#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC1	4363	genome.wustl.edu	37	16	16150133	16150133	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:16150133G>A	ENST00000399410.3	+	12	1833	c.1658G>A	c.(1657-1659)tGg>tAg	p.W553*	ABCC1_ENST00000345148.5_Nonsense_Mutation_p.W553*|ABCC1_ENST00000351154.5_Nonsense_Mutation_p.W553*|ABCC1_ENST00000349029.5_Nonsense_Mutation_p.W553*|ABCC1_ENST00000346370.5_Nonsense_Mutation_p.W553*|ABCC1_ENST00000399408.2_Nonsense_Mutation_p.W553*	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	553	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	ACCTTCACCTGGGTCTGCACG	0.507																																						dbGAP											0													55.0	57.0	56.0					16																	16150133		2045	4205	6250	-	-	-	SO:0001587	stop_gained	0			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1658G>A	16.37:g.16150133G>A	ENSP00000382342:p.Trp553*	Somatic		WXS	Illumina GAIIx	Phase_IV	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.W553*	ENST00000399410.3	37	c.1658	CCDS42122.1	16	.	.	.	.	.	.	.	.	.	.	G	39	7.318618	0.98207	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	.	.	.	5.29	4.33	0.51752	.	0.110853	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.4768	14.4611	0.67450	0.0:0.0:0.852:0.148	.	.	.	.	X	553;553;553;553;553;553;227	.	ENSP00000263014:W553X	W	+	2	0	ABCC1	16057634	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.225000	0.65294	1.204000	0.43247	0.462000	0.41574	TGG	ABCC1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000103222		0.507	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	HGNC	protein_coding	OTTHUMT00000109701.1	18	0.00	0	G	NM_004996		16150133	16150133	+1	no_errors	ENST00000399408	ensembl	human	known	69_37n	nonsense	19	29.63	8	SNP	1.000	A
ABCC9	10060	genome.wustl.edu	37	12	22001151	22001151	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:22001151C>G	ENST00000261201.4	-	23	2798	c.2799G>C	c.(2797-2799)gaG>gaC	p.E933D	ABCC9_ENST00000261200.4_Missense_Mutation_p.E933D|RP11-729I10.2_ENST00000539874.1_RNA|ABCC9_ENST00000345162.2_Missense_Mutation_p.E897D	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	933					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	GAGTTTTCCTCTCTAAAGTAG	0.413																																						dbGAP											0													129.0	117.0	121.0					12																	22001151		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2799G>C	12.37:g.22001151C>G	ENSP00000261201:p.Glu933Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.E933D	ENST00000261201.4	37	c.2799	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914252	0.52546	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.92858	-3.11;-2.96;-3.12;-3.11	5.39	3.18	0.36537	ABC transporter, transmembrane domain, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.90174	0.6929	L	0.46157	1.445	0.49582	D	0.999803	B;D	0.52996	0.096;0.957	B;P	0.51833	0.077;0.681	D	0.87691	0.2554	10	0.38643	T	0.18	-16.3712	7.4596	0.27287	0.0:0.6572:0.0:0.3428	.	933;933	O60706;O60706-2	ABCC9_HUMAN;.	D	933;560;933;897	ENSP00000261200:E933D;ENSP00000440521:E560D;ENSP00000261201:E933D;ENSP00000261202:E897D	ENSP00000261200:E933D	E	-	3	2	ABCC9	21892418	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.916000	0.48813	1.405000	0.46838	0.650000	0.86243	GAG	ABCC9	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000069431		0.413	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	41	0.00	0	C	NM_005691		22001151	22001151	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	1.000	G
ADCY2	108	genome.wustl.edu	37	5	7707849	7707849	+	Silent	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:7707849G>A	ENST00000338316.4	+	9	1388	c.1299G>A	c.(1297-1299)gaG>gaA	p.E433E	ADCY2_ENST00000537121.1_Silent_p.E253E|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	433					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TCACCCTGGAGCACTTGAATG	0.408																																						dbGAP											0													124.0	123.0	123.0					5																	7707849		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1299G>A	5.37:g.7707849G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E433	ENST00000338316.4	37	c.1299	CCDS3872.2	5																																																																																			ADCY2	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase	ENSG00000078295		0.408	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	49	0.00	0	G	NM_020546		7707849	7707849	+1	no_errors	ENST00000338316	ensembl	human	known	69_37n	silent	46	11.54	6	SNP	0.980	A
ADORA2A	135	genome.wustl.edu	37	22	24829415	24829415	+	Missense_Mutation	SNP	G	G	T	rs200557920	byFrequency	TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr22:24829415G>T	ENST00000337539.7	+	2	502	c.43G>T	c.(43-45)Gcc>Tcc	p.A15S	SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A-AS1_ENST00000543438.1_RNA|ADORA2A_ENST00000496497.1_Intron	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	15					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	GGTGGAGCTGGCCATTGCTGT	0.617																																						dbGAP											0													93.0	57.0	69.0					22																	24829415		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.43G>T	22.37:g.24829415G>T	ENSP00000336630:p.Ala15Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7E0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adeno_A2A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.A15S	ENST00000337539.7	37	c.43	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218767	0.58560	.	.	ENSG00000128271	ENST00000424232;ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596;ENST00000436735;ENST00000439591	T;T;T;T;T	0.37411	1.2;2.12;2.12;1.2;1.2	4.53	4.53	0.55603	.	0.296724	0.35067	N	0.003462	T	0.28566	0.0707	L	0.28649	0.875	0.41345	D	0.987322	B	0.13145	0.007	B	0.29077	0.098	T	0.10941	-1.0608	10	0.48119	T	0.1	-17.4199	9.8643	0.41134	0.1044:0.0:0.8956:0.0	.	15	P29274	AA2AR_HUMAN	S	15	ENSP00000404497:A15S;ENSP00000414802:A15S;ENSP00000336630:A15S;ENSP00000397071:A15S;ENSP00000400190:A15S	ENSP00000336630:A15S	A	+	1	0	ADORA2A	23159415	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.783000	0.55409	2.350000	0.79820	0.561000	0.74099	GCC	ADORA2A	-	prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	ENSG00000128271		0.617	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A	HGNC	protein_coding	OTTHUMT00000319971.2	22	0.00	0	G	NM_000675		24829415	24829415	+1	no_errors	ENST00000337539	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	1.000	T
