wustl.edu	37	1	171506485	171506485	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:171506485C>T	ENST00000338920.4	+	15	2608	c.2371C>T	c.(2371-2373)Cga>Tga	p.R791*	PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.R793*|PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.R791*|PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.R793*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	791					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GCATATAGCTCGATCTGCAAG	0.463																																						dbGAP											0													69.0	59.0	62.0					1																	171506485		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.2371C>T	1.37:g.171506485C>T	ENSP00000343629:p.Arg791*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	pfam_BAT2_N	p.R793*	ENST00000338920.4	37	c.2377	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	C	42	9.586797	0.99213	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	.	.	.	5.3	3.37	0.38596	.	0.000000	0.39341	N	0.001381	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	14.4833	0.67597	0.2667:0.7333:0.0:0.0	.	.	.	.	X	793;792;791;793;791;548;550	.	ENSP00000343629:R791X	R	+	1	2	PRRC2C	169773109	1.000000	0.71417	0.978000	0.43139	0.951000	0.60555	2.341000	0.43983	0.581000	0.29539	0.650000	0.86243	CGA	PRRC2C	-	NULL	ENSG00000117523		0.463	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	31	0.00	0	C	NM_015172		171506485	171506485	+1	no_errors	ENST00000392078	ensembl	human	known	69_37n	nonsense	26	18.18	6	SNP	1.000	T
PTCHD4	442213	genome.wustl.edu	37	6	47846120	47846120	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:47846120C>G	ENST00000339488.4	-	3	2493	c.2460G>C	c.(2458-2460)aaG>aaC	p.K820N		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	820						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TGGCACGTTTCTTTTTCTTGT	0.458																																						dbGAP											0													131.0	132.0	132.0					6																	47846120		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2460G>C	6.37:g.47846120C>G	ENSP00000341914:p.Lys820Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.K820N	ENST00000339488.4	37	c.2460	CCDS34473.2	6	.	.	.	.	.	.	.	.	.	.	C	16.94	3.259967	0.59321	.	.	ENSG00000244694	ENST00000339488	D	0.92805	-3.11	6.16	6.16	0.99307	.	0.054135	0.64402	D	0.000001	D	0.90865	0.7130	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.90385	0.4391	10	0.39692	T	0.17	.	13.9788	0.64291	0.0:0.9314:0.0:0.0686	.	820	Q6ZW05	CF138_HUMAN	N	820	ENSP00000341914:K820N	ENSP00000341914:K820N	K	-	3	2	C6orf138	47954079	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.763000	0.68818	2.937000	0.99478	0.650000	0.86243	AAG	PTCHD4	-	NULL	ENSG00000244694		0.458	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	67	0.00	0	C	NM_001013732		47846120	47846120	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	1.000	G
PTPRT	11122	genome.wustl.edu	37	20	41408885	41408885	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr20:41408885C>T	ENST00000373187.1	-	4	540	c.541G>A	c.(541-543)Gag>Aag	p.E181K	PTPRT_ENST00000373198.4_Missense_Mutation_p.E181K|PTPRT_ENST00000356100.2_Missense_Mutation_p.E181K|PTPRT_ENST00000373201.1_Missense_Mutation_p.E181K|PTPRT_ENST00000373193.3_Missense_Mutation_p.E181K|PTPRT_ENST00000373184.1_Missense_Mutation_p.E181K|PTPRT_ENST00000373190.1_Missense_Mutation_p.E181K			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	181	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				ACCCGGACCTCGTCCACGGCG	0.527																																						dbGAP											0													132.0	132.0	132.0					20																	41408885		2072	4216	6288	-	-	-	SO:0001583	missense	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.541G>A	20.37:g.41408885C>T	ENSP00000362283:p.Glu181Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.E181K	ENST00000373187.1	37	c.541	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	C	24.0	4.481934	0.84747	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02177	4.41;4.41;4.41;4.41;4.41;4.41;4.41	5.75	5.75	0.90469	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.199094	0.45606	D	0.000345	T	0.06690	0.0171	L	0.56769	1.78	0.80722	D	1	D;D	0.54601	0.959;0.967	B;P	0.48063	0.429;0.565	T	0.04400	-1.0954	10	0.72032	D	0.01	.	19.9564	0.97221	0.0:1.0:0.0:0.0	.	181;181	O14522-1;O14522	.;PTPRT_HUMAN	K	181	ENSP00000362286:E181K;ENSP00000362283:E181K;ENSP00000362289:E181K;ENSP00000348408:E181K;ENSP00000362294:E181K;ENSP00000362280:E181K;ENSP00000362297:E181K	ENSP00000348408:E181K	E	-	1	0	PTPRT	40842299	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.202000	0.77856	2.708000	0.92522	0.650000	0.86243	GAG	PTPRT	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom	ENSG00000196090		0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	60	0.00	0	C			41408885	41408885	-1	no_errors	ENST00000373198	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
QRICH2	84074	genome.wustl.edu	37	17	74287555	74287555	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:74287555C>T	ENST00000262765.5	-	4	2934	c.2755G>A	c.(2755-2757)Gag>Aag	p.E919K		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	919										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TGGTCATGCTCACCTGGGCCA	0.522																																						dbGAP											0													111.0	87.0	95.0					17																	74287555		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.2755G>A	17.37:g.74287555C>T	ENSP00000262765:p.Glu919Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE1|Q96LM3	Missense_Mutation	SNP	NULL	p.E919K	ENST00000262765.5	37	c.2755	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	C	4.857	0.159378	0.09236	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.09723	2.95	3.24	-6.48	0.01896	.	.	.	.	.	T	0.04907	0.0132	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.44892	-0.9298	9	0.52906	T	0.07	0.1186	9.9568	0.41671	0.0:0.6577:0.1975:0.1449	.	919;919	B5MD94;Q9H0J4	.;QRIC2_HUMAN	K	919	ENSP00000262765:E919K	ENSP00000262765:E919K	E	-	1	0	QRICH2	71799150	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.264000	0.02847	-0.738000	0.04817	-3.035000	0.00072	GAG	QRICH2	-	NULL	ENSG00000129646		0.522	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	65	0.00	0	C	NM_032134		74287555	74287555	-1	no_errors	ENST00000262765	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	0.000	T
RAB11FIP5	26056	genome.wustl.edu	37	2	73300560	73300560	+	3'UTR	SNP	C	C	G	rs1046151	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:73300560C>G	ENST00000258098.6	-	0	4291				SFXN5_ENST00000272433.2_5'Flank|SFXN5_ENST00000410065.1_5'Flank|RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)						cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						ACATGAAGAACAAGCTCTTTA	0.443													C|||	886	0.176917	0.0212	0.1571	5008	,	,		22274	0.2123		0.2455	False		,,,				2504	0.2945					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.*2089G>C	2.37:g.73300560C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O94939|Q9P0M1	RNA	SNP	-	NULL	ENST00000258098.6	37	NULL	CCDS1923.1	2																																																																																			RAB11FIP5	-	-	ENSG00000135631		0.443	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	HGNC	protein_coding	OTTHUMT00000251995.1	18	0.00	0	C	NM_015470		73300560	73300560	-1	no_errors	ENST00000493523	ensembl	human	known	69_37n	rna	26	16.13	5	SNP	1.000	G
RBM18	92400	genome.wustl.edu	37	9	125003960	125003960	+	3'UTR	SNP	C	C	T	rs142813776	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr9:125003960C>T	ENST00000417201.3	-	0	916				RBM18_ENST00000483428.1_5'Flank	NM_033117.3	NP_149108.1	Q96H35	RBM18_HUMAN	RNA binding motif protein 18								nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7						GGATACAACGCTATTTATTCT	0.368													C|||	6	0.00119808	0.0	0.0	5008	,	,		18650	0.0		0.005	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK057676	CCDS6839.1	9q34.11	2013-02-12			ENSG00000119446	ENSG00000119446		"""RNA binding motif (RRM) containing"""	28413	protein-coding gene	gene with protein product						12477932	Standard	NM_033117		Approved	MGC2734	uc004bma.2	Q96H35	OTTHUMG00000020602	ENST00000417201.3:c.*203G>A	9.37:g.125003960C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ89	RNA	SNP	-	NULL	ENST00000417201.3	37	NULL	CCDS6839.1	9																																																																																			RBM18	-	-	ENSG00000119446		0.368	RBM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM18	HGNC	protein_coding	OTTHUMT00000053928.2	15	0.00	0	C	NM_033117		125003960	125003960	-1	no_errors	ENST00000491850	ensembl	human	known	69_37n	rna	23	17.86	5	SNP	0.997	T
RBM39	9584	genome.wustl.edu	37	20	34327232	34327232	+	Intron	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr20:34327232G>A	ENST00000253363.6	-	3	75				RBM39_ENST00000463098.1_5'UTR|RBM39_ENST00000528062.3_Intron|RBM39_ENST00000407261.4_Intron|RBM39_ENST00000397370.3_Intron|RBM39_ENST00000361162.6_Intron			Q14498	RBM39_HUMAN	RNA binding motif protein 39						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TTACAATGTTGAAGTGGTTAA	0.279																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.52-293C>T	20.37:g.34327232G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	RNA	SNP	-	NULL	ENST00000253363.6	37	NULL	CCDS13266.1	20																																																																																			RBM39	-	-	ENSG00000131051		0.279	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	HGNC	protein_coding	OTTHUMT00000078931.2	39	0.00	0	G	NM_184237		34327232	34327232	-1	no_errors	ENST00000463098	ensembl	human	known	69_37n	rna	44	15.09	8	SNP	0.945	A
REEP5	7905	genome.wustl.edu	37	5	112222805	112222805	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:112222805G>C	ENST00000379638.4	-	4	775	c.427C>G	c.(427-429)Cct>Gct	p.P143A	REEP5_ENST00000504247.1_Silent_p.V96V|REEP5_ENST00000513339.1_Intron|REEP5_ENST00000474542.2_5'UTR|CTC-487M23.8_ENST00000512790.1_Intron|CTC-487M23.8_ENST00000506997.1_Intron|REEP5_ENST00000545426.1_3'UTR	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	143						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		AGGAAGAAAGGACGGATGATG	0.522																																						dbGAP											0													169.0	140.0	150.0					5																	112222805		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.427C>G	5.37:g.112222805G>C	ENSP00000368959:p.Pro143Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Missense_Mutation	SNP	pfam_TB2_DP1_HVA22	p.P143A	ENST00000379638.4	37	c.427	CCDS4109.2	5	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931163	0.92389	.	.	ENSG00000129625	ENST00000379638;ENST00000261482	D;D	0.94613	-3.47;-3.47	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.98482	0.9494	H	0.97732	4.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.99395	1.0926	10	0.87932	D	0	-34.5777	19.6375	0.95740	0.0:0.0:1.0:0.0	.	116;143	B7Z2A3;Q00765	.;REEP5_HUMAN	A	143;134	ENSP00000368959:P143A;ENSP00000261482:P134A	ENSP00000261482:P134A	P	-	1	0	REEP5	112250704	1.000000	0.71417	0.197000	0.23402	0.993000	0.82548	9.860000	0.99555	2.640000	0.89533	0.655000	0.94253	CCT	REEP5	-	pfam_TB2_DP1_HVA22	ENSG00000129625		0.522	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REEP5	HGNC	protein_coding	OTTHUMT00000250739.2	75	0.00	0	G	NM_005669		112222805	112222805	-1	no_errors	ENST00000379638	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	1.000	C
RGL4	266747	genome.wustl.edu	37	22	24040042	24040042	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:24040042G>A	ENST00000290691.5	+	9	2424	c.1254G>A	c.(1252-1254)agG>agA	p.R418R	RGL4_ENST00000401461.1_Silent_p.R282R|KB-1572G7.2_ENST00000421064.1_RNA	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	418	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						CCAACAAGAGGAGCAAGGTGA	0.617																																						dbGAP											0													71.0	54.0	60.0					22																	24040042		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.1254G>A	22.37:g.24040042G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q495L8	Missense_Mutation	SNP	superfamily_Ras_GEF_dom	p.E100K	ENST00000290691.5	37	c.298	CCDS13811.1	22	.	.	.	.	.	.	.	.	.	.	g	3.328	-0.137387	0.06711	.	.	ENSG00000159496	ENST00000452208	.	.	.	1.75	-1.01	0.10169	.	.	.	.	.	T	0.23210	0.0561	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27971	-1.0058	4	.	.	.	.	4.4575	0.11650	0.1645:0.2304:0.6051:0.0	.	.	.	.	K	100	.	.	E	+	1	0	RGL4	22370042	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.009000	0.12765	-0.159000	0.11021	0.436000	0.28706	GAG	RGL4	-	superfamily_Ras_GEF_dom	ENSG00000159496		0.617	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGL4	HGNC	protein_coding	OTTHUMT00000319711.1	20	0.00	0	G	NM_153615		24040042	24040042	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000452208	ensembl	human	novel	69_37n	missense	12	20.00	3	SNP	0.000	A
RIC8A	60626	genome.wustl.edu	37	11	213368	213368	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:213368G>T	ENST00000526104.1	+	9	2769	c.1425G>T	c.(1423-1425)caG>caT	p.Q475H	RIC8A_ENST00000325207.5_Missense_Mutation_p.Q481H|RIC8A_ENST00000527696.1_Missense_Mutation_p.Q469H			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	475					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CAGAGGAGCAGAAGGAGCACG	0.587																																						dbGAP											0													124.0	94.0	104.0					11																	213368		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.1425G>T	11.37:g.213368G>T	ENSP00000432008:p.Gln475His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Nonsense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,prints_Synembryn	p.E83*	ENST00000526104.1	37	c.247		11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	22.0|22.0|22.0	4.236601|4.236601|4.236601	0.79800|0.79800|0.79800	.|.|.	.|.|.	ENSG00000177963|ENSG00000177963|ENSG00000177963	ENST00000524854|ENST00000526104;ENST00000325207;ENST00000527696|ENST00000529275	.|.|.	.|.|.	.|.|.	4.89|4.89|4.89	3.98|3.98|3.98	0.46160|0.46160|0.46160	.|Synembryn (1);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	.|T|T	.|0.78868|0.78868	.|0.4351|0.4351	M|M|M	0.88377|0.88377|0.88377	2.95|2.95|2.95	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D|.	.|0.89917|.	.|0.999;1.0;1.0|.	.|D;D;D|.	.|0.91635|.	.|0.986;0.999;0.999|.	.|T|T	.|0.82416|0.82416	.|-0.0468|-0.0468	.|9|5	.|0.87932|.	.|D|.	.|0|.	-39.4589|-39.4589|-39.4589	13.3209|13.3209|13.3209	0.60432|0.60432|0.60432	0.078:0.0:0.922:0.0|0.078:0.0:0.922:0.0|0.078:0.0:0.922:0.0	.|.|.	.|469;475;481|.	.|Q9NPQ8-2;Q9NPQ8;Q9NPQ8-3|.	.|.;RIC8A_HUMAN;.|.	X|H|I	83|475;481;469|61	.|.|.	.|ENSP00000325941:Q481H|.	E|Q|R	+|+|+	1|3|2	0|2|0	RIC8A|RIC8A|RIC8A	203368|203368|203368	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.971000|0.971000|0.971000	0.66376|0.66376|0.66376	2.339000|2.339000|2.339000	0.43965|0.43965|0.43965	1.396000|1.396000|1.396000	0.46663|0.46663|0.46663	-0.224000|-0.224000|-0.224000	0.12420|0.12420|0.12420	GAA|CAG|AGA	RIC8A	-	pfam_Gua_nucleotide_exch_fac_Ric8,prints_Synembryn	ENSG00000177963		0.587	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	57	0.00	0	G	NM_021932		213368	213368	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524854	ensembl	human	novel	69_37n	nonsense	36	16.28	7	SNP	1.000	T
