#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48431660	48431660	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr7:48431660C>T	ENST00000435803.1	+	38	11821	c.11797C>T	c.(11797-11799)Cgg>Tgg	p.R3933W		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3933	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CCTCACCGTCCGGGAACATTT	0.512																																						dbGAP											0													126.0	129.0	128.0					7																	48431660		2023	4177	6200	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11797C>T	7.37:g.48431660C>T	ENSP00000411096:p.Arg3933Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R3933W	ENST00000435803.1	37	c.11797	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	7.673	0.687454	0.14973	.	.	ENSG00000179869	ENST00000435803	D	0.94613	-3.47	5.32	-3.0	0.05480	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.463917	0.15518	U	0.258162	D	0.90099	0.6907	M	0.64080	1.96	0.09310	N	1	B;B	0.17852	0.002;0.024	B;B	0.14023	0.004;0.01	T	0.80694	-0.1268	10	0.72032	D	0.01	.	4.8348	0.13458	0.4653:0.3182:0.0:0.2165	.	1635;3933	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	W	3933	ENSP00000411096:R3933W	ENSP00000411096:R3933W	R	+	1	2	ABCA13	48402206	0.144000	0.22641	0.000000	0.03702	0.086000	0.17979	0.830000	0.27462	-0.653000	0.05401	-0.518000	0.04402	CGG	ABCA13	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000179869		0.512	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	77	0.00	0	C	NM_152701		48431660	48431660	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	0.000	T
ABCA9	10350	genome.wustl.edu	37	17	67023189	67023189	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr17:67023189delG	ENST00000340001.4	-	15	2189	c.1978delC	c.(1978-1980)ctgfs	p.L660fs	ABCA9_ENST00000453985.2_Frame_Shift_Del_p.L660fs|ABCA9_ENST00000370732.2_Frame_Shift_Del_p.L660fs	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	660	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CCCTCTTTCAGGAGATTCCAT	0.428																																						dbGAP											0													85.0	85.0	85.0					17																	67023189		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.1978delC	17.37:g.67023189delG	ENSP00000342216:p.Leu660fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L660fs	ENST00000340001.4	37	c.1978	CCDS11681.1	17																																																																																			ABCA9	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154258		0.428	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	39	0.00	0	G	NM_172386		67023189	67023189	-1	no_errors	ENST00000340001	ensembl	human	known	69_37n	frame_shift_del	32	15.79	6	DEL	0.990	-
ADSSL1	122622	genome.wustl.edu	37	14	105207543	105207543	+	Silent	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr14:105207543G>A	ENST00000330877.2	+	8	841	c.756G>A	c.(754-756)gtG>gtA	p.V252V	ADSSL1_ENST00000332972.5_Silent_p.V295V	NM_152328.3	NP_689541.1			adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		AGATCCTGGTGGAGGGTGCCA	0.602																																						dbGAP											0													52.0	55.0	54.0					14																	105207543		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000330877.2:c.756G>A	14.37:g.105207543G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Adenylosuccinate_synthetase,smart_Adenylosuccinate_synthetase,tigrfam_Adenylosuccinate_synthetase	p.V295	ENST00000330877.2	37	c.885	CCDS9990.1	14																																																																																			ADSSL1	-	pfam_Adenylosuccinate_synthetase,smart_Adenylosuccinate_synthetase,tigrfam_Adenylosuccinate_synthetase	ENSG00000185100		0.602	ADSSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSSL1	HGNC	protein_coding	OTTHUMT00000410529.1	82	0.00	0	G			105207543	105207543	+1	no_errors	ENST00000332972	ensembl	human	known	69_37n	silent	62	16.22	12	SNP	1.000	A
AFP	174	genome.wustl.edu	37	4	74321366	74321366	+	3'UTR	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr4:74321366G>A	ENST00000395792.2	+	0	1959				AFP_ENST00000226359.2_Missense_Mutation_p.E602K|AFP_ENST00000506820.1_3'UTR	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein						ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAGACAAAACGAGTCTTTCAT	0.274									Alpha-Fetoprotein, Hereditary Persistence of																													dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.*29G>A	4.37:g.74321366G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBU3	Missense_Mutation	SNP	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr,prints_Alpha-fetoprotein,prints_Serum_albumin	p.E602K	ENST00000395792.2	37	c.1804	CCDS3556.1	4	.	.	.	.	.	.	.	.	.	.	G	6.097	0.386181	0.11524	.	.	ENSG00000081051	ENST00000226359	T	0.56275	0.47	4.46	-2.6	0.06190	.	.	.	.	.	T	0.16727	0.0402	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21930	-1.0231	6	0.02654	T	1	.	0.8044	0.01081	0.3907:0.2373:0.2199:0.1521	.	.	.	.	K	602	ENSP00000226359:E602K	ENSP00000226359:E602K	E	+	1	0	AFP	74540230	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	0.630000	0.24553	-0.680000	0.05211	-0.140000	0.14226	GAG	AFP	-	superfamily_Serum_albumin-like,pirsf_Serum_albumin_subgr	ENSG00000081051		0.274	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	HGNC	protein_coding	OTTHUMT00000252284.3	75	0.00	0	G			74321366	74321366	+1	no_errors	ENST00000226359	ensembl	human	putative	69_37n	missense	84	15.15	15	SNP	0.000	A
AFP	174	genome.wustl.edu	37	4	74321384	74321384	+	3'UTR	SNP	G	G	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr4:74321384G>T	ENST00000395792.2	+	0	1977				AFP_ENST00000226359.2_Nonsense_Mutation_p.E608*|AFP_ENST00000506820.1_3'UTR	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein						ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CATTCGGTGTGAACTTTTCTC	0.279									Alpha-Fetoprotein, Hereditary Persistence of																													dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.*47G>T	4.37:g.74321384G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBU3	Nonsense_Mutation	SNP	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr,prints_Alpha-fetoprotein,prints_Serum_albumin	p.E608*	ENST00000395792.2	37	c.1822	CCDS3556.1	4	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997102	0.54147	.	.	ENSG00000081051	ENST00000226359	.	.	.	4.56	0.925	0.19424	.	.	.	.	.	.	.	.	.	.	.	0.27802	N	0.942433	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.6311	0.22857	0.4016:0.0:0.5984:0.0	.	.	.	.	X	608	.	ENSP00000226359:E608X	E	+	1	0	AFP	74540248	0.002000	0.14202	0.001000	0.08648	0.087000	0.18053	0.122000	0.15687	0.018000	0.15052	-0.244000	0.11960	GAA	AFP	-	pirsf_Serum_albumin_subgr	ENSG00000081051		0.279	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	HGNC	protein_coding	OTTHUMT00000252284.3	82	0.00	0	G			74321384	74321384	+1	no_errors	ENST00000226359	ensembl	human	putative	69_37n	nonsense	90	16.67	18	SNP	0.004	T
ALDH16A1	126133	genome.wustl.edu	37	19	49973687	49973687	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:49973687C>T	ENST00000293350.4	+	17	2535	c.2372C>T	c.(2371-2373)gCg>gTg	p.A791V	ALDH16A1_ENST00000433981.2_Missense_Mutation_p.A626V|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.A740V|ALDH16A1_ENST00000540132.1_Missense_Mutation_p.A628V|CTD-3148I10.9_ENST00000599536.1_Intron	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	791						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CTGCGAGTGGCGCGGACCAAG	0.682																																						dbGAP											0													18.0	22.0	21.0					19																	49973687		2199	4294	6493	-	-	-	SO:0001583	missense	0			AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.2372C>T	19.37:g.49973687C>T	ENSP00000293350:p.Ala791Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH	p.A791V	ENST00000293350.4	37	c.2372	CCDS12766.1	19	.	.	.	.	.	.	.	.	.	.	C	11.52	1.661802	0.29515	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.71579	-0.58;-0.32;-0.51;-0.51	5.02	5.02	0.67125	.	0.625587	0.15777	N	0.245154	T	0.63379	0.2506	N	0.02225	-0.63	0.33177	D	0.54911	P;D;P	0.89917	0.785;1.0;0.791	B;D;B	0.75484	0.127;0.986;0.167	T	0.64706	-0.6344	10	0.15499	T	0.54	-5.9073	14.2431	0.65971	0.0:1.0:0.0:0.0	.	628;740;791	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	V	791;740;628;626	ENSP00000293350:A791V;ENSP00000410142:A740V;ENSP00000445088:A628V;ENSP00000398675:A626V	ENSP00000293350:A791V	A	+	2	0	ALDH16A1	54665499	0.984000	0.35163	0.973000	0.42090	0.621000	0.37620	4.096000	0.57734	2.498000	0.84270	0.603000	0.83216	GCG	ALDH16A1	-	pirsf_Aldehyde_DH	ENSG00000161618		0.682	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH16A1	HGNC	protein_coding	OTTHUMT00000465358.1	50	0.00	0	C	NM_153329		49973687	49973687	+1	no_errors	ENST00000293350	ensembl	human	known	69_37n	missense	80	19.19	19	SNP	0.993	T
ANKRD65	441869	genome.wustl.edu	37	1	1354749	1354749	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:1354749G>A	ENST00000537107.1	-	4	1068	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	RP4-758J18.7_ENST00000428932.1_RNA|ANKRD65_ENST00000520296.1_3'UTR|ANKRD65_ENST00000454272.1_5'UTR|ANKRD65_ENST00000442470.1_Silent_p.L130L|ANKRD65_ENST00000427211.1_Silent_p.L130L	NM_001145210.2	NP_001138682.1	E5RJM6	ANR65_HUMAN	ankyrin repeat domain 65	311										breast(1)	1						TGGCCTTCCCGAGAGGCGTGA	0.692																																						dbGAP											0													29.0	42.0	38.0					1																	1354749		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS55558.1, CCDS57962.1, CCDS57963.1	1p36.33	2013-01-10			ENSG00000235098	ENSG00000235098		"""Ankyrin repeat domain containing"""	42950	protein-coding gene	gene with protein product							Standard	NM_001243535		Approved		uc010nyo.2	E5RJM6	OTTHUMG00000002911	ENST00000537107.1:c.931C>T	1.37:g.1354749G>A	ENSP00000445688:p.Arg311Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KR93	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R311W	ENST00000537107.1	37	c.931	CCDS55558.1	1	.	.	.	.	.	.	.	.	.	.	G	5.879	0.346284	0.11126	.	.	ENSG00000235098	ENST00000537107	T	0.66460	-0.21	4.65	0.418	0.16429	.	.	.	.	.	T	0.52451	0.1735	L	0.46819	1.47	0.09310	N	1	B	0.32051	0.354	B	0.26770	0.073	T	0.30765	-0.9967	9	0.33141	T	0.24	.	7.0435	0.25033	0.1552:0.0:0.6024:0.2424	.	311	E5RJM6	ANR65_HUMAN	W	311	ENSP00000445688:R311W	ENSP00000445688:R311W	R	-	1	2	RP4-758J18.6	1344612	0.000000	0.05858	0.045000	0.18777	0.002000	0.02628	-0.004000	0.12878	-0.196000	0.10366	-2.127000	0.00345	CGG	ANKRD65	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000235098		0.692	ANKRD65-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD65	HGNC	protein_coding		128	0.00	0	G			1354749	1354749	-1	no_errors	ENST00000537107	ensembl	human	known	69_37n	missense	114	12.31	16	SNP	0.000	A
C10orf90	118611	genome.wustl.edu	37	10	128209867	128209867	+	Splice_Site	DEL	C	C	-			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr10:128209867delC	ENST00000284694.7	-	1	143		c.e1+1		C10orf90_ENST00000544758.1_Intron|C10orf90_ENST00000454341.1_Splice_Site|C10orf90_ENST00000368674.1_Intron|C10orf90_ENST00000392694.1_Splice_Site|C10orf90_ENST00000356858.3_5'Flank	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90						mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TTAGAACATACCTTCTCCAGA	0.358																																						dbGAP											0													68.0	67.0	67.0					10																	128209867		2202	4298	6500	-	-	-	SO:0001630	splice_region_variant	0			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.22+1G>-	10.37:g.128209867delC		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Splice_Site	DEL	-	e1+1	ENST00000284694.7	37	c.22+1	CCDS31310.1	10																																																																																			C10orf90	-	-	ENSG00000154493		0.358	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf90	HGNC	protein_coding		49	0.00	0	C	NM_001004298	Intron	128209867	128209867	-1	no_errors	ENST00000284694	ensembl	human	known	69_37n	splice_site_del	38	15.56	7	DEL	0.998	-
C17orf104	284071	genome.wustl.edu	37	17	42751400	42751400	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr17:42751400C>A	ENST00000409122.2	+	8	2837	c.2695C>A	c.(2695-2697)Cgc>Agc	p.R899S	RP11-1072C15.4_ENST00000591628.1_RNA	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	899										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						TCGGAAAACACGCACTGCCCT	0.408																																						dbGAP											0													125.0	104.0	110.0					17																	42751400		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.2695C>A	17.37:g.42751400C>A	ENSP00000386452:p.Arg899Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	NULL	p.R899S	ENST00000409122.2	37	c.2695	CCDS45703.2	17	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265136	0.59431	.	.	ENSG00000180336	ENST00000409122	T	0.71222	-0.55	5.83	5.83	0.93111	.	.	.	.	.	T	0.81721	0.4882	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82172	-0.0589	9	0.87932	D	0	-22.5504	20.1374	0.98035	0.0:1.0:0.0:0.0	.	899	A2RUB1	CQ104_HUMAN	S	899	ENSP00000386452:R899S	ENSP00000386452:R899S	R	+	1	0	C17orf104	40106926	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.362000	0.59467	2.763000	0.94921	0.563000	0.77884	CGC	C17orf104	-	NULL	ENSG00000180336		0.408	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf104	HGNC	protein_coding	OTTHUMT00000329171.2	76	0.00	0	C	NM_001145080		42751400	42751400	+1	no_errors	ENST00000409122	ensembl	human	known	69_37n	missense	37	45.59	31	SNP	1.000	A
C1orf127	148345	genome.wustl.edu	37	1	11024262	11024262	+	5'UTR	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:11024262G>A	ENST00000377008.4	-	0	438				C1orf127_ENST00000377004.4_Missense_Mutation_p.R147C			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127											NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		ATTATGTAGCGATCACTCCGC	0.498																																						dbGAP											0													117.0	99.0	105.0					1																	11024262		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.-9C>T	1.37:g.11024262G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	superfamily_DNA-bd_dom_put	p.R147C	ENST00000377008.4	37	c.439		1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.773091	0.31411	.	.	ENSG00000175262	ENST00000377004	T	0.31769	1.48	4.05	-5.4	0.02656	.	.	.	.	.	T	0.14227	0.0344	N	0.19112	0.55	0.19945	N	0.999941	.	.	.	.	.	.	T	0.30534	-0.9975	6	.	.	.	.	2.9659	0.05908	0.1686:0.3653:0.3479:0.1182	.	.	.	.	C	147	ENSP00000366203:R147C	.	R	-	1	0	C1orf127	10946849	0.028000	0.19301	0.001000	0.08648	0.069000	0.16628	-0.006000	0.12833	-0.803000	0.04415	0.561000	0.74099	CGC	C1orf127	-	NULL	ENSG00000175262		0.498	C1orf127-202	KNOWN	basic	protein_coding	C1orf127	HGNC	protein_coding		111	0.00	0	G	NM_173507		11024262	11024262	-1	no_errors	ENST00000377004	ensembl	human	known	69_37n	missense	70	21.35	19	SNP	0.029	A
ZGRF1	55345	genome.wustl.edu	37	4	113508772	113508772	+	Silent	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr4:113508772C>T	ENST00000505019.1	-	12	3566	c.3441G>A	c.(3439-3441)ctG>ctA	p.L1147L		NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		1147						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TTTGATATTTCAGCCACTTGC	0.408																																						dbGAP											0													58.0	47.0	51.0					4																	113508772		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000505019.1:c.3441G>A	4.37:g.113508772C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Silent	SNP	pfam_DUF2439,pfam_Znf_GRF	p.L1147	ENST00000505019.1	37	c.3441		4																																																																																			C4orf21	-	NULL	ENSG00000138658		0.408	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	HGNC	protein_coding	OTTHUMT00000256413.1	34	0.00	0	C			113508772	113508772	-1	no_errors	ENST00000505019	ensembl	human	known	69_37n	silent	25	24.24	8	SNP	1.000	T
C9orf9	11092	genome.wustl.edu	37	9	135759367	135759367	+	Silent	SNP	C	C	T	rs563527507		TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr9:135759367C>T	ENST00000372136.3	+	2	480	c.33C>T	c.(31-33)atC>atT	p.I11I	C9orf9_ENST00000356311.5_Silent_p.I11I|C9orf9_ENST00000350499.6_Silent_p.I11I			Q96E40	CI009_HUMAN	chromosome 9 open reading frame 9	11						cytoplasmic microtubule (GO:0005881)		p.?(1)		cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		TTCGCAGCATCGAGCAGAAGT	0.537																																						dbGAP											1	Unknown(1)	bone(1)											117.0	109.0	112.0					9																	135759367		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6955.1	9q34.13	2012-03-06			ENSG00000165698	ENSG00000165698			1367	protein-coding gene	gene with protein product							Standard	NM_018956		Approved		uc004cby.1	Q96E40	OTTHUMG00000020847	ENST00000372136.3:c.33C>T	9.37:g.135759367C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UGQ0	Silent	SNP	NULL	p.I11	ENST00000372136.3	37	c.33		9																																																																																			C9orf9	-	NULL	ENSG00000165698		0.537	C9orf9-001	KNOWN	basic	protein_coding	C9orf9	HGNC	protein_coding	OTTHUMT00000054806.1	60	0.00	0	C	NM_018956		135759367	135759367	+1	no_errors	ENST00000356311	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.140	T
