#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AFF1	4299	genome.wustl.edu	37	4	88029432	88029432	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr4:88029432G>A	ENST00000307808.6	+	10	1897	c.1477G>A	c.(1477-1479)Gaa>Aaa	p.E493K	AFF1_ENST00000395146.4_Missense_Mutation_p.E500K|AFF1_ENST00000544085.1_Missense_Mutation_p.E131K	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	493					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AAGTGACAGCGAAGAAAATGA	0.532																																						dbGAP											0													94.0	90.0	91.0					4																	88029432		2203	4300	6503	-	-	-	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1477G>A	4.37:g.88029432G>A	ENSP00000305689:p.Glu493Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E500K	ENST00000307808.6	37	c.1498	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.153595	0.94645	.	.	ENSG00000172493	ENST00000395146;ENST00000541943;ENST00000307808;ENST00000511722;ENST00000544085;ENST00000514970	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	5.7	5.7	0.88788	.	0.136846	0.49916	D	0.000130	D	0.88738	0.6518	M	0.84948	2.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.67103	0.949;0.949;0.949	D	0.86078	0.1542	10	0.24483	T	0.36	-15.6693	19.8411	0.96685	0.0:0.0:1.0:0.0	.	500;493;493	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	K	500;152;493;131;131;184	ENSP00000378578:E500K;ENSP00000305689:E493K;ENSP00000424766:E131K;ENSP00000440843:E131K;ENSP00000424881:E184K	ENSP00000305689:E493K	E	+	1	0	AFF1	88248456	1.000000	0.71417	0.958000	0.39756	0.983000	0.72400	8.657000	0.91106	2.683000	0.91414	0.655000	0.94253	GAA	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.532	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	23	0.00	0	G	NM_005935		88029432	88029432	+1	no_errors	ENST00000395146	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	A
AGAP4	119016	genome.wustl.edu	37	10	46342649	46342649	+	Silent	SNP	T	T	C	rs202147206	byFrequency	TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr10:46342649T>C	ENST00000448048.2	-	1	272	c.147A>G	c.(145-147)gtA>gtG	p.V49V	AGAP4_ENST00000430779.2_5'UTR	NM_133446.2	NP_597703.2	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 4	49					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			central_nervous_system(1)|lung(1)|ovary(1)	3						CAGCAGGCTGTACAGCAGCAG	0.582																																						dbGAP											0													1.0	1.0	1.0					10																	46342649		14	59	73	-	-	-	SO:0001819	synonymous_variant	0			AF411132	CCDS7215.1	10q11.21	2014-06-19	2008-09-22	2008-09-22	ENSG00000188234	ENSG00000188234		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23459	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 1"", ""ArfGAP with GTPase domain, ankyrin repeat and PH domain 8"", ""centaurin, gamma-like family, member 5"""	CTGLF1, AGAP8, CTGLF5		12477932	Standard	XM_005271797		Approved	Em:AC012044.1, MRIP2	uc001jcx.4	Q96P64	OTTHUMG00000018088	ENST00000448048.2:c.147A>G	10.37:g.46342649T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.V49	ENST00000448048.2	37	c.147	CCDS7215.1	10																																																																																			AGAP4	-	NULL	ENSG00000188234		0.582	AGAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP4	HGNC	protein_coding	OTTHUMT00000047799.1	12	0.00	0	T	NM_133446		46342649	46342649	-1	no_errors	ENST00000448048	ensembl	human	known	69_37n	silent	10	47.37	9	SNP	0.177	C
C1QTNF5	114902	genome.wustl.edu	37	11	119210295	119210295	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr11:119210295A>G	ENST00000528368.1	-	3	709	c.478T>C	c.