ALDH1L1	10840	genome.wustl.edu	37	3	125828949	125828949	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:125828949C>T	ENST00000393434.2	-	20	2534	c.2185G>A	c.(2185-2187)Gaa>Aaa	p.E729K	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.E729K|ALDH1L1-AS1_ENST00000512384.1_RNA|ALDH1L1_ENST00000393431.2_3'UTR|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.E628K|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.E739K	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	729	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CGCACCTCTTCTACCTGCAGA	0.572																																						dbGAP											0													118.0	108.0	112.0					3																	125828949		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.2185G>A	3.37:g.125828949C>T	ENSP00000377083:p.Glu729Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.E729K	ENST00000393434.2	37	c.2185	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	C	4.026	0.002383	0.07819	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.08807	3.05;3.05;3.05;3.05	3.91	3.03	0.35002	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.190057	0.44688	D	0.000422	T	0.07052	0.0179	L	0.31664	0.95	0.25426	N	0.988227	B;B;B	0.28801	0.223;0.118;0.006	B;B;B	0.24269	0.052;0.044;0.008	T	0.21827	-1.0234	10	0.33940	T	0.23	.	13.9802	0.64299	0.0:0.8433:0.1567:0.0	.	628;264;729	E9PBX3;Q6ZV71;O75891	.;.;AL1L1_HUMAN	K	739;729;628;729	ENSP00000273450:E739K;ENSP00000420293:E729K;ENSP00000395881:E628K;ENSP00000377083:E729K	ENSP00000273450:E739K	E	-	1	0	ALDH1L1	127311639	0.800000	0.28916	0.773000	0.31616	0.006000	0.05464	3.321000	0.51999	0.340000	0.23745	-1.961000	0.00478	GAA	ALDH1L1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH	ENSG00000144908		0.572	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	39	0.00	0	C	NM_012190		125828949	125828949	-1	no_errors	ENST00000393434	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	0.201	T
AMZ1	155185	genome.wustl.edu	37	7	2740234	2740234	+	Missense_Mutation	SNP	C	C	T	rs200667897		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:2740234C>T	ENST00000312371.4	+	2	517	c.149C>T	c.(148-150)cCg>cTg	p.P50L	AMZ1_ENST00000407112.1_Missense_Mutation_p.P50L	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	50							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		GCCTACAACCCGCAGAGGACG	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16683	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													112.0	120.0	117.0					7																	2740234		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.149C>T	7.37:g.2740234C>T	ENSP00000308149:p.Pro50Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRS0|Q8TF51	Missense_Mutation	SNP	pfam_Pept_M54_archaemetzincn	p.P50L	ENST00000312371.4	37	c.149	CCDS34589.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	23.4	4.412402	0.83340	.	.	ENSG00000174945	ENST00000312371;ENST00000407112	T;T	0.26223	1.75;2.21	4.34	4.34	0.51931	.	0.000000	0.64402	D	0.000007	T	0.52158	0.1717	M	0.77103	2.36	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.59674	-0.7410	10	0.87932	D	0	-33.9851	15.04	0.71781	0.0:1.0:0.0:0.0	.	50;50	B3KRS0;Q400G9	.;AMZ1_HUMAN	L	50	ENSP00000308149:P50L;ENSP00000386020:P50L	ENSP00000308149:P50L	P	+	2	0	AMZ1	2706760	0.995000	0.38212	0.884000	0.34674	0.912000	0.54170	3.608000	0.54109	1.969000	0.57287	0.561000	0.74099	CCG	AMZ1	-	NULL	ENSG00000174945		0.657	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	HGNC	protein_coding	OTTHUMT00000325244.1	52	0.00	0	C	NM_133463		2740234	2740234	+1	no_errors	ENST00000312371	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	0.983	T
ANGPT4	51378	genome.wustl.edu	37	20	896547	896547	+	Splice_Site	SNP	A	A	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr20:896547A>G	ENST00000381922.3	-	1	412		c.e1+1		ANGPT4_ENST00000546022.1_Splice_Site	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						CATGCCCCGTACCTTCTTCAG	0.602																																					Pancreas(181;481 2077 3259 31286 49856)	dbGAP											0													113.0	90.0	98.0					20																	896547		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.309+1T>C	20.37:g.896547A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3J9|Q5TFF4|Q9H4Z4	Splice_Site	SNP	-	e1+2	ENST00000381922.3	37	c.309+2	CCDS13009.1	20	.	.	.	.	.	.	.	.	.	.	A	9.104	1.004936	0.19199	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1652	0.42875	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANGPT4	844547	1.000000	0.71417	0.988000	0.46212	0.039000	0.13416	5.348000	0.66004	1.905000	0.55150	0.397000	0.26171	.	ANGPT4	-	-	ENSG00000101280		0.602	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	HGNC	protein_coding	OTTHUMT00000077493.1	56	0	0	A	NM_015985	Intron	896547	896547	-1	no_errors	ENST00000381922	ensembl	human	known	69_37n	splice_site	59	26.25	21	SNP	0.998	G
ARHGAP30	257106	genome.wustl.edu	37	1	161026308	161026308	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:161026308G>A	ENST00000368013.3	-	3	535	c.215C>T	c.(214-216)tCa>tTa	p.S72L	ARHGAP30_ENST00000368015.1_Intron|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.S72L	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	72	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CTTCCGCTCTGACTCAAATTC	0.597																																						dbGAP											0													63.0	56.0	58.0					1																	161026308		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.215C>T	1.37:g.161026308G>A	ENSP00000356992:p.Ser72Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S72L	ENST00000368013.3	37	c.215	CCDS30918.1	1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628616	0.46944	.	.	ENSG00000186517	ENST00000368016;ENST00000368013	T;T	0.20332	2.08;2.08	5.34	4.43	0.53597	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.495253	0.22236	N	0.062756	T	0.10035	0.0246	M	0.66297	2.02	0.26364	N	0.977001	B;B	0.16802	0.004;0.019	B;B	0.15870	0.009;0.014	T	0.16630	-1.0396	10	0.56958	D	0.05	.	8.2671	0.31821	0.1785:0.0:0.8215:0.0	.	72;72	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	L	72	ENSP00000356995:S72L;ENSP00000356992:S72L	ENSP00000356992:S72L	S	-	2	0	ARHGAP30	159292932	0.000000	0.05858	0.965000	0.40720	0.992000	0.81027	1.010000	0.29898	1.252000	0.44001	0.650000	0.86243	TCA	ARHGAP30	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000186517		0.597	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	HGNC	protein_coding	OTTHUMT00000077090.2	48	0.00	0	G	NM_181720		161026308	161026308	-1	no_errors	ENST00000368013	ensembl	human	known	69_37n	missense	71	11.25	9	SNP	0.437	A