CARS	833	genome.wustl.edu	37	11	3059366	3059366	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr11:3059366G>A	ENST00000397111.5	-	6	711	c.466C>T	c.(466-468)Cag>Tag	p.Q156*	CARS_ENST00000380525.4_Nonsense_Mutation_p.Q239*|CARS_ENST00000278224.9_Nonsense_Mutation_p.Q156*|CARS_ENST00000401769.3_Nonsense_Mutation_p.Q169*|CARS-AS1_ENST00000499962.1_RNA|CARS_ENST00000397114.3_Nonsense_Mutation_p.Q146*			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	156					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ACTGCGTGCTGAATCCGTTCG	0.478			T	ALK	ALCL						OREG0020690	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(61;932 1157 5961 20446 52152)	dbGAP		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	0													173.0	156.0	162.0					11																	3059366		2202	4298	6500	-	-	-	SO:0001587	stop_gained	0			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.466C>T	11.37:g.3059366G>A	ENSP00000380300:p.Gln156*	Somatic	608	WXS	Illumina GAIIx	Phase_IV	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Nonsense_Mutation	SNP	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-synt	p.Q239*	ENST00000397111.5	37	c.715	CCDS7742.1	11	.	.	.	.	.	.	.	.	.	.	G	12.75	2.032100	0.35893	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	.	.	.	3.86	1.94	0.25998	.	0.212905	0.40908	D	0.000988	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-19.9752	10.1935	0.43041	0.0:0.1478:0.6987:0.1535	.	.	.	.	X	239;156;156;146;169	.	ENSP00000278224:Q156X	Q	-	1	0	CARS	3015942	0.989000	0.36119	0.001000	0.08648	0.088000	0.18126	2.756000	0.47549	0.295000	0.22570	-0.268000	0.10319	CAG	CARS	-	pfam_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-synt	ENSG00000110619		0.478	CARS-001	KNOWN	basic|CCDS	protein_coding	CARS	HGNC	protein_coding	OTTHUMT00000030117.4	76	0.00	0	G	NM_001751		3059366	3059366	-1	no_errors	ENST00000380525	ensembl	human	known	69_37n	nonsense	61	10.29	7	SNP	0.004	A
CCNB3	85417	genome.wustl.edu	37	X	50053142	50053142	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chrX:50053142C>G	ENST00000376042.1	+	6	2271	c.1973C>G	c.(1972-1974)tCa>tGa	p.S658*	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Nonsense_Mutation_p.S658*|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	658					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					TCAAAAGAGTCATTGGCCATC	0.448																																						dbGAP											0													50.0	43.0	45.0					X																	50053142		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.1973C>G	X.37:g.50053142C>G	ENSP00000365210:p.Ser658*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Nonsense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.S658*	ENST00000376042.1	37	c.1973	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.508337	0.97624	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	.	.	.	3.28	-0.614	0.11590	.	2.685630	0.01197	N	0.007495	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.4552	0.00508	0.2006:0.3469:0.1939:0.2585	.	.	.	.	X	658	.	.	S	+	2	0	CCNB3	50069882	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	0.397000	0.20883	-0.282000	0.09128	-0.297000	0.09499	TCA	CCNB3	-	NULL	ENSG00000147082		0.448	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	42	0.00	0	C			50053142	50053142	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	nonsense	33	17.50	7	SNP	0.000	G
CDH1	999	genome.wustl.edu	37	16	68842658	68842659	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr16:68842658_68842659insA	ENST00000261769.5	+	5	785_786	c.594_595insA	c.(595-597)acafs	p.T199fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.T199fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	199	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AAGGAGCTGACACACCCCCTGT	0.411			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Unknown(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.595dupA	16.37:g.68842659_68842659dupA	ENSP00000261769:p.Thr199fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T198fs	ENST00000261769.5	37	c.594_595	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.411	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	55	0.00	0	-	NM_004360		68842658	68842659	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	9	40.00	6	INS	0.121:0.000	A
CELSR1	9620	genome.wustl.edu	37	22	46930419	46930419	+	Silent	SNP	G	G	C	rs372878563		TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr22:46930419G>C	ENST00000262738.3	-	1	2648	c.2649C>G	c.(2647-2649)ctC>ctG	p.L883L	CELSR1_ENST00000395964.1_Silent_p.L883L|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	883	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.L883L(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CATTGGCATCGAGGATGAGGA	0.557																																						dbGAP											1	Substitution - coding silent(1)	central_nervous_system(1)											93.0	70.0	78.0					22																	46930419		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.2649C>G	22.37:g.46930419G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_EGF-like_dom,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,pfscan_EG-like_dom,pfscan_Cadherin,prints_Cadherin	p.S258W	ENST00000262738.3	37	c.773	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	G	3.446	-0.112946	0.06881	.	.	ENSG00000075275	ENST00000454637	.	.	.	4.42	-8.85	0.00799	.	.	.	.	.	T	0.44726	0.1307	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52704	-0.8540	4	.	.	.	.	6.2234	0.20693	0.1987:0.5613:0.1013:0.1387	.	.	.	.	W	258	.	.	S	-	2	0	CELSR1	45309083	0.000000	0.05858	0.045000	0.18777	0.975000	0.68041	-2.405000	0.01045	-2.961000	0.00290	0.462000	0.41574	TCG	CELSR1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000075275		0.557	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	223	0.00	0	G	NM_014246		46930419	46930419	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000454637	ensembl	human	putative	69_37n	missense	111	11.90	15	SNP	0.064	C
CENPO	79172	genome.wustl.edu	37	2	25038422	25038422	+	Missense_Mutation	SNP	G	G	C	rs545448123		TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr2:25038422G>C	ENST00000380834.2	+	5	816	c.391G>C	c.(391-393)Gag>Cag	p.E131Q	CENPO_ENST00000260662.1_Missense_Mutation_p.E131Q|CENPO_ENST00000473706.1_Missense_Mutation_p.E125Q			Q9BU64	CENPO_HUMAN	centromere protein O	131					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TACTGCTTTTGAGGGGAACCT	0.483																																						dbGAP											0													170.0	153.0	159.0					2																	25038422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027859	CCDS1714.1, CCDS56113.1	2p23.3	2013-11-05			ENSG00000138092	ENSG00000138092			28152	protein-coding gene	gene with protein product		611504				16622420, 16622419	Standard	NM_024322		Approved	MGC11266, CENP-O	uc002rfp.2	Q9BU64	OTTHUMG00000125525	ENST00000380834.2:c.391G>C	2.37:g.25038422G>C	ENSP00000370214:p.Glu131Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDC0|D6W536|Q53T55|Q96JV3	Missense_Mutation	SNP	pfam_Centromere_CenpO	p.E131Q	ENST00000380834.2	37	c.391	CCDS1714.1	2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033353	0.75504	.	.	ENSG00000138092	ENST00000380834;ENST00000473706;ENST00000260662	T;T;T	0.55413	0.52;0.52;0.52	5.27	4.39	0.52855	.	0.123341	0.53938	D	0.000044	T	0.69886	0.3161	M	0.73598	2.24	0.46113	D	0.998878	D;D	0.69078	0.996;0.997	D;D	0.67382	0.919;0.951	T	0.74565	-0.3623	10	0.87932	D	0	-23.9034	13.399	0.60872	0.0761:0.0:0.9239:0.0	.	125;131	Q9BU64-2;Q9BU64	.;CENPO_HUMAN	Q	131;125;131	ENSP00000370214:E131Q;ENSP00000417787:E125Q;ENSP00000260662:E131Q	ENSP00000260662:E131Q	E	+	1	0	CENPO	24891926	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.468000	0.60162	1.454000	0.47793	0.650000	0.86243	GAG	CENPO	-	pfam_Centromere_CenpO	ENSG00000138092		0.483	CENPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPO	HGNC	protein_coding	OTTHUMT00000246856.2	112	0.00	0	G	NM_024322		25038422	25038422	+1	no_errors	ENST00000260662	ensembl	human	known	69_37n	missense	72	20.88	19	SNP	1.000	C
CNTNAP4	85445	genome.wustl.edu	37	16	76592633	76592633	+	3'UTR	SNP	G	G	A	rs12599021	byFrequency	TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr16:76592633G>A	ENST00000476707.1	+	0	4128				RP11-58C22.1_ENST00000563764.1_Intron|CNTNAP4_ENST00000307431.8_3'UTR|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4						cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						AATAGCCAGGGGTTCTCAATG	0.403													G|||	807	0.161142	0.0151	0.2954	5008	,	,		18330	0.1607		0.2545	False		,,,				2504	0.1677					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.*53G>A	16.37:g.76592633G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFZ6|Q86YZ7	RNA	SNP	-	NULL	ENST00000476707.1	37	NULL		16																																																																																			CNTNAP4	-	-	ENSG00000152910		0.403	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	36	0.00	0	G	NM_033401		76592633	76592633	+1	no_errors	ENST00000469589	ensembl	human	known	69_37n	rna	22	12.00	3	SNP	1.000	A
COBLL1	22837	genome.wustl.edu	37	2	165542501	165542501	+	Silent	SNP	T	T	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr2:165542501T>C	ENST00000392717.2	-	15	3574	c.3570A>G	c.(3568-3570)tcA>tcG	p.S1190S	SNORA70F_ENST00000384142.1_RNA|COBLL1_ENST00000194871.6_Silent_p.S1219S|COBLL1_ENST00000342193.4_Silent_p.S1152S|COBLL1_ENST00000375458.2_Silent_p.S1114S|COBLL1_ENST00000409184.3_Silent_p.S1152S			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1190						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						GGCTGAGTCTTGACCTTCCAT	0.428																																						dbGAP											0													147.0	118.0	128.0					2																	165542501		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3570A>G	2.37:g.165542501T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Silent	SNP	pfam_Cordon-bleu_domain,pfscan_WH2_dom	p.S1219	ENST00000392717.2	37	c.3657		2																																																																																			COBLL1	-	NULL	ENSG00000082438		0.428	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		52	0.00	0	T	NM_014900		165542501	165542501	-1	no_errors	ENST00000194871	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.535	C
COL11A2	1302	genome.wustl.edu	37	6	33133527	33133527	+	Missense_Mutation	SNP	C	C	A	rs267600980		TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr6:33133527C>A	ENST00000374708.4	-	61	4549	c.4291G>T	c.(4291-4293)Gat>Tat	p.D1431Y	COL11A2_ENST00000374713.1_Missense_Mutation_p.D1470Y|COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000357486.1_Missense_Mutation_p.D1496Y|COL11A2_ENST00000374712.1_Missense_Mutation_p.D1436Y|COL11A2_ENST00000361917.1_Missense_Mutation_p.D1410Y|COL11A2_ENST00000374714.1_Missense_Mutation_p.D1491Y|COL11A2_ENST00000341947.2_Missense_Mutation_p.D1517Y|COL11A2_ENST00000395197.1_Missense_Mutation_p.D1457Y	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	1517	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CGGCTTCCATCCACCGAGCGC	0.642																																					Melanoma(1;90 116 3946 5341 17093)	dbGAP											0													62.0	62.0	62.0					6																	33133527		2203	4300	6503	-	-	-	SO:0001583	missense	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.4291G>T	6.37:g.33133527C>A	ENSP00000363840:p.Asp1431Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.D1517Y	ENST00000374708.4	37	c.4549	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417691	0.83449	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000395196	D;D;D;D;D;D;D;D	0.89875	-2.52;-2.44;-2.49;-2.49;-2.48;-2.48;-2.58;-2.49	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	D	0.91002	0.7170	L	0.49126	1.545	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;0.999	D;D;D;D	0.87578	0.96;0.998;0.998;0.995	D	0.92061	0.5656	10	0.72032	D	0.01	.	14.5472	0.68041	0.0:1.0:0.0:0.0	.	113;1410;1431;1517	A2ABA7;P13942-8;P13942-6;P13942	.;.;.;COBA2_HUMAN	Y	1431;1517;1496;1491;1470;1457;1436;1410;87	ENSP00000363840:D1431Y;ENSP00000339915:D1517Y;ENSP00000350079:D1496Y;ENSP00000363846:D1491Y;ENSP00000363845:D1470Y;ENSP00000378623:D1457Y;ENSP00000363844:D1436Y;ENSP00000355123:D1410Y	ENSP00000339915:D1517Y	D	-	1	0	COL11A2	33241505	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	7.580000	0.82523	2.283000	0.76528	0.551000	0.68910	GAT	COL11A2	-	NULL	ENSG00000204248		0.642	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	32	0.00	0	C			33133527	33133527	-1	no_errors	ENST00000341947	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	1.000	A
DDIT4	54541	genome.wustl.edu	37	10	74033832	74033832	+	Intron	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr10:74033832C>T	ENST00000307365.3	+	1	141				RP11-442H21.2_ENST00000491934.2_RNA	NM_019058.2	NP_061931.1	Q9NX09	DDIT4_HUMAN	DNA-damage-inducible transcript 4						brain development (GO:0007420)|cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of glycolytic process (GO:0045820)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of TOR signaling (GO:0032007)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron death (GO:1901216)|protein complex disassembly (GO:0043241)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|lung(5)|pancreas(1)|prostate(2)|urinary_tract(1)	12						AGTGTCCCTTCTGTGTGTGGG	0.627																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK000507	CCDS7315.1	10q22.1	2008-05-14			ENSG00000168209	ENSG00000168209			24944	protein-coding gene	gene with protein product	"""HIF-1 responsive RTP801"""	607729				11884613	Standard	NM_019058		Approved	RTP801, FLJ20500, REDD-1, REDD1, Dig2	uc001jsx.1	Q9NX09	OTTHUMG00000018435	ENST00000307365.3:c.-61+14C>T	10.37:g.74033832C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0S3	RNA	SNP	-	NULL	ENST00000307365.3	37	NULL	CCDS7315.1	10																																																																																			DDIT4	-	-	ENSG00000168209		0.627	DDIT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDIT4	HGNC	protein_coding	OTTHUMT00000048577.1	31	0.00	0	C	NM_019058		74033832	74033832	+1	no_errors	ENST00000473155	ensembl	human	known	69_37n	rna	13	33.33	7	SNP	0.000	T
DENND2D	79961	genome.wustl.edu	37	1	111731934	111731934	+	Intron	SNP	T	T	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:111731934T>C	ENST00000357640.4	-	9	1202				DENND2D_ENST00000369752.5_Intron	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D						positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CCCCAGAGGATTTACCGTCTT	0.428																																						dbGAP											0													100.0	99.0	99.0					1																	111731934		692	1591	2283	-	-	-	SO:0001627	intron_variant	0				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.973-59A>G	1.37:g.111731934T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5V6|Q9BSU0	RNA	SNP	-	NULL	ENST00000357640.4	37	NULL	CCDS831.1	1																																																																																			DENND2D	-	-	ENSG00000162777		0.428	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	41	0.00	0	T	NM_024901		111731934	111731934	-1	no_errors	ENST00000468692	ensembl	human	known	69_37n	rna	30	21.05	8	SNP	0.001	C
DGKK	139189	genome.wustl.edu	37	X	50129373	50129373	+	RNA	SNP	A	A	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chrX:50129373A>G	ENST00000376025.2	-	0	2389							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					AACTTGAAATATGATGAGTTT	0.478																																						dbGAP											0													100.0	88.0	92.0					X																	50129373		2104	4222	6326	-	-	-			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50129373A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.478	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	131	0.00	0	A	NM_001013742		50129373	50129373	-1	no_errors	ENST00000376025	ensembl	human	known	69_37n	rna	54	35.71	30	SNP	1.000	G
DHDH	27294	genome.wustl.edu	37	19	49439288	49439288	+	Splice_Site	SNP	G	G	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:49439288G>C	ENST00000221403.2	+	3	242		c.e3-1		DHDH_ENST00000523250.1_Intron|DHDH_ENST00000522614.1_Splice_Site	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)						carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		TCCCACCCTAGAGGTGGCCTA	0.682																																						dbGAP											0													15.0	14.0	14.0					19																	49439288		2201	4297	6498	-	-	-	SO:0001630	splice_region_variant	0			AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.203-1G>C	19.37:g.49439288G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e3-1	ENST00000221403.2	37	c.203-1	CCDS12741.1	19	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166829	0.57476	.	.	ENSG00000104808	ENST00000221403;ENST00000522614	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1442	0.81551	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DHDH	54131100	1.000000	0.71417	0.996000	0.52242	0.530000	0.34684	8.178000	0.89690	2.747000	0.94245	0.557000	0.71058	.	DHDH	-	-	ENSG00000104808		0.682	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHDH	HGNC	protein_coding	OTTHUMT00000381477.1	105	0.00	0	G	NM_014475	Intron	49439288	49439288	+1	no_errors	ENST00000221403	ensembl	human	known	69_37n	splice_site	106	22.06	30	SNP	1.000	C