(478-480)Tac>Cac	p.Y160H	C1QTNF5_ENST00000525657.1_5'UTR|C1QTNF5_ENST00000445041.2_Missense_Mutation_p.Y160H|RP11-334E6.10_ENST00000501918.2_RNA|MFRP_ENST00000530681.1_3'UTR|MFRP_ENST00000555262.1_3'UTR	NM_001278431.1	NP_001265360.1	Q9BXJ0	C1QT5_HUMAN	C1q and tumor necrosis factor related protein 5	160	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(2)	3		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CTGGCCCGGTAGACGGTGGCA	0.612																																						dbGAP											0													58.0	51.0	54.0					11																	119210295		2199	4294	6493	-	-	-	SO:0001583	missense	0			AF329841	CCDS8420.1	11q23.3	2013-05-10				ENSG00000223953			14344	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 5"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 3"""	608752				12944416	Standard	NM_015645		Approved	CTRP5, DKFZp586B0621, LORD		Q9BXJ0	OTTHUMG00000166198	ENST00000528368.1:c.478T>C	11.37:g.119210295A>G	ENSP00000431140:p.Tyr160His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDD3|B0YJ35|Q335M2|Q8N6P2|Q9UFX4	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,prints_C1q,pfscan_C1q	p.Y160H	ENST00000528368.1	37	c.478	CCDS8420.1	11	.	.	.	.	.	.	.	.	.	.	A	17.56	3.420843	0.62622	.	.	ENSG00000223953	ENST00000528368;ENST00000445041	T;T	0.74632	-0.86;-0.86	4.24	4.24	0.50183	.	0.079544	0.52532	U	0.000064	T	0.77558	0.4148	L	0.51853	1.615	0.80722	D	1	.	.	.	.	.	.	T	0.78775	-0.2072	8	0.51188	T	0.08	.	13.5216	0.61572	1.0:0.0:0.0:0.0	.	.	.	.	H	160	ENSP00000431140:Y160H;ENSP00000402389:Y160H	ENSP00000402389:Y160H	Y	-	1	0	C1QTNF5	118715505	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	5.818000	0.69236	1.773000	0.52216	0.533000	0.62120	TAC	C1QTNF5	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,prints_C1q,pfscan_C1q	ENSG00000223953		0.612	C1QTNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF5	HGNC	protein_coding	OTTHUMT00000388354.1	114	0.00	0	A	NM_015645		119210295	119210295	-1	no_errors	ENST00000445041	ensembl	human	known	69_37n	missense	111	16.54	22	SNP	1.000	G
CDH1	999	genome.wustl.edu	37	16	68862200	68862201	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr16:68862200_68862201insG	ENST00000261769.5	+	14	2479_2480	c.2288_2289insG	c.(2287-2292)gaggacfs	p.D764fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.D703fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	764	Required for binding CTNND1 and PSEN1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GGCGGAGAAGAGGACCAGGTGG	0.475			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2290dupG	16.37:g.68862202_68862202dupG	ENSP00000261769:p.Asp764fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D764fs	ENST00000261769.5	37	c.2288_2289	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000039068		0.475	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	76	0.00	0	-	NM_004360		68862200	68862201	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	88	13.73	14	INS	1.000:0.883	G
EP400	57634	genome.wustl.edu	37	12	132547141	132547141	+	Silent	SNP	G	G	A			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr12:132547141G>A	ENST00000333577.4	+	48	8446	c.8337G>A	c.(8335-8337)caG>caA	p.Q2779Q	EP400_ENST00000389562.2_Silent_p.Q2742Q|EP400_ENST00000389561.2_Silent_p.Q2743Q|EP400_ENST00000332482.4_Silent_p.Q2706Q|EP400_ENST00000330386.6_Silent_p.Q2662Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2779	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2742Q(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacagcagcagcagc	0.597																																						dbGAP											2	Substitution - coding silent(2)	kidney(2)											52.0	42.0	46.0					12																	132547141		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8337G>A	12.37:g.132547141G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2779	ENST00000333577.4	37	c.8337		12																																																																																			EP400	-	NULL	ENSG00000183495		0.597	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		42	0.00	0	G	NM_015409		132547141	132547141	+1	no_errors	ENST00000333577	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	0.737	A
EVPLL	645027	genome.wustl.edu	37	17	18292454	18292454	+	3'UTR	SNP	C	C	G	rs199697056		TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr17:18292454C>G	ENST00000399134.4	+	0	1588				RP1-37N7.1_ENST00000579352.1_RNA|EVPLL_ENST00000583003.1_3'UTR	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like											NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GCAGCTCCCACGCTGCCCCTA	0.587																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.*324C>G	17.37:g.18292454C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPD4	RNA	SNP	-	NULL	ENST00000399134.4	37	NULL	CCDS45626.1	17																																																																																			EVPLL	-	-	ENSG00000214860		0.587	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EVPLL	HGNC	protein_coding	OTTHUMT00000130836.2	9	0.00	0	C	NM_001145127		18292454	18292454	+1	no_errors	ENST00000583003	ensembl	human	putative	69_37n	rna	6	40.00	4	SNP	0.006	G