ATG7	10533	genome.wustl.edu	37	3	11518615	11518615	+	Intron	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:11518615G>C	ENST00000354449.3	+	18	2104				ATG7_ENST00000354956.5_Intron|ATG7_ENST00000446450.2_Intron	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CAGCATCTTTGAGATCTTCGG	0.413																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.2079+50215G>C	3.37:g.11518615G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Silent	SNP	NULL	p.97	ENST00000354449.3	37	c.289	CCDS2605.1	3																																																																																			ATG7	-	NULL	ENSG00000197548		0.413	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	40	0.00	0	G	NM_006395		11518615	11518615	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427759	ensembl	human	putative	69_37n	silent	45	21.05	12	SNP	0.900	C
ATP6V0B	533	genome.wustl.edu	37	1	44441519	44441519	+	Splice_Site	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:44441519T>C	ENST00000472174.2	+	2	508	c.115T>C	c.(115-117)Tgg>Cgg	p.W39R	ATP6V0B_ENST00000532642.1_Splice_Site_p.W39R|ATP6V0B_ENST00000236067.4_Intron|ATP6V0B_ENST00000472277.1_Intron|ATP6V0B_ENST00000498664.1_5'Flank|ATP6V0B_ENST00000471859.2_Intron	NM_004047.3	NP_004038.1	Q99437	VATO_HUMAN	ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b	39					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuole (GO:0005773)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(2)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				TGATGTGGCATGGTAAGGGAG	0.557																																						dbGAP											0													138.0	137.0	137.0					1																	44441519		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC000423	CCDS505.1, CCDS41315.1, CCDS72772.1	1p32.3	2010-04-21	2006-01-20	2002-05-10	ENSG00000117410	ENSG00000117410		"""ATPases / V-type"""	861	protein-coding gene	gene with protein product		603717	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD"", ""ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c''"""	ATP6F		9653649	Standard	XM_005270944		Approved	VMA16, HATPL	uc001cld.3	Q99437	OTTHUMG00000008298	ENST00000472174.2:c.116+1T>C	1.37:g.44441519T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPY5|Q6IB32	Missense_Mutation	SNP	pfam_ATPase_F0/V0-cplx_csu,superfamily_ATPase_F0/V0-cplx_csu,prints_ATPase_V0-cplx_csu	p.W39R	ENST00000472174.2	37	c.115	CCDS505.1	1	.	.	.	.	.	.	.	.	.	.	T	16.13	3.035925	0.54896	.	.	ENSG00000117410	ENST00000472174;ENST00000532642	.	.	.	4.89	3.7	0.42460	.	0.255981	0.42548	D	0.000697	T	0.52948	0.1766	L	0.52759	1.655	0.80722	D	1	B;B	0.15719	0.0;0.014	B;B	0.14023	0.002;0.01	T	0.50591	-0.8810	9	0.28530	T	0.3	-4.1084	10.9054	0.47078	0.1403:0.0:0.0:0.8597	.	39;39	Q99437;E9PNL3	VATO_HUMAN;.	R	39	.	ENSP00000431605:W39R	W	+	1	0	ATP6V0B	44214106	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	5.596000	0.67570	1.837000	0.53436	0.392000	0.25879	TGG	ATP6V0B	-	NULL	ENSG00000117410		0.557	ATP6V0B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0B	HGNC	protein_coding	OTTHUMT00000022854.2	104	0.00	0	T	NM_004047	Missense_Mutation	44441519	44441519	+1	no_errors	ENST00000472174	ensembl	human	known	69_37n	missense	79	12.22	11	SNP	1.000	C
BBOX1	8424	genome.wustl.edu	37	11	27077057	27077057	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:27077057C>A	ENST00000529202.1	+	2	419	c.80C>A	c.(79-81)tCt>tAt	p.S27Y	BBOX1_ENST00000525090.1_Missense_Mutation_p.S27Y|BBOX1_ENST00000263182.3_Missense_Mutation_p.S27Y|BBOX1_ENST00000528583.1_Missense_Mutation_p.S27Y|BBOX1_ENST00000527505.1_3'UTR|RP11-1L12.3_ENST00000526061.1_RNA			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	27					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	GAGGAAGAGTCTCTCTACCCA	0.493																																						dbGAP											0													106.0	97.0	100.0					11																	27077057		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.80C>A	11.37:g.27077057C>A	ENSP00000435781:p.Ser27Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.S27Y	ENST00000529202.1	37	c.80	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688418	0.68271	.	.	ENSG00000129151	ENST00000529202;ENST00000533566;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	5.94	5.94	0.96194	Domain of unknown function, DUF971 (1);	0.086452	0.85682	D	0.000000	D	0.90504	0.7025	M	0.71920	2.185	0.49915	D	0.999832	D	0.89917	1.0	D	0.78314	0.991	D	0.87488	0.2425	10	0.22109	T	0.4	.	13.4406	0.61109	0.0:0.8429:0.1571:0.0	.	27	O75936	BODG_HUMAN	Y	27	ENSP00000435781:S27Y;ENSP00000263182:S27Y;ENSP00000434918:S27Y;ENSP00000433772:S27Y	ENSP00000263182:S27Y	S	+	2	0	BBOX1	27033633	1.000000	0.71417	0.997000	0.53966	0.740000	0.42216	4.486000	0.60286	2.807000	0.96579	0.591000	0.81541	TCT	BBOX1	-	pfam_DUF971,tigrfam_2-oxoglut_dOase	ENSG00000129151		0.493	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	34	0.00	0	C	NM_003986		27077057	27077057	+1	no_errors	ENST00000263182	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.999	A
BMPR2	659	genome.wustl.edu	37	2	203421091	203421091	+	Silent	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr2:203421091T>C	ENST00000374580.4	+	12	3242	c.2703T>C	c.(2701-2703)aaT>aaC	p.N901N	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	901	Poly-Asn.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GCCGAACTAATTCCAATAACA	0.502																																						dbGAP											0													115.0	117.0	116.0					2																	203421091		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.2703T>C	2.37:g.203421091T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.N901	ENST00000374580.4	37	c.2703	CCDS33361.1	2																																																																																			BMPR2	-	NULL	ENSG00000204217		0.502	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1	25	0.00	0	T	NM_001204		203421091	203421091	+1	no_errors	ENST00000374580	ensembl	human	known	69_37n	silent	46	17.86	10	SNP	1.000	C
BOC	91653	genome.wustl.edu	37	3	113003409	113003409	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:113003409C>T	ENST00000495514.1	+	17	3585	c.2881C>T	c.(2881-2883)Cag>Tag	p.Q961*	BOC_ENST00000273395.4_Nonsense_Mutation_p.Q962*|BOC_ENST00000355385.3_Nonsense_Mutation_p.Q961*			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	961					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			AGGCGAGCTTCAGCAGGTAGC	0.662																																						dbGAP											0													16.0	16.0	16.0					3																	113003409		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2881C>T	3.37:g.113003409C>T	ENSP00000418663:p.Gln961*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Q962*	ENST00000495514.1	37	c.2884	CCDS2971.1	3	.	.	.	.	.	.	.	.	.	.	C	43	9.906295	0.99293	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	.	.	.	4.99	4.1	0.47936	.	0.638176	0.15028	N	0.284634	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	13.4938	0.61411	0.0:0.8373:0.1627:0.0	.	.	.	.	X	961;962;961	.	ENSP00000273395:Q962X	Q	+	1	0	BOC	114486099	0.827000	0.29292	0.973000	0.42090	0.300000	0.27592	3.460000	0.53028	1.280000	0.44463	0.655000	0.94253	CAG	BOC	-	NULL	ENSG00000144857		0.662	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3	64	0.00	0	C	NM_033254		113003409	113003409	+1	no_errors	ENST00000273395	ensembl	human	known	69_37n	nonsense	69	16.87	14	SNP	0.996	T