ELK4	2005	genome.wustl.edu	37	1	205589824	205589824	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:205589824G>T	ENST00000357992.4	-	3	689	c.350C>A	c.(349-351)tCc>tAc	p.S117Y	ELK4_ENST00000289703.4_Missense_Mutation_p.S117Y|ELK4_ENST00000468523.1_5'UTR	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)	117					cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CACATCTTTGGAACTGCTGCT	0.438			T	SLC45A3	prostate																																	dbGAP		Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	0													134.0	110.0	118.0					1																	205589824		2203	4300	6503	-	-	-	SO:0001583	missense	0			M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.350C>A	1.37:g.205589824G>T	ENSP00000350681:p.Ser117Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	P28323|Q6GSJ2	Missense_Mutation	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.S117Y	ENST00000357992.4	37	c.350	CCDS1456.1	1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.619085	0.46736	.	.	ENSG00000158711	ENST00000539916;ENST00000357992;ENST00000289703	T;T	0.56444	0.46;0.46	5.8	3.92	0.45320	.	0.715273	0.14837	N	0.295491	T	0.50000	0.1590	L	0.46157	1.445	0.34691	D	0.725701	P;P	0.49559	0.925;0.641	P;B	0.48141	0.568;0.188	T	0.62576	-0.6825	10	0.66056	D	0.02	.	6.7264	0.23359	0.1497:0.1531:0.6972:0.0	.	117;117	P28324-2;P28324	.;ELK4_HUMAN	Y	207;117;117	ENSP00000350681:S117Y;ENSP00000289703:S117Y	ENSP00000289703:S117Y	S	-	2	0	ELK4	203856447	0.860000	0.29831	0.919000	0.36401	0.968000	0.65278	1.174000	0.31932	1.440000	0.47531	0.650000	0.86243	TCC	ELK4	-	NULL	ENSG00000158711		0.438	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELK4	HGNC	protein_coding	OTTHUMT00000090615.1	56	0.00	0	G	NM_021795		205589824	205589824	-1	no_errors	ENST00000357992	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.967	T
EPRS	2058	genome.wustl.edu	37	1	220197789	220197789	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:220197789C>T	ENST00000366923.3	-	8	1029	c.760G>A	c.(760-762)Gaa>Aaa	p.E254K		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	254	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	GCAACATCTTCCAAGATAACC	0.323																																						dbGAP											0													82.0	75.0	77.0					1																	220197789		2202	4300	6502	-	-	-	SO:0001583	missense	0			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.760G>A	1.37:g.220197789C>T	ENSP00000355890:p.Glu254Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_WHEP-TRS,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Pro-tRNA_synth_II_C,pfam_Anticodon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,superfamily_Anticodon-bd,superfamily_Pro-tRNA_synth_II,superfamily_S15_NS1_RNA-bd,superfamily_Glutathione-S-Trfase_C-like,smart_Pro-tRNA_synth_II_C,prints_Glu/Gln-tRNA-synth_Ib,prints_Pro-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_Pro-tRNA-synth_IIa_arc-type,tigrfam_Glu-tRNA-synth_Ib_arc/euk	p.E254K	ENST00000366923.3	37	c.760	CCDS31027.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602785	0.87157	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.25085	1.82	5.52	5.52	0.82312	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.46502	0.1396	M	0.76433	2.335	0.80722	D	1	P;P;B;P	0.36110	0.537;0.53;0.002;0.537	B;P;B;P	0.48227	0.349;0.571;0.119;0.556	T	0.30679	-0.9970	10	0.46703	T	0.11	-20.1143	19.854	0.96750	0.0:1.0:0.0:0.0	.	278;254;254;254	E7EMN0;F5H7I7;Q3KQZ8;P07814	.;.;.;SYEP_HUMAN	K	254;254;278	ENSP00000355890:E254K	ENSP00000355890:E254K	E	-	1	0	EPRS	218264412	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.522000	0.81844	2.774000	0.95407	0.580000	0.79431	GAA	EPRS	-	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,tigrfam_Glu-tRNA-synth_Ib_arc/euk	ENSG00000136628		0.323	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	HGNC	protein_coding	OTTHUMT00000091133.2	41	0.00	0	C	NM_004446		220197789	220197789	-1	no_errors	ENST00000366923	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	1.000	T
EXOG	9941	genome.wustl.edu	37	3	38537966	38537966	+	Silent	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr3:38537966G>A	ENST00000287675.5	+	1	204	c.108G>A	c.(106-108)ctG>ctA	p.L36L	EXOG_ENST00000422077.2_Silent_p.L36L|EXOG_ENST00000358249.2_5'UTR	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	36					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						TCGCGGCCCTGCAGTTCTTCC	0.662											OREG0015479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													47.0	46.0	47.0					3																	38537966		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.108G>A	3.37:g.38537966G>A		Somatic	879	WXS	Illumina GAIIx	Phase_IV	A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Silent	SNP	pfam_DNA/RNA_non-sp_Endonuclease,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A	p.L36	ENST00000287675.5	37	c.108	CCDS2680.1	3																																																																																			EXOG	-	NULL	ENSG00000157036		0.662	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOG	HGNC	protein_coding	OTTHUMT00000254063.2	183	0.00	0	G	NM_005107		38537966	38537966	+1	no_errors	ENST00000287675	ensembl	human	known	69_37n	silent	151	29.95	65	SNP	0.135	A
RMDN2	151393	genome.wustl.edu	37	2	38201314	38201314	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr2:38201314G>T	ENST00000406384.1	+	3	778	c.584G>T	c.(583-585)gGc>gTc	p.G195V	RMDN2_ENST00000417700.2_Missense_Mutation_p.G50V|RMDN2_ENST00000234195.3_Missense_Mutation_p.G373V|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000354545.2_Missense_Mutation_p.G195V|RMDN2_ENST00000407257.1_Missense_Mutation_p.G373V	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	195						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											AGTGAGTCTGGCAAGTCGGAG	0.373																																						dbGAP											0													117.0	117.0	117.0					2																	38201314		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.584G>T	2.37:g.38201314G>T	ENSP00000386004:p.Gly195Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	NULL	p.G373V	ENST00000406384.1	37	c.1118	CCDS54351.1	2	.	.	.	.	.	.	.	.	.	.	G	10.10	1.258057	0.22965	.	.	ENSG00000115841	ENST00000354545;ENST00000406384;ENST00000407257;ENST00000417700;ENST00000234195;ENST00000442857	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.44	-1.04	0.10068	.	0.736216	0.12741	N	0.443080	T	0.25901	0.0631	L	0.34521	1.04	0.09310	N	1	P;B;B;B	0.37781	0.608;0.113;0.113;0.139	B;B;B;B	0.34093	0.175;0.037;0.037;0.05	T	0.12066	-1.0562	9	.	.	.	.	8.5948	0.33710	0.5958:0.0:0.4042:0.0	.	373;50;195;50	Q96LZ7-2;Q96LZ7-4;Q96LZ7;Q96LZ7-3	.;.;RMD2_HUMAN;.	V	195;195;373;50;373;50	ENSP00000346549:G195V;ENSP00000386004:G195V;ENSP00000385049:G373V;ENSP00000392977:G50V;ENSP00000234195:G373V;ENSP00000416367:G50V	.	G	+	2	0	FAM82A1	38054818	0.000000	0.05858	0.001000	0.08648	0.755000	0.42902	-0.280000	0.08468	-0.083000	0.12618	0.650000	0.86243	GGC	FAM82A1	-	NULL	ENSG00000115841		0.373	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM82A1	HGNC	protein_coding	OTTHUMT00000325577.1	32	0.00	0	G	NM_144713		38201314	38201314	+1	no_errors	ENST00000234195	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.001	T
FER1L4	80307	genome.wustl.edu	37	20	34191783	34191783	+	RNA	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr20:34191783C>T	ENST00000430275.2	-	0	633							A9Z1Z3	FR1L4_HUMAN	fer-1-like family member 4, pseudogene (functional)							integral component of membrane (GO:0016021)											AGGTCCTGCTCCAGCTCAAGC	0.602																																						dbGAP											0																																										-	-	-			0			AL121586		20q11.23	2014-09-11	2014-06-27		ENSG00000088340	ENSG00000088340		"""-"""	15801	pseudogene	pseudogene			"""fer-1-like 4 (C. elegans)"", ""fer-1-like 4 (C. elegans), pseudogene (functional)"""	C20orf124		24063685, 24961353	Standard	XR_425236		Approved	bA563A22B.1, dJ309K20.1	uc002xcx.3	A9Z1Z3	OTTHUMG00000032354		20.37:g.34191783C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9GZQ9|Q9H646|Q9H8L7	RNA	SNP	-	NULL	ENST00000430275.2	37	NULL		20																																																																																			FER1L4	-	-	ENSG00000088340		0.602	FER1L4-016	KNOWN	basic	processed_transcript	FER1L4	HGNC	pseudogene	OTTHUMT00000443297.1	58	0.00	0	C	NR_024377		34191783	34191783	-1	no_errors	ENST00000430275	ensembl	human	known	69_37n	rna	33	21.43	9	SNP	0.998	T
FLG2	388698	genome.wustl.edu	37	1	152325695	152325695	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:152325695C>T	ENST00000388718.5	-	3	4639	c.4567G>A	c.(4567-4569)Ggc>Agc	p.G1523S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1523					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCACTTTGGCCGTGAGTGTGT	0.498																																						dbGAP											0													306.0	293.0	297.0					1																	152325695		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4567G>A	1.37:g.152325695C>T	ENSP00000373370:p.Gly1523Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.G1523S	ENST00000388718.5	37	c.4567	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	t	8.024	0.760287	0.15914	.	.	ENSG00000143520	ENST00000388718	T	0.13089	2.62	4.43	-3.1	0.05315	.	.	.	.	.	T	0.01800	0.0057	L	0.46157	1.445	0.09310	N	1	D	0.52996	0.957	B	0.34242	0.178	T	0.43245	-0.9403	9	0.07644	T	0.81	0.9125	5.0308	0.14409	0.0:0.4192:0.23:0.3508	.	1523	Q5D862	FILA2_HUMAN	S	1523	ENSP00000373370:G1523S	ENSP00000373370:G1523S	G	-	1	0	FLG2	150592319	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.790000	0.04604	-0.878000	0.04007	-0.382000	0.06688	GGC	FLG2	-	NULL	ENSG00000143520		0.498	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	189	0.52	1	C	NM_001014342		152325695	152325695	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	243	18.12	54	SNP	0.000	T
FXYD5	53827	genome.wustl.edu	37	19	35650472	35650473	+	Intron	INS	-	-	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:35650472_35650473insT	ENST00000342879.3	+	4	977				FXYD5_ENST00000423817.3_Intron|FXYD5_ENST00000590686.1_Intron|FXYD5_ENST00000543307.1_Intron|FXYD5_ENST00000392218.2_Frame_Shift_Ins_p.V85fs|FXYD5_ENST00000541435.2_Intron|FXYD5_ENST00000392219.2_Intron|FXYD5_ENST00000588699.1_Intron			Q96DB9	FXYD5_HUMAN	FXYD domain containing ion transport regulator 5						microvillus assembly (GO:0030033)|negative regulation of calcium-dependent cell-cell adhesion (GO:0046588)	integral component of membrane (GO:0016021)	actin binding (GO:0003779)|cadherin binding (GO:0045296)|ion channel activity (GO:0005216)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			catgttggctgtttccagcttt	0.446																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF161462	CCDS12447.1	19q13.12	2008-02-05	2002-01-14		ENSG00000089327	ENSG00000089327			4029	protein-coding gene	gene with protein product	"""dysadherin"""	606669	"""FXYD domain-containing ion transport regulator 5"""				Standard	NM_144779		Approved	OIT2	uc002nyg.2	Q96DB9	OTTHUMG00000048092	ENST00000342879.3:c.200-1139->T	19.37:g.35650475_35650475dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNZ8|Q6UW44|Q9HC34|Q9P039	Frame_Shift_Ins	INS	NULL	p.S86fs	ENST00000342879.3	37	c.253_254	CCDS12447.1	19																																																																																			FXYD5	-	NULL	ENSG00000089327		0.446	FXYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXYD5	HGNC	protein_coding	OTTHUMT00000109443.1	83	0.00	0	-	NM_014164		35650472	35650473	+1	no_errors	ENST00000392218	ensembl	human	novel	69_37n	frame_shift_ins	46	25.81	16	INS	0.001:0.001	T
GRM7	2917	genome.wustl.edu	37	3	7732913	7732913	+	Intron	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr3:7732913C>T	ENST00000357716.4	+	9	2972				GRM7_ENST00000389336.4_Intron|GRM7_ENST00000403881.1_Silent_p.L905L|GRM7_ENST00000486284.1_Intron	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CTGAGGACCTCAGCTTGCACA	0.363																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2698+10931C>T	3.37:g.7732913C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_7,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.L905	ENST00000357716.4	37	c.2715	CCDS43042.1	3																																																																																			GRM7	-	NULL	ENSG00000196277		0.363	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	HGNC	protein_coding	OTTHUMT00000246895.3	85	0.00	0	C	NM_000844		7732913	7732913	+1	no_errors	ENST00000389335	ensembl	human	known	69_37n	silent	51	28.17	20	SNP	0.000	T
GRM7	2917	genome.wustl.edu	37	3	7735320	7735320	+	Intron	SNP	G	G	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr3:7735320G>C	ENST00000357716.4	+	9	2972				GRM7_ENST00000389336.4_Splice_Site_p.S900T|GRM7_ENST00000486284.1_Intron	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TTTTATTCAGGTGAGAAGTGC	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2698+13338G>C	3.37:g.7735320G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_7,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.S900T	ENST00000357716.4	37	c.2699	CCDS43042.1	3	.	.	.	.	.	.	.	.	.	.	G	0.785	-0.761071	0.02996	.	.	ENSG00000196277	ENST00000389336	D	0.89343	-2.5	4.86	3.98	0.46160	.	.	.	.	.	T	0.80428	0.4621	.	.	.	0.80722	D	1	B	0.17038	0.02	B	0.10450	0.005	T	0.72567	-0.4254	7	.	.	.	.	8.8836	0.35389	0.1006:0.0:0.8994:0.0	.	900	Q14831-5	.	T	900	ENSP00000373987:S900T	.	S	+	2	0	GRM7	7710320	1.000000	0.71417	0.994000	0.49952	0.619000	0.37552	2.880000	0.48530	1.403000	0.46800	0.655000	0.94253	AGT	GRM7	-	NULL	ENSG00000196277		0.418	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	HGNC	protein_coding	OTTHUMT00000246895.3	51	0.00	0	G	NM_000844		7735320	7735320	+1	no_errors	ENST00000389336	ensembl	human	known	69_37n	missense	33	17.07	7	SNP	1.000	C
HACL1	26061	genome.wustl.edu	37	3	15642907	15642907	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr3:15642907G>A	ENST00000321169.5	-	1	431	c.64C>T	c.(64-66)Cag>Tag	p.Q22*	HACL1_ENST00000451445.2_Nonsense_Mutation_p.Q22*|BTD_ENST00000449107.1_5'Flank|BTD_ENST00000383778.4_5'Flank|BTD_ENST00000437172.1_5'Flank|HACL1_ENST00000456194.2_Nonsense_Mutation_p.Q22*|HACL1_ENST00000435217.2_Nonsense_Mutation_p.Q22*|BTD_ENST00000303498.5_5'Flank|HACL1_ENST00000457447.2_Nonsense_Mutation_p.Q22*	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	22					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						TTCAGGGCCTGAGCGATGACT	0.567																																						dbGAP											0													108.0	100.0	103.0					3																	15642907		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.64C>T	3.37:g.15642907G>A	ENSP00000323811:p.Gln22*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Nonsense_Mutation	SNP	pfam_Thiamin_PyroP_enz_TPP-bd_dom,pfam_Thiamin_PyroP_enz_cen_dom,pfam_TPP_enzyme-bd_C,pfam_CO_DH_CoA_synth	p.Q22*	ENST00000321169.5	37	c.64	CCDS2627.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.210134	0.97380	.	.	ENSG00000131373	ENST00000321169;ENST00000435217;ENST00000451445;ENST00000456194;ENST00000457447;ENST00000421993;ENST00000414979	.	.	.	5.32	4.44	0.53790	.	0.281923	0.38605	N	0.001634	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	12.3186	0.54971	0.0:0.3272:0.6728:0.0	.	.	.	.	X	22	.	ENSP00000323811:Q22X	Q	-	1	0	HACL1	15617911	1.000000	0.71417	0.994000	0.49952	0.814000	0.46013	1.548000	0.36201	1.456000	0.47831	0.655000	0.94253	CAG	HACL1	-	pfam_Thiamin_PyroP_enz_TPP-bd_dom	ENSG00000131373		0.567	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HACL1	HGNC	protein_coding	OTTHUMT00000252104.3	88	0.00	0	G	NM_012260		15642907	15642907	-1	no_errors	ENST00000321169	ensembl	human	known	69_37n	nonsense	53	11.67	7	SNP	0.997	A
JUNB	3726	genome.wustl.edu	37	19	12902831	12902831	+	Silent	SNP	C	C	T	rs558783117	byFrequency	TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:12902831C>T	ENST00000302754.4	+	1	522	c.246C>T	c.(244-246)ctC>ctT	p.L82L		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	82					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						CTCTCAAGCTCGCCTCTTCGG	0.672													C|||	2	0.000399361	0.0	0.0	5008	,	,		11234	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													13.0	13.0	13.0					19																	12902831		2190	4274	6464	-	-	-	SO:0001819	synonymous_variant	0			M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.246C>T	19.37:g.12902831C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GH3	Silent	SNP	pfam_JNK,pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.L82	ENST00000302754.4	37	c.246	CCDS12280.1	19																																																																																			JUNB	-	pfam_JNK	ENSG00000171223		0.672	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUNB	HGNC	protein_coding	OTTHUMT00000451015.1	75	0.00	0	C	NM_002229		12902831	12902831	+1	no_errors	ENST00000302754	ensembl	human	known	69_37n	silent	58	18.31	13	SNP	0.979	T