RNF115	27246	genome.wustl.edu	37	1	145688197	145688197	+	Missense_Mutation	SNP	C	C	G	rs145517263		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:145688197C>G	ENST00000369291.5	+	9	1096	c.892C>G	c.(892-894)Cta>Gta	p.L298V		NM_014455.2	NP_055270.1			ring finger protein 115											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13						TGACAGTCAGCTACATGACCG	0.428																																						dbGAP											0													112.0	95.0	101.0					1																	145688197		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF419857	CCDS72863.1	1q12	2013-01-09	2008-06-16	2008-06-16	ENSG00000121848	ENSG00000265491		"""RING-type (C3HC4) zinc fingers"""	18154	protein-coding gene	gene with protein product			"""zinc finger protein 364"""	ZNF364			Standard	NM_014455		Approved	CL469780	uc001eoj.3	Q9Y4L5	OTTHUMG00000013758	ENST00000369291.5:c.892C>G	1.37:g.145688197C>G	ENSP00000358297:p.Leu298Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L298V	ENST00000369291.5	37	c.892	CCDS922.1	1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822457	0.32237	.	.	ENSG00000121848	ENST00000369291	T	0.11385	2.78	5.55	3.69	0.42338	.	0.217306	0.40064	N	0.001192	T	0.01976	0.0062	N	0.24115	0.695	0.24399	N	0.994715	B	0.34015	0.435	B	0.27887	0.084	T	0.46020	-0.9221	10	0.20519	T	0.43	-2.753	11.2048	0.48762	0.0:0.8408:0.0:0.1592	.	298	Q9Y4L5	RN115_HUMAN	V	298	ENSP00000358297:L298V	ENSP00000358297:L298V	L	+	1	2	RNF115	144399554	0.998000	0.40836	0.998000	0.56505	0.949000	0.60115	1.484000	0.35508	0.470000	0.27294	-0.797000	0.03246	CTA	RNF115	-	NULL	ENSG00000121848		0.428	RNF115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF115	HGNC	protein_coding	OTTHUMT00000038554.2	45	0.00	0	C	NM_014455		145688197	145688197	+1	no_errors	ENST00000369291	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	G
RNF126P1	376412	genome.wustl.edu	37	17	55123129	55123129	+	RNA	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:55123129C>T	ENST00000567452.1	+	0	291					NR_002818.2				ring finger protein 126 pseudogene 1																		AGTTTGCTTTCGGCATCTTTG	0.642																																						dbGAP											0																																										-	-	-			0			BC033555		17q23.2	2004-04-22				ENSG00000261192		"""RING-type (C3HC4) zinc fingers"""	30340	pseudogene	pseudogene						12477932	Standard	NR_002818		Approved		uc002iuw.3				17.37:g.55123129C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567452.1	37	NULL		17																																																																																			RNF126P1	-	-	ENSG00000261192		0.642	RNF126P1-002	KNOWN	basic	processed_transcript	RNF126P1	HGNC	pseudogene	OTTHUMT00000431453.1	47	0.00	0	C			55123129	55123129	+1	no_errors	ENST00000567452	ensembl	human	known	69_37n	rna	14	30.00	6	SNP	0.908	T
RPL13AP3	645683	genome.wustl.edu	37	14	56232970	56232970	+	lincRNA	SNP	T	T	C	rs2184557	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:56232970T>C	ENST00000554458.1	+	0	75				RPL13AP3_ENST00000494676.1_RNA																							CGTGGCTAAGTAGTTACTGCT	0.587													C|||	3286	0.65615	0.9221	0.4914	5008	,	,		16651	0.756		0.3678	False		,,,				2504	0.6074					dbGAP											0																																										-	-	-			0																															14.37:g.56232970T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000554458.1	37	NULL		14																																																																																			RPL13AP3	-	-	ENSG00000177350		0.587	RP11-813I20.2-001	KNOWN	basic	lincRNA	RPL13AP3	HGNC	lincRNA	OTTHUMT00000411474.1	38	0.00	0	T			56232970	56232970	+1	no_errors	ENST00000494676	ensembl	human	known	69_37n	rna	28	15.15	5	SNP	1.000	C
RPL22P19	644022	genome.wustl.edu	37	12	125420380	125420380	+	RNA	SNP	T	T	C	rs7132501	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:125420380T>C	ENST00000480427.1	-	0	61									ribosomal protein L22 pseudogene 19																		TTTTTAGCCCTCCTTTACCAC	0.473													C|||	847	0.169129	0.2012	0.1369	5008	,	,		20062	0.2173		0.0974	False		,,,				2504	0.1728					dbGAP											0																																										-	-	-			0					12q24.31	2009-03-11				ENSG00000241129			36567	pseudogene	pseudogene						19123937	Standard	NG_010946		Approved						12.37:g.125420380T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000480427.1	37	NULL		12																																																																																			RPL22P19	-	-	ENSG00000241129		0.473	RPL22P19-002	KNOWN	basic	processed_transcript	RPL22P19	HGNC	pseudogene	OTTHUMT00000351190.1	14	0.00	0	T	NG_010946		125420380	125420380	-1	no_errors	ENST00000480427	ensembl	human	known	69_37n	rna	6	45.45	5	SNP	0.998	C
RPRD2	23248	genome.wustl.edu	37	1	150444067	150444067	+	Silent	SNP	A	A	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:150444067A>G	ENST00000369068.4	+	11	2647	c.2643A>G	c.(2641-2643)caA>caG	p.Q881Q	RPRD2_ENST00000539519.1_Silent_p.Q855Q|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Silent_p.Q855Q	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	881	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ACAGAGCCCAAGAATTTGGGG	0.498																																						dbGAP											0													90.0	87.0	88.0					1																	150444067		1919	4115	6034	-	-	-	SO:0001819	synonymous_variant	0			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2643A>G	1.37:g.150444067A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,superfamily_Ricin_B_lectin,smart_RNA_polymerase_II_lsu_CTD	p.Q881	ENST00000369068.4	37	c.2643	CCDS44216.1	1																																																																																			RPRD2	-	NULL	ENSG00000163125		0.498	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	HGNC	protein_coding	OTTHUMT00000035844.1	41	0.00	0	A	NM_015203		150444067	150444067	+1	no_errors	ENST00000369068	ensembl	human	known	69_37n	silent	31	11.43	4	SNP	0.990	G
RPTOR	57521	genome.wustl.edu	37	17	78897547	78897547	+	Intron	SNP	C	C	T	rs7217786	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr17:78897547C>T	ENST00000306801.3	+	23	3170				RPTOR_ENST00000575542.1_Intron|RPTOR_ENST00000544334.2_Intron	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1						cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						ATGGCCTCAGCCTCAGGCTGC	0.637													C|||	1248	0.249201	0.1634	0.2925	5008	,	,		18353	0.1994		0.326	False		,,,				2504	0.3067					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.2808+74C>T	17.37:g.78897547C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	NULL	p.A121V	ENST00000306801.3	37	c.362	CCDS11773.1	17																																																																																			RPTOR	-	NULL	ENSG00000141564		0.637	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	65	0.00	0	C	NM_020761		78897547	78897547	+1	no_start_codon	ENST00000576366	ensembl	human	putative	69_37n	missense	45	11.76	6	SNP	0.000	T
RSPH6A	81492	genome.wustl.edu	37	19	46299147	46299149	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:46299147_46299149delCCT	ENST00000221538.3	-	6	2274_2276	c.2132_2134delAGG	c.(2131-2136)gagggc>ggc	p.E711del	RSPH6A_ENST00000600188.1_In_Frame_Del_p.E447del|RSPH6A_ENST00000597055.1_3'UTR	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	711	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GTctcctcgccctcctcctcctc	0.557																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.2132_2134delAGG	19.37:g.46299156_46299158delCCT	ENSP00000221538:p.Glu711del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FE2|Q6PEZ9	In_Frame_Del	DEL	pfam_Radial_spoke	p.E711in_frame_del	ENST00000221538.3	37	c.2134_2132	CCDS12675.1	19																																																																																			RSPH6A	-	NULL	ENSG00000104941		0.557	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	35	0.00	0	CCT			46299147	46299149	-1	no_errors	ENST00000221538	ensembl	human	known	69_37n	in_frame_del	21	12.50	3	DEL	1.000:1.000:1.000	-
SEPT7P9	285961	genome.wustl.edu	37	10	38682079	38682079	+	RNA	SNP	T	T	C	rs2754366	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:38682079T>C	ENST00000489259.1	-	0	348									septin 7 pseudogene 9																		TATCATACATTACACCAGTGA	0.373													.|||	2406	0.480431	0.6392	0.4899	5008	,	,		17634	0.5258		0.4205	False		,,,				2504	0.274					dbGAP											0																																										-	-	-			0					10p11.21	2013-04-02	2013-04-02	2013-04-02	ENSG00000120555	ENSG00000120555			30810	pseudogene	pseudogene			"""CDC10 cell division cycle 10 homolog (S. cerevisiae) like"", ""CDC10 cell division cycle 10 homolog (S. cerevisiae)-like"", ""septin 7-like"""	CDC10L, SEPT7L			Standard	NR_027269		Approved	bA291L22.2	uc009xmd.2		OTTHUMG00000017994		10.37:g.38682079T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000489259.1	37	NULL		10																																																																																			SEPT7L	-	-	ENSG00000120555		0.373	SEPT7P9-006	KNOWN	basic	processed_transcript	SEPT7L	HGNC	pseudogene	OTTHUMT00000047644.1	111	0.00	0	T	NR_027269		38682079	38682079	-1	no_errors	ENST00000474003	ensembl	human	known	69_37n	rna	86	13.00	13	SNP	0.573	C
SEMA4G	57715	genome.wustl.edu	37	10	102740337	102740337	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr10:102740337G>A	ENST00000370250.4	+	11	1727	c.1354G>A	c.(1354-1356)Gat>Aat	p.D452N	MRPL43_ENST00000370241.3_Intron|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000210633.3_Missense_Mutation_p.D452N|MRPL43_ENST00000318325.2_Intron|MRPL43_ENST00000370242.4_Intron|SEMA4G_ENST00000517724.1_Missense_Mutation_p.D452N	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	452	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CATACCAGCTGATGGCTGGAT	0.517																																						dbGAP											0													105.0	98.0	100.0					10																	102740337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.1354G>A	10.37:g.102740337G>A	ENSP00000359270:p.Asp452Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.D452N	ENST00000370250.4	37	c.1354		10	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360940	0.61403	.	.	ENSG00000095539	ENST00000519649;ENST00000457585;ENST00000370250;ENST00000517724;ENST00000210633	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	5.02	5.02	0.67125	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.097042	0.64402	D	0.000002	T	0.16085	0.0387	L	0.45137	1.4	0.52099	D	0.999949	P;P;B	0.42827	0.791;0.711;0.281	B;P;B	0.46885	0.41;0.53;0.091	T	0.02491	-1.1151	10	0.29301	T	0.29	.	16.8963	0.86101	0.0:0.0:1.0:0.0	.	452;452;452	Q9NTN9;A1A5C6;Q9NTN9-2	SEM4G_HUMAN;.;.	N	452	ENSP00000428896:D452N;ENSP00000359270:D452N;ENSP00000430175:D452N;ENSP00000210633:D452N	ENSP00000210633:D452N	D	+	1	0	SEMA4G	102730327	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	3.079000	0.50104	2.330000	0.79161	0.305000	0.20034	GAT	SEMA4G	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000095539		0.517	SEMA4G-002	KNOWN	basic	protein_coding	SEMA4G	HGNC	protein_coding	OTTHUMT00000049920.2	45	0.00	0	G			102740337	102740337	+1	no_errors	ENST00000210633	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	A
SGTB	54557	genome.wustl.edu	37	5	64981225	64981225	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:64981225G>C	ENST00000381007.4	-	6	684	c.449C>G	c.(448-450)tCa>tGa	p.S150*		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	150										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		GCTGTACTTTGAATCAATTGC	0.408																																						dbGAP											0													252.0	215.0	228.0					5																	64981225		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.449C>G	5.37:g.64981225G>C	ENSP00000370395:p.Ser150*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S150*	ENST00000381007.4	37	c.449	CCDS3988.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.623855	0.97714	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	.	.	.	5.35	5.35	0.76521	.	0.180136	0.49305	D	0.000159	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.3002	19.4331	0.94779	0.0:0.0:1.0:0.0	.	.	.	.	X	150	.	ENSP00000370395:S150X	S	-	2	0	SGTB	65016981	1.000000	0.71417	0.821000	0.32701	0.993000	0.82548	9.404000	0.97306	2.659000	0.90383	0.655000	0.94253	TCA	SGTB	-	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000197860		0.408	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGTB	HGNC	protein_coding	OTTHUMT00000215057.2	66	0.00	0	G	NM_019072		64981225	64981225	-1	no_errors	ENST00000381007	ensembl	human	known	69_37n	nonsense	33	12.82	5	SNP	1.000	C
SHANK2	22941	genome.wustl.edu	37	11	70803543	70803543	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:70803543G>T	ENST00000338508.4	-	6	836	c.837C>A	c.(835-837)taC>taA	p.Y279*				Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1194	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GCTCGCAGCAGTAGGGATCAC	0.557																																						dbGAP											0													129.0	124.0	126.0					11																	70803543		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000338508.4:c.837C>A	11.37:g.70803543G>T	ENSP00000345193:p.Tyr279*	Somatic		WXS	Illumina GAIIx	Phase_IV	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Nonsense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.Y279*	ENST00000338508.4	37	c.837		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.057534|4.057534	0.76074|0.76074	.|.	.|.	ENSG00000162105|ENSG00000162105	ENST00000458632|ENST00000338508;ENST00000457074;ENST00000413503	.|.	.|.	.|.	4.07|4.07	3.12|3.12	0.35913|0.35913	.|.	.|0.000000	.|0.39615	.|U	.|0.001306	T|.	0.27313|.	0.0670|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.14448|.	-1.0472|.	4|.	.|0.02654	.|T	.|1	.|.	7.2802|7.2802	0.26308|0.26308	0.0899:0.3307:0.5794:0.0|0.0899:0.3307:0.5794:0.0	.|.	.|.	.|.	.|.	N|X	82|279	.|.	.|ENSP00000345193:Y279X	T|Y	-|-	2|3	0|2	SHANK2|SHANK2	70481191|70481191	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.844000|0.844000	0.47949|0.47949	4.072000|4.072000	0.57563|0.57563	0.878000|0.878000	0.35920|0.35920	0.555000|0.555000	0.69702|0.69702	ACT|TAC	SHANK2	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000162105		0.557	SHANK2-201	KNOWN	basic|appris_principal	protein_coding	SHANK2	HGNC	protein_coding		46	0.00	0	G	NM_012309		70803543	70803543	-1	no_errors	ENST00000338508	ensembl	human	known	69_37n	nonsense	23	14.81	4	SNP	0.973	T