ERBB2	2064	genome.wustl.edu	37	17	37880220	37880220	+	Missense_Mutation	SNP	T	T	C	rs121913470|rs121913469		TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr17:37880220T>C	ENST00000269571.5	+	19	2423	c.2264T>C	c.(2263-2265)tTg>tCg	p.L755S	MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000540147.1_Missense_Mutation_p.L725S|ERBB2_ENST00000445658.2_Missense_Mutation_p.L479S|ERBB2_ENST00000584601.1_Missense_Mutation_p.L725S|ERBB2_ENST00000406381.2_Missense_Mutation_p.L725S|ERBB2_ENST00000584450.1_Missense_Mutation_p.L755S|ERBB2_ENST00000541774.1_Missense_Mutation_p.L740S			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	755	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in a lung adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:15457249}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L755S(10)|p.L755P(2)|p.L755_S760>A(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	ATCAAAGTGTTGAGGGAAAAC	0.532	L755S(LN229_CENTRAL_NERVOUS_SYSTEM)	1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	13	Substitution - Missense(12)|Complex - insertion inframe(1)	breast(7)|lung(3)|stomach(2)|large_intestine(1)											112.0	97.0	102.0					17																	37880220		2203	4300	6503	-	-	-	SO:0001583	missense	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2264T>C	17.37:g.37880220T>C	ENSP00000269571:p.Leu755Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L755S	ENST00000269571.5	37	c.2264	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	T	32	5.190536	0.94923	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.18	5.18	0.71444	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.83644	0.5299	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86913	0.2062	9	0.87932	D	0	.	14.7238	0.69329	0.0:0.0:0.0:1.0	.	479;740;755	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	S	725;740;479;755;725	ENSP00000385185:L725S;ENSP00000446466:L740S;ENSP00000404047:L479S;ENSP00000269571:L755S;ENSP00000443562:L725S	ENSP00000269571:L755S	L	+	2	0	ERBB2	35133746	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	1.955000	0.56771	0.379000	0.24179	TTG	ERBB2	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000141736		0.532	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	26	0.00	0	T			37880220	37880220	+1	no_errors	ENST00000269571	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	C
EXOC4	60412	genome.wustl.edu	37	7	132937919	132937919	+	Missense_Mutation	SNP	C	C	T	rs183280115		TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr7:132937919C>T	ENST00000253861.4	+	1	91	c.62C>T	c.(61-63)tCg>tTg	p.S21L	EXOC4_ENST00000393161.2_Missense_Mutation_p.S21L|EXOC4_ENST00000539845.1_5'Flank	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	21					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				AAAGACCCCTCGGGGCTGCTC	0.617													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13313	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													74.0	77.0	76.0					7																	132937919		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.62C>T	7.37:g.132937919C>T	ENSP00000253861:p.Ser21Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	pfam_Sec8_exocyst	p.S21L	ENST00000253861.4	37	c.62	CCDS5829.1	7	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	21.7	4.185798	0.78789	.	.	ENSG00000131558	ENST00000253861;ENST00000393161	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.60766	0.2294	M	0.72894	2.215	0.80722	D	1	D;D	0.57899	0.98;0.981	B;P	0.46685	0.444;0.524	T	0.58014	-0.7711	9	0.10902	T	0.67	.	17.3791	0.87400	0.0:1.0:0.0:0.0	.	21;21	Q96A65;Q8TAR2	EXOC4_HUMAN;.	L	21	.	ENSP00000253861:S21L	S	+	2	0	EXOC4	132588459	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.571000	0.60879	2.861000	0.98227	0.650000	0.86243	TCG	EXOC4	-	NULL	ENSG00000131558		0.617	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC4	HGNC	protein_coding	OTTHUMT00000339182.1	24	0.00	0	C	NM_021807		132937919	132937919	+1	no_errors	ENST00000253861	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	T