IL4I1	259307	genome.wustl.edu	37	19	50397597	50397597	+	Silent	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:50397597C>T	ENST00000391826.2	-	5	637	c.495G>A	c.(493-495)aaG>aaA	p.K165K	IL4I1_ENST00000595948.1_Silent_p.K187K|IL4I1_ENST00000341114.3_Silent_p.K187K	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	165						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CGTAGCCCAGCTTCTCGGGCA	0.607																																						dbGAP											0													112.0	110.0	111.0					19																	50397597		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.495G>A	19.37:g.50397597C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_CHP00275_HI0933-like,pfam_FAD_bind_dom,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_AlaDH/PNT_NAD(H)-bd,pfam_mOase_FAD-bd,prints_Flavin_amine_oxidase	p.K187	ENST00000391826.2	37	c.561	CCDS12787.1	19																																																																																			IL4I1	-	pfam_Amino_oxidase	ENSG00000104951		0.607	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4I1	HGNC	protein_coding	OTTHUMT00000466413.1	88	0.00	0	C			50397597	50397597	-1	no_errors	ENST00000341114	ensembl	human	known	69_37n	silent	30	30.23	13	SNP	0.948	T
SPIDR	23514	genome.wustl.edu	37	8	48353017	48353017	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr8:48353017G>A	ENST00000297423.4	+	8	1394	c.1010G>A	c.(1009-1011)gGa>gAa	p.G337E	SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Missense_Mutation_p.G267E|SPIDR_ENST00000518074.1_Missense_Mutation_p.G277E	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	337	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											CCCAGGCCTGGAGCTGGCCTG	0.587																																						dbGAP											0													49.0	51.0	50.0					8																	48353017		1946	4144	6090	-	-	-	SO:0001583	missense	0			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1010G>A	8.37:g.48353017G>A	ENSP00000297423:p.Gly337Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	NULL	p.G337E	ENST00000297423.4	37	c.1010	CCDS43737.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.57|11.57	1.677468|1.677468	0.29783|0.29783	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000519401|ENST00000297423;ENST00000518074;ENST00000541342;ENST00000524006	.|.	.|.	.|.	5.38|5.38	2.57|2.57	0.30868|0.30868	.|.	.|0.622190	.|0.14207	.|N	.|0.334313	T|T	0.33789|0.33789	0.0875|0.0875	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	1|1	.|P;P;P;P	.|0.44139	.|0.551;0.782;0.827;0.782	.|B;B;B;B	.|0.44044	.|0.135;0.26;0.439;0.332	T|T	0.29397|0.29397	-1.0013|-1.0013	5|9	.|0.49607	.|T	.|0.09	.|.	1.9013|1.9013	0.03268|0.03268	0.1538:0.1371:0.4262:0.2829|0.1538:0.1371:0.4262:0.2829	.|.	.|277;267;337;337	.|B4E0Y6;B4DFV2;B4DEV5;Q14159	.|.;.;.;K0146_HUMAN	K|E	19|337;277;267;26	.|.	.|ENSP00000297423:G337E	E|G	+|+	1|2	0|0	KIAA0146|KIAA0146	48515570|48515570	0.017000|0.017000	0.18338|0.18338	0.001000|0.001000	0.08648|0.08648	0.033000|0.033000	0.12548|0.12548	1.844000|1.844000	0.39269|0.39269	0.241000|0.241000	0.21283|0.21283	-0.176000|-0.176000	0.13171|0.13171	GAG|GGA	KIAA0146	-	NULL	ENSG00000164808		0.587	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0146	HGNC	protein_coding	OTTHUMT00000377611.1	65	0.00	0	G	NM_001080394		48353017	48353017	+1	no_errors	ENST00000297423	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.000	A
KIAA0355	9710	genome.wustl.edu	37	19	34832781	34832781	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:34832781G>A	ENST00000299505.6	+	10	2815	c.1942G>A	c.(1942-1944)Gag>Aag	p.E648K		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	648										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					GGAAATGCAAGAGGTGATAGA	0.502																																						dbGAP											0													74.0	70.0	72.0					19																	34832781		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.1942G>A	19.37:g.34832781G>A	ENSP00000299505:p.Glu648Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3W4	Missense_Mutation	SNP	NULL	p.E648K	ENST00000299505.6	37	c.1942	CCDS12436.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.080526	0.94050	.	.	ENSG00000166398	ENST00000299505	T	0.25579	1.79	5.73	5.73	0.89815	.	0.058436	0.64402	D	0.000001	T	0.19927	0.0479	N	0.19112	0.55	0.54753	D	0.999981	P	0.37330	0.59	B	0.33121	0.158	T	0.04029	-1.0983	10	0.87932	D	0	-2.8008	18.8873	0.92383	0.0:0.0:1.0:0.0	.	648	O15063	K0355_HUMAN	K	648	ENSP00000299505:E648K	ENSP00000299505:E648K	E	+	1	0	KIAA0355	39524621	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.147000	0.94646	2.708000	0.92522	0.655000	0.94253	GAG	KIAA0355	-	NULL	ENSG00000166398		0.502	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	HGNC	protein_coding	OTTHUMT00000451678.4	98	0.00	0	G	NM_014686		34832781	34832781	+1	no_errors	ENST00000299505	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	A
KNTC1	9735	genome.wustl.edu	37	12	123022922	123022922	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr12:123022922G>A	ENST00000333479.7	+	4	464	c.287G>A	c.(286-288)gGa>gAa	p.G96E	KNTC1_ENST00000450485.2_Missense_Mutation_p.G96E	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	96					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGTCAAGAAGGAAAGTTTCTT	0.318																																						dbGAP											0													103.0	93.0	96.0					12																	123022922		1837	4102	5939	-	-	-	SO:0001583	missense	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.287G>A	12.37:g.123022922G>A	ENSP00000328236:p.Gly96Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.G96E	ENST00000333479.7	37	c.287	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840468	0.32513	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.24538	1.85;1.85	5.02	4.13	0.48395	.	0.314966	0.31589	N	0.007387	T	0.34106	0.0886	L	0.32530	0.975	0.80722	D	1	P;D	0.76494	0.58;0.999	B;P	0.61658	0.254;0.892	T	0.08351	-1.0726	10	0.66056	D	0.02	-20.2704	10.8006	0.46487	0.1595:0.0:0.8405:0.0	.	96;96	E7ES84;P50748	.;KNTC1_HUMAN	E	96	ENSP00000397992:G96E;ENSP00000328236:G96E	ENSP00000328236:G96E	G	+	2	0	KNTC1	121588875	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	4.223000	0.58587	1.242000	0.43836	0.467000	0.42956	GGA	KNTC1	-	superfamily_WD40_repeat_dom	ENSG00000184445		0.318	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	49	0.00	0	G			123022922	123022922	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	A
KRT16P3	644945	genome.wustl.edu	37	17	20405802	20405802	+	RNA	SNP	T	T	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr17:20405802T>C	ENST00000580113.1	-	0	1012									keratin 16 pseudogene 3																		TCTGGTCCCATCCTGAGAAAA	0.498																																						dbGAP											0																																										-	-	-			0			BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20405802T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000580113.1	37	NULL		17																																																																																			KRT16P3	-	-	ENSG00000214822		0.498	KRT16P3-004	KNOWN	basic	processed_transcript	KRT16P3	HGNC	pseudogene	OTTHUMT00000443764.1	32	0.00	0	T	NR_029393		20405802	20405802	-1	no_errors	ENST00000580621	ensembl	human	known	69_37n	rna	51	12.07	7	SNP	0.000	C
L1TD1	54596	genome.wustl.edu	37	1	62676024	62676024	+	Silent	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:62676024C>T	ENST00000498273.1	+	4	1873	c.1578C>T	c.(1576-1578)caC>caT	p.H526H	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	526										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						TGGTGAAACACCAGGTGGTGC	0.478																																						dbGAP											0													52.0	53.0	53.0					1																	62676024		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1578C>T	1.37:g.62676024C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDA1|Q9NUV8|Q9NV78	Silent	SNP	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.H526	ENST00000498273.1	37	c.1578	CCDS619.1	1																																																																																			L1TD1	-	NULL	ENSG00000240563		0.478	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	HGNC	protein_coding	OTTHUMT00000024688.1	34	0.00	0	C	NM_019079		62676024	62676024	+1	no_errors	ENST00000498273	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.001	T
LILRB1	10859	genome.wustl.edu	37	19	55144014	55144014	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:55144014G>A	ENST00000396331.1	+	7	1118	c.761G>A	c.(760-762)aGa>aAa	p.R254K	LILRB1_ENST00000396315.1_Missense_Mutation_p.R254K|LILRB1_ENST00000324602.7_Missense_Mutation_p.R254K|LILRB1_ENST00000396327.3_Missense_Mutation_p.R254K|LILRB1_ENST00000396317.1_Missense_Mutation_p.R254K|LILRB1_ENST00000418536.2_Missense_Mutation_p.R254K|LILRB1_ENST00000427581.2_Missense_Mutation_p.R290K|LILRB1_ENST00000396332.4_Missense_Mutation_p.R254K|LILRB1_ENST00000396321.2_Missense_Mutation_p.R254K|LILRB1_ENST00000434867.2_Missense_Mutation_p.R254K|LILRB1_ENST00000448689.1_Missense_Mutation_p.R254K	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	254	Ig-like C2-type 3.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GGCTACAACAGATTTGTTCTG	0.587										HNSCC(37;0.09)																												dbGAP											0													100.0	105.0	103.0					19																	55144014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.761G>A	19.37:g.55144014G>A	ENSP00000379622:p.Arg254Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R254K	ENST00000396331.1	37	c.761	CCDS42617.1	19	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236632	0.39498	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79;2.79;2.79;2.79;2.79;2.79;2.79	2.02	0.722	0.18225	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.593104	0.14272	N	0.330117	T	0.21718	0.0523	M	0.73372	2.23	0.09310	N	1	P;B;D;P;P	0.55172	0.732;0.318;0.97;0.84;0.51	P;B;P;P;P	0.59546	0.596;0.259;0.859;0.721;0.531	T	0.03863	-1.0997	10	0.48119	T	0.1	.	5.7363	0.18069	0.0:0.344:0.656:0.0	.	254;254;254;254;254	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	K	254;254;254;254;254;254;254;254;290;254;254	ENSP00000379614:R254K;ENSP00000391514:R254K;ENSP00000409968:R254K;ENSP00000379622:R254K;ENSP00000379618:R254K;ENSP00000315997:R254K;ENSP00000405243:R254K;ENSP00000379623:R254K;ENSP00000395004:R290K;ENSP00000379610:R254K;ENSP00000379608:R254K	ENSP00000315997:R254K	R	+	2	0	LILRB1	59835826	0.000000	0.05858	0.043000	0.18650	0.007000	0.05969	-0.214000	0.09292	1.136000	0.42199	0.184000	0.17185	AGA	LILRB1	-	smart_Ig_sub,smart_Ig_sub2	ENSG00000104972		0.587	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	120	0.00	0	G			55144014	55144014	+1	no_errors	ENST00000324602	ensembl	human	known	69_37n	missense	123	26.35	44	SNP	0.006	A
LTN1	26046	genome.wustl.edu	37	21	30342948	30342948	+	Silent	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr21:30342948G>A	ENST00000361371.5	-	8	1180	c.1101C>T	c.(1099-1101)atC>atT	p.I367I	LTN1_ENST00000389194.2_Silent_p.I413I|LTN1_ENST00000389195.2_Silent_p.I413I			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	367					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						GGAGCTTGCTGATGAATGGCA	0.388																																						dbGAP											0													120.0	109.0	113.0					21																	30342948		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.1101C>T	21.37:g.30342948G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.I367	ENST00000361371.5	37	c.1101		21																																																																																			LTN1	-	superfamily_ARM-type_fold	ENSG00000198862		0.388	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	HGNC	protein_coding	OTTHUMT00000472108.1	70	0.00	0	G	NM_015565		30342948	30342948	-1	no_errors	ENST00000361371	ensembl	human	known	69_37n	silent	49	27.94	19	SNP	1.000	A
MACC1	346389	genome.wustl.edu	37	7	20193845	20193845	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr7:20193845G>A	ENST00000400331.5	-	6	2625	c.2317C>T	c.(2317-2319)Cga>Tga	p.R773*	MACC1_ENST00000589011.1_Nonsense_Mutation_p.R773*|MACC1_ENST00000332878.4_Nonsense_Mutation_p.R773*|MACC1-AS1_ENST00000439285.1_RNA	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	773					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						GTGTTTCCTCGATGAGGAATT	0.408																																						dbGAP											0													198.0	170.0	179.0					7																	20193845		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.2317C>T	7.37:g.20193845G>A	ENSP00000383185:p.Arg773*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Nonsense_Mutation	SNP	pfam_SH3_2,superfamily_DEATH-like	p.R773*	ENST00000400331.5	37	c.2317	CCDS5369.1	7	.	.	.	.	.	.	.	.	.	.	G	40	8.461333	0.98822	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	.	.	.	5.45	3.62	0.41486	.	0.680599	0.15549	N	0.256532	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3925	8.4103	0.32640	0.0702:0.0:0.6511:0.2787	.	.	.	.	X	773	.	ENSP00000328410:R773X	R	-	1	2	MACC1	20160370	0.999000	0.42202	0.583000	0.28640	0.757000	0.42996	2.754000	0.47532	0.636000	0.30508	0.655000	0.94253	CGA	MACC1	-	NULL	ENSG00000183742		0.408	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MACC1	HGNC	protein_coding	OTTHUMT00000250202.5	43	0.00	0	G	NM_182762		20193845	20193845	-1	no_errors	ENST00000332878	ensembl	human	known	69_37n	nonsense	30	25.00	10	SNP	0.648	A
THBS3	7059	genome.wustl.edu	37	1	155162590	155162590	+	IGR	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:155162590G>A	ENST00000368378.3	-	0	3145				MUC1_ENST00000438413.1_Silent_p.L15L|MUC1_ENST00000462215.1_5'UTR|MUC1_ENST00000368398.3_Silent_p.L15L|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368395.1_Silent_p.L15L|MUC1_ENST00000368392.3_Silent_p.L15L|MUC1_ENST00000368389.2_Silent_p.L15L|MUC1_ENST00000337604.5_Silent_p.L15L|MUC1_ENST00000368393.3_Silent_p.L15L|MUC1_ENST00000368396.4_Silent_p.L15L|MIR92B_ENST00000607575.1_RNA|MUC1_ENST00000338684.5_Silent_p.L15L|MUC1_ENST00000368390.3_Silent_p.L15L|MUC1_ENST00000342482.4_Silent_p.L15L|MUC1_ENST00000343256.5_Silent_p.L15L|MUC1_ENST00000457295.2_Silent_p.L15L	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3						bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TAAGCACTGTGAGGAGCAGCA	0.612																																						dbGAP											0													109.0	91.0	97.0					1																	155162590		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710		1.37:g.155162590G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AVR8|B4DQ20|Q8WV34	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.L15	ENST00000368378.3	37	c.45	CCDS1099.1	1																																																																																			MUC1	-	NULL	ENSG00000185499		0.612	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC1	HGNC	protein_coding	OTTHUMT00000086856.1	88	0.00	0	G	NM_007112		155162590	155162590	-1	no_errors	ENST00000425082	ensembl	human	known	69_37n	silent	68	17.07	14	SNP	0.000	A
NAF1	92345	genome.wustl.edu	37	4	164085408	164085408	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr4:164085408C>G	ENST00000274054.2	-	2	694	c.501G>C	c.(499-501)aaG>aaC	p.K167N	NAF1_ENST00000422287.2_Missense_Mutation_p.K167N	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	167					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				GAGGAAAATTCTTATTTTCCT	0.333																																						dbGAP											0													42.0	44.0	43.0					4																	164085408		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.501G>C	4.37:g.164085408C>G	ENSP00000274054:p.Lys167Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP28|E9PAZ2	Missense_Mutation	SNP	pfam_H/ACA_rnp_Gar1/Naf1,superfamily_Transl_elong_init/rib_B-barrel	p.K167N	ENST00000274054.2	37	c.501	CCDS3803.1	4	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236529	0.39498	.	.	ENSG00000145414	ENST00000422287;ENST00000274054	T;T	0.35605	1.33;1.3	4.79	3.04	0.35103	.	0.081157	0.48767	D	0.000178	T	0.21631	0.0521	L	0.36672	1.1	0.32997	D	0.525771	B;P	0.35272	0.296;0.493	B;B	0.29942	0.041;0.109	T	0.22941	-1.0202	10	0.25106	T	0.35	-26.2004	6.4064	0.21666	0.0:0.786:0.0:0.214	.	167;167	E9PAZ2;Q96HR8	.;NAF1_HUMAN	N	167	ENSP00000408963:K167N;ENSP00000274054:K167N	ENSP00000274054:K167N	K	-	3	2	NAF1	164304858	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.026000	0.30103	1.335000	0.45486	0.467000	0.42956	AAG	NAF1	-	NULL	ENSG00000145414		0.333	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAF1	HGNC	protein_coding	OTTHUMT00000364684.2	24	0.00	0	C	NM_138386		164085408	164085408	-1	no_errors	ENST00000274054	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	G