BRCA1	672	genome.wustl.edu	37	17	41228540	41228540	+	Silent	SNP	A	A	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:41228540A>G	ENST00000357654.3	-	13	4567	c.4449T>C	c.(4447-4449)agT>agC	p.S1483S	BRCA1_ENST00000471181.2_Silent_p.S1504S|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Silent_p.S1436S|BRCA1_ENST00000491747.2_Silent_p.S379S|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000351666.3_Silent_p.S300S|BRCA1_ENST00000468300.1_Silent_p.S379S|BRCA1_ENST00000352993.3_Silent_p.S341S|BRCA1_ENST00000309486.4_Silent_p.S1187S	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1483					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TACTGGTAGAACTATCTGCAG	0.363			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													129.0	122.0	124.0					17																	41228540		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4449T>C	17.37:g.41228540A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.S1504	ENST00000357654.3	37	c.4512	CCDS11453.1	17																																																																																			BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.363	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	49	0.00	0	A	NM_007294		41228540	41228540	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	silent	19	48.65	18	SNP	0.002	G
BSN	8927	genome.wustl.edu	37	3	49680077	49680077	+	Missense_Mutation	SNP	G	G	C	rs112246114		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:49680077G>C	ENST00000296452.4	+	3	1124	c.1010G>C	c.(1009-1011)gGt>gCt	p.G337A	BSN-AS1_ENST00000442384.1_RNA	NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	337					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCTGGGCTTGGTGCCACTGAG	0.667																																						dbGAP											0													22.0	23.0	22.0					3																	49680077		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.1010G>C	3.37:g.49680077G>C	ENSP00000296452:p.Gly337Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O43161|Q7LGH3	Missense_Mutation	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.G337A	ENST00000296452.4	37	c.1010	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	G	10.20	1.283900	0.23392	.	.	ENSG00000164061	ENST00000296452	T	0.18174	2.23	4.35	4.35	0.52113	.	0.000000	0.64402	D	0.000006	T	0.18467	0.0443	L	0.50333	1.59	0.44547	D	0.997507	P	0.43094	0.799	B	0.37731	0.257	T	0.04825	-1.0924	10	0.39692	T	0.17	.	17.7676	0.88483	0.0:0.0:1.0:0.0	.	337	Q9UPA5	BSN_HUMAN	A	337	ENSP00000296452:G337A	ENSP00000296452:G337A	G	+	2	0	BSN	49655081	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	2.684000	0.46951	2.347000	0.79759	0.455000	0.32223	GGT	BSN	-	NULL	ENSG00000164061		0.667	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	23	0.00	0	G	NM_003458		49680077	49680077	+1	no_errors	ENST00000296452	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	1.000	C
C12orf45	121053	genome.wustl.edu	37	12	105381963	105381965	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	TCA	TCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:105381963_105381965delTCA	ENST00000552951.1	+	2	177_179	c.134_136delTCA	c.(133-138)ctcatc>ctc	p.I46del	C12orf45_ENST00000280749.5_In_Frame_Del_p.I46del	NM_152318.2	NP_689531.2	Q8N5I9	CL045_HUMAN	chromosome 12 open reading frame 45	46										large_intestine(1)|lung(2)	3						GACAGGTTGCTCATCAACTCCCA	0.448																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC032326	CCDS41825.1	12q23.3	2012-05-30			ENSG00000151131	ENSG00000151131			28628	protein-coding gene	gene with protein product						12477932	Standard	NM_152318		Approved	MGC40397	uc001tlb.3	Q8N5I9	OTTHUMG00000169822	ENST00000552951.1:c.134_136delTCA	12.37:g.105381966_105381968delTCA	ENSP00000447057:p.Ile46del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	NULL	p.I46in_frame_del	ENST00000552951.1	37	c.134_136	CCDS41825.1	12																																																																																			C12orf45	-	NULL	ENSG00000151131		0.448	C12orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf45	HGNC	protein_coding	OTTHUMT00000406076.1	59	0.00	0	TCA	NM_152318		105381963	105381965	+1	no_errors	ENST00000552951	ensembl	human	known	69_37n	in_frame_del	54	23.94	17	DEL	0.987:0.990:0.995	-
CACTIN	58509	genome.wustl.edu	37	19	3620798	3620798	+	Silent	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:3620798G>T	ENST00000429344.2	-	3	697	c.645C>A	c.(643-645)gcC>gcA	p.A215A	CACTIN_ENST00000248420.5_Silent_p.A215A|CACTIN_ENST00000221899.3_Silent_p.A147A	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	215					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										TCTTCTCCAGGGCCTGGAAGC	0.622																																						dbGAP											0													74.0	81.0	79.0					19																	3620798		2067	4181	6248	-	-	-	SO:0001819	synonymous_variant	0			BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.645C>A	19.37:g.3620798G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Silent	SNP	pfam_Cactin_dom,pfam_Cactin_C	p.A147	ENST00000429344.2	37	c.441	CCDS45920.1	19																																																																																			CACTIN	-	NULL	ENSG00000105298		0.622	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACTIN	HGNC	protein_coding	OTTHUMT00000457370.2	22	0.00	0	G			3620798	3620798	-1	no_errors	ENST00000221899	ensembl	human	known	69_37n	silent	24	22.58	7	SNP	1.000	T
CCDC146	57639	genome.wustl.edu	37	7	76797009	76797009	+	Silent	SNP	A	A	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:76797009A>G	ENST00000285871.4	+	2	151	c.24A>G	c.(22-24)acA>acG	p.T8T	RP11-467H10.2_ENST00000459742.1_RNA|CCDC146_ENST00000431197.1_5'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	8										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GCACAGACACAGAAAAAGAAG	0.338																																						dbGAP											0													37.0	39.0	39.0					7																	76797009		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.24A>G	7.37:g.76797009A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8X6|Q9P223	Silent	SNP	NULL	p.T8	ENST00000285871.4	37	c.24	CCDS34671.1	7																																																																																			CCDC146	-	NULL	ENSG00000135205		0.338	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	91	0.00	0	A	NM_020879		76797009	76797009	+1	no_errors	ENST00000285871	ensembl	human	known	69_37n	silent	83	17.82	18	SNP	0.975	G