SHPRH	257218	genome.wustl.edu	37	6	146268666	146268666	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:146268666C>T	ENST00000367505.2	-	6	1439	c.1175G>A	c.(1174-1176)cGa>cAa	p.R392Q	SHPRH_ENST00000275233.7_Missense_Mutation_p.R392Q|SHPRH_ENST00000367503.3_Missense_Mutation_p.R392Q|SHPRH_ENST00000438092.2_Missense_Mutation_p.R392Q			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	392					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GACATCTTGTCGAGTATGTGT	0.473																																						dbGAP											0													145.0	140.0	142.0					6																	146268666		1954	4140	6094	-	-	-	SO:0001583	missense	0			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.1175G>A	6.37:g.146268666C>T	ENSP00000356475:p.Arg392Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Histone_H1/H5,superfamily_Znf_FYVE_PHD,superfamily_WW_Rsp5_WWP,smart_Helicase_ATP-bd,smart_Histone_H1/H5,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.R392Q	ENST00000367505.2	37	c.1175	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	C	34	5.402060	0.96030	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.53	5.53	0.82687	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.56097	D	0.000030	D	0.95385	0.8502	M	0.66939	2.045	0.52501	D	0.999954	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	P;D;D;D	0.91635	0.889;0.999;0.998;0.998	D	0.95049	0.8185	10	0.66056	D	0.02	-12.7929	19.8173	0.96576	0.0:1.0:0.0:0.0	.	281;392;392;281	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	Q	392;392;392;392;281	ENSP00000356475:R392Q;ENSP00000356473:R392Q;ENSP00000412797:R392Q;ENSP00000275233:R392Q	ENSP00000275233:R392Q	R	-	2	0	SHPRH	146310359	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.050000	0.71063	2.763000	0.94921	0.585000	0.79938	CGA	SHPRH	-	pfam_SNF2_N,smart_Helicase_ATP-bd	ENSG00000146414		0.473	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	44	0.00	0	C	NM_173082		146268666	146268666	-1	no_errors	ENST00000367503	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	T
SHROOM2	357	genome.wustl.edu	37	X	9863480	9863480	+	Missense_Mutation	SNP	C	C	G	rs199877667		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:9863480C>G	ENST00000380913.3	+	4	1622	c.1532C>G	c.(1531-1533)aCg>aGg	p.T511R		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	511					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CCCCCACCCACGGTGGGCCAG	0.677																																						dbGAP											0													24.0	20.0	21.0					X																	9863480		2192	4289	6481	-	-	-	SO:0001583	missense	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.1532C>G	X.37:g.9863480C>G	ENSP00000370299:p.Thr511Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T511R	ENST00000380913.3	37	c.1532	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	C	2.438	-0.329205	0.05314	.	.	ENSG00000146950	ENST00000380913	T	0.14766	2.48	4.71	-3.02	0.05446	.	7.424890	0.00166	N	0.000002	T	0.06234	0.0161	N	0.08118	0	0.09310	N	1	B	0.28933	0.228	B	0.21151	0.033	T	0.22556	-1.0213	10	0.17369	T	0.5	.	6.5073	0.22202	0.0:0.4395:0.1165:0.444	.	511	Q13796	SHRM2_HUMAN	R	511	ENSP00000370299:T511R	ENSP00000370299:T511R	T	+	2	0	SHROOM2	9823480	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.620000	0.05565	-1.005000	0.03417	-1.327000	0.01280	ACG	SHROOM2	-	NULL	ENSG00000146950		0.677	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	40	0.00	0	C	NM_001649		9863480	9863480	+1	no_errors	ENST00000380913	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.000	G
SLC2A14	144195	genome.wustl.edu	37	12	8023500	8023500	+	5'UTR	SNP	A	A	G	rs12372273	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:8023500A>G	ENST00000543909.1	-	0	619				SLC2A14_ENST00000396589.2_Intron|SLC2A14_ENST00000539924.1_Intron|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000535295.1_Intron|SLC2A14_ENST00000544749.1_5'UTR|SLC2A14_ENST00000431042.2_Intron|SLC2A14_ENST00000340749.5_5'UTR			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		CCACAGCACAAGGGGCCACAT	0.517													G|||	3850	0.76877	0.7179	0.7392	5008	,	,		-128	0.9623		0.674	False		,,,				2504	0.7566					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.-141T>C	12.37:g.8023500A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	RNA	SNP	-	NULL	ENST00000543909.1	37	NULL	CCDS8585.1	12																																																																																			SLC2A14	-	-	ENSG00000173262		0.517	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	SLC2A14	HGNC	protein_coding	OTTHUMT00000399836.2	53	0.00	0	A	NM_153449		8023500	8023500	-1	no_errors	ENST00000544749	ensembl	human	known	69_37n	rna	36	12.20	5	SNP	0.981	G
SLC43A3	29015	genome.wustl.edu	37	11	57177504	57177504	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:57177504G>A	ENST00000395123.2	-	12	1455	c.1151C>T	c.(1150-1152)tCa>tTa	p.S384L	RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.S28L|SLC43A3_ENST00000533524.1_Missense_Mutation_p.S397L|SLC43A3_ENST00000529554.1_Missense_Mutation_p.S384L|SLC43A3_ENST00000352187.1_Missense_Mutation_p.S384L|SLC43A3_ENST00000395124.1_Missense_Mutation_p.S384L	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	384					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GATGGGGACTGAGGCACAGAG	0.627																																						dbGAP											0													100.0	77.0	84.0					11																	57177504		2201	4296	6497	-	-	-	SO:0001583	missense	0			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.1151C>T	11.37:g.57177504G>A	ENSP00000378555:p.Ser384Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S384L	ENST00000395123.2	37	c.1151	CCDS7956.1	11	.	.	.	.	.	.	.	.	.	.	G	10.58	1.389847	0.25118	.	.	ENSG00000254979;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802	ENST00000529411;ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524	T;T;T;T;T;T	0.77489	-1.1;0.48;0.48;0.48;0.48;0.48	5.65	5.65	0.86999	Major facilitator superfamily domain, general substrate transporter (1);	0.343534	0.31392	N	0.007733	T	0.66218	0.2767	N	0.26092	0.79	0.38513	D	0.948525	B;B	0.24132	0.098;0.098	B;B	0.31101	0.124;0.124	T	0.61347	-0.7081	10	0.02654	T	1	-17.4735	16.6606	0.85239	0.0:0.0:1.0:0.0	.	397;384	E7EQD2;Q8NBI5	.;S43A3_HUMAN	L	28;384;384;384;384;397	ENSP00000431536:S28L;ENSP00000378555:S384L;ENSP00000378556:S384L;ENSP00000337561:S384L;ENSP00000436254:S384L;ENSP00000434515:S397L	ENSP00000431536:S28L	S	-	2	0	RP11-872D17.8;SLC43A3	56934080	1.000000	0.71417	0.933000	0.37362	0.076000	0.17211	6.428000	0.73383	2.656000	0.90262	0.655000	0.94253	TCA	SLC43A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000134802		0.627	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC43A3	HGNC	protein_coding	OTTHUMT00000393057.1	35	0.00	0	G	NM_017611		57177504	57177504	-1	no_errors	ENST00000352187	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.993	A
SLC51A	200931	genome.wustl.edu	37	3	195959935	195959935	+	Splice_Site	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:195959935G>A	ENST00000296327.5	+	9	1097	c.888G>A	c.(886-888)gtG>gtA	p.V296V	PCYT1A_ENST00000419333.1_Intron	NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	296					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	ACACTGCAGTGATGAATTGCC	0.468																																						dbGAP											0													173.0	155.0	161.0					3																	195959935		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.887-1G>A	3.37:g.195959935G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMC7	Silent	SNP	pfam_Ost-alpha	p.V296	ENST00000296327.5	37	c.888	CCDS3314.1	3																																																																																			SLC51A	-	pfam_Ost-alpha	ENSG00000163959		0.468	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC51A	HGNC	protein_coding	OTTHUMT00000341253.1	51	0.00	0	G	NM_152672	Silent	195959935	195959935	+1	no_errors	ENST00000296327	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	1.000	A
SLC6A5	9152	genome.wustl.edu	37	11	20657903	20657903	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:20657903C>G	ENST00000525748.1	+	11	1948	c.1675C>G	c.(1675-1677)Ctc>Gtc	p.L559V	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	559					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	CAGGCTGCCTCTCTCTCCGTT	0.527																																						dbGAP											0													177.0	139.0	152.0					11																	20657903		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1675C>G	11.37:g.20657903C>G	ENSP00000434364:p.Leu559Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.L559V	ENST00000525748.1	37	c.1675	CCDS7854.1	11	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387283	0.25031	.	.	ENSG00000165970	ENST00000525748	T	0.74947	-0.89	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	N	0.11927	0.2	0.58432	D	0.999999	B	0.23316	0.083	B	0.28139	0.086	T	0.56226	-0.8014	10	0.08381	T	0.77	.	18.8865	0.92379	0.0:1.0:0.0:0.0	.	559	Q9Y345	SC6A5_HUMAN	V	559	ENSP00000434364:L559V	ENSP00000434364:L559V	L	+	1	0	SLC6A5	20614479	0.949000	0.32298	1.000000	0.80357	0.970000	0.65996	1.974000	0.40559	2.455000	0.83008	0.563000	0.77884	CTC	SLC6A5	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000165970		0.527	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A5	HGNC	protein_coding	OTTHUMT00000387497.2	101	0.00	0	C	NM_004211		20657903	20657903	+1	no_errors	ENST00000525748	ensembl	human	known	69_37n	missense	61	17.57	13	SNP	0.999	G
SOCS4	122809	genome.wustl.edu	37	14	55494105	55494105	+	5'UTR	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:55494105C>G	ENST00000395472.2	+	0	158				SOCS4_ENST00000555846.1_5'UTR|WDHD1_ENST00000420358.2_5'Flank|SOCS4_ENST00000553735.1_3'UTR|WDHD1_ENST00000421192.1_5'Flank|SOCS4_ENST00000339298.2_5'Flank|WDHD1_ENST00000360586.3_5'Flank	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4						intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)					central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						GGCCTCCCCTCTCCACTTAAG	0.612																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.-175C>G	14.37:g.55494105C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000395472.2	37	NULL	CCDS9722.1	14																																																																																			SOCS4	-	-	ENSG00000180008		0.612	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS4	HGNC	protein_coding	OTTHUMT00000276910.1	32	0.00	0	C			55494105	55494105	+1	no_errors	ENST00000553735	ensembl	human	putative	69_37n	rna	17	29.17	7	SNP	0.000	G
SPEG	10290	genome.wustl.edu	37	2	220330976	220330976	+	Intron	SNP	C	C	A	rs4369848	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:220330976C>A	ENST00000312358.7	+	10	3013				SPEG_ENST00000396698.1_3'UTR|SPEG_ENST00000396686.1_3'UTR|SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396688.1_3'UTR|SPEG_ENST00000396689.2_3'UTR|SPEG_ENST00000396695.2_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCCTGTGGACCCTCCCTCCCC	0.706													C|||	2033	0.40595	0.3933	0.4222	5008	,	,		13902	0.2847		0.4682	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-920C>A	2.37:g.220330976C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	RNA	SNP	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																			SPEG	-	-	ENSG00000072195		0.706	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	24	0.00	0	C	NM_005876		220330976	220330976	+1	no_errors	ENST00000462545	ensembl	human	known	69_37n	rna	21	19.23	5	SNP	0.997	A
SPHKAP	80309	genome.wustl.edu	37	2	228883051	228883051	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:228883051C>A	ENST00000392056.3	-	7	2565	c.2519G>T	c.(2518-2520)gGa>gTa	p.G840V	SPHKAP_ENST00000344657.5_Missense_Mutation_p.G840V	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	840						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TGTATCCTCTCCTGCTATTCC	0.488																																						dbGAP											0													753.0	715.0	728.0					2																	228883051		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2519G>T	2.37:g.228883051C>A	ENSP00000375909:p.Gly840Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.G840V	ENST00000392056.3	37	c.2519	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	0.480	-0.880486	0.02530	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.13089	2.62;2.62	5.45	-0.959	0.10343	.	0.965741	0.08633	N	0.916752	T	0.10809	0.0264	L	0.45581	1.43	0.21499	N	0.999661	B;B	0.13145	0.004;0.007	B;B	0.15484	0.004;0.013	T	0.39781	-0.9597	10	0.56958	D	0.05	.	1.8454	0.03158	0.1238:0.3873:0.2646:0.2243	.	840;840	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	V	840	ENSP00000375909:G840V;ENSP00000339886:G840V	ENSP00000339886:G840V	G	-	2	0	SPHKAP	228591295	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.122000	0.10627	-0.390000	0.07774	-1.114000	0.02060	GGA	SPHKAP	-	NULL	ENSG00000153820		0.488	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	84	0.00	0	C	NM_030623		228883051	228883051	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	56	16.42	11	SNP	0.000	A
SRPK2	6733	genome.wustl.edu	37	7	104844105	104844105	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:104844105C>A	ENST00000393651.3	-	3	286	c.199G>T	c.(199-201)Gag>Tag	p.E67*	SRPK2_ENST00000357311.3_Nonsense_Mutation_p.E56*|SRPK2_ENST00000489828.1_Nonsense_Mutation_p.E56*	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						TCCTCTTGCTCCTCATCATCT	0.597																																						dbGAP											0													144.0	118.0	127.0					7																	104844105		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.199G>T	7.37:g.104844105C>A	ENSP00000377262:p.Glu67*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E67*	ENST00000393651.3	37	c.199	CCDS34724.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.816087	0.96982	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828;ENST00000482897;ENST00000460391	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.7987	18.3674	0.90396	0.0:1.0:0.0:0.0	.	.	.	.	X	67;56;56;104;56	.	ENSP00000349863:E56X	E	-	1	0	SRPK2	104631341	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.147000	0.77382	2.873000	0.98535	0.561000	0.74099	GAG	SRPK2	-	NULL	ENSG00000135250		0.597	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	HGNC	protein_coding	OTTHUMT00000348723.1	72	0.00	0	C	NM_182691		104844105	104844105	-1	no_errors	ENST00000393651	ensembl	human	known	69_37n	nonsense	28	12.50	4	SNP	1.000	A