NBEAL2	23218	genome.wustl.edu	37	3	47049023	47049023	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr3:47049023G>A	ENST00000450053.3	+	48	7522	c.7343G>A	c.(7342-7344)cGa>cAa	p.R2448Q	NBEAL2_ENST00000292309.5_Missense_Mutation_p.R2264Q|NBEAL2_ENST00000383740.2_Missense_Mutation_p.R697Q	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2448					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		AGGACGCAGCGACTGCTGAGT	0.642																																						dbGAP											0													18.0	21.0	20.0					3																	47049023		2067	4201	6268	-	-	-	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.7343G>A	3.37:g.47049023G>A	ENSP00000415034:p.Arg2448Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R2448Q	ENST00000450053.3	37	c.7343	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.88|19.88	3.908880|3.908880	0.72868|0.72868	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000416683|ENST00000292309;ENST00000383740;ENST00000450053;ENST00000445550	.|T;T;T	.|0.60171	.|0.24;0.92;0.21	4.82|4.82	3.93|3.93	0.45458|0.45458	.|.	.|0.064498	.|0.64402	.|D	.|0.000007	T|T	0.59004|0.59004	0.2162|0.2162	M|M	0.73962|0.73962	2.25|2.25	0.45648|0.45648	D|D	0.998572|0.998572	.|P;B	.|0.50443	.|0.935;0.074	.|P;B	.|0.44623	.|0.455;0.018	T|T	0.62163|0.62163	-0.6912|-0.6912	5|10	.|0.44086	.|T	.|0.13	.|.	11.0226|11.0226	0.47726|0.47726	0.0926:0.0:0.9074:0.0|0.0926:0.0:0.9074:0.0	.|.	.|2264;2448	.|Q6ZNJ1-2;Q6ZNJ1	.|.;NBEL2_HUMAN	N|Q	1736|2264;697;2448;391	.|ENSP00000292309:R2264Q;ENSP00000373246:R697Q;ENSP00000415034:R2448Q	.|ENSP00000292309:R2264Q	D|R	+|+	1|2	0|0	NBEAL2|NBEAL2	47024027|47024027	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.906000|0.906000	0.53458|0.53458	4.372000|4.372000	0.59530|0.59530	1.238000|1.238000	0.43771|0.43771	0.586000|0.586000	0.80456|0.80456	GAC|CGA	NBEAL2	-	smart_WD40_repeat	ENSG00000160796		0.642	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	34	0.00	0	G	XM_291064		47049023	47049023	+1	no_errors	ENST00000450053	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	A
NEIL3	55247	genome.wustl.edu	37	4	178274472	178274472	+	Silent	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr4:178274472C>T	ENST00000264596.3	+	8	1168	c.1050C>T	c.(1048-1050)ctC>ctT	p.L350L	RP11-376O6.2_ENST00000506895.1_RNA	NM_018248.2	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3 (E. coli)	350					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		ATTCAGTGCTCAAGAGTGAAG	0.318								Base excision repair (BER), DNA glycosylases																														dbGAP											0													71.0	74.0	73.0					4																	178274472		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB079071	CCDS3828.1	4q34	2014-02-18			ENSG00000109674	ENSG00000109674			24573	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 3"""	608934				12713815, 12509226	Standard	NM_018248		Approved	FLJ10858, hFPG2, FPG2, hNEI3, ZGRF3	uc003iut.2	Q8TAT5	OTTHUMG00000160722	ENST00000264596.3:c.1050C>T	4.37:g.178274472C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PPJ3|Q8NG51|Q9NV95	Silent	SNP	pfam_Znf_GRF,pfam_DNA_glyclase/AP_lyase_DNA-bd,pfam_Znf_RanBP2,superfamily_Ribosomal_S13-like_H2TH,superfamily_DNA_glycosylase/AP_lyase_cat,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_Znf_DNA_glyclase/AP_lyase,pfscan_DNA_glycosylase/AP_lyase_cat	p.L350	ENST00000264596.3	37	c.1050	CCDS3828.1	4																																																																																			NEIL3	-	NULL	ENSG00000109674		0.318	NEIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEIL3	HGNC	protein_coding	OTTHUMT00000361914.1	64	0.00	0	C	NM_018248		178274472	178274472	+1	no_errors	ENST00000264596	ensembl	human	known	69_37n	silent	37	36.21	21	SNP	0.000	T
NOTCH2	4853	genome.wustl.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	GG	-	rs372504208		TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	GG	GG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:120612003_120612004delGG	ENST00000256646.2	-	1	236_237	c.17_18delCC	c.(16-18)cccfs	p.P6fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	6					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.P6fs*27(2)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCAGAGCGGGGCGCAGGGC	0.762			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	2	Deletion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.17_18delCC	1.37:g.120612005_120612006delGG	ENSP00000256646:p.Pro6fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P6fs	ENST00000256646.2	37	c.18_17	CCDS908.1	1																																																																																			NOTCH2	-	pirsf_Notch	ENSG00000134250		0.762	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	43	0.00	0	GG	NM_024408		120612003	120612004	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	frame_shift_del	78	19.39	19	DEL	0.101:0.700	-
NTM	50863	genome.wustl.edu	37	11	131781424	131781424	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr11:131781424G>C	ENST00000374786.1	+	1	528	c.49G>C	c.(49-51)Gtg>Ctg	p.V17L	NTM_ENST00000374784.1_Missense_Mutation_p.V17L|NTM_ENST00000374791.3_Intron|NTM_ENST00000425719.2_Missense_Mutation_p.V17L|NTM_ENST00000539799.1_Intron|NTM_ENST00000427481.2_Intron	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	17					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						CCTCGTGGTCGTGTCTCTCAG	0.642											OREG0021537	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													105.0	97.0	100.0					11																	131781424		2201	4293	6494	-	-	-	SO:0001583	missense	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.49G>C	11.37:g.131781424G>C	ENSP00000363918:p.Val17Leu	Somatic	1590	WXS	Illumina GAIIx	Phase_IV	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V17L	ENST00000374786.1	37	c.49	CCDS8491.1	11	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527020	0.44969	.	.	ENSG00000182667	ENST00000374786;ENST00000425719;ENST00000374784	T;T;T	0.58652	0.4;0.35;0.32	5.28	4.34	0.51931	.	.	.	.	.	T	0.29458	0.0734	N	0.02539	-0.55	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.15896	-1.0421	9	0.14252	T	0.57	-0.0647	12.3835	0.55320	0.0:0.4292:0.5708:0.0	.	17;17;17	Q9P121-4;Q9P121;Q9P121-3	.;NTRI_HUMAN;.	L	17	ENSP00000363918:V17L;ENSP00000396722:V17L;ENSP00000363916:V17L	ENSP00000363916:V17L	V	+	1	0	NTM	131286634	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.549000	0.45803	2.479000	0.83701	0.561000	0.74099	GTG	NTM	-	NULL	ENSG00000182667		0.642	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1	105	0.00	0	G	NM_016522		131781424	131781424	+1	no_errors	ENST00000374786	ensembl	human	known	69_37n	missense	137	29.38	57	SNP	1.000	C
NUP210	23225	genome.wustl.edu	37	3	13378496	13378496	+	Intron	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr3:13378496C>T	ENST00000254508.5	-	27	3635				NUP210_ENST00000485755.1_5'UTR	NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					CTGCCTCCTTCAAGCAGTGGG	0.532																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3553-78G>A	3.37:g.13378496C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	RNA	SNP	-	NULL	ENST00000254508.5	37	NULL	CCDS33704.1	3																																																																																			NUP210	-	-	ENSG00000132182		0.532	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	HGNC	protein_coding	OTTHUMT00000340085.1	34	0.00	0	C	NM_024923		13378496	13378496	-1	no_errors	ENST00000485755	ensembl	human	putative	69_37n	rna	30	21.05	8	SNP	0.000	T
OR8K5	219453	genome.wustl.edu	37	11	55927147	55927147	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr11:55927147A>T	ENST00000313447.1	-	1	646	c.647T>A	c.(646-648)gTg>gAg	p.V216E		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CATGTAGGACACTAAGACTAT	0.388																																						dbGAP											0													69.0	69.0	69.0					11																	55927147		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.647T>A	11.37:g.55927147A>T	ENSP00000323853:p.Val216Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFB5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V216E	ENST00000313447.1	37	c.647	CCDS31521.1	11	.	.	.	.	.	.	.	.	.	.	A	11.87	1.768070	0.31320	.	.	ENSG00000181752	ENST00000313447	T	0.42131	0.98	4.11	1.68	0.24146	GPCR, rhodopsin-like superfamily (1);	1.758880	0.03243	N	0.180722	T	0.66127	0.2758	H	0.95079	3.62	0.09310	N	1	P	0.44877	0.845	P	0.51229	0.663	T	0.37888	-0.9686	10	0.72032	D	0.01	.	3.7915	0.08722	0.584:0.1871:0.2289:0.0	.	216	Q8NH50	OR8K5_HUMAN	E	216	ENSP00000323853:V216E	ENSP00000323853:V216E	V	-	2	0	OR8K5	55683723	0.001000	0.12720	0.001000	0.08648	0.377000	0.30045	1.599000	0.36751	0.227000	0.20999	0.462000	0.41574	GTG	OR8K5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000181752		0.388	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K5	HGNC	protein_coding	OTTHUMT00000391543.1	41	0.00	0	A	NM_001004058		55927147	55927147	-1	no_errors	ENST00000313447	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.003	T
PDXDC1	23042	genome.wustl.edu	37	16	15126771	15126771	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr16:15126771delA	ENST00000396410.4	+	18	1722	c.1625delA	c.(1624-1626)gaafs	p.E542fs	PDXDC1_ENST00000450288.2_Frame_Shift_Del_p.E514fs|PDXDC1_ENST00000447912.2_Frame_Shift_Del_p.E451fs|PDXDC1_ENST00000563679.1_Frame_Shift_Del_p.E560fs|PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000325823.7_Frame_Shift_Del_p.E527fs|PDXDC1_ENST00000569715.1_Frame_Shift_Del_p.E515fs	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	542					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCCGAAGGGGAAAACATCCAT	0.378																																						dbGAP											0													98.0	105.0	103.0					16																	15126771		2197	4300	6497	-	-	-	SO:0001589	frameshift_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1625delA	16.37:g.15126771delA	ENSP00000379691:p.Glu542fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Frame_Shift_Del	DEL	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.N543fs	ENST00000396410.4	37	c.1625	CCDS32393.1	16																																																																																			PDXDC1	-	NULL	ENSG00000179889		0.378	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXDC1	HGNC	protein_coding	OTTHUMT00000389065.2	77	0.00	0	A	NM_015027		15126771	15126771	+1	no_errors	ENST00000396410	ensembl	human	known	69_37n	frame_shift_del	46	16.07	9	DEL	1.000	-
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	52	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	55	28.57	22	SNP	1.000	A
PKP4	8502	genome.wustl.edu	37	2	159481709	159481709	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr2:159481709C>A	ENST00000389759.3	+	7	1035	c.923C>A	c.(922-924)aCc>aAc	p.T308N	PKP4_ENST00000389757.3_Missense_Mutation_p.T308N	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	308					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CAATACCAAACCACCGCCAGA	0.617										HNSCC(62;0.18)																												dbGAP											0													46.0	43.0	44.0					2																	159481709		2203	4300	6503	-	-	-	SO:0001583	missense	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.923C>A	2.37:g.159481709C>A	ENSP00000374409:p.Thr308Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W91	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.T308N	ENST00000389759.3	37	c.923	CCDS33305.1	2	.	.	.	.	.	.	.	.	.	.	C	15.46	2.840091	0.51057	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	T;T	0.75821	-0.94;-0.97	5.87	5.87	0.94306	.	0.187142	0.44688	D	0.000438	T	0.78227	0.4250	L	0.43152	1.355	0.46260	D	0.998956	P;B;B;P	0.48764	0.774;0.045;0.112;0.915	P;B;B;P	0.54100	0.623;0.049;0.033;0.742	T	0.76121	-0.3075	10	0.42905	T	0.14	-14.3466	17.469	0.87640	0.0:0.8762:0.1238:0.0	.	160;308;308;160	Q6LCG8;Q99569-2;Q99569;F8W7E2	.;.;PKP4_HUMAN;.	N	160;308;308	ENSP00000374407:T308N;ENSP00000374409:T308N	ENSP00000374407:T308N	T	+	2	0	PKP4	159189955	0.649000	0.27322	0.996000	0.52242	0.765000	0.43378	3.263000	0.51546	2.941000	0.99782	0.655000	0.94253	ACC	PKP4	-	NULL	ENSG00000144283		0.617	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	29	0.00	0	C			159481709	159481709	+1	no_errors	ENST00000389759	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	A
POMT1	10585	genome.wustl.edu	37	9	134382847	134382847	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr9:134382847G>T	ENST00000372228.3	+	5	552	c.373G>T	c.(373-375)Gag>Tag	p.E125*	POMT1_ENST00000423007.1_Nonsense_Mutation_p.E125*|POMT1_ENST00000402686.3_Nonsense_Mutation_p.E125*|POMT1_ENST00000419118.2_Intron|POMT1_ENST00000354713.4_Nonsense_Mutation_p.E95*|POMT1_ENST00000541219.1_Intron|POMT1_ENST00000341012.7_Nonsense_Mutation_p.E71*|POMT1_ENST00000404875.2_Nonsense_Mutation_p.E8*	NM_007171.3	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1	125					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|mannosylation (GO:0097502)|multicellular organismal development (GO:0007275)|protein O-linked glycosylation (GO:0006493)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannosyltransferase activity (GO:0000030)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	31		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		GATAGTGTTGGAGCTCCACTT	0.577																																						dbGAP											0													186.0	153.0	164.0					9																	134382847		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF095136	CCDS6943.1, CCDS43894.1, CCDS43895.1, CCDS48045.1	9q34.1	2014-09-17			ENSG00000130714	ENSG00000130714	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	9202	protein-coding gene	gene with protein product	"""dolichyl-phosphate-mannose-protein mannosyltransferase"""	607423				10366449	Standard	NM_001077366		Approved	LGMD2K	uc004cav.3	Q9Y6A1	OTTHUMG00000020826	ENST00000372228.3:c.373G>T	9.37:g.134382847G>T	ENSP00000361302:p.Glu125*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQG0|B4DIF0|Q5JT01|Q5JT06|Q5JT08|Q8NC91|Q8TCA9|Q9NX32|Q9NX82|Q9UNT2	Nonsense_Mutation	SNP	pfam_Glyco_trans_39,pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	p.E125*	ENST00000372228.3	37	c.373	CCDS6943.1	9	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734166	0.69189	.	.	ENSG00000130714	ENST00000423007;ENST00000404875;ENST00000341012;ENST00000441334;ENST00000372221;ENST00000372228;ENST00000402686;ENST00000354713;ENST00000418774;ENST00000415075;ENST00000448212;ENST00000430619	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-33.2659	17.8015	0.88589	0.0:0.0:1.0:0.0	.	.	.	.	X	125;8;71;8;8;125;125;95;125;8;71;8	.	ENSP00000343034:E71X	E	+	1	0	POMT1	133372668	1.000000	0.71417	0.836000	0.33094	0.368000	0.29767	8.809000	0.91944	2.499000	0.84300	0.563000	0.77884	GAG	POMT1	-	pfam_Glyco_trans_39	ENSG00000130714		0.577	POMT1-001	KNOWN	basic|CCDS	protein_coding	POMT1	HGNC	protein_coding	OTTHUMT00000054737.1	116	0.85	1	G	NM_007171		134382847	134382847	+1	no_errors	ENST00000372228	ensembl	human	known	69_37n	nonsense	71	25.26	24	SNP	1.000	T
POTEB	100996331	genome.wustl.edu	37	15	22077592	22077592	+	Missense_Mutation	SNP	T	T	C	rs28363950	byFrequency	TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr15:22077592T>C	ENST00000439682.1	-	3	689	c.638A>G	c.(637-639)gAa>gGa	p.E213G	POTEB_ENST00000553662.2_5'UTR	NM_001277304.1	NP_001264233.1	Q6S5H4	POTEB_HUMAN	POTE ankyrin domain family, member B	250										endometrium(2)|kidney(8)|lung(4)	14						TAATTTATCTTCATTGTAGAT	0.348																																						dbGAP											0													1.0	1.0	1.0					15																	22077592		194	310	504	-	-	-	SO:0001583	missense	0			AY465170	CCDS59250.1	15q11.2	2014-01-10	2008-11-26	2008-11-26	ENSG00000233917	ENSG00000233917		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33734	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 5"""	608912	"""ANKRD26-like family B, member 1"""	A26B1			Standard	NM_001277304		Approved	POTE15, POTE-15, CT104.5	uc031qqz.1	Q6S5H4		ENST00000439682.1:c.638A>G	15.37:g.22077592T>C	ENSP00000457689:p.Glu213Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NXN7|Q6S5H7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E213G	ENST00000439682.1	37	c.638	CCDS59250.1	15																																																																																			POTEB	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000233917		0.348	POTEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB	HGNC	protein_coding	OTTHUMT00000414911.2	9	0.00	0	T	NM_207355		22077592	22077592	-1	no_errors	ENST00000439682	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.000	C