IL32	9235	genome.wustl.edu	37	16	3131810	3131810	+	lincRNA	SNP	T	T	C	rs148052546	byFrequency	TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr16:3131810T>C	ENST00000571404.1	-	0	210																		p.V172V(1)									GGCACGGGGTTCTGGCCTGGG	0.592													T|||	2501	0.499401	0.2564	0.5058	5008	,	,		14657	0.5417		0.6183	False		,,,				2504	0.6575					dbGAP											1	Substitution - coding silent(1)	central_nervous_system(1)																																								-	-	-			0																															16.37:g.3131810T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.V172	ENST00000571404.1	37	c.516		16																																																																																			IL32	-	NULL	ENSG00000008517		0.592	RP11-473M20.9-002	KNOWN	basic	lincRNA	IL32	HGNC	lincRNA	OTTHUMT00000437122.1	25	0.00	0	T			3131810	3131810	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000525377	ensembl	human	putative	69_37n	silent	22	24.14	7	SNP	0.000	C
LARP1B	55132	genome.wustl.edu	37	4	129143606	129143606	+	3'UTR	SNP	C	C	T			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr4:129143606C>T	ENST00000506199.1	+	0	932							Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						AGTGACACTCCAGTCGCCGCC	0.448																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000506199.1:c.*929C>T	4.37:g.129143606C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	RNA	SNP	-	NULL	ENST00000506199.1	37	NULL		4																																																																																			LARP1B	-	-	ENSG00000138709		0.448	LARP1B-010	KNOWN	basic	processed_transcript	LARP1B	HGNC	protein_coding	OTTHUMT00000364016.1	50	0.00	0	C	NM_018078		129143606	129143606	+1	no_errors	ENST00000503725	ensembl	human	known	69_37n	rna	70	12.50	10	SNP	0.003	T
MUC16	94025	genome.wustl.edu	37	19	9058918	9058918	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr19:9058918C>T	ENST00000397910.4	-	3	28731	c.28528G>A	c.(28528-28530)Gag>Aag	p.E9510K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9512	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAATTGCCTCTGTCTCCGTG	0.493																																						dbGAP											0													156.0	152.0	154.0					19																	9058918		1990	4166	6156	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28528G>A	19.37:g.9058918C>T	ENSP00000381008:p.Glu9510Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.E9510K	ENST00000397910.4	37	c.28528	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	7.864	0.726771	0.15439	.	.	ENSG00000181143	ENST00000397910	T	0.34072	1.38	2.22	1.14	0.20703	.	.	.	.	.	T	0.21801	0.0525	N	0.08118	0	.	.	.	P	0.34977	0.478	B	0.41236	0.351	T	0.30416	-0.9979	8	0.87932	D	0	.	6.6339	0.22872	0.0:0.5072:0.4928:0.0	.	9510	B5ME49	.	K	9510	ENSP00000381008:E9510K	ENSP00000381008:E9510K	E	-	1	0	MUC16	8919918	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.014000	0.03641	0.482000	0.27582	0.197000	0.17608	GAG	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	25	0.00	0	C	NM_024690		9058918	9058918	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	0.000	T
LILRB5	10990	genome.wustl.edu	37	19	54759985	54759985	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr19:54759985C>A	ENST00000316219.5	-	4	683	c.576G>T	c.(574-576)agG>agT	p.R192S	LILRB5_ENST00000449561.2_Missense_Mutation_p.R192S|LILRB5_ENST00000450632.1_Missense_Mutation_p.R183S|LILRB5_ENST00000345866.6_Intron	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	192	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGCATCTGAACCTCCACCTGC	0.567																																						dbGAP											0													55.0	64.0	61.0					19																	54759985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.576G>T	19.37:g.54759985C>A	ENSP00000320390:p.Arg192Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N760	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R183S	ENST00000316219.5	37	c.549	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	C	6.896	0.534793	0.13188	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561	T;T;T	0.12672	2.66;2.66;2.66	3.11	-3.32	0.04973	Immunoglobulin-like fold (1);	0.997041	0.08124	N	0.994295	T	0.05777	0.0151	N	0.12422	0.21	0.09310	N	1	B;B;P	0.37466	0.345;0.235;0.596	B;B;B	0.38683	0.279;0.079;0.217	T	0.28427	-1.0044	10	0.28530	T	0.3	.	