SSFA2	6744	genome.wustl.edu	37	2	182781087	182781087	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:182781087C>T	ENST00000431877.2	+	11	2899	c.2720C>T	c.(2719-2721)tCa>tTa	p.S907L	SSFA2_ENST00000409001.1_Missense_Mutation_p.S907L|SSFA2_ENST00000409136.1_Missense_Mutation_p.S416L|SSFA2_ENST00000320370.7_Missense_Mutation_p.S907L|SSFA2_ENST00000428267.2_Missense_Mutation_p.S754L	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	907						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			AATCCTCCTTCAGCCATAGAA	0.433																																						dbGAP											0													97.0	92.0	94.0					2																	182781087		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.2720C>T	2.37:g.182781087C>T	ENSP00000388731:p.Ser907Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.S907L	ENST00000431877.2	37	c.2720	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611734	0.87258	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.59756	0.2217	M	0.73598	2.24	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.996;0.996;0.996;0.996	T	0.58885	-0.7557	10	0.62326	D	0.03	-15.0301	20.3932	0.98965	0.0:1.0:0.0:0.0	.	754;416;907;907;907	E7END2;E7EUL7;E9PHV5;P28290;P28290-3	.;.;.;SSFA2_HUMAN;.	L	907;907;907;754;416	ENSP00000388731:S907L;ENSP00000314669:S907L;ENSP00000387319:S907L;ENSP00000409867:S754L;ENSP00000386916:S416L	ENSP00000314669:S907L	S	+	2	0	SSFA2	182489332	1.000000	0.71417	0.985000	0.45067	0.906000	0.53458	5.915000	0.69973	2.824000	0.97209	0.655000	0.94253	TCA	SSFA2	-	NULL	ENSG00000138434		0.433	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2	29	0.00	0	C	NM_006751		182781087	182781087	+1	no_errors	ENST00000431877	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.998	T
SSR1	6745	genome.wustl.edu	37	6	7288122	7288122	+	3'UTR	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:7288122G>C	ENST00000244763.4	-	0	2922				SSR1_ENST00000534851.1_3'UTR|SSR1_ENST00000397511.2_3'UTR|RP11-69L16.4_ENST00000379928.4_RNA|SSR1_ENST00000474597.1_Intron	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					cctggcatctgaggatttaag	0.348																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.*1975C>G	6.37:g.7288122G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	RNA	SNP	-	NULL	ENST00000244763.4	37	NULL	CCDS4499.1	6																																																																																			SSR1	-	-	ENSG00000124783		0.348	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSR1	HGNC	protein_coding	OTTHUMT00000039775.2	17	0.00	0	G			7288122	7288122	-1	no_errors	ENST00000475213	ensembl	human	known	69_37n	rna	16	20.00	4	SNP	0.858	C
STMN4	81551	genome.wustl.edu	37	8	27099954	27099954	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:27099954G>C	ENST00000265770.7	-	3	205	c.69C>G	c.(67-69)ttC>ttG	p.F23L	STMN4_ENST00000350889.4_Missense_Mutation_p.F23L|STMN4_ENST00000522908.1_Missense_Mutation_p.F23L|STMN4_ENST00000519997.1_Missense_Mutation_p.F14L|STMN4_ENST00000519614.1_Missense_Mutation_p.F23L|STMN4_ENST00000523048.1_Missense_Mutation_p.F23L			Q9H169	STMN4_HUMAN	stathmin-like 4	23					regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	GATCGGCCAGGAAGCAGGAGC	0.572																																						dbGAP											0													101.0	96.0	98.0					8																	27099954		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.69C>G	8.37:g.27099954G>C	ENSP00000265770:p.Phe23Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Missense_Mutation	SNP	pfam_Stathmin,superfamily_Stathmin,pirsf_Stathmin,prints_Stathmin	p.F23L	ENST00000265770.7	37	c.69		8	.	.	.	.	.	.	.	.	.	.	G	14.60	2.583392	0.46006	.	.	ENSG00000015592	ENST00000350889;ENST00000519997;ENST00000265770;ENST00000523048;ENST00000519614;ENST00000522908	.	.	.	5.03	3.15	0.36227	.	0.151689	0.64402	D	0.000011	T	0.30634	0.0771	N	0.12887	0.27	0.42433	D	0.992685	B;B;B;B;B;B	0.19200	0.002;0.0;0.001;0.034;0.0;0.001	B;B;B;B;B;B	0.14023	0.003;0.0;0.002;0.01;0.0;0.002	T	0.05954	-1.0854	9	0.25751	T	0.34	-27.7025	9.3841	0.38331	0.1852:0.0:0.8148:0.0	.	23;14;23;23;23;23	E7EVN3;B7Z2Z7;G5EA16;E5RIR6;Q9H169;Q9H169-2	.;.;.;.;STMN4_HUMAN;.	L	23;14;23;23;23;23	.	ENSP00000265770:F23L	F	-	3	2	STMN4	27155871	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.483000	0.45233	0.749000	0.32854	0.655000	0.94253	TTC	STMN4	-	pirsf_Stathmin	ENSG00000015592		0.572	STMN4-006	KNOWN	basic|appris_principal	protein_coding	STMN4	HGNC	protein_coding	OTTHUMT00000375941.1	57	0.00	0	G	NM_030795		27099954	27099954	-1	no_errors	ENST00000350889	ensembl	human	known	69_37n	missense	62	12.68	9	SNP	1.000	C
STOX2	56977	genome.wustl.edu	37	4	184827952	184827952	+	Missense_Mutation	SNP	G	G	C	rs555741867	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:184827952G>C	ENST00000308497.4	+	1	1444	c.9G>C	c.(7-9)aaG>aaC	p.K3N	STOX2_ENST00000438269.1_Missense_Mutation_p.K3N|STOX2_ENST00000511250.1_Intron	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	3					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		CCATGAAGAAGACCCGGAGCA	0.711																																						dbGAP											0													13.0	17.0	16.0					4																	184827952		1890	3953	5843	-	-	-	SO:0001583	missense	0			AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.9G>C	4.37:g.184827952G>C	ENSP00000311257:p.Lys3Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U4|Q9NPS8	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.K3N	ENST00000308497.4	37	c.9	CCDS47167.1	4	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975840	0.92982	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;D	0.81499	-0.52;-1.5	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.80199	0.4579	N	0.08118	0	0.58432	D	0.99999	D	0.71674	0.998	D	0.73708	0.981	D	0.85544	0.1217	10	0.72032	D	0.01	-8.8641	17.3574	0.87340	0.0:0.0:1.0:0.0	.	3	Q9P2F5	STOX2_HUMAN	N	3	ENSP00000311257:K3N;ENSP00000390127:K3N	ENSP00000311257:K3N	K	+	3	2	STOX2	185064946	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.577000	0.67444	2.147000	0.66899	0.561000	0.74099	AAG	STOX2	-	NULL	ENSG00000173320		0.711	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX2	HGNC	protein_coding	OTTHUMT00000361433.3	71	0.00	0	G	NM_020225		184827952	184827952	+1	no_errors	ENST00000308497	ensembl	human	known	69_37n	missense	42	18.87	10	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152631999	152631999	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:152631999C>G	ENST00000367255.5	-	88	17321	c.16720G>C	c.(16720-16722)Gaa>Caa	p.E5574Q	SYNE1_ENST00000356820.4_Missense_Mutation_p.E98Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.E5186Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.E5503Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.E5574Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.E5503Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5574					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGGATTCTTCTAGCAGGGTC	0.408										HNSCC(10;0.0054)																												dbGAP											0													82.0	71.0	75.0					6																	152631999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16720G>C	6.37:g.152631999C>G	ENSP00000356224:p.Glu5574Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E5574Q	ENST00000367255.5	37	c.16720	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744752	0.30865	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.55760	1.28;1.28;1.28;1.28;0.5;1.28	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000007	T	0.40979	0.1139	L	0.55481	1.735	0.42689	D	0.993577	B;B;B	0.31227	0.209;0.209;0.314	B;B;B	0.31495	0.037;0.037;0.131	T	0.28522	-1.0041	10	0.34782	T	0.22	.	20.2683	0.98464	0.0:1.0:0.0:0.0	.	5574;5574;5503	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Q	5574;5503;5574;5503;5186;98	ENSP00000356224:E5574Q;ENSP00000396024:E5503Q;ENSP00000265368:E5574Q;ENSP00000390975:E5503Q;ENSP00000341887:E5186Q;ENSP00000349276:E98Q	ENSP00000265368:E5574Q	E	-	1	0	SYNE1	152673692	1.000000	0.71417	0.990000	0.47175	0.097000	0.18754	4.952000	0.63618	2.800000	0.96347	0.591000	0.81541	GAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.408	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	36	0.00	0	C	NM_182961		152631999	152631999	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.999	G
SYNE2	23224	genome.wustl.edu	37	14	64491747	64491747	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:64491747G>C	ENST00000344113.4	+	40	6170	c.5958G>C	c.(5956-5958)aaG>aaC	p.K1986N	SYNE2_ENST00000358025.3_Missense_Mutation_p.K1986N|SYNE2_ENST00000554584.1_Missense_Mutation_p.K1986N|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1986					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAGCTAGAAAGAGGTATAGCT	0.388																																						dbGAP											0													91.0	85.0	87.0					14																	64491747		1859	4103	5962	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.5958G>C	14.37:g.64491747G>C	ENSP00000341781:p.Lys1986Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.K1986N	ENST00000344113.4	37	c.5958	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	9.445	1.088962	0.20390	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.35789	1.29;1.29;1.29	5.6	1.18	0.20946	.	0.104251	0.42172	D	0.000754	T	0.35248	0.0925	L	0.29908	0.895	0.80722	D	1	D;D	0.61697	0.983;0.99	P;P	0.57152	0.656;0.814	T	0.03306	-1.1050	10	0.25751	T	0.34	.	9.8023	0.40773	0.3277:0.0:0.6723:0.0	.	1986;1986	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	N	1986	ENSP00000350719:K1986N;ENSP00000341781:K1986N;ENSP00000452570:K1986N	ENSP00000261678:K1986N	K	+	3	2	SYNE2	63561500	1.000000	0.71417	0.972000	0.41901	0.254000	0.26022	1.252000	0.32874	0.322000	0.23283	0.557000	0.71058	AAG	SYNE2	-	NULL	ENSG00000054654		0.388	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	58	0.00	0	G	NM_182914		64491747	64491747	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.973	C
SYNJ2BP	55333	genome.wustl.edu	37	14	70839389	70839389	+	3'UTR	SNP	A	A	C	rs11844845	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:70839389A>C	ENST00000256366.4	-	0	838				SYNJ2BP-COX16_ENST00000555276.1_RNA|SYNJ2BP_ENST00000554216.1_5'UTR	NM_018373.2	NP_060843.2	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein						intracellular distribution of mitochondria (GO:0048312)|negative regulation of activin receptor signaling pathway (GO:0032926)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of receptor internalization (GO:0002092)	cell surface (GO:0009986)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)				central_nervous_system(1)|kidney(2)|large_intestine(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		GCTAAGAAAAAAGGTATTGCC	0.358													A|||	1640	0.327476	0.3699	0.1657	5008	,	,		18094	0.6032		0.164	False		,,,				2504	0.2689					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK002133	CCDS9803.1	14q24.2	2013-05-10			ENSG00000213463	ENSG00000213463			18955	protein-coding gene	gene with protein product	"""activin receptor interacting protein 5"""	609411				11882656	Standard	NM_018373		Approved	Arip2		P57105	OTTHUMG00000171240	ENST00000256366.4:c.*319T>G	14.37:g.70839389A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q49SH3|Q96IA4	RNA	SNP	-	NULL	ENST00000256366.4	37	NULL	CCDS9803.1	14																																																																																			SYNJ2BP	-	-	ENSG00000213463		0.358	SYNJ2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2BP	HGNC	protein_coding	OTTHUMT00000412472.1	45	0.00	0	A	NM_018373		70839389	70839389	-1	no_errors	ENST00000554216	ensembl	human	putative	69_37n	rna	33	17.50	7	SNP	0.004	C
SYT7	9066	genome.wustl.edu	37	11	61290626	61290626	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:61290626G>A	ENST00000263846.4	-	8	1355	c.1028C>T	c.(1027-1029)aCg>aTg	p.T343M	SYT7_ENST00000535826.1_Missense_Mutation_p.T462M|SYT7_ENST00000540677.1_Missense_Mutation_p.T418M|SYT7_ENST00000542836.1_Missense_Mutation_p.T387M|SYT7_ENST00000542670.1_Missense_Mutation_p.T551M|SYT7_ENST00000540831.1_5'Flank|SYT7_ENST00000539008.1_Missense_Mutation_p.T626M	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	343	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CAGCTTCTCCGTGGGGATATC	0.547																																						dbGAP											0													273.0	217.0	236.0					11																	61290626		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.1028C>T	11.37:g.61290626G>A	ENSP00000263846:p.Thr343Met	Somatic		WXS	Illumina GAIIx	Phase_IV	F5GZU9|Q08AH6	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting	p.T343M	ENST00000263846.4	37	c.1028	CCDS31577.1	11	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351846	0.61183	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	4.64	4.64	0.57946	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.053914	0.85682	D	0.000000	T	0.48874	0.1524	N	0.12502	0.225	0.51012	D	0.999909	B;B	0.28760	0.221;0.11	B;B	0.19666	0.026;0.025	T	0.46527	-0.9185	10	0.31617	T	0.26	.	18.1087	0.89528	0.0:0.0:1.0:0.0	.	418;343	F5GZU9;O43581	.;SYT7_HUMAN	M	343;418;626;387;551;462	ENSP00000263846:T343M;ENSP00000444201:T418M;ENSP00000439694:T626M;ENSP00000444568:T387M;ENSP00000444019:T551M;ENSP00000437720:T462M	ENSP00000263846:T343M	T	-	2	0	SYT7	61047202	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.640000	0.83355	2.583000	0.87209	0.561000	0.74099	ACG	SYT7	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,pfscan_C2_membr_targeting	ENSG00000011347		0.547	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT7	HGNC	protein_coding	OTTHUMT00000398733.1	58	0.00	0	G	NM_004200		61290626	61290626	-1	no_errors	ENST00000263846	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	1.000	A