PRB2	653247	genome.wustl.edu	37	12	11546686	11546686	+	Missense_Mutation	SNP	C	C	T	rs76832300		TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr12:11546686C>T	ENST00000389362.4	-	3	361	c.326G>A	c.(325-327)cGa>cAa	p.R109Q	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	109	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TCGGGGACTTCGGGACTTGTC	0.602																																						dbGAP											0													324.0	347.0	339.0					12																	11546686		2203	4300	6503	-	-	-	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.326G>A	12.37:g.11546686C>T	ENSP00000374013:p.Arg109Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.R109Q	ENST00000389362.4	37	c.326	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	0.127	-1.117972	0.01785	.	.	ENSG00000121335	ENST00000389362	T	0.04083	3.71	1.23	-2.46	0.06461	.	.	.	.	.	T	0.00936	0.0031	N	0.00227	-1.8	0.80722	P	0.0	B	0.23854	0.092	B	0.06405	0.002	T	0.36089	-0.9762	8	0.10902	T	0.67	.	2.7758	0.05347	0.2053:0.2954:0.0:0.4994	.	109	P02812	PRB2_HUMAN	Q	109	ENSP00000374013:R109Q	ENSP00000374013:R109Q	R	-	2	0	PRB2	11437953	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.294000	0.02767	-2.070000	0.00881	-1.096000	0.02151	CGA	PRB2	-	NULL	ENSG00000121335		0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	85	0.00	0	C	NM_006248		11546686	11546686	-1	no_errors	ENST00000389362	ensembl	human	known	69_37n	missense	142	10.69	17	SNP	0.000	T
PRKAB1	5564	genome.wustl.edu	37	12	120118061	120118061	+	Silent	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr12:120118061G>A	ENST00000229328.5	+	7	1236	c.744G>A	c.(742-744)gtG>gtA	p.V248V	PRKAB1_ENST00000540121.1_Silent_p.V82V|PRKAB1_ENST00000541640.1_Silent_p.V248V|PRKAB1_ENST00000537057.1_3'UTR	NM_006253.4	NP_006244.2	Q9Y478	AAKB1_HUMAN	protein kinase, AMP-activated, beta 1 non-catalytic subunit	248					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase activity (GO:0004672)			endometrium(2)|large_intestine(3)|lung(5)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Metformin(DB00331)	AGGATGGAGTGATGGTGCTCA	0.507																																						dbGAP											0													103.0	87.0	93.0					12																	120118061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001823	CCDS9191.1	12q24.1-q24.3	2008-05-14			ENSG00000111725	ENSG00000111725			9378	protein-coding gene	gene with protein product	"""AMPK beta 1"""	602740				8557660	Standard	NM_006253		Approved		uc001txg.3	Q9Y478	OTTHUMG00000168954	ENST00000229328.5:c.744G>A	12.37:g.120118061G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UBV0|Q9UE20|Q9UEX2|Q9Y6V8	Silent	SNP	pfam_AMP_prot_kin_bsu_interact-dom,superfamily_Ig_E-set	p.V248	ENST00000229328.5	37	c.744	CCDS9191.1	12																																																																																			PRKAB1	-	pfam_AMP_prot_kin_bsu_interact-dom	ENSG00000111725		0.507	PRKAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAB1	HGNC	protein_coding	OTTHUMT00000401731.2	79	0.00	0	G	NM_006253		120118061	120118061	+1	no_errors	ENST00000229328	ensembl	human	known	69_37n	silent	17	29.17	7	SNP	1.000	A
PTPN20A	653129	genome.wustl.edu	37	10	46584514	46584514	+	Silent	SNP	T	T	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr10:46584514T>C	ENST00000374339.3	-	6	577	c.501A>G	c.(499-501)gaA>gaG	p.E167E	PTPN20A_ENST00000506080.1_Silent_p.E139E|PTPN20A_ENST00000505814.1_Silent_p.E86E|PTPN20A_ENST00000511769.1_Silent_p.E158E|PTPN20A_ENST00000509599.1_Silent_p.E167E|PTPN20A_ENST00000509900.1_Silent_p.E86E|PTPN20A_ENST00000513156.1_Intron|PTPN20A_ENST00000395725.3_Silent_p.E86E|PTPN20A_ENST00000509774.1_Silent_p.E158E|PTPN20A_ENST00000374218.2_Silent_p.E86E|PTPN20A_ENST00000374346.3_Silent_p.E167E|PTPN20A_ENST00000503851.1_Intron|PTPN20A_ENST00000437863.1_Silent_p.E139E|PTPN20A_ENST00000502705.1_Intron|PTPN20A_ENST00000395722.3_Intron|PTPN20A_ENST00000502254.1_Intron|PTPN20A_ENST00000395727.2_Intron|PTPN20A_ENST00000395721.2_Silent_p.E86E|PTPN20A_ENST00000513266.1_Intron|PTPN20A_ENST00000508602.1_Silent_p.E139E|PTPN20A_ENST00000374340.3_5'UTR|PTPN20A_ENST00000374342.2_Intron			Q4JDL3	PTN20_HUMAN	protein tyrosine phosphatase, non-receptor type 20A	167	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.					cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)								Kidney(211;0.201)		GATTCTTAAGTTCTAAAGCCT	0.274																																						dbGAP											0													1.0	1.0	1.0					10																	46584514		424	272	696	-	-	-	SO:0001819	synonymous_variant	0					10q11.22	2011-06-09			ENSG00000204179	ENSG00000204179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	23422	protein-coding gene	gene with protein product	"""cancer/testis antigen 126"""						Standard			Approved	bA142I17.1, CT126		Q4JDL3	OTTHUMG00000018094	ENST00000374339.3:c.501A>G	10.37:g.46584514T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNH8|B7ZKV3|Q4JDG6|Q4JDK1|Q4JDK5|Q4JDK6|Q4JDK8|Q4JDK9|Q4JDL0|Q4JDL1|Q4JDL4|Q4JDL5|Q4JDL6|Q4JDL7|Q4JDL8|Q5RJ33|Q5T1G3	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.E167	ENST00000374339.3	37	c.501	CCDS31190.1	10																																																																																			PTPN20A	-	smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000204179		0.274	PTPN20A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPN20A	HGNC	protein_coding	OTTHUMT00000358639.1	10	0.00	0	T			46584514	46584514	-1	no_errors	ENST00000374339	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.220	C
Unknown	0	genome.wustl.edu	37	10	49291929	49291929	+	IGR	SNP	T	T	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr10:49291929T>C								RNA5SP315 (43338 upstream) : RP11-13E1.5 (71438 downstream)																							GATTCTTAAGTTCTAAAGCCT	0.274																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															10.37:g.49291929T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.E164		37	c.492		10																																																																																			PTPN20C	-	smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000126542	0	0.274					PTPN20C	HGNC			42	0.00	0	T			49291929	49291929	-1	no_start_codon	ENST00000316733	ensembl	human	known	69_37n	silent	49	10.91	6	SNP	0.490	C
RBAK	57786	genome.wustl.edu	37	7	5103887	5103887	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr7:5103887G>T	ENST00000353796.3	+	6	1124	c.800G>T	c.(799-801)gGa>gTa	p.G267V	RBAK_ENST00000396912.1_Missense_Mutation_p.G267V|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	267					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		AGTGAATGTGGAAAATCCTTC	0.388																																						dbGAP											0													62.0	65.0	64.0					7																	5103887		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.800G>T	7.37:g.5103887G>T	ENSP00000275423:p.Gly267Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G267V	ENST00000353796.3	37	c.800	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	G	8.184	0.794440	0.16327	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.22134	1.97;1.97	3.76	2.87	0.33458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000120	T	0.52289	0.1725	M	0.92077	3.27	0.41859	D	0.990211	D	0.89917	1.0	D	0.87578	0.998	T	0.70835	-0.4764	8	.	.	.	.	10.9083	0.47092	0.0:0.0:0.8106:0.1894	.	267	Q9NYW8	RBAK_HUMAN	V	267	ENSP00000275423:G267V;ENSP00000380120:G267V	.	G	+	2	0	RBAK	5070413	0.998000	0.40836	0.964000	0.40570	0.016000	0.09150	2.713000	0.47194	1.142000	0.42291	-0.320000	0.08662	GGA	RBAK	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000146587		0.388	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	HGNC	protein_coding	OTTHUMT00000241640.2	31	0.00	0	G	NM_021163		5103887	5103887	+1	no_errors	ENST00000353796	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.516	T
RGPD4	285190	genome.wustl.edu	37	2	108499277	108499277	+	Silent	SNP	G	G	A	rs552179889	byFrequency	TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr2:108499277G>A	ENST00000408999.3	+	22	5291	c.5214G>A	c.(5212-5214)acG>acA	p.T1738T	RGPD4_ENST00000354986.4_Silent_p.T1738T	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1738	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TTATAAATACGATGTTGCAGC	0.433													N|||	2	0.000399361	0.0	0.0	5008	,	,		18256	0.001		0.0	False		,,,				2504	0.001					dbGAP											0													105.0	87.0	92.0					2																	108499277		692	1578	2270	-	-	-	SO:0001819	synonymous_variant	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.5214G>A	2.37:g.108499277G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9A029	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.T1738	ENST00000408999.3	37	c.5214	CCDS46381.1	2																																																																																			RGPD4	-	pfam_GRIP,superfamily_GRIP,smart_GRIP,pfscan_GRIP	ENSG00000196862		0.433	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	132	0.00	0	G	XM_496581		108499277	108499277	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	silent	116	32.95	57	SNP	0.990	A
RSPH1	89765	genome.wustl.edu	37	21	43916278	43916278	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr21:43916278C>G	ENST00000291536.3	-	1	186	c.19G>C	c.(19-21)Gag>Cag	p.E7Q	RSPH1_ENST00000398352.3_Missense_Mutation_p.E7Q|SLC37A1_ENST00000454800.1_3'UTR|AP001625.4_ENST00000416179.1_RNA	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	7					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						TCCAACTCCTCCGAGCCCAGG	0.672																																					Esophageal Squamous(23;63 706 6286 10288 12913)	dbGAP											0													132.0	113.0	120.0					21																	43916278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.19G>C	21.37:g.43916278C>G	ENSP00000291536:p.Glu7Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWV0|B2RBN9|Q3MJA1	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.E7Q	ENST00000291536.3	37	c.19	CCDS13688.1	21	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703795	0.68501	.	.	ENSG00000160188	ENST00000291536;ENST00000398352	T;T	0.60424	0.19;0.31	3.79	3.79	0.43588	.	0.630283	0.14446	N	0.319108	T	0.74007	0.3660	M	0.76574	2.34	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.70498	-0.4855	10	0.27785	T	0.31	.	15.1034	0.72299	0.0:1.0:0.0:0.0	.	7	Q8WYR4	RSPH1_HUMAN	Q	7	ENSP00000291536:E7Q;ENSP00000381395:E7Q	ENSP00000291536:E7Q	E	-	1	0	RSPH1	42789347	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	3.498000	0.53302	2.414000	0.81942	0.655000	0.94253	GAG	RSPH1	-	NULL	ENSG00000160188		0.672	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH1	HGNC	protein_coding	OTTHUMT00000195379.1	45	0.00	0	C			43916278	43916278	-1	no_errors	ENST00000291536	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	1.000	G
SGCE	8910	genome.wustl.edu	37	7	94257530	94257530	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr7:94257530T>G	ENST00000265735.7	-	3	484	c.374A>C	c.(373-375)aAg>aCg	p.K125T	SGCE_ENST00000428696.2_Missense_Mutation_p.K125T|SGCE_ENST00000415788.2_Missense_Mutation_p.K161T|SGCE_ENST00000437425.2_Missense_Mutation_p.K84T|SGCE_ENST00000445866.2_Missense_Mutation_p.K125T|SGCE_ENST00000447873.1_Missense_Mutation_p.K125T	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	125					cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GATTGTTGGCTTCCCCACATT	0.413																																						dbGAP											0													85.0	73.0	77.0					7																	94257530		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.374A>C	7.37:g.94257530T>G	ENSP00000265735:p.Lys125Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Missense_Mutation	SNP	pfam_Sarcoglycan_2,superfamily_Cadherin-like,smart_Cadg	p.K125T	ENST00000265735.7	37	c.374	CCDS5637.1	7	.	.	.	.	.	.	.	.	.	.	T	16.28	3.079504	0.55753	.	.	ENSG00000127990	ENST00000265735;ENST00000445866;ENST00000437425;ENST00000447873;ENST00000428696;ENST00000415788	D;D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44;-4.44	5.5	5.5	0.81552	Dystroglycan-type cadherin-like (1);	0.091092	0.85682	D	0.000000	D	0.96688	0.8919	L	0.58101	1.795	0.80722	D	1	B;P;B;P;P	0.47484	0.155;0.77;0.254;0.823;0.896	B;P;B;P;P	0.48952	0.159;0.5;0.266;0.535;0.596	D	0.96516	0.9382	10	0.46703	T	0.11	-16.2008	15.9068	0.79436	0.0:0.0:0.0:1.0	.	161;84;125;125;125	B7Z2R4;E9PEH6;E9PF60;G5E9K6;O43556	.;.;.;.;SGCE_HUMAN	T	125;125;84;125;125;161	ENSP00000265735:K125T;ENSP00000398930:K125T;ENSP00000394061:K84T;ENSP00000388734:K125T;ENSP00000397536:K125T;ENSP00000405313:K161T	ENSP00000265735:K125T	K	-	2	0	SGCE	94095466	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.729000	0.62008	2.218000	0.71995	0.528000	0.53228	AAG	SGCE	-	pfam_Sarcoglycan_2,superfamily_Cadherin-like,smart_Cadg	ENSG00000127990		0.413	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCE	HGNC	protein_coding	OTTHUMT00000255251.2	73	0.00	0	T			94257530	94257530	-1	no_errors	ENST00000445866	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	G
SGSM1	129049	genome.wustl.edu	37	22	25270489	25270489	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr22:25270489G>A	ENST00000400359.4	+	13	1406	c.1399G>A	c.(1399-1401)Gag>Aag	p.E467K	SGSM1_ENST00000400358.4_Intron	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	467						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GAGTCAGTGGGAGCCAGCCAG	0.657																																						dbGAP											0													38.0	40.0	39.0					22																	25270489		2061	4206	6267	-	-	-	SO:0001583	missense	0			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.1399G>A	22.37:g.25270489G>A	ENSP00000383212:p.Glu467Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.E467K	ENST00000400359.4	37	c.1399	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	G	1.531	-0.544238	0.04024	.	.	ENSG00000167037	ENST00000400359	T	0.06371	3.31	4.63	3.61	0.41365	.	.	.	.	.	T	0.02767	0.0083	N	0.08118	0	0.36059	D	0.841293	B	0.11235	0.004	B	0.04013	0.001	T	0.33214	-0.9877	9	0.07030	T	0.85	0.7207	7.9968	0.30273	0.1077:0.0:0.8923:0.0	.	467	Q2NKQ1	SGSM1_HUMAN	K	467	ENSP00000383212:E467K	ENSP00000383212:E467K	E	+	1	0	SGSM1	23600489	0.988000	0.35896	0.978000	0.43139	0.051000	0.14879	2.447000	0.44917	2.563000	0.86464	0.563000	0.77884	GAG	SGSM1	-	NULL	ENSG00000167037		0.657	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	79	0.00	0	G	XM_059318		25270489	25270489	+1	no_errors	ENST00000400359	ensembl	human	known	69_37n	missense	30	31.82	14	SNP	0.907	A
SLC26A2	1836	genome.wustl.edu	37	5	149361212	149361212	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr5:149361212delT	ENST00000286298.4	+	3	2324	c.2056delT	c.(2056-2058)tgcfs	p.C686fs		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	686	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GCTGGCTCAGTGCAATCCCAC	0.438																																						dbGAP											0													61.0	63.0	63.0					5																	149361212		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.2056delT	5.37:g.149361212delT	ENSP00000286298:p.Cys686fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U3|B2R6J1|Q6N051	Frame_Shift_Del	DEL	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.C686fs	ENST00000286298.4	37	c.2056	CCDS4300.1	5																																																																																			SLC26A2	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	ENSG00000155850		0.438	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A2	HGNC	protein_coding	OTTHUMT00000252333.2	53	0.00	0	T	NM_000112		149361212	149361212	+1	no_errors	ENST00000286298	ensembl	human	known	69_37n	frame_shift_del	28	14.71	5	DEL	0.998	-
SLC35E1	79939	genome.wustl.edu	37	19	16683056	16683056	+	Silent	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:16683056C>T	ENST00000595753.1	-	1	137	c.120G>A	c.(118-120)ctG>ctA	p.L40L	CTD-3222D19.2_ENST00000409035.1_Intron|SLC35E1_ENST00000431408.1_5'Flank	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	40					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						CGCCCGCGCTCAGCGCGTACC	0.751																																						dbGAP											0													16.0	24.0	21.0					19																	16683056		685	1583	2268	-	-	-	SO:0001819	synonymous_variant	0			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.120G>A	19.37:g.16683056C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBQ2|Q96JV7	Silent	SNP	pfam_DUF250,pfam_DMT,pfam_UAA	p.L40	ENST00000595753.1	37	c.120	CCDS12346.2	19																																																																																			SLC35E1	-	NULL	ENSG00000127526		0.751	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35E1	HGNC	protein_coding	OTTHUMT00000326809.2	33	0.00	0	C	NM_024881		16683056	16683056	-1	no_errors	ENST00000409648	ensembl	human	known	69_37n	silent	71	21.11	19	SNP	1.000	T