0.4361	0.00479	0.1768:0.2466:0.2143:0.3623	.	183;192;192	C9JMK7;O75023-3;O75023	.;.;LIRB5_HUMAN	S	192;183;192	ENSP00000320390:R192S;ENSP00000414225:R183S;ENSP00000406478:R192S	ENSP00000320390:R192S	R	-	3	2	LILRB5	59451797	0.000000	0.05858	0.003000	0.11579	0.123000	0.20343	-2.710000	0.00818	-0.325000	0.08577	0.446000	0.29264	AGG	LILRB5	-	smart_Ig_sub	ENSG00000105609		0.567	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	58	0.00	0	C			54759985	54759985	-1	no_errors	ENST00000450632	ensembl	human	known	69_37n	missense	63	10.00	7	SNP	0.001	A
NAP1L4	4676	genome.wustl.edu	37	11	2970465	2970465	+	3'UTR	SNP	G	G	T			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr11:2970465G>T	ENST00000380542.4	-	0	1292				NAP1L4_ENST00000469089.1_5'UTR|NAP1L4_ENST00000526115.1_Intron	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4						nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		ACCTAGAAACGTATGAATGAT	0.323																																						dbGAP											0													74.0	67.0	69.0					11																	2970465		1848	4085	5933	-	-	-	SO:0001624	3_prime_UTR_variant	0			AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.*24C>A	11.37:g.2970465G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6J4|F5HFY4	RNA	SNP	-	NULL	ENST00000380542.4	37	NULL	CCDS41599.1	11																																																																																			NAP1L4	-	-	ENSG00000205531		0.323	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L4	HGNC	protein_coding	OTTHUMT00000030273.3	35	0.00	0	G	NM_005969		2970465	2970465	-1	no_errors	ENST00000469089	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	1.000	T
OGFR	11054	genome.wustl.edu	37	20	61444600	61444600	+	Missense_Mutation	SNP	C	C	A	rs6122313	byFrequency	TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr20:61444600C>A	ENST00000290291.6	+	7	1658	c.1633C>A	c.(1633-1635)Cgc>Agc	p.R545S	OGFR_ENST00000370461.1_Missense_Mutation_p.R493S	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	545	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].		R -> S (in dbSNP:rs6122313).		opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.R545S(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCCAGGCCCCCGCCCAGCAGG	0.741																																						dbGAP											1	Substitution - Missense(1)	skin(1)											12.0	18.0	16.0					20																	61444600		2126	4164	6290	-	-	-	SO:0001583	missense	0			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1633C>A	20.37:g.61444600C>A	ENSP00000290291:p.Arg545Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.R545S	ENST00000290291.6	37	c.1633	CCDS13504.1	20	177	0.08104395604395605	9	0.018292682926829267	28	0.07734806629834254	113	0.19755244755244755	27	0.03562005277044855	A	0.017	-1.504049	0.00992	.	.	ENSG00000060491	ENST00000290291;ENST00000370461	T;T	0.54866	0.55;0.55	1.4	-0.396	0.12427	.	.	.	.	.	T	0.00039	0.0001	N	0.12182	0.205	0.80722	P	0.0	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.19289	-1.0310	8	0.20046	T	0.44	.	3.5878	0.07977	0.2924:0.5063:0.2013:0.0	rs6122313	528;545	Q05BV5;Q9NZT2	.;OGFR_HUMAN	S	545;493	ENSP00000290291:R545S;ENSP00000359491:R493S	ENSP00000290291:R545S	R	+	1	0	OGFR	60915045	0.000000	0.05858	0.001000	0.08648	0.049000	0.14656	-0.544000	0.06077	-0.264000	0.09365	-1.293000	0.01348	CGC	OGFR	-	pfam_OGF_rcpt_rpt	ENSG00000060491		0.741	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1	28	0.00	0	C			61444600	61444600	+1	no_errors	ENST00000290291	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.000	A