TAF7L	54457	genome.wustl.edu	37	X	100538458	100538458	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:100538458T>C	ENST00000372907.3	-	4	528	c.517A>G	c.(517-519)Aaa>Gaa	p.K173E	TAF7L_ENST00000356784.1_Missense_Mutation_p.K87E|TAF7L_ENST00000372905.2_Missense_Mutation_p.K87E|TAF7L_ENST00000324762.6_Missense_Mutation_p.K87E	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	173					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						TCTGCTGTTTTATAAAAGGTT	0.378																																					Ovarian(104;431 1530 3210 15406 18594)	dbGAP											0													147.0	147.0	147.0					X																	100538458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.517A>G	X.37:g.100538458T>C	ENSP00000361998:p.Lys173Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	pfam_TAFII55_prot_cons_reg	p.K173E	ENST00000372907.3	37	c.517	CCDS35347.1	X	.	.	.	.	.	.	.	.	.	.	T	19.13	3.767845	0.69878	.	.	ENSG00000102387	ENST00000372907;ENST00000372905;ENST00000324762;ENST00000356784	T;T;T;T	0.67523	0.1;0.03;0.03;-0.27	5.64	1.74	0.24563	TAFII55 protein, conserved region (1);	0.151448	0.31031	N	0.008389	T	0.80696	0.4672	H	0.94847	3.59	0.36008	D	0.837836	D;P	0.56968	0.978;0.946	P;P	0.57620	0.824;0.592	T	0.82082	-0.0633	10	0.87932	D	0	-16.4361	6.9566	0.24574	0.0:0.0756:0.2463:0.6782	.	173;87	Q5H9L4;Q5H9L4-3	TAF7L_HUMAN;.	E	173;87;87;87	ENSP00000361998:K173E;ENSP00000361996:K87E;ENSP00000320283:K87E;ENSP00000349235:K87E	ENSP00000320283:K87E	K	-	1	0	TAF7L	100425114	1.000000	0.71417	0.959000	0.39883	0.971000	0.66376	4.401000	0.59716	-0.037000	0.13646	0.478000	0.44815	AAA	TAF7L	-	pfam_TAFII55_prot_cons_reg	ENSG00000102387		0.378	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF7L	HGNC	protein_coding	OTTHUMT00000057526.2	58	0.00	0	T			100538458	100538458	-1	no_errors	ENST00000372907	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	C
TEX15	56154	genome.wustl.edu	37	8	30705960	30705960	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:30705960C>G	ENST00000256246.2	-	1	648	c.574G>C	c.(574-576)Gag>Cag	p.E192Q	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	192					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTACTGTACTCTTTTGTATAA	0.403																																						dbGAP											0													53.0	57.0	55.0					8																	30705960		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.574G>C	8.37:g.30705960C>G	ENSP00000256246:p.Glu192Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E192Q	ENST00000256246.2	37	c.574	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	10.10	1.258314	0.23051	.	.	ENSG00000133863	ENST00000256246	T	0.11495	2.77	5.67	1.31	0.21738	.	0.923130	0.09145	N	0.842368	T	0.06050	0.0157	N	0.08118	0	0.09310	N	1	P	0.37276	0.589	B	0.35971	0.215	T	0.38090	-0.9677	10	0.87932	D	0	.	8.3448	0.32266	0.0:0.6129:0.0:0.3871	.	192	Q9BXT5	TEX15_HUMAN	Q	192	ENSP00000256246:E192Q	ENSP00000256246:E192Q	E	-	1	0	TEX15	30825502	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.204000	0.17335	0.426000	0.26116	0.655000	0.94253	GAG	TEX15	-	NULL	ENSG00000133863		0.403	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	30	0.00	0	C			30705960	30705960	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.000	G
TFPI	7035	genome.wustl.edu	37	2	188332559	188332559	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:188332559G>A	ENST00000233156.3	-	7	1023	c.729C>T	c.(727-729)cgC>cgT	p.R243R	TFPI_ENST00000392365.1_Silent_p.R243R|AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA	NM_006287.4	NP_006278.1	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)	243	BPTI/Kunitz inhibitor 3. {ECO:0000255|PROSITE-ProRule:PRU00031}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)|Dalteparin(DB06779)	ACTTAAATGGGCGGCATTTCC	0.423																																						dbGAP											0													153.0	146.0	149.0					2																	188332559		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2294.1, CCDS33349.1	2q32	2008-06-02			ENSG00000003436	ENSG00000003436			11760	protein-coding gene	gene with protein product	"""extrinsic pathway inhibitor"""	152310		LACI		1993173	Standard	XM_005246818		Approved	EPI, TFI, TFPI1	uc002upy.3	P10646	OTTHUMG00000132634	ENST00000233156.3:c.729C>T	2.37:g.188332559G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95103|Q53TS4	Silent	SNP	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.R243	ENST00000233156.3	37	c.729	CCDS2294.1	2																																																																																			TFPI	-	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000003436		0.423	TFPI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI	HGNC	protein_coding	OTTHUMT00000255881.1	40	0.00	0	G	NM_006287		188332559	188332559	-1	no_errors	ENST00000233156	ensembl	human	known	69_37n	silent	33	28.26	13	SNP	0.000	A
TIAM2	26230	genome.wustl.edu	37	6	155571697	155571697	+	Intron	SNP	T	T	C	rs1041474	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:155571697T>C	ENST00000461783.3	+	24	5224				TIAM2_ENST00000529824.2_Missense_Mutation_p.M1326T|TIAM2_ENST00000456144.1_Missense_Mutation_p.M1326T|TIAM2_ENST00000360366.4_Intron|TIAM2_ENST00000367174.2_Intron|TIAM2_ENST00000275246.7_Intron|TIAM2_ENST00000318981.5_Intron|TIAM2_ENST00000456877.2_Intron|RP11-477D19.2_ENST00000435295.1_RNA|TIAM2_ENST00000528391.2_Intron			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TCAGAGGTGATGGATGTACTA	0.493													T|||	1261	0.251797	0.2829	0.2478	5008	,	,		18821	0.0149		0.4046	False		,,,				2504	0.2996					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.3952-350T>C	6.37:g.155571697T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.M1326T	ENST00000461783.3	37	c.3977	CCDS34558.1	6	554	0.25366300366300365	141	0.2865853658536585	97	0.26795580110497236	13	0.022727272727272728	303	0.3997361477572559	T	3.449	-0.112331	0.06881	.	.	ENSG00000146426	ENST00000456144;ENST00000529824	T;T	0.04119	3.7;3.7	2.88	-0.963	0.10330	.	.	.	.	.	T	0.00580	0.0019	.	.	.	0.80722	P	0.0	B	0.06786	0.001	B	0.09377	0.004	T	0.45991	-0.9223	7	0.10377	T	0.69	.	3.0215	0.06077	0.0:0.2551:0.2312:0.5138	rs1041474;rs17262156;rs57485233;rs1041474	1326	Q8IVF5-2	.	T	1326	ENSP00000407746:M1326T;ENSP00000433348:M1326T	ENSP00000407746:M1326T	M	+	2	0	TIAM2	155613389	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	0.264000	0.18497	-0.180000	0.10637	0.533000	0.62120	ATG	TIAM2	-	NULL	ENSG00000146426		0.493	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2	48	0.00	0	T	NM_012454		155571697	155571697	+1	no_errors	ENST00000456144	ensembl	human	known	69_37n	missense	27	10.00	3	SNP	0.000	C
TIMP1	7076	genome.wustl.edu	37	X	47444879	47444879	+	Intron	SNP	G	G	C	rs5953060	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:47444879G>C	ENST00000218388.4	+	5	498				SYN1_ENST00000295987.7_Intron|TIMP1_ENST00000377018.2_Missense_Mutation_p.G83A|MIR4769_ENST00000584126.1_RNA|TIMP1_ENST00000377017.1_Intron|SYN1_ENST00000340666.4_Intron|TIMP1_ENST00000456754.2_3'UTR	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1						aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|large_intestine(2)	3						CGGGCCTTTGGCAGCTTGGCA	0.592													c|||	1784	0.472583	0.3828	0.3184	3775	,	,		11048	0.3452		0.3479	False		,,,				2504	0.3671					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.329-63G>C	X.37:g.47444879G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14252|Q9UCU1	Missense_Mutation	SNP	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP	p.G83A	ENST00000218388.4	37	c.248	CCDS14281.1	X	754|754	0.45449065702230257|0.45449065702230257	110|110	0.3089887640449438|0.3089887640449438	79|79	0.2762237762237762|0.2762237762237762	121|121	0.275|0.275	196|196	0.3234323432343234|0.3234323432343234	c|c	0.001|0.001	-2.932920|-2.932920	0.00053|0.00053	.|.	.|.	ENSG00000102265|ENSG00000102265	ENST00000445623|ENST00000377018	.|.	.|.	.|.	3.38|3.38	1.53|1.53	0.23141|0.23141	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.80722|0.80722	P|P	0.0|0.0	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.26916|0.26916	-1.0089|-1.0089	3|6	.|0.87932	.|D	.|0	.|.	3.2167|3.2167	0.06701|0.06701	0.0:0.5004:0.2209:0.2787|0.0:0.5004:0.2209:0.2787	rs5953060;rs6520276;rs59378722|rs5953060;rs6520276;rs59378722	.|83	.|B4DJK3	.|.	P|A	47|83	.|.	.|ENSP00000366217:G83A	A|G	+|+	1|2	0|0	TIMP1|TIMP1	47329823|47329823	0.006000|0.006000	0.16342|0.16342	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	0.019000|0.019000	0.13444|0.13444	-0.005000|-0.005000	0.14395|0.14395	-0.279000|-0.279000	0.10071|0.10071	GCA|GGC	TIMP1	-	smart_Prot_inh_TIMP	ENSG00000102265		0.592	TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMP1	HGNC	protein_coding	OTTHUMT00000056423.1	68	0.00	0	G	NM_003254		47444879	47444879	+1	no_errors	ENST00000377018	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	0.000	C
TMEM132C	92293	genome.wustl.edu	37	12	129189822	129189822	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:129189822G>C	ENST00000435159.2	+	9	2309	c.2309G>C	c.(2308-2310)cGa>cCa	p.R770P	TMEM132C_ENST00000537538.1_Missense_Mutation_p.R155P|TMEM132C_ENST00000315208.8_Missense_Mutation_p.R386P	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	770						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCACTGATCCGAGTGGACATG	0.642																																						dbGAP											0													24.0	29.0	27.0					12																	129189822		692	1591	2283	-	-	-	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2309G>C	12.37:g.129189822G>C	ENSP00000410852:p.Arg770Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YX8	Missense_Mutation	SNP	NULL	p.R770P	ENST00000435159.2	37	c.2309		12	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290335	0.59976	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.17213	2.29;2.29;2.29	4.84	2.7	0.31948	.	0.121402	0.33875	N	0.004469	T	0.29389	0.0732	M	0.66297	2.02	0.48135	D	0.999594	D	0.61080	0.989	P	0.61328	0.887	T	0.03993	-1.0986	10	0.72032	D	0.01	.	4.151	0.10238	0.5508:0.0:0.4492:0.0	.	770	Q8N3T6	T132C_HUMAN	P	770;386;155	ENSP00000410852:R770P;ENSP00000324458:R386P;ENSP00000438477:R155P	ENSP00000324458:R386P	R	+	2	0	TMEM132C	127755775	0.820000	0.29190	0.907000	0.35723	0.589000	0.36550	2.600000	0.46240	1.021000	0.39600	0.655000	0.94253	CGA	TMEM132C	-	NULL	ENSG00000181234		0.642	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		43	0.00	0	G	XM_044062		129189822	129189822	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.971	C
TMEM191A	84222	genome.wustl.edu	37	22	21055502	21055502	+	RNA	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:21055502G>C	ENST00000450925.2	+	0	101					NR_026815.1		Q9H0A3	T191A_HUMAN	transmembrane protein 191A (pseudogene)							integral component of membrane (GO:0016021)											ttctgatgttgaacaatccct	0.368																																						dbGAP											0													160.0	120.0	132.0					22																	21055502		692	1591	2283	-	-	-			0			AL136879		22q11.21	2012-04-20	2012-04-20		ENSG00000226287	ENSG00000226287			25317	pseudogene	pseudogene			"""transmembrane protein 191A"""			11230166	Standard	NR_026815		Approved	DKFZp434N035, TMEM191AP	uc002zsx.1	Q9H0A3	OTTHUMG00000150164		22.37:g.21055502G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8E2	RNA	SNP	-	NULL	ENST00000450925.2	37	NULL		22																																																																																			TMEM191A	-	-	ENSG00000226287		0.368	TMEM191A-001	KNOWN	basic	processed_transcript	TMEM191A	HGNC	processed_transcript	OTTHUMT00000316649.1	26	0.00	0	G			21055502	21055502	+1	no_errors	ENST00000359859	ensembl	human	known	69_37n	rna	33	15.38	6	SNP	0.322	C
TMEM191A	84222	genome.wustl.edu	37	22	21056938	21056938	+	RNA	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr22:21056938G>C	ENST00000450925.2	+	0	1258					NR_026815.1		Q9H0A3	T191A_HUMAN	transmembrane protein 191A (pseudogene)							integral component of membrane (GO:0016021)											GGCGGCGCGGGAGCGCGCGCA	0.687																																						dbGAP											0																																										-	-	-			0			AL136879		22q11.21	2012-04-20	2012-04-20		ENSG00000226287	ENSG00000226287			25317	pseudogene	pseudogene			"""transmembrane protein 191A"""			11230166	Standard	NR_026815		Approved	DKFZp434N035, TMEM191AP	uc002zsx.1	Q9H0A3	OTTHUMG00000150164		22.37:g.21056938G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8E2	RNA	SNP	-	NULL	ENST00000450925.2	37	NULL		22																																																																																			TMEM191A	-	-	ENSG00000226287		0.687	TMEM191A-001	KNOWN	basic	processed_transcript	TMEM191A	HGNC	processed_transcript	OTTHUMT00000316649.1	43	0.00	0	G			21056938	21056938	+1	no_errors	ENST00000450925	ensembl	human	known	69_37n	rna	32	17.95	7	SNP	0.893	C
TNRC18	84629	genome.wustl.edu	37	7	5401603	5401603	+	Missense_Mutation	SNP	C	C	T	rs570365021		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:5401603C>T	ENST00000430969.1	-	13	4805	c.4457G>A	c.(4456-4458)cGg>cAg	p.R1486Q	TNRC18_ENST00000399537.4_Missense_Mutation_p.R1486Q	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1486							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CTCGGCCAGCCGCATCCGGAA	0.667													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12792	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													19.0	22.0	21.0					7																	5401603		2075	4206	6281	-	-	-	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4457G>A	7.37:g.5401603C>T	ENSP00000395538:p.Arg1486Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.R1486Q	ENST00000430969.1	37	c.4457	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042577	0.93685	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.21543	2.31;2.31;2.0	5.52	5.52	0.82312	.	0.000000	0.40469	N	0.001093	T	0.32315	0.0825	M	0.77103	2.36	0.38951	D	0.958359	P	0.52577	0.954	B	0.43728	0.429	T	0.23904	-1.0175	10	0.25751	T	0.34	.	19.4381	0.94806	0.0:1.0:0.0:0.0	.	1486	O15417	TNC18_HUMAN	Q	1486;1486;541;19	ENSP00000382452:R1486Q;ENSP00000395538:R1486Q;ENSP00000395990:R19Q	ENSP00000382452:R1486Q	R	-	2	0	TNRC18	5368129	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.007000	0.63984	2.606000	0.88127	0.561000	0.74099	CGG	TNRC18	-	NULL	ENSG00000182095		0.667	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		34	0.00	0	C			5401603	5401603	-1	no_errors	ENST00000399537	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	1.000	T
TRAV8-2	28684	genome.wustl.edu	37	14	22315274	22315274	+	RNA	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:22315274C>T	ENST00000390434.3	+	0	437									T cell receptor alpha variable 8-2																		AAGTACACATCAGCGGCCACC	0.493											OREG0022570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													143.0	142.0	142.0					14																	22315274		1936	4141	6077	-	-	-			0			AE000659		14q11.2	2012-02-07			ENSG00000211786	ENSG00000211786		"""T cell receptors / TRA locus"""	12147	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000168991		14.37:g.22315274C>T		Somatic	755	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.S71L	ENST00000390434.3	37	c.212		14																																																																																			TRAV8-2	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211786		0.493	TRAV8-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRAV8-2	HGNC	TR_V_gene	OTTHUMT00000401889.1	66	0.00	0	C	NG_001332		22315274	22315274	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390434	ensembl	human	known	69_37n	missense	63	14.86	11	SNP	0.001	T