SLC39A3	29985	genome.wustl.edu	37	19	2737421	2737421	+	Intron	DEL	T	T	-	rs567070163	byFrequency	TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:2737421delT	ENST00000269740.4	-	2	208				SLC39A3_ENST00000545664.1_Intron|SLC39A3_ENST00000455372.2_Intron|SLC39A3_ENST00000590875.1_5'UTR|AC006538.4_ENST00000586572.1_Intron	NM_144564.4	NP_653165.2	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter), member 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttcttttttcttttttttttt	0.488																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF052125	CCDS12093.1, CCDS45909.1	19p13.3	2013-05-22			ENSG00000141873	ENSG00000141873		"""Solute carriers"""	17128	protein-coding gene	gene with protein product		612168				10681536	Standard	NM_144564		Approved	ZIP3	uc002lwg.3	Q9BRY0		ENST00000269740.4:c.122-44A>-	19.37:g.2737421delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMJ3|Q8WUG1	RNA	DEL	-	NULL	ENST00000269740.4	37	NULL	CCDS12093.1	19																																																																																			SLC39A3	-	-	ENSG00000141873		0.488	SLC39A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A3	HGNC	protein_coding	OTTHUMT00000451354.2	14	0.00	0	T			2737421	2737421	-1	no_errors	ENST00000590875	ensembl	human	known	69_37n	rna	17	29.17	7	DEL	0.018	-
SLC35E1	79939	genome.wustl.edu	37	19	16683100	16683100	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:16683100C>T	ENST00000595753.1	-	1	93	c.76G>A	c.(76-78)Gag>Aag	p.E26K	CTD-3222D19.2_ENST00000409035.1_Intron|SLC35E1_ENST00000431408.1_5'Flank	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	26					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						CGCGCGCCCTCGCGCGCCCCA	0.781																																						dbGAP											0													8.0	11.0	10.0					19																	16683100		656	1558	2214	-	-	-	SO:0001583	missense	0			AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.76G>A	19.37:g.16683100C>T	ENSP00000470652:p.Glu26Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	pfam_DUF250,pfam_DMT,pfam_UAA	p.E26K	ENST00000595753.1	37	c.76	CCDS12346.2	19	.	.	.	.	.	.	.	.	.	.	c	12.84	2.059782	0.36373	.	.	ENSG00000127526	ENST00000409648;ENST00000436553	.	.	.	3.67	1.49	0.22878	.	.	.	.	.	T	0.34803	0.0910	L	0.27053	0.805	0.80722	D	1	B	0.17465	0.022	B	0.12156	0.007	T	0.23013	-1.0200	8	0.02654	T	1	.	7.9008	0.29734	0.0:0.7869:0.0:0.2131	.	26	Q96K37	S35E1_HUMAN	K	26;6	.	ENSP00000387152:E26K	E	-	1	0	SLC35E1	16544100	1.000000	0.71417	0.708000	0.30435	0.119000	0.20118	5.581000	0.67471	0.093000	0.17368	0.306000	0.20318	GAG	SLC35E1	-	NULL	ENSG00000127526		0.781	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35E1	HGNC	protein_coding	OTTHUMT00000326809.2	16	0.00	0	C	NM_024881		16683100	16683100	-1	no_errors	ENST00000409648	ensembl	human	known	69_37n	missense	35	28.57	14	SNP	1.000	T
SLC5A8	160728	genome.wustl.edu	37	12	101581287	101581287	+	Silent	SNP	G	G	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr12:101581287G>C	ENST00000536262.2	-	7	1398	c.840C>G	c.(838-840)ctC>ctG	p.L280L		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8									p.L280L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GATTGATGTAGAGAGACCTAA	0.433																																					GBM(60;420 1056 13605 22380 47675)	dbGAP											1	Substitution - coding silent(1)	endometrium(1)											89.0	85.0	86.0					12																	101581287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.840C>G	12.37:g.101581287G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L280	ENST00000536262.2	37	c.840	CCDS9080.1	12																																																																																			SLC5A8	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000256870		0.433	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A8	HGNC	protein_coding	OTTHUMT00000409401.1	32	0.00	0	G	NM_145913		101581287	101581287	-1	no_errors	ENST00000536262	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.987	C
SMG1	23049	genome.wustl.edu	37	16	18826809	18826809	+	Silent	SNP	G	G	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr16:18826809G>C	ENST00000446231.2	-	59	10879	c.10467C>G	c.(10465-10467)ctC>ctG	p.L3489L	SMG1_ENST00000389467.3_Silent_p.L3490L			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3489					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGATTTCCTGGAGCATTTCAA	0.383																																						dbGAP											0													173.0	152.0	159.0					16																	18826809		1873	4113	5986	-	-	-	SO:0001819	synonymous_variant	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.10467C>G	16.37:g.18826809G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L3490	ENST00000446231.2	37	c.10470	CCDS45430.1	16																																																																																			SMG1	-	NULL	ENSG00000157106		0.383	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	61	0.00	0	G	NM_015092		18826809	18826809	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	silent	31	29.55	13	SNP	1.000	C
SLC6A10P	386757	genome.wustl.edu	37	16	32890814	32890814	+	RNA	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr16:32890814C>T	ENST00000330048.5	-	0	3066					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		GGTCGGTACCCGATCATACAG	0.662																																						dbGAP											0																																										-	-	-			0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32890814C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.662	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	167	0.00	0	C			32890814	32890814	-1	no_errors	ENST00000330048	ensembl	human	known	69_37n	rna	165	20.29	42	SNP	1.000	T
SNUPN	10073	genome.wustl.edu	37	15	75913265	75913265	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr15:75913265C>T	ENST00000564644.1	-	3	706	c.128G>A	c.(127-129)cGc>cAc	p.R43H	SNUPN_ENST00000564675.1_Missense_Mutation_p.R43H|SNUPN_ENST00000371091.5_Missense_Mutation_p.R85H|SNUPN_ENST00000567134.1_Missense_Mutation_p.R43H|SNUPN_ENST00000308588.5_Missense_Mutation_p.R43H			O95149	SPN1_HUMAN	snurportin 1	43	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.|Necessary for interaction with KPNB1 and m3G-cap U1 and U5 snRNP import receptor activity.|Necessary for interaction with XPO1.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein import into nucleus (GO:0006606)|RNA metabolic process (GO:0016070)|snRNA import into nucleus (GO:0061015)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	protein transporter activity (GO:0008565)|RNA cap binding (GO:0000339)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)	8						CCTCCGGCGGCGCTCACTCTG	0.517																																						dbGAP											0													123.0	123.0	123.0					15																	75913265		2197	4294	6491	-	-	-	SO:0001583	missense	0			AF039029	CCDS10281.1	15q24.2	2008-02-05	2006-07-14	2006-07-14	ENSG00000169371	ENSG00000169371			14245	protein-coding gene	gene with protein product		607902	"""RNA, U transporter 1"""	RNUT1		9670026	Standard	NM_005701		Approved	SNURPORTIN-1, Snurportin1	uc002bas.3	O95149	OTTHUMG00000142833	ENST00000564644.1:c.128G>A	15.37:g.75913265C>T	ENSP00000454852:p.Arg43His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE34|A8K0B0|D3DW76	Missense_Mutation	SNP	pfam_Snurportin-1_N,pirsf_Snurportin-1,pfscan_Importin-a_IBB	p.R85H	ENST00000564644.1	37	c.254	CCDS10281.1	15	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592824	0.86953	.	.	ENSG00000169371	ENST00000308588;ENST00000371091	.	.	.	5.87	5.87	0.94306	Importin-alpha, importin-beta-binding domain (1);Snurportin-1, N-terminal (1);	0.114590	0.64402	D	0.000012	T	0.79499	0.4456	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.963	T	0.80362	-0.1414	9	0.87932	D	0	-22.3518	18.782	0.91937	0.0:1.0:0.0:0.0	.	85;43	C9K0X5;O95149	.;SPN1_HUMAN	H	43;85	.	ENSP00000309831:R43H	R	-	2	0	SNUPN	73700320	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	6.592000	0.74095	2.785000	0.95823	0.655000	0.94253	CGC	SNUPN	-	pfam_Snurportin-1_N,pirsf_Snurportin-1,pfscan_Importin-a_IBB	ENSG00000169371		0.517	SNUPN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNUPN	HGNC	protein_coding	OTTHUMT00000420332.1	53	0.00	0	C	NM_005701		75913265	75913265	-1	no_errors	ENST00000371091	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	1.000	T
SNX27	81609	genome.wustl.edu	37	1	151665018	151665018	+	Silent	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:151665018G>A	ENST00000458013.2	+	9	1467	c.1347G>A	c.(1345-1347)acG>acA	p.T449T	SNX27_ENST00000368838.1_Silent_p.T356T|SNX27_ENST00000368843.3_Silent_p.T449T			Q96L92	SNX27_HUMAN	sorting nexin family member 27	449	FERM-like region F3.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCAGCATCACGCACTTTAAAC	0.507																																					Colon(46;291 966 40145 41237 41888)	dbGAP											0													162.0	135.0	144.0					1																	151665018		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1347G>A	1.37:g.151665018G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Silent	SNP	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.T449	ENST00000458013.2	37	c.1347		1																																																																																			SNX27	-	NULL	ENSG00000143376		0.507	SNX27-003	NOVEL	basic	protein_coding	SNX27	HGNC	protein_coding	OTTHUMT00000036624.3	88	0.00	0	G	NM_030918		151665018	151665018	+1	no_errors	ENST00000368843	ensembl	human	known	69_37n	silent	66	22.35	19	SNP	1.000	A
SPAM1	6677	genome.wustl.edu	37	7	123599693	123599693	+	Silent	SNP	C	C	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr7:123599693C>G	ENST00000439500.1	+	6	1813	c.1200C>G	c.(1198-1200)ctC>ctG	p.L400L	SPAM1_ENST00000460182.1_Silent_p.L400L|SPAM1_ENST00000223028.7_Silent_p.L400L|SPAM1_ENST00000402183.2_Silent_p.L400L|SPAM1_ENST00000340011.5_Silent_p.L400L	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	400					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ATCTTCACCTCAACCCAGATA	0.408																																						dbGAP											0													113.0	106.0	108.0					7																	123599693		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1200C>G	7.37:g.123599693C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TC30	Silent	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Glyco_hydro_56_PH20,prints_Hyaluronidase	p.L400	ENST00000439500.1	37	c.1200	CCDS5791.1	7																																																																																			SPAM1	-	pirsf_Hyaluronidase	ENSG00000106304		0.408	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	HGNC	protein_coding	OTTHUMT00000348309.1	50	0.00	0	C			123599693	123599693	+1	no_errors	ENST00000340011	ensembl	human	known	69_37n	silent	41	18.00	9	SNP	0.973	G
SPANXN2	494119	genome.wustl.edu	37	X	142795497	142795497	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chrX:142795497T>C	ENST00000370498.1	-	2	934	c.181A>G	c.(181-183)Acg>Gcg	p.T61A		NM_001009615.1	NP_001009615.1	Q5MJ10	SPXN2_HUMAN	SPANX family, member N2	61										NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)					TTTATTTTCGTATGCTTCCTG	0.453																																						dbGAP											0													247.0	215.0	226.0					X																	142795497		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35419.1	Xq27.3	2012-06-12			ENSG00000203924	ENSG00000268988			33175	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 7"""	300665				14973187, 17012309	Standard	NM_001009615		Approved	SPANX-N2, CT11.7	uc004fbz.3	Q5MJ10	OTTHUMG00000022583	ENST00000370498.1:c.181A>G	X.37:g.142795497T>C	ENSP00000359529:p.Thr61Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0ZNM2	Missense_Mutation	SNP	pfam_SPANX_prot	p.T61A	ENST00000370498.1	37	c.181	CCDS35419.1	X	.	.	.	.	.	.	.	.	.	.	T	3.731	-0.055601	0.07362	.	.	ENSG00000203924	ENST00000370498	T	0.06294	3.32	0.645	-0.727	0.11166	.	.	.	.	.	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B	0.21688	0.059	B	0.14578	0.011	T	0.42932	-0.9422	8	0.44086	T	0.13	.	.	.	.	.	61	Q5MJ10	SPXN2_HUMAN	A	61	ENSP00000359529:T61A	ENSP00000359529:T61A	T	-	1	0	SPANXN2	142623163	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.137000	0.10389	-0.395000	0.07715	-0.794000	0.03295	ACG	SPANXN2	-	pfam_SPANX_prot	ENSG00000203924		0.453	SPANXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN2	HGNC	protein_coding	OTTHUMT00000058621.2	160	0.00	0	T	NM_001009615		142795497	142795497	-1	no_errors	ENST00000370498	ensembl	human	known	69_37n	missense	78	47.65	71	SNP	0.000	C
SPATA13	221178	genome.wustl.edu	37	13	24797937	24797937	+	Intron	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr13:24797937G>A	ENST00000382095.4	+	2	185				SPATA13_ENST00000382108.3_Silent_p.L290L|SPATA13_ENST00000424834.2_Silent_p.L290L|RP11-307N16.6_ENST00000382141.4_Silent_p.L290L	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		AGAGGACCCTGAGCAGTTCCT	0.542																																						dbGAP											0													57.0	55.0	55.0					13																	24797937		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.-222-25678G>A	13.37:g.24797937G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.E328K	ENST00000382095.4	37	c.982	CCDS9305.1	13	.	.	.	.	.	.	.	.	.	.	G	9.129	1.010854	0.19277	.	.	ENSG00000182957	ENST00000424834	.	.	.	4.62	-2.66	0.06077	.	.	.	.	.	T	0.50000	0.1590	.	.	.	0.40297	D	0.978563	.	.	.	.	.	.	T	0.44251	-0.9340	4	.	.	.	.	6.2984	0.21099	0.3787:0.2222:0.3991:0.0	.	.	.	.	K	328	.	.	E	+	1	0	SPATA13	23695937	0.109000	0.22037	0.241000	0.24154	0.379000	0.30106	0.045000	0.14013	-0.558000	0.06118	-0.730000	0.03578	GAG	SPATA13	-	NULL	ENSG00000182957		0.542	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPATA13	HGNC	protein_coding	OTTHUMT00000044180.2	48	0.00	0	G	NM_153023		24797937	24797937	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000382141	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	0.099	A
TAS2R41	259287	genome.wustl.edu	37	7	143175315	143175315	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr7:143175315C>G	ENST00000408916.1	+	1	350	c.350C>G	c.(349-351)tCc>tGc	p.S117C	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	117					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S117Y(1)		endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					ATCACACACTCCACCTTCCTG	0.522																																						dbGAP											1	Substitution - Missense(1)	lung(1)											76.0	75.0	76.0					7																	143175315		2000	4171	6171	-	-	-	SO:0001583	missense	0			AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.350C>G	7.37:g.143175315C>G	ENSP00000386201:p.Ser117Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S117C	ENST00000408916.1	37	c.350	CCDS43663.1	7	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581562	0.28180	.	.	ENSG00000221855	ENST00000408916	T	0.38560	1.13	5.7	3.84	0.44239	.	0.200286	0.34046	U	0.004307	T	0.43033	0.1229	L	0.34521	1.04	0.09310	N	0.999999	D	0.56521	0.976	P	0.54856	0.762	T	0.25363	-1.0134	10	0.66056	D	0.02	.	9.3883	0.38356	0.1539:0.5482:0.2978:0.0	.	117	P59536	T2R41_HUMAN	C	117	ENSP00000386201:S117C	ENSP00000386201:S117C	S	+	2	0	TAS2R41	142885437	0.000000	0.05858	0.590000	0.28732	0.728000	0.41692	0.427000	0.21379	0.710000	0.31997	-0.175000	0.13238	TCC	TAS2R41	-	pfam_TAS2_rcpt	ENSG00000221855		0.522	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R41	HGNC	protein_coding	OTTHUMT00000342149.1	62	0.00	0	C			143175315	143175315	+1	no_errors	ENST00000408916	ensembl	human	known	69_37n	missense	60	27.71	23	SNP	0.631	G
TK2	7084	genome.wustl.edu	37	16	66547661	66547661	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr16:66547661G>T	ENST00000451102.2	-	9	1022	c.672C>A	c.(670-672)agC>agA	p.S224R	TK2_ENST00000299697.7_Missense_Mutation_p.S266R|TK2_ENST00000544898.1_Missense_Mutation_p.S175R|TK2_ENST00000417693.3_Missense_Mutation_p.S206R|RP11-403P17.5_ENST00000561728.1_Missense_Mutation_p.P41T|TK2_ENST00000527800.1_Missense_Mutation_p.S127R|TK2_ENST00000568170.1_5'Flank|TK2_ENST00000527284.1_Missense_Mutation_p.S193R|TK2_ENST00000563369.2_Missense_Mutation_p.S127R|TK2_ENST00000525974.1_Missense_Mutation_p.S127R|TK2_ENST00000545043.2_Missense_Mutation_p.S199R|TK2_ENST00000564917.1_Missense_Mutation_p.S241R			O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial	224					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|DNA replication (GO:0006260)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|thymidine kinase activity (GO:0004797)			large_intestine(1)|lung(2)|urinary_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		TGGGGAAAAGGCTGCCTTTGA	0.537																																						dbGAP											0													82.0	68.0	73.0					16																	66547661		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS10805.1, CCDS10805.2, CCDS54016.1, CCDS54017.1, CCDS54018.1, CCDS61955.1	16q22-q23.1	2012-10-02			ENSG00000166548	ENSG00000166548	2.7.1.21		11831	protein-coding gene	gene with protein product		188250					Standard	NM_004614		Approved		uc002eos.3	O00142	OTTHUMG00000137499	ENST00000451102.2:c.672C>A	16.37:g.66547661G>T	ENSP00000414334:p.Ser224Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGJ7|B4DZK7|B7ZAB1|E9PH08|O15238	Missense_Mutation	SNP	pfam_Deoxynucleoside_kinase	p.S266R	ENST00000451102.2	37	c.798	CCDS10805.2	16	.	.	.	.	.	.	.	.	.	.	G	9.056	0.993395	0.19043	.	.	ENSG00000166548	ENST00000299697;ENST00000417693;ENST00000545043;ENST00000451102;ENST00000527800;ENST00000527284;ENST00000544898;ENST00000525974	D;D;D;D;D;D;D;D	0.97976	-4.64;-4.64;-4.64;-4.64;-4.64;-4.64;-4.64;-4.64	4.89	0.69	0.18039	.	0.801083	0.11827	N	0.525583	D	0.94112	0.8112	L	0.34521	1.04	0.09310	N	1	P;B;B;P;B	0.37141	0.584;0.43;0.006;0.584;0.005	B;B;B;B;B	0.40782	0.34;0.259;0.009;0.34;0.026	D	0.88572	0.3130	10	0.34782	T	0.22	-0.7096	4.6285	0.12489	0.3553:0.1541:0.4906:0.0	.	266;224;175;266;193	Q8IZR3;O00142;F5GYK4;E5KNQ5;O00142-2	.;KITM_HUMAN;.;.;.	R	266;206;199;224;127;193;175;127	ENSP00000299697:S266R;ENSP00000407469:S206R;ENSP00000438143:S199R;ENSP00000414334:S224R;ENSP00000433770:S127R;ENSP00000435312:S193R;ENSP00000440898:S175R;ENSP00000434594:S127R	ENSP00000299697:S266R	S	-	3	2	TK2	65105162	0.042000	0.20092	0.090000	0.20809	0.838000	0.47535	1.071000	0.30666	0.278000	0.22164	0.650000	0.86243	AGC	TK2	-	pfam_Deoxynucleoside_kinase	ENSG00000166548		0.537	TK2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TK2	HGNC	protein_coding	OTTHUMT00000268806.4	41	0.00	0	G			66547661	66547661	-1	no_errors	ENST00000299697	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.002	T