CCIN	881	genome.wustl.edu	37	9	36170435	36170435	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr9:36170435C>A	ENST00000335119.2	+	1	1047	c.936C>A	c.(934-936)gaC>gaA	p.D312E		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	312					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			AGCTCTCAGACATGCCCTATC	0.542																																						dbGAP											0													77.0	74.0	75.0					9																	36170435		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.936C>A	9.37:g.36170435C>A	ENSP00000334996:p.Asp312Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXG7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.D312E	ENST00000335119.2	37	c.936	CCDS6599.1	9	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.414939	0.01145	.	.	ENSG00000185972	ENST00000335119	T	0.66995	-0.24	5.97	2.11	0.27256	Kelch-type beta propeller (1);	0.102269	0.42821	N	0.000643	T	0.27524	0.0676	N	0.01352	-0.895	0.24024	N	0.996131	B	0.02656	0.0	B	0.01281	0.0	T	0.34675	-0.9819	10	0.02654	T	1	.	6.0693	0.19881	0.1622:0.3108:0.527:0.0	.	312	Q13939	CALI_HUMAN	E	312	ENSP00000334996:D312E	ENSP00000334996:D312E	D	+	3	2	CCIN	36160435	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.194000	0.32174	0.427000	0.26145	-0.165000	0.13383	GAC	CCIN	-	smart_Kelch_1	ENSG00000185972		0.542	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCIN	HGNC	protein_coding	OTTHUMT00000052418.1	37	0.00	0	C	NM_005893		36170435	36170435	+1	no_errors	ENST00000335119	ensembl	human	known	69_37n	missense	23	54.90	28	SNP	1.000	A
CD244	51744	genome.wustl.edu	37	1	160832438	160832438	+	Silent	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:160832438G>T	ENST00000368033.3	-	1	112	c.30C>A	c.(28-30)ctC>ctA	p.L10L	CD244_ENST00000368032.2_Silent_p.L10L|CD244_ENST00000368034.4_Silent_p.L10L|CD244_ENST00000322302.7_Silent_p.L10L			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	10					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GGAGCAGGAGGAGTATGAGGG	0.637																																						dbGAP											0													103.0	70.0	81.0					1																	160832438		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.30C>A	1.37:g.160832438G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Silent	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like	p.L10	ENST00000368033.3	37	c.30	CCDS53399.1	1																																																																																			CD244	-	NULL	ENSG00000122223		0.637	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	44	0.00	0	G	NM_016382		160832438	160832438	-1	no_errors	ENST00000368033	ensembl	human	known	69_37n	silent	58	17.14	12	SNP	0.007	T
CECR2	27443	genome.wustl.edu	37	22	17976444	17976444	+	Silent	SNP	A	A	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr22:17976444A>G	ENST00000400573.5	+	3	172	c.165A>G	c.(163-165)acA>acG	p.T55T	CECR2_ENST00000342247.5_Silent_p.T35T|CECR2_ENST00000497534.1_3'UTR|CECR2_ENST00000262608.8_Silent_p.T36T|CECR2_ENST00000400585.2_5'UTR			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	77					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GGCCTCAGACATTCCACAGCT	0.493																																						dbGAP											0													43.0	42.0	42.0					22																	17976444		1913	4131	6044	-	-	-	SO:0001819	synonymous_variant	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400573.5:c.165A>G	22.37:g.17976444A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.T55	ENST00000400573.5	37	c.165		22																																																																																			CECR2	-	NULL	ENSG00000099954		0.493	CECR2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316104.5	316	0.00	0	A	NM_031413		17976444	17976444	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	silent	27	30.77	12	SNP	0.711	G
CHD5	26038	genome.wustl.edu	37	1	6166465	6166465	+	Silent	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:6166465G>C	ENST00000262450.3	-	40	5946	c.5847C>G	c.(5845-5847)ccC>ccG	p.P1949P	CHD5_ENST00000378021.1_Intron	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CGGTCACATAGGGCCCCAGGG	0.672																																						dbGAP											0													26.0	24.0	25.0					1																	6166465		2177	4267	6444	-	-	-	SO:0001819	synonymous_variant	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.5847C>G	1.37:g.6166465G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1949	ENST00000262450.3	37	c.5847	CCDS57.1	1																																																																																			CHD5	-	NULL	ENSG00000116254		0.672	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	26	0.00	0	G	NM_015557		6166465	6166465	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	silent	23	36.11	13	SNP	1.000	C
CHFR	55743	genome.wustl.edu	37	12	133438213	133438213	+	Silent	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:133438213C>G	ENST00000432561.2	-	7	700	c.627G>C	c.(625-627)ggG>ggC	p.G209G	CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000443047.2_Silent_p.G117G|CHFR_ENST00000450056.2_Silent_p.G197G|CHFR_ENST00000266880.7_Silent_p.G209G|CHFR_ENST00000315585.7_Silent_p.G168G			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	209					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TGCCACCACCCCCAGACCCTG	0.542																																						dbGAP											0													69.0	66.0	67.0					12																	133438213		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.627G>C	12.37:g.133438213C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Silent	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Znf_RING,pfscan_FHA_dom,pfscan_Znf_RING	p.G209	ENST00000432561.2	37	c.627	CCDS53849.1	12																																																																																			CHFR	-	NULL	ENSG00000072609		0.542	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CHFR	HGNC	protein_coding	OTTHUMT00000397130.2	47	0.00	0	C			133438213	133438213	-1	no_errors	ENST00000266880	ensembl	human	known	69_37n	silent	39	32.76	19	SNP	0.000	G