TREML3P	340206	genome.wustl.edu	37	6	41176759	41176759	+	RNA	SNP	C	C	T	rs11962624	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr6:41176759C>T	ENST00000564680.1	-	0	669									triggering receptor expressed on myeloid cells-like 3, pseudogene																		TGGGGGGCAACGCTTAGGGCA	0.587													C|||	1355	0.270567	0.0393	0.3012	5008	,	,		19699	0.4038		0.3419	False		,,,				2504	0.3507					dbGAP											0																																										-	-	-			0			AF534825		6p21.1	2012-04-20	2012-04-20	2012-04-20	ENSG00000184106	ENSG00000184106			30806	pseudogene	pseudogene	"""TREM like transcript 3"""	609716	"""triggering receptor expressed on myeloid cells-like 3"""	TREML3		12645956	Standard	NR_027256		Approved	TLT3	uc003oqb.3		OTTHUMG00000177313		6.37:g.41176759C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000564680.1	37	NULL		6																																																																																			TREML3P	-	-	ENSG00000184106		0.587	TREML3P-002	KNOWN	basic	processed_transcript	TREML3P	HGNC	pseudogene	OTTHUMT00000436224.1	33	0.00	0	C			41176759	41176759	-1	no_errors	ENST00000564680	ensembl	human	known	69_37n	rna	21	16.00	4	SNP	0.000	T
TRIP11	9321	genome.wustl.edu	37	14	92472654	92472654	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:92472654C>G	ENST00000267622.4	-	11	2039	c.1666G>C	c.(1666-1668)Gag>Cag	p.E556Q		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	556					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		ACATCTAACTCTTTAGTAATG	0.308			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	dbGAP		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													95.0	91.0	92.0					14																	92472654		2202	4296	6498	-	-	-	SO:0001583	missense	0			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1666G>C	14.37:g.92472654C>G	ENSP00000267622:p.Glu556Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.E556Q	ENST00000267622.4	37	c.1666	CCDS9899.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.64|17.64	3.438611|3.438611	0.62955|0.62955	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.07021|.	3.23|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.098347|.	0.64402|.	D|.	0.000002|.	T|T	0.75406|0.75406	0.3845|0.3845	M|M	0.77103|0.77103	2.36|2.36	0.48632|0.48632	D|D	0.999683|0.999683	D;D|.	0.89917|.	0.992;1.0|.	P;D|.	0.77557|.	0.856;0.99|.	T|T	0.74896|0.74896	-0.3508|-0.3508	10|5	0.36615|.	T|.	0.2|.	.|.	13.9788|13.9788	0.64291|0.64291	0.0:0.9314:0.0:0.0686|0.0:0.9314:0.0:0.0686	.|.	292;556|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	Q|T	556;292|271	ENSP00000267622:E556Q|.	ENSP00000267622:E556Q|.	E|R	-|-	1|2	0|0	TRIP11|TRIP11	91542407|91542407	1.000000|1.000000	0.71417|0.71417	0.923000|0.923000	0.36655|0.36655	0.341000|0.341000	0.28922|0.28922	5.308000|5.308000	0.65768|0.65768	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GAG|AGA	TRIP11	-	NULL	ENSG00000100815		0.308	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	41	0.00	0	C			92472654	92472654	-1	no_errors	ENST00000267622	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	1.000	G
TUBGCP3	10426	genome.wustl.edu	37	13	113212675	113212675	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr13:113212675G>T	ENST00000261965.3	-	5	569	c.383C>A	c.(382-384)tCa>tAa	p.S128*	TUBGCP3_ENST00000375669.3_Nonsense_Mutation_p.S128*	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	128					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					GTAAGGGGTTGAGTGGGCATC	0.532																																						dbGAP											0													125.0	117.0	120.0					13																	113212675		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.383C>A	13.37:g.113212675G>T	ENSP00000261965:p.Ser128*	Somatic		WXS	Illumina GAIIx	Phase_IV	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Nonsense_Mutation	SNP	pfam_Spc97_Spc98	p.S128*	ENST00000261965.3	37	c.383	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	G	27.3	4.816916	0.90790	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	.	.	.	5.34	5.34	0.76211	.	0.120970	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.7931	19.1289	0.93397	0.0:0.0:1.0:0.0	.	.	.	.	X	128	.	ENSP00000261965:S128X	S	-	2	0	TUBGCP3	112260676	1.000000	0.71417	0.164000	0.22755	0.366000	0.29705	8.769000	0.91742	2.513000	0.84729	0.543000	0.68304	TCA	TUBGCP3	-	NULL	ENSG00000126216		0.532	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	38	0.00	0	G	NM_006322		113212675	113212675	-1	no_errors	ENST00000261965	ensembl	human	known	69_37n	nonsense	19	17.39	4	SNP	1.000	T
UBE2D3	7323	genome.wustl.edu	37	4	103747697	103747697	+	5'UTR	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:103747697C>G	ENST00000453744.2	-	0	482				UBE2D3_ENST00000394803.5_5'UTR|UBE2D3_ENST00000504211.1_5'Flank|UBE2D3_ENST00000357194.6_Intron|UBE2D3_ENST00000513098.1_5'UTR|UBE2D3_ENST00000321805.7_5'UTR|UBE2D3_ENST00000507845.1_5'Flank|UBE2D3_ENST00000350435.7_5'Flank|UBE2D3_ENST00000505207.1_5'Flank|UBE2D3_ENST00000343106.5_5'UTR|UBE2D3_ENST00000394801.4_5'UTR|UBE2D3_ENST00000394804.2_5'UTR|UBE2D3_ENST00000349311.8_5'UTR|RP11-10L12.4_ENST00000501133.2_RNA|UBE2D3_ENST00000338145.3_5'UTR|UBE2D3_ENST00000502404.1_5'Flank	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3						apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TCCTCACTCTCTCGGTGTATG	0.562																																						dbGAP											0													173.0	161.0	165.0					4																	103747697		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.-32G>C	4.37:g.103747697C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	RNA	SNP	-	NULL	ENST00000453744.2	37	NULL	CCDS3660.1	4																																																																																			UBE2D3	-	-	ENSG00000109332		0.562	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UBE2D3	HGNC	protein_coding	OTTHUMT00000253791.2	57	0.00	0	C	NM_181893		103747697	103747697	-1	no_errors	ENST00000513098	ensembl	human	known	69_37n	rna	51	10.53	6	SNP	0.997	G
UBL7	84993	genome.wustl.edu	37	15	74741602	74741602	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:74741602C>G	ENST00000567435.1	-	9	1270	c.807G>C	c.(805-807)caG>caC	p.Q269H	UBL7_ENST00000565335.1_Missense_Mutation_p.Q269H|UBL7_ENST00000361351.4_Missense_Mutation_p.Q269H|UBL7_ENST00000564488.1_Missense_Mutation_p.Q269H|UBL7_ENST00000395081.2_Missense_Mutation_p.Q269H			Q96S82	UBL7_HUMAN	ubiquitin-like 7	269										endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						CCAGCTCACTCTGGGTGATGG	0.662																																						dbGAP											0													37.0	40.0	39.0					15																	74741602		2197	4296	6493	-	-	-	SO:0001583	missense	0			BC007913	CCDS10263.1	15q23	2014-03-06	2014-03-06		ENSG00000138629	ENSG00000138629			28221	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived ubiquitin-like"", "" ubiquitin-like protein SB132"""	609748	"""ubiquitin-like 7 (bone marrow stromal cell-derived)"""			12644319	Standard	NM_201265		Approved	BMSC-UbP, MGC14421	uc002axy.1	Q96S82	OTTHUMG00000139001	ENST00000567435.1:c.807G>C	15.37:g.74741602C>G	ENSP00000457703:p.Gln269His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW57|Q96I03	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_Ubiquitin,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.Q269H	ENST00000567435.1	37	c.807	CCDS10263.1	15	.	.	.	.	.	.	.	.	.	.	C	18.18	3.565716	0.65651	.	.	ENSG00000138629	ENST00000361351;ENST00000395081	T;T	0.47869	0.83;0.83	5.77	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.60843	0.2300	L	0.60455	1.87	0.53005	D	0.999966	D;P	0.71674	0.998;0.524	D;B	0.79784	0.993;0.371	T	0.56438	-0.7979	10	0.31617	T	0.26	-25.1598	11.1164	0.48262	0.0:0.851:0.0:0.149	.	309;269	D3DW56;Q96S82	.;UBL7_HUMAN	H	269	ENSP00000354883:Q269H;ENSP00000378518:Q269H	ENSP00000354883:Q269H	Q	-	3	2	UBL7	72528655	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.182000	0.50910	0.795000	0.33922	-0.137000	0.14449	CAG	UBL7	-	NULL	ENSG00000138629		0.662	UBL7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBL7	HGNC	protein_coding	OTTHUMT00000419627.1	28	0.00	0	C	NM_032907, NM_201265		74741602	74741602	-1	no_errors	ENST00000361351	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	G
UBLCP1	134510	genome.wustl.edu	37	5	158710234	158710234	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:158710234G>A	ENST00000296786.6	+	10	1142	c.816G>A	c.(814-816)atG>atA	p.M272I		NM_145049.3	NP_659486.2	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase 1	272	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.|Phosphatase.					nucleolus (GO:0005730)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|kidney(3)|large_intestine(4)|ovary(1)	9	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCCTTTTATGAAAGCGCACC	0.299																																						dbGAP											0													90.0	89.0	89.0					5																	158710234		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK057996	CCDS4345.1	5q33.3	2010-06-21			ENSG00000164332	ENSG00000164332	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	28110	protein-coding gene	gene with protein product	"""CTD phosphatase-like with ubiquitin domain 1"""	609867				15883030	Standard	NM_145049		Approved	MGC10067, CPUB1	uc003lxq.2	Q8WVY7	OTTHUMG00000130305	ENST00000296786.6:c.816G>A	5.37:g.158710234G>A	ENSP00000296786:p.Met272Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQJ7|Q96DK5	Missense_Mutation	SNP	pfam_NIF,pfam_Ubiquitin,superfamily_HAD-like_dom,smart_Ubiquitin,smart_NIF,pfscan_NIF,pfscan_Ubiquitin_supergroup,tigrfam_HAD-SF_hydro_IIID	p.M272I	ENST00000296786.6	37	c.816	CCDS4345.1	5	.	.	.	.	.	.	.	.	.	.	G	16.39	3.111194	0.56398	.	.	ENSG00000164332	ENST00000296786	T	0.15834	2.39	5.55	4.69	0.59074	HAD-superfamily hydrolase, subfamily IIID (1);NLI interacting factor (3);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.10723	0.0262	N	0.11064	0.09	0.58432	D	0.999995	B	0.02656	0.0	B	0.06405	0.002	T	0.07214	-1.0784	10	0.72032	D	0.01	-15.5904	13.2086	0.59811	0.0742:0.0:0.9258:0.0	.	272	Q8WVY7	UBCP1_HUMAN	I	272	ENSP00000296786:M272I	ENSP00000296786:M272I	M	+	3	0	UBLCP1	158642812	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.384000	0.97219	1.480000	0.48289	-0.150000	0.13652	ATG	UBLCP1	-	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_HAD-SF_hydro_IIID	ENSG00000164332		0.299	UBLCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBLCP1	HGNC	protein_coding	OTTHUMT00000252650.2	49	0.00	0	G	NM_145049		158710234	158710234	+1	no_errors	ENST00000296786	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	1.000	A
UBN2	254048	genome.wustl.edu	37	7	138945999	138945999	+	Splice_Site	SNP	G	G	T	rs200761673		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:138945999G>T	ENST00000473989.3	+	6	907	c.907G>T	c.(907-909)Gtt>Ttt	p.V303F	UBN2_ENST00000288561.8_Splice_Site_p.V220F	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	303	Lys-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						TCTTCACAGAGTTGTGGCTCT	0.328																																						dbGAP											0													36.0	37.0	37.0					7																	138945999		1834	4093	5927	-	-	-	SO:0001630	splice_region_variant	0			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.906-1G>T	7.37:g.138945999G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	NULL	p.V303F	ENST00000473989.3	37	c.907	CCDS43655.2	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.43|13.43	2.236240|2.236240	0.39498|0.39498	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000483726|ENST00000486663;ENST00000473989;ENST00000288561	.|T;T;T	.|0.23950	.|1.88;1.88;1.88	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	.|0.166035	.|0.52532	.|D	.|0.000074	T|T	0.36276|0.36276	0.0961|0.0961	L|L	0.31804|0.31804	0.96|0.96	0.58432|0.58432	D|D	0.999997|0.999997	.|D	.|0.71674	.|0.998	.|P	.|0.61874	.|0.895	T|T	0.02161|0.02161	-1.1203|-1.1203	5|10	.|0.11485	.|T	.|0.65	-9.8639|-9.8639	20.2207|20.2207	0.98324|0.98324	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|303	.|Q6ZU65	.|UBN2_HUMAN	D|F	71|126;303;220	.|ENSP00000417849:V126F;ENSP00000418648:V303F;ENSP00000288561:V220F	.|ENSP00000288561:V220F	E|V	+|+	3|1	2|0	UBN2|UBN2	138596539|138596539	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	5.094000|5.094000	0.64523|0.64523	2.790000|2.790000	0.95986|0.95986	0.591000|0.591000	0.81541|0.81541	GAG|GTT	UBN2	-	NULL	ENSG00000157741		0.328	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBN2	HGNC	protein_coding	OTTHUMT00000349272.3	38	0.00	0	G	NM_173569	Missense_Mutation	138945999	138945999	+1	no_errors	ENST00000473989	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	T
USP1	7398	genome.wustl.edu	37	1	62905665	62905665	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:62905665C>G	ENST00000339950.4	+	2	942	c.127C>G	c.(127-129)Caa>Gaa	p.Q43E	USP1_ENST00000371146.1_Missense_Mutation_p.Q43E	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	43					DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		CACAGATTCTCAAGAAAATGA	0.318																																					Ovarian(122;1846 2315 3982 19504)	dbGAP											0													43.0	50.0	48.0					1																	62905665		2200	4296	6496	-	-	-	SO:0001583	missense	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.127C>G	1.37:g.62905665C>G	ENSP00000343526:p.Gln43Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.Q43E	ENST00000339950.4	37	c.127	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.423244	0.43020	.	.	ENSG00000162607	ENST00000452143;ENST00000442679;ENST00000371146;ENST00000339950	T;T;T	0.44482	0.92;2.24;2.24	5.56	5.56	0.83823	.	0.188630	0.46758	D	0.000268	T	0.21631	0.0521	N	0.14661	0.345	0.38117	D	0.937759	B	0.34015	0.435	B	0.29598	0.104	T	0.14615	-1.0466	10	0.07813	T	0.8	-10.6681	11.7431	0.51804	0.0:0.9182:0.0:0.0818	.	43	O94782	UBP1_HUMAN	E	43	ENSP00000403662:Q43E;ENSP00000360188:Q43E;ENSP00000343526:Q43E	ENSP00000343526:Q43E	Q	+	1	0	USP1	62678253	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.247000	0.65416	2.615000	0.88500	0.585000	0.79938	CAA	USP1	-	NULL	ENSG00000162607		0.318	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	42	0.00	0	C	NM_001017415		62905665	62905665	+1	no_errors	ENST00000339950	ensembl	human	known	69_37n	missense	37	15.56	7	SNP	1.000	G