TMEM169	92691	genome.wustl.edu	37	2	216965075	216965075	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr2:216965075C>T	ENST00000295658.4	+	3	911	c.704C>T	c.(703-705)tCg>tTg	p.S235L	TMEM169_ENST00000406027.2_Missense_Mutation_p.S235L|TMEM169_ENST00000437356.2_Missense_Mutation_p.S235L|TMEM169_ENST00000454545.1_Missense_Mutation_p.S235L	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	235						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCCAGCTCTCGTGGTCCTGG	0.582																																						dbGAP											0													200.0	162.0	175.0					2																	216965075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.704C>T	2.37:g.216965075C>T	ENSP00000295658:p.Ser235Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8W6	Missense_Mutation	SNP	NULL	p.S235L	ENST00000295658.4	37	c.704	CCDS2401.1	2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.021482	0.75275	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	L	0.47716	1.5	0.80722	D	1	D	0.65815	0.995	P	0.47626	0.552	T	0.57980	-0.7717	8	.	.	.	-5.2046	17.308	0.87200	0.0:1.0:0.0:0.0	.	235	Q96HH4	TM169_HUMAN	L	235	.	.	S	+	2	0	TMEM169	216673320	1.000000	0.71417	0.952000	0.39060	0.988000	0.76386	5.914000	0.69964	2.550000	0.86006	0.655000	0.94253	TCG	TMEM169	-	NULL	ENSG00000163449		0.582	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM169	HGNC	protein_coding	OTTHUMT00000256666.2	64	0.00	0	C	NM_138390		216965075	216965075	+1	no_errors	ENST00000295658	ensembl	human	known	69_37n	missense	51	19.05	12	SNP	1.000	T
TNXB	7148	genome.wustl.edu	37	6	32052279	32052279	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr6:32052279G>A	ENST00000375244.3	-	8	3557	c.3356C>T	c.(3355-3357)tCc>tTc	p.S1119F	TNXB_ENST00000375247.2_Missense_Mutation_p.S1119F			P22105	TENX_HUMAN	tenascin XB	1206	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGGATCCAGGGAGGTGATGAC	0.587																																						dbGAP											0													55.0	61.0	59.0					6																	32052279		1317	2568	3885	-	-	-	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3356C>T	6.37:g.32052279G>A	ENSP00000364393:p.Ser1119Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.S1119F	ENST00000375244.3	37	c.3356		6	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519299	0.44866	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.55234	0.53;0.53	4.23	0.147	0.14838	.	0.702571	0.12329	N	0.478560	T	0.37571	0.1008	L	0.43152	1.355	0.09310	N	1	D	0.62365	0.991	P	0.61592	0.891	T	0.16394	-1.0404	10	0.87932	D	0	.	2.5456	0.04736	0.0913:0.232:0.2375:0.4391	.	1119	P22105-3	.	F	1119	ENSP00000364393:S1119F;ENSP00000364396:S1119F	ENSP00000364393:S1119F	S	-	2	0	TNXB	32160257	0.414000	0.25408	0.069000	0.20011	0.727000	0.41649	0.547000	0.23299	-0.192000	0.10432	0.655000	0.94253	TCC	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.587	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	66	0.00	0	G	NM_019105		32052279	32052279	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	0.044	A
TPST1	8460	genome.wustl.edu	37	7	65705583	65705583	+	Silent	SNP	C	C	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr7:65705583C>A	ENST00000304842.5	+	2	596	c.171C>A	c.(169-171)ctC>ctA	p.L57L	TPST1_ENST00000480281.1_Intron	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	57					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GCCTGGACCTCAAAGCCAACA	0.512																																						dbGAP											0													107.0	87.0	94.0					7																	65705583		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.171C>A	7.37:g.65705583C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2M0|Q6FGM7	Silent	SNP	pfam_Sulfotransferase_dom	p.L57	ENST00000304842.5	37	c.171	CCDS5533.1	7																																																																																			TPST1	-	NULL	ENSG00000169902		0.512	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPST1	HGNC	protein_coding	OTTHUMT00000251705.2	67	0.00	0	C	NM_003596		65705583	65705583	+1	no_errors	ENST00000304842	ensembl	human	known	69_37n	silent	29	39.58	19	SNP	0.128	A
UCK2	7371	genome.wustl.edu	37	1	165875181	165875181	+	Silent	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr1:165875181C>T	ENST00000367879.4	+	6	924	c.621C>T	c.(619-621)atC>atT	p.I207I	UCK2_ENST00000462329.1_3'UTR|UCK2_ENST00000469256.2_Silent_p.I57I|UCK2_ENST00000470820.1_Silent_p.I57I|UCK2_ENST00000372212.4_3'UTR	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	207					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					CTGATGTGATCATCCCTAGAG	0.458																																						dbGAP											0													161.0	138.0	146.0					1																	165875181		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.621C>T	1.37:g.165875181C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Silent	SNP	pfam_PRK/URK,pfam_Depp_CoAkinase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.I207	ENST00000367879.4	37	c.621	CCDS1252.1	1																																																																																			UCK2	-	pfam_PRK/URK,prints_Uridine_kinase,tigrfam_Uridine_kinase	ENSG00000143179		0.458	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK2	HGNC	protein_coding	OTTHUMT00000096753.1	125	0.00	0	C	NM_012474		165875181	165875181	+1	no_errors	ENST00000367879	ensembl	human	known	69_37n	silent	109	25.34	37	SNP	0.958	T
ZNF16	7564	genome.wustl.edu	37	8	146157647	146157647	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr8:146157647T>C	ENST00000276816.4	-	4	712	c.526A>G	c.(526-528)Aca>Gca	p.T176A	ZNF16_ENST00000394909.2_Missense_Mutation_p.T176A	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	176	Necessary for transcription activation.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		CTCTCTTCTGTAGGGATTTCC	0.527																																						dbGAP											0													152.0	146.0	148.0					8																	146157647		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.526A>G	8.37:g.146157647T>C	ENSP00000276816:p.Thr176Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T176A	ENST00000276816.4	37	c.526	CCDS6437.1	8	.	.	.	.	.	.	.	.	.	.	T	10.61	1.398312	0.25205	.	.	ENSG00000170631	ENST00000276816;ENST00000394909;ENST00000532351	T;T;T	0.33438	1.41;1.41;2.19	4.21	-8.41	0.00961	.	.	.	.	.	T	0.27731	0.0682	M	0.83118	2.625	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45056	-0.9287	9	0.72032	D	0.01	.	2.7636	0.05314	0.2132:0.4181:0.1086:0.2601	.	176	P17020	ZNF16_HUMAN	A	176	ENSP00000276816:T176A;ENSP00000378369:T176A;ENSP00000434321:T176A	ENSP00000276816:T176A	T	-	1	0	ZNF16	146128451	0.000000	0.05858	0.000000	0.03702	0.079000	0.17450	-1.396000	0.02513	-1.757000	0.01316	0.460000	0.39030	ACA	ZNF16	-	NULL	ENSG00000170631		0.527	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF16	HGNC	protein_coding	OTTHUMT00000382978.1	53	0.00	0	T	NM_006958		146157647	146157647	-1	no_errors	ENST00000276816	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	0.000	C
ZNF202	7753	genome.wustl.edu	37	11	123597676	123597676	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr11:123597676C>T	ENST00000529691.1	-	7	1195	c.976G>A	c.(976-978)Gag>Aag	p.E326K	ZNF202_ENST00000530393.1_Missense_Mutation_p.E326K|ZNF202_ENST00000336139.4_Missense_Mutation_p.E326K			O95125	ZN202_HUMAN	zinc finger protein 202	326					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TCCAGACACTCTTCCTCATCT	0.453																																						dbGAP											0													122.0	146.0	138.0					11																	123597676		2168	4176	6344	-	-	-	SO:0001583	missense	0			AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.976G>A	11.37:g.123597676C>T	ENSP00000433881:p.Glu326Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E326K	ENST00000529691.1	37	c.976	CCDS8443.1	11	.	.	.	.	.	.	.	.	.	.	C	7.504	0.653320	0.14580	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.06218	3.33;3.33;3.33	3.93	2.98	0.34508	.	0.366514	0.19863	N	0.104388	T	0.04815	0.0130	N	0.22421	0.69	0.20074	N	0.999936	B	0.10296	0.003	B	0.06405	0.002	T	0.39187	-0.9626	10	0.24483	T	0.36	-6.474	11.2942	0.49269	0.0:0.8134:0.1866:0.0	.	326	O95125	ZN202_HUMAN	K	326	ENSP00000337724:E326K;ENSP00000432504:E326K;ENSP00000433881:E326K	ENSP00000337724:E326K	E	-	1	0	ZNF202	123102886	0.000000	0.05858	0.099000	0.21106	0.041000	0.13682	0.837000	0.27558	0.965000	0.38133	0.655000	0.94253	GAG	ZNF202	-	NULL	ENSG00000166261		0.453	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF202	HGNC	protein_coding	OTTHUMT00000387419.1	37	0.00	0	C	NM_003455		123597676	123597676	-1	no_errors	ENST00000336139	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.295	T
ZNF544	27300	genome.wustl.edu	37	19	58772398	58772398	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:58772398C>G	ENST00000596652.1	+	6	660	c.426C>G	c.(424-426)ttC>ttG	p.F142L	ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000600044.1_Missense_Mutation_p.F114L|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000599953.1_5'UTR|ZNF544_ENST00000415203.2_Missense_Mutation_p.F114L|ZNF544_ENST00000600220.1_Missense_Mutation_p.F114L|CTD-3138B18.4_ENST00000600029.1_Intron|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000269829.4_Missense_Mutation_p.F142L			Q6NX49	ZN544_HUMAN	zinc finger protein 544	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		CCTTGAGGTTCATGGTACTCA	0.473																																						dbGAP											0													100.0	91.0	94.0					19																	58772398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.426C>G	19.37:g.58772398C>G	ENSP00000469635:p.Phe142Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J1|Q9UEX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F142L	ENST00000596652.1	37	c.426	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	C	1.073	-0.669174	0.03403	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.06449	3.38;3.3	2.45	-1.47	0.08772	.	.	.	.	.	T	0.02533	0.0077	N	0.08118	0	0.09310	N	1	B;B;B	0.26975	0.0;0.165;0.138	B;B;B	0.22601	0.0;0.015;0.04	T	0.45963	-0.9225	9	0.24483	T	0.36	.	3.1969	0.06636	0.3479:0.2597:0.3924:0.0	.	114;114;142	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	L	142;114	ENSP00000269829:F142L;ENSP00000394341:F114L	ENSP00000269829:F142L	F	+	3	2	ZNF544	63464210	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-0.489000	0.06716	-0.147000	0.13772	TTC	ZNF544	-	NULL	ENSG00000198131		0.473	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	65	0.00	0	C	NM_014480		58772398	58772398	+1	no_errors	ENST00000269829	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	0.001	G
ZNF544	27300	genome.wustl.edu	37	19	58772895	58772895	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:58772895C>A	ENST00000596652.1	+	6	1157	c.923C>A	c.(922-924)tCt>tAt	p.S308Y	ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000600044.1_Missense_Mutation_p.S280Y|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000599953.1_Missense_Mutation_p.S166Y|ZNF544_ENST00000415203.2_Missense_Mutation_p.S280Y|ZNF544_ENST00000600220.1_Missense_Mutation_p.S280Y|CTD-3138B18.4_ENST00000600029.1_Intron|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000269829.4_Missense_Mutation_p.S308Y			Q6NX49	ZN544_HUMAN	zinc finger protein 544	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		GAAACCTGTTCTGAGAGTCTG	0.488																																						dbGAP											0													65.0	61.0	63.0					19																	58772895		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.923C>A	19.37:g.58772895C>A	ENSP00000469635:p.Ser308Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J1|Q9UEX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S308Y	ENST00000596652.1	37	c.923	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850894	0.32699	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.08193	3.18;3.12	2.5	1.43	0.22495	.	.	.	.	.	T	0.19406	0.0466	M	0.66506	2.035	0.09310	N	0.999999	D;D;P	0.69078	0.989;0.997;0.761	P;D;B	0.68039	0.648;0.955;0.144	T	0.14587	-1.0467	9	0.21540	T	0.41	.	7.3471	0.26670	0.0:0.8547:0.0:0.1453	.	280;280;308	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	Y	308;280	ENSP00000269829:S308Y;ENSP00000394341:S280Y	ENSP00000269829:S308Y	S	+	2	0	ZNF544	63464707	0.003000	0.15002	0.047000	0.18901	0.130000	0.20726	0.878000	0.28126	0.366000	0.24427	-0.194000	0.12790	TCT	ZNF544	-	NULL	ENSG00000198131		0.488	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	44	0.00	0	C	NM_014480		58772895	58772895	+1	no_errors	ENST00000269829	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.001	A
ZNF544	27300	genome.wustl.edu	37	19	58773563	58773563	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr19:58773563C>T	ENST00000596652.1	+	6	1825	c.1591C>T	c.(1591-1593)Cag>Tag	p.Q531*	ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000600044.1_Nonsense_Mutation_p.Q503*|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000599953.1_Nonsense_Mutation_p.Q389*|ZNF544_ENST00000415203.2_Nonsense_Mutation_p.Q503*|ZNF544_ENST00000600220.1_Nonsense_Mutation_p.Q503*|CTD-3138B18.4_ENST00000600029.1_Intron|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000269829.4_Nonsense_Mutation_p.Q531*			Q6NX49	ZN544_HUMAN	zinc finger protein 544	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		ATCCTTCTCCCAGAGTTCCAA	0.448																																						dbGAP											0													84.0	87.0	86.0					19																	58773563		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.1591C>T	19.37:g.58773563C>T	ENSP00000469635:p.Gln531*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J1|Q9UEX4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q531*	ENST00000596652.1	37	c.1591	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.001620	0.97189	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	.	.	.	2.8	-2.43	0.06522	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	0.782	0.01042	0.1635:0.3433:0.161:0.3322	.	.	.	.	X	531;503	.	ENSP00000269829:Q531X	Q	+	1	0	ZNF544	63465375	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.693000	0.00197	-0.594000	0.05836	-0.351000	0.07748	CAG	ZNF544	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198131		0.448	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	32	0.00	0	C	NM_014480		58773563	58773563	+1	no_errors	ENST00000269829	ensembl	human	known	69_37n	nonsense	26	25.71	9	SNP	0.000	T
ZNF770	54989	genome.wustl.edu	37	15	35273613	35273613	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3W7-01A-11D-A228-09	TCGA-AC-A3W7-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1d98bbae-0506-4428-99b1-c17109be2443	cfa4574d-c002-40e3-a7b5-f57a056ca98b	g.chr15:35273613G>A	ENST00000356321.4	-	3	2367	c.2023C>T	c.(2023-2025)Cac>Tac	p.H675Y		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	675					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TCTTTAAAGTGAGTAAGCTGA	0.413																																						dbGAP											0													62.0	56.0	58.0					15																	35273613		2201	4298	6499	-	-	-	SO:0001583	missense	0			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.2023C>T	15.37:g.35273613G>A	ENSP00000348673:p.His675Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H675Y	ENST00000356321.4	37	c.2023	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	g	18.90	3.720704	0.68959	.	.	ENSG00000198146	ENST00000356321	D	0.88896	-2.44	5.03	5.03	0.67393	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	D	0.94584	0.8255	M	0.80508	2.5	0.43994	D	0.99669	D	0.89917	1.0	D	0.85130	0.997	D	0.94990	0.8133	10	0.72032	D	0.01	-5.6573	17.5234	0.87793	0.0:0.0:1.0:0.0	.	675	Q6IQ21	ZN770_HUMAN	Y	675	ENSP00000348673:H675Y	ENSP00000348673:H675Y	H	-	1	0	ZNF770	33060905	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.017000	0.93651	2.634000	0.89283	0.563000	0.77884	CAC	ZNF770	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198146		0.413	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	101	0.00	0	G	NM_014106		35273613	35273613	-1	no_errors	ENST00000356321	ensembl	human	known	69_37n	missense	53	26.39	19	SNP	1.000	A