CISD3	284106	genome.wustl.edu	37	17	36887616	36887616	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:36887616T>C	ENST00000439660.2	+	3	252	c.128T>C	c.(127-129)cTg>cCg	p.L43P	RNA5SP440_ENST00000363245.1_RNA|CISD3_ENST00000578573.1_3'UTR	NM_001136498.1	NP_001129970.1	P0C7P0	CISD3_HUMAN	CDGSH iron sulfur domain 3	43						mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)			endometrium(2)	2						GTGGTGGCCCTGAAGACCCCC	0.622																																						dbGAP											0													79.0	88.0	85.0					17																	36887616		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097047	CCDS45662.1	17q12	2007-08-10				ENSG00000277972		"""CDGSH iron sulfur domain containing"""	27578	protein-coding gene	gene with protein product	"""mitoNEET related 2"""	611933				17376863, 17584744	Standard	NM_001136498		Approved	Miner2	uc010wds.1	P0C7P0		ENST00000439660.2:c.128T>C	17.37:g.36887616T>C	ENSP00000391402:p.Leu43Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FeS-contain_CDGSH-typ,smart_FeS-contain_CDGSH-typ_subfam	p.L43P	ENST00000439660.2	37	c.128	CCDS45662.1	17	.	.	.	.	.	.	.	.	.	.	T	12.67	2.006716	0.35415	.	.	ENSG00000230055	ENST00000439660	.	.	.	4.86	-2.64	0.06114	.	.	.	.	.	T	0.29588	0.0738	N	0.03608	-0.345	0.39229	D	0.963639	B	0.30889	0.299	B	0.39119	0.291	T	0.10753	-1.0616	8	0.32370	T	0.25	-1.4582	10.0657	0.42301	0.5967:0.0:0.0:0.4033	.	43	P0C7P0	CISD3_HUMAN	P	43	.	ENSP00000391402:L43P	L	+	2	0	CISD3	34141142	0.020000	0.18652	0.965000	0.40720	0.328000	0.28507	-0.171000	0.09883	-0.425000	0.07371	0.454000	0.30748	CTG	CISD3	-	NULL	ENSG00000230055		0.622	CISD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CISD3	HGNC	protein_coding	OTTHUMT00000441921.1	34	0.00	0	T			36887616	36887616	+1	no_errors	ENST00000439660	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.917	C
CKAP2	26586	genome.wustl.edu	37	13	53049032	53049032	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr13:53049032T>G	ENST00000378037.5	+	9	1898	c.1808T>G	c.(1807-1809)gTg>gGg	p.V603G	CKAP2_ENST00000258607.5_Missense_Mutation_p.V602G|CKAP2_ENST00000490903.1_Missense_Mutation_p.V554G	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		ATTTTCAGTGTGAAAAAAAAG	0.318																																						dbGAP											0													38.0	38.0	38.0					13																	53049032		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1808T>G	13.37:g.53049032T>G	ENSP00000367276:p.Val603Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V603G	ENST00000378037.5	37	c.1808	CCDS41893.1	13	.	.	.	.	.	.	.	.	.	.	.	11.41	1.630237	0.28978	.	.	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.26810	1.71;1.71;1.71	5.98	3.31	0.37934	.	0.620141	0.16332	N	0.219092	T	0.30479	0.0766	L	0.50333	1.59	0.51012	D	0.999906	P;P;P	0.45827	0.867;0.867;0.867	P;P;P	0.48030	0.564;0.564;0.564	T	0.02378	-1.1168	10	0.87932	D	0	-1.6945	9.3679	0.38237	0.0:0.1575:0.0:0.8425	.	554;603;602	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	G	602;603;554	ENSP00000258607:V602G;ENSP00000367276:V603G;ENSP00000417830:V554G	ENSP00000258607:V602G	V	+	2	0	CKAP2	51947033	0.938000	0.31826	0.826000	0.32828	0.295000	0.27426	1.385000	0.34408	0.420000	0.25954	0.528000	0.53228	GTG	CKAP2	-	NULL	ENSG00000136108		0.318	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CKAP2	HGNC	protein_coding	OTTHUMT00000355010.2	13	0.00	0	T			53049032	53049032	+1	no_errors	ENST00000378037	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.935	G
CLCN4	1183	genome.wustl.edu	37	X	10176285	10176285	+	Silent	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chrX:10176285C>G	ENST00000380833.4	+	9	1435	c.1044C>G	c.(1042-1044)ctC>ctG	p.L348L	CLCN4_ENST00000380829.1_Intron|CLCN4_ENST00000421085.2_Silent_p.L254L	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	348					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GGGGAACCCTCTTCATCCGCT	0.582																																					Melanoma(74;1050 1296 1576 30544 38374)	dbGAP											0													110.0	107.0	108.0					X																	10176285		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.1044C>G	X.37:g.10176285C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U1|B7Z5Z4|Q9UBU1	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-4	p.L348	ENST00000380833.4	37	c.1044	CCDS14137.1	X																																																																																			CLCN4	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000073464		0.582	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN4	HGNC	protein_coding	OTTHUMT00000055730.1	42	0.00	0	C			10176285	10176285	+1	no_errors	ENST00000380833	ensembl	human	known	69_37n	silent	52	14.75	9	SNP	1.000	G
COL1A1	1277	genome.wustl.edu	37	17	48271770	48271770	+	Silent	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:48271770G>A	ENST00000225964.5	-	23	1672	c.1554C>T	c.(1552-1554)ggC>ggT	p.G518G		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	518	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	ATCCTTTGGGGCCAGCAGGGC	0.632			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															dbGAP		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0													64.0	71.0	68.0					17																	48271770		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.1554C>T	17.37:g.48271770G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G518	ENST00000225964.5	37	c.1554	CCDS11561.1	17																																																																																			COL1A1	-	pfam_Collagen	ENSG00000108821		0.632	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2	30	0.00	0	G			48271770	48271770	-1	no_errors	ENST00000225964	ensembl	human	known	69_37n	silent	20	58.33	28	SNP	0.814	A
COL6A5	256076	genome.wustl.edu	37	3	130188288	130188288	+	Silent	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:130188288C>A	ENST00000432398.2	+	38	7934	c.7440C>A	c.(7438-7440)atC>atA	p.I2480I	COL6A5_ENST00000265379.6_Silent_p.I2480I	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2480	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GGAACTATATCATCAAGTTTG	0.383																																						dbGAP											0													59.0	54.0	56.0					3																	130188288		1893	4123	6016	-	-	-	SO:0001819	synonymous_variant	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.7440C>A	3.37:g.130188288C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.H732N	ENST00000432398.2	37	c.2194		3	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.534547	0.00942	.	.	ENSG00000172752	ENST00000512836	.	.	.	5.0	0.38	0.16222	.	.	.	.	.	T	0.23451	0.0567	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24512	-1.0158	4	.	.	.	.	3.8599	0.08991	0.2797:0.4243:0.0:0.296	.	.	.	.	N	732	.	.	H	+	1	0	COL6A5	131670978	0.001000	0.12720	0.001000	0.08648	0.101000	0.19017	-0.331000	0.07914	0.141000	0.18875	-0.261000	0.10672	CAT	COL6A5	-	pfscan_VWF_A	ENSG00000172752		0.383	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		42	0.00	0	C	NM_153264		130188288	130188288	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000512836	ensembl	human	putative	69_37n	missense	32	13.51	5	SNP	0.000	A