USP19	10869	genome.wustl.edu	37	3	49154009	49154009	+	Silent	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr3:49154009G>A	ENST00000398888.2	-	7	1173	c.855C>T	c.(853-855)gtC>gtT	p.V285V	USP19_ENST00000398896.1_Silent_p.V91V|USP19_ENST00000417901.1_Silent_p.V386V|USP19_ENST00000453664.1_Silent_p.V376V|USP19_ENST00000434032.2_Silent_p.V386V|USP19_ENST00000398898.2_Silent_p.V323V|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000398892.3_Silent_p.V323V	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	285	CS 2. {ECO:0000255|PROSITE- ProRule:PRU00547}.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGTCATTCTTGACAAACGCCA	0.532																																						dbGAP											0													100.0	100.0	100.0					3																	49154009		2083	4224	6307	-	-	-	SO:0001819	synonymous_variant	0			AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.855C>T	3.37:g.49154009G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Silent	SNP	pfam_DUF1872,pfam_Peptidase_C19,pfam_Znf_MYND,pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain,pfscan_Znf_MYND,pfscan_Peptidase_C19	p.V285	ENST00000398888.2	37	c.855	CCDS43090.1	3																																																																																			USP19	-	pfam_DUF1872,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	ENSG00000172046		0.532	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USP19	HGNC	protein_coding	OTTHUMT00000257721.1	104	0.00	0	G	NM_006677		49154009	49154009	-1	no_errors	ENST00000398888	ensembl	human	known	69_37n	silent	71	16.47	14	SNP	1.000	A
WDFY3	23001	genome.wustl.edu	37	4	85701312	85701312	+	Silent	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:85701312G>C	ENST00000295888.4	-	26	4721	c.4314C>G	c.(4312-4314)gtC>gtG	p.V1438V	WDFY3_ENST00000322366.6_Silent_p.V1438V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1438					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGTTACTCTTGACCACACAAA	0.502																																						dbGAP											0													158.0	147.0	151.0					4																	85701312		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.4314C>G	4.37:g.85701312G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V1438	ENST00000295888.4	37	c.4314	CCDS3609.1	4																																																																																			WDFY3	-	NULL	ENSG00000163625		0.502	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	58	0.00	0	G	NM_014991		85701312	85701312	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	silent	38	22.45	11	SNP	1.000	C
DAW1	164781	genome.wustl.edu	37	2	228776996	228776996	+	Intron	SNP	T	T	C	rs3748862	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr2:228776996T>C	ENST00000309931.2	+	10	1056				DAW1_ENST00000545118.1_Intron|DAW1_ENST00000373666.2_Missense_Mutation_p.W334R	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1							cilium (GO:0005929)											tcgcccaggctggagtgcagt	0.493													C|||	2087	0.416733	0.3911	0.3588	5008	,	,		23721	0.3442		0.5666	False		,,,				2504	0.4131					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.973+5028T>C	2.37:g.228776996T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRY1|Q8N776	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W334R	ENST00000309931.2	37	c.1000	CCDS2470.1	2	977	0.44734432234432236	192	0.3902439024390244	149	0.4116022099447514	207	0.3618881118881119	429	0.5659630606860159	C	1.660	-0.511779	0.04200	.	.	ENSG00000123977	ENST00000373666	T	0.37411	1.2	0.225	-0.451	0.12214	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.46803	-0.9165	4	0.39692	T	0.17	.	.	.	.	rs3748862;rs56932248	.	.	.	R	334	ENSP00000362770:W334R	ENSP00000362770:W334R	W	+	1	0	WDR69	228485240	0.027000	0.19231	0.035000	0.18076	0.036000	0.12997	-1.987000	0.01483	-2.142000	0.00804	-2.166000	0.00325	TGG	WDR69	-	NULL	ENSG00000123977		0.493	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR69	HGNC	protein_coding	OTTHUMT00000331745.1	37	0.00	0	T	NM_178821		228776996	228776996	+1	no_errors	ENST00000373666	ensembl	human	novel	69_37n	missense	23	14.81	4	SNP	0.047	C
WFIKKN1	117166	genome.wustl.edu	37	16	682843	682843	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:682843G>T	ENST00000319070.2	+	2	755	c.433G>T	c.(433-435)Gcc>Tcc	p.A145S		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	145	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				GGACGCCGAGGCCTGCCTGCG	0.716																																						dbGAP											0													18.0	19.0	19.0					16																	682843		2140	4223	6363	-	-	-	SO:0001583	missense	0			AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.433G>T	16.37:g.682843G>T	ENSP00000324763:p.Ala145Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LDW0|Q8NBQ1|Q96S20	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Whey_acidic_protein_4-diS_core,pfam_Kazal-type_dom,pfam_Immunoglobulin,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like,prints_Prot_inh_Kunz-m	p.A145S	ENST00000319070.2	37	c.433	CCDS10414.1	16	.	.	.	.	.	.	.	.	.	.	g	19.00	3.741522	0.69304	.	.	ENSG00000127578	ENST00000319070	T	0.04049	3.72	4.93	4.93	0.64822	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	T	0.21145	0.0509	M	0.73217	2.22	0.52501	D	0.999955	D	0.89917	1.0	D	0.87578	0.998	T	0.00354	-1.1794	10	0.62326	D	0.03	.	16.7096	0.85381	0.0:0.0:1.0:0.0	.	145	Q96NZ8	WFKN1_HUMAN	S	145	ENSP00000324763:A145S	ENSP00000324763:A145S	A	+	1	0	WFIKKN1	622844	1.000000	0.71417	1.000000	0.80357	0.054000	0.15201	6.488000	0.73637	2.293000	0.77203	0.486000	0.48141	GCC	WFIKKN1	-	pfam_Kazal-type_dom	ENSG00000127578		0.716	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN1	HGNC	protein_coding	OTTHUMT00000206731.2	38	0.00	0	G	NM_053284		682843	682843	+1	no_errors	ENST00000319070	ensembl	human	known	69_37n	missense	16	40.00	12	SNP	1.000	T
WNK1	65125	genome.wustl.edu	37	12	989090	989090	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr12:989090C>T	ENST00000315939.6	+	11	3368	c.2725C>T	c.(2725-2727)Cag>Tag	p.Q909*	WNK1_ENST00000530271.2_Nonsense_Mutation_p.Q1407*|WNK1_ENST00000340908.4_Nonsense_Mutation_p.Q502*|WNK1_ENST00000537687.1_Intron|WNK1_ENST00000535572.1_Intron	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	909					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GCTGCCAAGTCAGGTTCACCC	0.532																																					Colon(19;451 567 6672 12618 28860)	dbGAP											0													126.0	108.0	114.0					12																	989090		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2725C>T	12.37:g.989090C>T	ENSP00000313059:p.Gln909*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q1407*	ENST00000315939.6	37	c.4219	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	C	45	11.923978	0.99618	.	.	ENSG00000060237	ENST00000315939;ENST00000530271;ENST00000340908;ENST00000535698	.	.	.	5.63	5.63	0.86233	.	0.000000	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-7.8622	17.8619	0.88784	0.0:1.0:0.0:0.0	.	.	.	.	X	909;1407;502;179	.	ENSP00000313059:Q909X	Q	+	1	0	WNK1	859351	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.770000	0.62309	2.642000	0.89623	0.557000	0.71058	CAG	WNK1	-	NULL	ENSG00000060237		0.532	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	63	0.00	0	C	NM_018979		989090	989090	+1	no_errors	ENST00000530271	ensembl	human	known	69_37n	nonsense	38	13.64	6	SNP	1.000	T
ZAN	7455	genome.wustl.edu	37	7	100350126	100350126	+	RNA	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr7:100350126G>C	ENST00000348028.3	+	0	2563				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTCCACAGAAGAGCCCACCAC	0.532																																						dbGAP											0													211.0	245.0	234.0					7																	100350126		1882	4094	5976	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100350126G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.E800Q	ENST00000348028.3	37	c.2398		7	.	.	.	.	.	.	.	.	.	.	g	11.46	1.644648	0.29246	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.72051	-0.62;-0.62;-0.62	3.37	-3.64	0.04515	.	.	.	.	.	T	0.50017	0.1591	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.13145	0.007;0.004	B;B	0.09377	0.004;0.002	T	0.26950	-1.0088	9	0.52906	T	0.07	.	7.2935	0.26380	0.3771:0.1389:0.484:0.0	.	800;800	F5H0T8;Q9Y493	.;ZAN_HUMAN	Q	800	ENSP00000445943:E800Q;ENSP00000445091:E800Q;ENSP00000444427:E800Q	ENSP00000423579:E800Q	E	+	1	0	ZAN	100188062	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.117000	0.03283	-1.221000	0.02591	-0.387000	0.06579	GAG	ZAN	-	NULL	ENSG00000146839		0.532	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	45	0.00	0	G	NM_003386		100350126	100350126	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	41	10.42	5	SNP	0.000	C
ZBTB33	10009	genome.wustl.edu	37	X	119388279	119388279	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chrX:119388279G>A	ENST00000326624.2	+	2	1237	c.1009G>A	c.(1009-1011)Gat>Aat	p.D337N	ZBTB33_ENST00000557385.1_Missense_Mutation_p.D337N	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	337					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						AATAATAGATGATGATGATGA	0.428																																						dbGAP											0													153.0	129.0	137.0					X																	119388279		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.1009G>A	X.37:g.119388279G>A	ENSP00000314153:p.Asp337Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.D337N	ENST00000326624.2	37	c.1009	CCDS14596.1	X	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735877	0.49045	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.10668	2.85;2.85	5.67	5.67	0.87782	.	0.070530	0.64402	D	0.000018	T	0.12178	0.0296	L	0.27053	0.805	0.37198	D	0.904249	P	0.52842	0.956	P	0.48454	0.578	T	0.11867	-1.0570	10	0.36615	T	0.2	-17.7232	13.5586	0.61775	0.0:0.1513:0.8487:0.0	.	337	Q86T24	KAISO_HUMAN	N	337	ENSP00000314153:D337N;ENSP00000450969:D337N	ENSP00000314153:D337N	D	+	1	0	ZBTB33;AC002086.1	119272307	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.722000	0.74735	2.527000	0.85204	0.600000	0.82982	GAT	ZBTB33	-	NULL	ENSG00000177485		0.428	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB33	HGNC	protein_coding	OTTHUMT00000058085.2	33	0.00	0	G	NM_006777		119388279	119388279	+1	no_errors	ENST00000326624	ensembl	human	known	69_37n	missense	24	13.79	4	SNP	1.000	A
ZC3H12A	80149	genome.wustl.edu	37	1	37948212	37948212	+	Intron	SNP	C	C	G	rs215205	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr1:37948212C>G	ENST00000373087.6	+	5	1041					NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGCCTGTGCCCTGTTTTCCTC	0.617													C|||	1673	0.334065	0.5159	0.1988	5008	,	,		16573	0.0585		0.3002	False		,,,				2504	0.5031					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.925+71C>G	1.37:g.37948212C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000373087.6	37	NULL	CCDS417.1	1																																																																																			ZC3H12A	-	-	ENSG00000163874		0.617	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12A	HGNC	protein_coding	OTTHUMT00000012154.2	88	0.00	0	C	NM_025079		37948212	37948212	+1	no_errors	ENST00000492829	ensembl	human	known	69_37n	rna	67	12.82	10	SNP	0.080	G
ZDHHC11	79844	genome.wustl.edu	37	5	710714	710714	+	Intron	SNP	T	T	C	rs72707058|rs70955289|rs144825362		TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr5:710714T>C	ENST00000424784.2	-	15	2007				ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			CAGTACTGTGTGCTCCCATTT	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-6A>G	5.37:g.710714T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.502	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		25	0.00	0	T	NM_024786		710714	710714	-1	no_errors	ENST00000522356	ensembl	human	known	69_37n	rna	33	15.38	6	SNP	0.232	C
ZFYVE26	23503	genome.wustl.edu	37	14	68264774	68264774	+	Silent	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:68264774C>T	ENST00000347230.4	-	11	2343	c.2205G>A	c.(2203-2205)gaG>gaA	p.E735E	ZFYVE26_ENST00000555452.1_Silent_p.E735E	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	735					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCCACTGGGCCTCAGAGACAA	0.562																																						dbGAP											0													95.0	99.0	98.0					14																	68264774		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2205G>A	14.37:g.68264774C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.E735	ENST00000347230.4	37	c.2205	CCDS9788.1	14																																																																																			ZFYVE26	-	NULL	ENSG00000072121		0.562	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	HGNC	protein_coding	OTTHUMT00000412736.2	82	0.00	0	C	NM_015346		68264774	68264774	-1	no_errors	ENST00000347230	ensembl	human	known	69_37n	silent	39	20.41	10	SNP	1.000	T
ZG16B	124220	genome.wustl.edu	37	16	2880415	2880415	+	Splice_Site	SNP	G	G	C	rs537078933	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr16:2880415G>C	ENST00000382280.3	+	2	160		c.e2-1		ZG16B_ENST00000572863.1_5'UTR	NM_145252.2	NP_660295.2	Q96DA0	ZG16B_HUMAN	zymogen granule protein 16B						retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5						TCTTCCCACAGAGCCCTGGGA	0.662																																						dbGAP											0													27.0	34.0	32.0					16																	2880415		2071	4199	6270	-	-	-	SO:0001630	splice_region_variant	0			BC009722	CCDS10479.2	16p13.3	2014-02-12	2012-12-07		ENSG00000162078	ENSG00000162078			30456	protein-coding gene	gene with protein product	"""jacalin-like lectin domain containing 2"""		"""zymogen granule protein 16 homolog B (rat)"""			12477932	Standard	NM_145252		Approved	HRPE773, PRO1567, JCLN2	uc002cru.3	Q96DA0	OTTHUMG00000128933	ENST00000382280.3:c.82-1G>C	16.37:g.2880415G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIY1|B2R4F6|Q6UW28	Splice_Site	SNP	-	e2-1	ENST00000382280.3	37	c.82-1	CCDS10479.2	16	.	.	.	.	.	.	.	.	.	.	g	6.763	0.509645	0.12883	.	.	ENSG00000162078	ENST00000382280	.	.	.	3.11	2.13	0.27403	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1724	0.31262	0.0:0.2478:0.7522:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZG16B	2820416	0.132000	0.22450	0.201000	0.23476	0.012000	0.07955	1.189000	0.32114	0.866000	0.35629	0.556000	0.70494	.	ZG16B	-	-	ENSG00000162078		0.662	ZG16B-001	KNOWN	basic|CCDS	protein_coding	ZG16B	HGNC	protein_coding	OTTHUMT00000250912.1	83	0.00	0	G	NM_145252	Intron	2880415	2880415	+1	no_errors	ENST00000382280	ensembl	human	known	69_37n	splice_site	61	12.86	9	SNP	0.751	C