PLEKHH2	130271	genome.wustl.edu	37	2	43927380	43927380	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr2:43927380C>A	ENST00000282406.4	+	8	1393	c.1283C>A	c.(1282-1284)aCa>aAa	p.T428K		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	428					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GGAAAAGGAACACAATTAGTG	0.448																																						dbGAP											0													121.0	113.0	115.0					2																	43927380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.1283C>A	2.37:g.43927380C>A	ENSP00000282406:p.Thr428Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.T428K	ENST00000282406.4	37	c.1283	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	C	9.140	1.013597	0.19277	.	.	ENSG00000152527	ENST00000282406	T	0.72282	-0.64	5.81	3.91	0.45181	.	0.943050	0.08933	N	0.872683	T	0.54351	0.1853	L	0.29908	0.895	0.09310	N	1	B;B	0.30439	0.029;0.279	B;B	0.25140	0.01;0.058	T	0.30851	-0.9964	10	0.05721	T	0.95	-2.383	11.4285	0.50025	0.1323:0.6125:0.2552:0.0	.	428;428	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	K	428	ENSP00000282406:T428K	ENSP00000282406:T428K	T	+	2	0	PLEKHH2	43780884	0.000000	0.05858	0.020000	0.16555	0.967000	0.64934	0.763000	0.26517	1.424000	0.47217	0.563000	0.77884	ACA	PLEKHH2	-	NULL	ENSG00000152527		0.448	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	44	0.00	0	C	NM_172069		43927380	43927380	+1	no_errors	ENST00000282406	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.003	A
RGS22	26166	genome.wustl.edu	37	8	101117734	101117734	+	Intron	SNP	A	A	G	rs1471293	byFrequency	TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr8:101117734A>G	ENST00000360863.6	-	2	220				RGS22_ENST00000523437.1_Intron|RGS22_ENST00000523287.1_5'UTR	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ACACAGGCAAACGTAGCACAT	0.418													g|||	3487	0.696286	0.8759	0.7262	5008	,	,		18718	0.7044		0.5606	False		,,,				2504	0.5634					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.26-104T>C	8.37:g.101117734A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	RNA	SNP	-	NULL	ENST00000360863.6	37	NULL	CCDS43758.1	8																																																																																			RGS22	-	-	ENSG00000132554		0.418	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	HGNC	protein_coding	OTTHUMT00000380365.1	28	0.00	0	A	NM_015668		101117734	101117734	-1	no_errors	ENST00000522064	ensembl	human	known	69_37n	rna	34	10.53	4	SNP	0.000	G
RPP30	10556	genome.wustl.edu	37	10	92655664	92655664	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr10:92655664G>T	ENST00000371703.3	+	9	878	c.607G>T	c.(607-609)Gtg>Ttg	p.V203L	RPP30_ENST00000489806.1_3'UTR|RPP30_ENST00000413330.1_Missense_Mutation_p.V203L	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	203					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						GCCATATGACGTGGCAAATCT	0.284																																						dbGAP											0													80.0	85.0	83.0					10																	92655664		2203	4295	6498	-	-	-	SO:0001583	missense	0			BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.607G>T	10.37:g.92655664G>T	ENSP00000360768:p.Val203Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R799|E9PB02	Missense_Mutation	SNP	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	p.V203L	ENST00000371703.3	37	c.607	CCDS7411.1	10	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465546	0.63513	.	.	ENSG00000148688	ENST00000371703;ENST00000413330;ENST00000371705;ENST00000277882;ENST00000414836	T;T;T	0.59083	0.31;0.3;0.29	5.79	3.92	0.45320	Polymerase/histidinol phosphatase-like (1);	0.210963	0.43416	D	0.000579	T	0.51449	0.1675	L	0.45698	1.435	0.45528	D	0.998488	P;P	0.45176	0.515;0.852	B;B	0.43838	0.394;0.433	T	0.54695	-0.8255	10	0.59425	D	0.04	-17.2499	9.3038	0.37863	0.2272:0.0:0.7728:0.0	.	203;203	P78346;E9PB02	RPP30_HUMAN;.	L	203;203;193;225;147	ENSP00000360768:V203L;ENSP00000389182:V203L;ENSP00000277882:V225L	ENSP00000277882:V225L	V	+	1	0	RPP30	92645644	0.998000	0.40836	0.986000	0.45419	0.832000	0.47134	2.418000	0.44662	1.441000	0.47550	0.557000	0.71058	GTG	RPP30	-	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	ENSG00000148688		0.284	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPP30	HGNC	protein_coding	OTTHUMT00000049347.1	45	0.00	0	G	NM_006413		92655664	92655664	+1	no_errors	ENST00000413330	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	0.959	T