CREBBP	1387	genome.wustl.edu	37	16	3900661	3900661	+	Silent	SNP	G	G	T	rs201435679		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:3900661G>T	ENST00000262367.5	-	2	1244	c.435C>A	c.(433-435)ccC>ccA	p.P145P	CREBBP_ENST00000382070.3_Silent_p.P145P	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	145					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGGAGGCAGCGGGGGTGGGCC	0.622			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															dbGAP		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													46.0	51.0	49.0					16																	3900661		2197	4299	6496	-	-	-	SO:0001819	synonymous_variant	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.435C>A	16.37:g.3900661G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.P145	ENST00000262367.5	37	c.435	CCDS10509.1	16																																																																																			CREBBP	-	NULL	ENSG00000005339		0.622	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	25	0.00	0	G	NM_004380		3900661	3900661	-1	no_errors	ENST00000262367	ensembl	human	known	69_37n	silent	27	41.67	20	SNP	0.961	T
CREBZF	58487	genome.wustl.edu	37	11	85375464	85375464	+	Silent	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:85375464C>G	ENST00000527447.1	-	1	682	c.456G>C	c.(454-456)gcG>gcC	p.A152A	CREBZF_ENST00000398294.2_Silent_p.A70A|CREBZF_ENST00000534224.1_Intron|CREBZF_ENST00000531515.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	152					negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				TTTCAGCAGCCGCGGCCTCAT	0.647											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(172;674 2044 9050 18334 41735)	dbGAP											0													25.0	29.0	28.0					11																	85375464		2015	4190	6205	-	-	-	SO:0001819	synonymous_variant	0			AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.456G>C	11.37:g.85375464C>G		Somatic	1236	WXS	Illumina GAIIx	Phase_IV	B2R8Q9|Q0P5U9|Q52LT3	Silent	SNP	pfam_bZIP_1	p.A152	ENST00000527447.1	37	c.456	CCDS41697.1	11																																																																																			CREBZF	-	NULL	ENSG00000137504		0.647	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBZF	HGNC	protein_coding	OTTHUMT00000390191.2	35	0.00	0	C	NM_001039618		85375464	85375464	-1	no_errors	ENST00000525639	ensembl	human	known	69_37n	silent	42	10.64	5	SNP	0.983	G
CROCCP2	84809	genome.wustl.edu	37	1	16956819	16956819	+	lincRNA	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:16956819G>A	ENST00000412962.1	-	0	294							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCTCCTATGTGCCCTCACCAC	0.642																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16956819G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.642	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	21	0.00	0	G	NR_026752.1		16956819	16956819	-1	no_errors	ENST00000362058	ensembl	human	known	69_37n	rna	31	20.00	8	SNP	0.024	A
CROCC	9696	genome.wustl.edu	37	1	17275669	17275669	+	Intron	SNP	G	G	A	rs9435720		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:17275669G>A	ENST00000375541.5	+	19	2905				CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ccaggatgacgtgggaaaagc	0.552																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2836+248G>A	1.37:g.17275669G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000375541.5	37	NULL	CCDS30616.1	1																																																																																			CROCC	-	-	ENSG00000058453		0.552	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	9	0.00	0	G	NM_014675		17275669	17275669	+1	no_errors	ENST00000488646	ensembl	human	known	69_37n	rna	2	66.67	4	SNP	0.002	A
CTTNBP2	83992	genome.wustl.edu	37	7	117365286	117365286	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:117365286C>T	ENST00000160373.3	-	18	4172	c.4081G>A	c.(4081-4083)Gtc>Atc	p.V1361I		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1361					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GGTGCGATGACGCCATTCCAC	0.483																																						dbGAP											0													171.0	164.0	166.0					7																	117365286		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4081G>A	7.37:g.117365286C>T	ENSP00000160373:p.Val1361Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V1361I	ENST00000160373.3	37	c.4081	CCDS5774.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.722|8.722	0.914513|0.914513	0.17907|0.17907	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|D	.|0.88509	.|-2.39	5.72|5.72	0.644|0.644	0.17776|0.17776	.|.	.|0.348573	.|0.32970	.|N	.|0.005437	D|D	0.85318|0.85318	0.5669|0.5669	M|M	0.65498|0.65498	2.005|2.005	0.29840|0.29840	N|N	0.829284|0.829284	.|B	.|0.19935	.|0.04	.|B	.|0.14023	.|0.01	T|T	0.77016|0.77016	-0.2744|-0.2744	5|10	.|0.45353	.|T	.|0.12	-0.0314|-0.0314	10.4035|10.4035	0.44243|0.44243	0.0:0.5989:0.0:0.4011|0.0:0.5989:0.0:0.4011	.|.	.|1361	.|Q8WZ74	.|CTTB2_HUMAN	H|I	848|1361	.|ENSP00000160373:V1361I	.|ENSP00000160373:V1361I	R|V	-|-	2|1	0|0	CTTNBP2|CTTNBP2	117152522|117152522	0.000000|0.000000	0.05858|0.05858	0.027000|0.027000	0.17364|0.17364	0.229000|0.229000	0.25112|0.25112	-0.188000|-0.188000	0.09642|0.09642	-0.087000|-0.087000	0.12528|0.12528	0.655000|0.655000	0.94253|0.94253	CGT|GTC	CTTNBP2	-	NULL	ENSG00000077063		0.483	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	44	0.00	0	C	NM_033427		117365286	117365286	-1	no_errors	ENST00000160373	ensembl	human	known	69_37n	missense	41	25.45	14	SNP	0.275	T
BRINP1	1620	genome.wustl.edu	37	9	121971147	121971147	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr9:121971147C>A	ENST00000265922.3	-	7	1456	c.995G>T	c.(994-996)tGg>tTg	p.W332L	BRINP1_ENST00000482797.1_5'UTR	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	332					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GTCATTGCCCCAGTGCTGATG	0.537																																						dbGAP											0													136.0	117.0	123.0					9																	121971147		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.995G>T	9.37:g.121971147C>A	ENSP00000265922:p.Trp332Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.W332L	ENST00000265922.3	37	c.995	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957730	0.92726	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.26518	1.73	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.50786	0.1636	M	0.72894	2.215	0.80722	D	1	D	0.54601	0.967	P	0.62382	0.901	T	0.49634	-0.8919	10	0.87932	D	0	-10.5381	19.0317	0.92960	0.0:1.0:0.0:0.0	.	332	O60477	DBC1_HUMAN	L	332	ENSP00000265922:W332L	ENSP00000265922:W332L	W	-	2	0	DBC1	121010968	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.731000	0.93534	0.650000	0.86243	TGG	DBC1	-	NULL	ENSG00000078725		0.537	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBC1	HGNC	protein_coding	OTTHUMT00000055440.2	79	0.00	0	C	NM_014618		121971147	121971147	-1	no_errors	ENST00000265922	ensembl	human	known	69_37n	missense	55	40.86	38	SNP	1.000	A