ZNF208	7757	genome.wustl.edu	37	19	22154322	22154322	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:22154322C>G	ENST00000397126.4	-	4	3662	c.3514G>C	c.(3514-3516)Gaa>Caa	p.E1172Q	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCACATTCTTCACATTTGTAG	0.373																																						dbGAP											0													32.0	35.0	34.0					19																	22154322		2088	4229	6317	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3514G>C	19.37:g.22154322C>G	ENSP00000380315:p.Glu1172Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E1172Q	ENST00000397126.4	37	c.3514	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	13.04	2.119092	0.37436	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.18960	2.18	3.12	-1.92	0.07618	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08492	0.0211	.	.	.	0.09310	N	1	B	0.25850	0.136	B	0.21151	0.033	T	0.34925	-0.9809	8	0.19590	T	0.45	.	1.0242	0.01524	0.15:0.2755:0.3023:0.2721	.	1044	O43345	ZN208_HUMAN	Q	1172;1044	ENSP00000380315:E1172Q	ENSP00000380315:E1172Q	E	-	1	0	ZNF208	21946162	0.000000	0.05858	0.000000	0.03702	0.729000	0.41735	-4.428000	0.00235	-0.423000	0.07394	0.306000	0.20318	GAA	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	35	0.00	0	C	NM_007153		22154322	22154322	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.000	G
ZNF208	7757	genome.wustl.edu	37	19	22155757	22155757	+	Silent	SNP	G	G	A	rs7258849	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:22155757G>A	ENST00000397126.4	-	4	2227	c.2079C>T	c.(2077-2079)taC>taT	p.Y693Y	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	693					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTTCACATTTGTAGGGTTTCT	0.383																																						dbGAP											0													37.0	38.0	37.0					19																	22155757		1995	4179	6174	-	-	-	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2079C>T	19.37:g.22155757G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y693	ENST00000397126.4	37	c.2079	CCDS54240.1	19																																																																																			ZNF208	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.383	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	39	0.00	0	G	NM_007153		22155757	22155757	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.000	A
ZNF252P	286101	genome.wustl.edu	37	8	146202846	146202846	+	RNA	SNP	T	T	C	rs72499143	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr8:146202846T>C	ENST00000426361.2	-	0	1338					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						CATAGGGCTTTTCTCCTGTAT	0.393													T|||	798	0.159345	0.0855	0.2853	5008	,	,		20886	0.3036		0.0666	False		,,,				2504	0.1166					dbGAP											0																																										-	-	-			0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146202846T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000426361.2	37	NULL		8																																																																																			ZNF252P	-	-	ENSG00000196922		0.393	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	HGNC	pseudogene	OTTHUMT00000451422.1	43	0.00	0	T	NR_023392		146202846	146202846	-1	no_errors	ENST00000426361	ensembl	human	known	69_37n	rna	39	11.36	5	SNP	1.000	C
ZPR1	8882	genome.wustl.edu	37	11	116658327	116658327	+	Silent	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr11:116658327G>T	ENST00000227322.3	-	2	263	c.204C>A	c.(202-204)ccC>ccA	p.P68P		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		68					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		CTCTGAAGAAGGGAATCTTGG	0.522																																						dbGAP											0													44.0	46.0	45.0					11																	116658327		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000227322.3:c.204C>A	11.37:g.116658327G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAA0	Missense_Mutation	SNP	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	p.P68H	ENST00000227322.3	37	c.203	CCDS8375.1	11	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635735	0.29068	.	.	ENSG00000109917	ENST00000444935	T	0.74737	-0.87	5.61	-0.762	0.11034	.	0.093102	0.85682	D	0.000000	T	0.72851	0.3512	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68131	-0.5490	7	0.87932	D	0	-14.9753	4.6061	0.12378	0.262:0.0:0.4978:0.2401	.	.	.	.	H	68	ENSP00000390391:P68H	ENSP00000390391:P68H	P	-	2	0	ZNF259	116163537	0.111000	0.22076	0.992000	0.48379	0.955000	0.61496	-0.693000	0.05121	-0.158000	0.11040	-0.286000	0.09958	CCT	ZNF259	-	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	ENSG00000109917		0.522	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF259	HGNC	protein_coding	OTTHUMT00000106283.2	22	0.00	0	G			116658327	116658327	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444935	ensembl	human	novel	69_37n	missense	16	15.79	3	SNP	0.990	T
ZNF280D	54816	genome.wustl.edu	37	15	56981521	56981521	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr15:56981521G>T	ENST00000267807.7	-	8	863	c.647C>A	c.(646-648)tCt>tAt	p.S216Y	ZNF280D_ENST00000396245.1_5'UTR|ZNF280D_ENST00000559237.1_Missense_Mutation_p.S203Y|ZNF280D_ENST00000559000.1_Missense_Mutation_p.S203Y	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	216					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		AGCCTGGGAAGAAGTCACTGA	0.328																																						dbGAP											0													83.0	85.0	84.0					15																	56981521		2192	4292	6484	-	-	-	SO:0001583	missense	0			AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.647C>A	15.37:g.56981521G>T	ENSP00000267807:p.Ser216Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S216Y	ENST00000267807.7	37	c.647	CCDS32245.1	15	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016132	0.35606	.	.	ENSG00000137871	ENST00000267807;ENST00000455329;ENST00000260435	T	0.36878	1.23	4.35	3.42	0.39159	.	1.820450	0.03224	N	0.178019	T	0.48750	0.1517	L	0.57536	1.79	0.09310	N	0.999995	P;P	0.49447	0.924;0.619	P;P	0.53224	0.721;0.646	T	0.17531	-1.0366	10	0.87932	D	0	-2.234	4.698	0.12813	0.1903:0.0:0.636:0.1737	.	279;216	B4DHL1;Q6N043	.;Z280D_HUMAN	Y	216;203;52	ENSP00000267807:S216Y	ENSP00000260435:S52Y	S	-	2	0	ZNF280D	54768813	0.741000	0.28217	0.003000	0.11579	0.084000	0.17831	3.625000	0.54238	1.107000	0.41642	0.650000	0.86243	TCT	ZNF280D	-	NULL	ENSG00000137871		0.328	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF280D	HGNC	protein_coding	OTTHUMT00000418891.2	23	0.00	0	G	XM_370867		56981521	56981521	-1	no_errors	ENST00000267807	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.001	T
ZNF653	115950	genome.wustl.edu	37	19	11598467	11598467	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:11598467C>T	ENST00000293771.5	-	4	947	c.811G>A	c.(811-813)Gaa>Aaa	p.E271K	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						TCCAGGGCTTCAGGCCCATTG	0.662																																					Pancreas(83;980 1446 4542 6441 43352)	dbGAP											0													42.0	45.0	44.0					19																	11598467		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.811G>A	19.37:g.11598467C>T	ENSP00000293771:p.Glu271Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AS7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E271K	ENST00000293771.5	37	c.811	CCDS12261.1	19	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085720	0.76642	.	.	ENSG00000161914	ENST00000293771	T	0.13538	2.58	4.49	4.49	0.54785	.	0.330413	0.27966	N	0.017136	T	0.13457	0.0326	L	0.27053	0.805	0.37977	D	0.933467	P	0.51057	0.941	B	0.43658	0.426	T	0.09250	-1.0683	10	0.87932	D	0	-17.1015	16.3403	0.83080	0.0:1.0:0.0:0.0	.	271	Q96CK0	ZN653_HUMAN	K	271	ENSP00000293771:E271K	ENSP00000293771:E271K	E	-	1	0	ZNF653	11459467	0.979000	0.34478	0.916000	0.36221	0.762000	0.43233	3.283000	0.51701	2.210000	0.71456	0.561000	0.74099	GAA	ZNF653	-	NULL	ENSG00000161914		0.662	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF653	HGNC	protein_coding	OTTHUMT00000458836.2	52	0.00	0	C	NM_138783		11598467	11598467	-1	no_errors	ENST00000293771	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	0.891	T
ZNF676	163223	genome.wustl.edu	37	19	22363115	22363115	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:22363115C>G	ENST00000397121.2	-	3	1721	c.1404G>C	c.(1402-1404)aaG>aaC	p.K468N		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K468N(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CATGAATTCTCTTGTGTTTAG	0.398																																						dbGAP											1	Substitution - Missense(1)	lung(1)											123.0	128.0	127.0					19																	22363115		2153	4268	6421	-	-	-	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1404G>C	19.37:g.22363115C>G	ENSP00000380310:p.Lys468Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K468N	ENST00000397121.2	37	c.1404	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	4.158	0.027858	0.08054	.	.	ENSG00000196109	ENST00000397121	T	0.18657	2.2	0.81	0.81	0.18732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27765	0.0683	L	0.31845	0.965	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.11941	-1.0567	9	0.62326	D	0.03	.	2.5131	0.04661	0.0:0.4274:0.3203:0.2523	.	468	Q8N7Q3	ZN676_HUMAN	N	468	ENSP00000380310:K468N	ENSP00000380310:K468N	K	-	3	2	ZNF676	22154955	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-0.306000	0.08178	0.181000	0.19994	0.184000	0.17185	AAG	ZNF676	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.398	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	52	0.00	0	C	NM_001001411		22363115	22363115	-1	no_errors	ENST00000397121	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.004	G
ZNF382	84911	genome.wustl.edu	37	19	37117321	37117321	+	Silent	SNP	C	C	G			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:37117321C>G	ENST00000292928.2	+	5	635	c.522C>G	c.(520-522)acC>acG	p.T174T	CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000439428.1_Silent_p.T173T|ZNF382_ENST00000435416.1_Silent_p.T173T|ZNF382_ENST00000423582.1_Silent_p.T125T	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	174	Represses transcription. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TCCTCAATACCAAGCATGAGA	0.373																																						dbGAP											0													103.0	110.0	108.0					19																	37117321		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.522C>G	19.37:g.37117321C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T174	ENST00000292928.2	37	c.522	CCDS33004.1	19																																																																																			ZNF382	-	NULL	ENSG00000161298		0.373	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF382	HGNC	protein_coding	OTTHUMT00000109562.2	18	0.00	0	C	NM_032825		37117321	37117321	+1	no_errors	ENST00000292928	ensembl	human	known	69_37n	silent	23	20.00	6	SNP	0.000	G
ZNF839	55778	genome.wustl.edu	37	14	102808652	102808652	+	3'UTR	SNP	T	T	A			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr14:102808652T>A	ENST00000558850.1	+	0	2922				ZNF839_ENST00000442396.2_3'UTR|ZNF839_ENST00000420933.2_3'UTR|AL137229.1_ENST00000577622.1_RNA|ZNF839_ENST00000262236.5_3'UTR|ZNF839_ENST00000559185.1_3'UTR	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839								metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						ATTTTTCTAATGTGAATATTG	0.378																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.*136T>A	14.37:g.102808652T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	RNA	SNP	-	NULL	ENST00000558850.1	37	NULL	CCDS58336.1	14																																																																																			ZNF839	-	-	ENSG00000022976		0.378	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF839	HGNC	protein_coding	OTTHUMT00000415492.2	38	0.00	0	T	NM_018335		102808652	102808652	+1	no_errors	ENST00000420933	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	1.000	A
ZNF876P	642280	genome.wustl.edu	37	4	247825	247825	+	RNA	SNP	G	G	A	rs10028482	byFrequency	TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr4:247825G>A	ENST00000356347.3	+	0	649					NR_027481.1		Q49A33	Z876P_HUMAN	zinc finger protein 876, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GAACGTGTCAGAATCTTTACC	0.398													A|||	1460	0.291534	0.3638	0.3285	5008	,	,		19234	0.1518		0.2207	False		,,,				2504	0.3845					dbGAP											0																																										-	-	-			0			BC028359		4p16.3	2011-04-20	2010-08-03	2009-07-22	ENSG00000198155	ENSG00000198155			32472	pseudogene	pseudogene							Standard	NR_027481		Approved		uc010iba.4	Q49A33	OTTHUMG00000159874		4.37:g.247825G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000356347.3	37	NULL		4																																																																																			ZNF876P	-	-	ENSG00000198155		0.398	ZNF876P-001	KNOWN	basic	processed_transcript	ZNF876P	HGNC	pseudogene	OTTHUMT00000357870.2	24	0.00	0	G	NR_027481		247825	247825	+1	no_errors	ENST00000356347	ensembl	human	known	69_37n	rna	14	17.65	3	SNP	0.778	A
ZSCAN1	284312	genome.wustl.edu	37	19	58549454	58549454	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W6-01A-12D-A228-09	TCGA-AC-A3W6-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81fd007e-f718-4cfb-909b-88944ac9712d	648d0ca0-d1fb-4dcb-a056-291b9a1fa261	g.chr19:58549454G>C	ENST00000282326.1	+	3	497	c.250G>C	c.(250-252)Gag>Cag	p.E84Q	ZSCAN1_ENST00000601162.1_Missense_Mutation_p.E84Q|ZSCAN1_ENST00000391700.1_Missense_Mutation_p.E84Q	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	84	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GCTGGTGCTGGAGCAGTTCCT	0.716																																						dbGAP											0													18.0	18.0	18.0					19																	58549454		2199	4295	6494	-	-	-	SO:0001583	missense	0			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.250G>C	19.37:g.58549454G>C	ENSP00000282326:p.Glu84Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E84Q	ENST00000282326.1	37	c.250	CCDS12969.1	19	.	.	.	.	.	.	.	.	.	.	G	18.39	3.613604	0.66672	.	.	ENSG00000152467	ENST00000391700;ENST00000282326	T;T	0.16597	2.33;2.33	2.09	2.09	0.27110	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.50565	0.1623	H	0.96048	3.76	0.25186	N	0.99016	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.994	T	0.36962	-0.9726	9	0.87932	D	0	.	7.6073	0.28110	0.0:0.0:1.0:0.0	.	84;84	Q8NBB4;Q8NBB4-2	ZSCA1_HUMAN;.	Q	84	ENSP00000375581:E84Q;ENSP00000282326:E84Q	ENSP00000282326:E84Q	E	+	1	0	ZSCAN1	63241266	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.679000	0.61649	1.170000	0.42753	0.407000	0.27541	GAG	ZSCAN1	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000152467		0.716	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	HGNC	protein_coding	OTTHUMT00000466427.1	48	0.00	0	G	NM_182572		58549454	58549454	+1	no_errors	ENST00000282326	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	1.000	C