UBA6	55236	genome.wustl.edu	37	4	68500227	68500227	+	Missense_Mutation	SNP	G	G	T	rs375592057		TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr4:68500227G>T	ENST00000322244.5	-	21	1911	c.1852C>A	c.(1852-1854)Cca>Aca	p.P618T		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	618					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TCCTCTTCTGGGGGATCCCGC	0.338																																						dbGAP											0													50.0	57.0	54.0					4																	68500227		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1852C>A	4.37:g.68500227G>T	ENSP00000313454:p.Pro618Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.P618T	ENST00000322244.5	37	c.1852	CCDS3516.1	4	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294976	0.60086	.	.	ENSG00000033178	ENST00000322244	T	0.51071	0.72	5.79	4.95	0.65309	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-activating enzyme (1);	0.052688	0.85682	D	0.000000	T	0.44286	0.1286	L	0.42686	1.345	0.80722	D	1	B	0.20780	0.048	B	0.26094	0.066	T	0.38286	-0.9668	10	0.59425	D	0.04	-31.786	14.9056	0.70715	0.0688:0.0:0.9312:0.0	.	618	A0AVT1	UBA6_HUMAN	T	618	ENSP00000313454:P618T	ENSP00000313454:P618T	P	-	1	0	UBA6	68182822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.658000	0.83755	1.464000	0.47987	0.591000	0.81541	CCA	UBA6	-	pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000033178		0.338	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6	HGNC	protein_coding	OTTHUMT00000251429.2	41	0.00	0	G	NM_018227		68500227	68500227	-1	no_errors	ENST00000322244	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
XKR5	389610	genome.wustl.edu	37	8	6686791	6686791	+	RNA	SNP	C	C	T	rs2741087	byFrequency	TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr8:6686791C>T	ENST00000518724.1	-	0	393							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		AGGCCTTCTTCTGTCATCTCA	0.343													C|||	1052	0.210064	0.1573	0.1657	5008	,	,		18762	0.2302		0.2316	False		,,,				2504	0.2699					dbGAP											0																																										-	-	-			0			AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6686791C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5GH74	RNA	SNP	-	NULL	ENST00000518724.1	37	NULL		8																																																																																			XKR5	-	-	ENSG00000186530		0.343	XKR5-001	KNOWN	basic	processed_transcript	XKR5	HGNC	processed_transcript	OTTHUMT00000331969.2	38	0.00	0	C	NM_207411		6686791	6686791	-1	no_errors	ENST00000405979	ensembl	human	known	69_37n	rna	33	10.81	4	SNP	0.000	T
ZNF652	22834	genome.wustl.edu	37	17	47375975	47375975	+	Missense_Mutation	SNP	G	G	A	rs537777094		TCGA-AC-A3YI-01A-21D-A23C-09	TCGA-AC-A3YI-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	52e2b434-5394-4a59-a62f-0e6de07c0539	dd822976-3f35-4194-8c2a-ddaf2408f4a3	g.chr17:47375975G>A	ENST00000362063.2	-	6	1939	c.1621C>T	c.(1621-1623)Cgg>Tgg	p.R541W	ZNF652_ENST00000430262.2_Missense_Mutation_p.R541W	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	541	Mediates interaction with CBFA2T3.|Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			gggatgggccgagggGGAAGA	0.597																																						dbGAP											0													58.0	63.0	61.0					17																	47375975		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.1621C>T	17.37:g.47375975G>A	ENSP00000354686:p.Arg541Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPD9|Q5H9Q0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R541W	ENST00000362063.2	37	c.1621	CCDS32677.1	17	.	.	.	.	.	.	.	.	.	.	G	21.1	4.092163	0.76756	.	.	ENSG00000198740	ENST00000362063;ENST00000430262	D;D	0.83250	-1.7;-1.7	4.51	3.51	0.40186	.	0.198447	0.43579	D	0.000542	T	0.78735	0.4330	L	0.44542	1.39	0.46654	D	0.99914	D	0.71674	0.998	B	0.44315	0.446	T	0.81084	-0.1093	10	0.72032	D	0.01	-3.2722	13.4009	0.60883	0.0:0.0:0.8361:0.1639	.	541	Q9Y2D9	ZN652_HUMAN	W	541	ENSP00000354686:R541W;ENSP00000416305:R541W	ENSP00000354686:R541W	R	-	1	2	ZNF652	44730974	0.561000	0.26578	0.844000	0.33320	0.995000	0.86356	1.800000	0.38833	1.190000	0.43042	0.591000	0.81541	CGG	ZNF652	-	NULL	ENSG00000198740		0.597	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF652	HGNC	protein_coding	OTTHUMT00000364524.1	22	0.00	0	G	NM_014897		47375975	47375975	-1	no_errors	ENST00000362063	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.915	A