DLGAP1	9229	genome.wustl.edu	37	18	3879801	3879801	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr18:3879801G>A	ENST00000315677.3	-	4	863	c.268C>T	c.(268-270)Cgc>Tgc	p.R90C	DLGAP1_ENST00000515196.2_Missense_Mutation_p.R90C|DLGAP1_ENST00000584874.1_Missense_Mutation_p.R90C|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R90C|DLGAP1-AS3_ENST00000577649.1_RNA	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	90					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GCCAGGGTGCGGGGCACCAGG	0.677																																						dbGAP											0													48.0	49.0	48.0					18																	3879801		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.268C>T	18.37:g.3879801G>A	ENSP00000316377:p.Arg90Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	pfam_GKAP	p.R90C	ENST00000315677.3	37	c.268	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750357	0.49257	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.18338	2.22;2.22	5.69	5.69	0.88448	.	0.203322	0.45361	D	0.000362	T	0.19644	0.0472	N	0.14661	0.345	0.41643	D	0.989082	P;D;P	0.65815	0.876;0.995;0.84	B;P;B	0.50708	0.183;0.648;0.298	T	0.02498	-1.1150	10	0.59425	D	0.04	-17.1155	19.812	0.96551	0.0:0.0:1.0:0.0	.	90;90;90	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	C	90	ENSP00000316377:R90C;ENSP00000445973:R90C	ENSP00000316377:R90C	R	-	1	0	DLGAP1	3869801	1.000000	0.71417	0.996000	0.52242	0.903000	0.53119	6.294000	0.72738	2.685000	0.91497	0.655000	0.94253	CGC	DLGAP1	-	NULL	ENSG00000170579		0.677	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	38	0.00	0	G			3879801	3879801	-1	no_errors	ENST00000315677	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	1.000	A
DUOX1	53905	genome.wustl.edu	37	15	45421674	45421674	+	5'Flank	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:45421674G>A	ENST00000321429.4	+	0	0				DUOXA1_ENST00000558996.1_Intron|DUOXA1_ENST00000559407.1_5'UTR|DUOXA1_ENST00000558422.1_5'UTR|DUOXA1_ENST00000559014.1_5'UTR|DUOX1_ENST00000389037.3_5'Flank|DUOXA1_ENST00000267803.4_5'UTR	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1						cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		ACGCAGTTCCGGGTCTGGCGG	0.706																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9			15.37:g.45421674G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	RNA	SNP	-	NULL	ENST00000321429.4	37	NULL	CCDS32221.1	15																																																																																			DUOXA1	-	-	ENSG00000140254		0.706	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOXA1	HGNC	protein_coding	OTTHUMT00000416251.1	36	0.00	0	G	NM_017434		45421674	45421674	-1	no_errors	ENST00000558976	ensembl	human	putative	69_37n	rna	38	30.91	17	SNP	0.000	A
DUSP16	80824	genome.wustl.edu	37	12	12672818	12672818	+	Silent	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:12672818G>A	ENST00000228862.2	-	3	976	c.345C>T	c.(343-345)ttC>ttT	p.F115F	DUSP16_ENST00000298573.4_Silent_p.F115F	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	115	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GAACAGAGTTGAAGCTCTTCT	0.438																																					Ovarian(158;443 1896 15437 36069 46477)	dbGAP											0													91.0	82.0	85.0					12																	12672818		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.345C>T	12.37:g.12672818G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q547C7|Q96QS2|Q9C0G3	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.F115	ENST00000228862.2	37	c.345	CCDS8650.1	12																																																																																			DUSP16	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000111266		0.438	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP16	HGNC	protein_coding	OTTHUMT00000400311.1	32	0.00	0	G	NM_030640		12672818	12672818	-1	no_errors	ENST00000228862	ensembl	human	known	69_37n	silent	19	42.42	14	SNP	1.000	A
DUSP22	56940	genome.wustl.edu	37	6	348111	348111	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr6:348111G>C	ENST00000344450.5	+	6	715	c.272G>C	c.(271-273)gGg>gCg	p.G91A	DUSP22_ENST00000604971.1_5'UTR|DUSP22_ENST00000605315.1_5'UTR|DUSP22_ENST00000605863.1_5'UTR|DUSP22_ENST00000419235.2_Missense_Mutation_p.G91A|DUSP22_ENST00000603453.1_5'UTR|DUSP22_ENST00000605035.1_5'UTR	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	91	Tyrosine-protein phosphatase.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		AGCCTGGCCGGGGTCTCCAGG	0.602																																						dbGAP											0													152.0	145.0	147.0					6																	348111		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.272G>C	6.37:g.348111G>C	ENSP00000345281:p.Gly91Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP	p.G91A	ENST00000344450.5	37	c.272	CCDS4468.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.257060	0.95336	.	.	ENSG00000112679	ENST00000344450	D	0.97066	-4.23	5.82	5.82	0.92795	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.99351	0.9772	H	0.99090	4.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98528	1.0626	10	0.87932	D	0	.	20.0852	0.97797	0.0:0.0:1.0:0.0	.	91;48;91	Q9NRW4-2;B3KSA8;Q9NRW4	.;.;DUS22_HUMAN	A	91	ENSP00000345281:G91A	ENSP00000345281:G91A	G	+	2	0	DUSP22	293111	1.000000	0.71417	0.955000	0.39395	0.927000	0.56198	9.807000	0.99171	2.752000	0.94435	0.655000	0.94253	GGG	DUSP22	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000112679		0.602	DUSP22-001	KNOWN	basic|CCDS	protein_coding	DUSP22	HGNC	protein_coding	OTTHUMT00000039621.1	75	0.00	0	G	NM_020185		348111	348111	+1	no_errors	ENST00000344450	ensembl	human	known	69_37n	missense	80	16.67	16	SNP	1.000	C
EDDM3A	10876	genome.wustl.edu	37	14	21216054	21216054	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr14:21216054T>G	ENST00000326842.2	+	2	442	c.315T>G	c.(313-315)tgT>tgG	p.C105W		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	105					sperm displacement (GO:0007321)	extracellular space (GO:0005615)				breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						TACTCGAGTGTCACTGGGAGA	0.448																																						dbGAP											0													87.0	74.0	78.0					14																	21216054		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	ENST00000326842.2:c.315T>G	14.37:g.21216054T>G	ENSP00000315098:p.Cys105Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN33	Missense_Mutation	SNP	superfamily_RNaseA_domain	p.C105W	ENST00000326842.2	37	c.315	CCDS9556.1	14	.	.	.	.	.	.	.	.	.	.	T	12.97	2.096220	0.36952	.	.	ENSG00000181562	ENST00000326842	D	0.94966	-3.57	2.46	-1.55	0.08558	Ribonuclease A, domain (2);	0.000000	0.49916	D	0.000122	D	0.94719	0.8296	L	0.59436	1.845	0.18873	N	0.999985	D	0.76494	0.999	D	0.76575	0.988	D	0.88212	0.2891	10	0.87932	D	0	.	6.5325	0.22334	0.0:0.6649:0.0:0.3351	.	105	Q14507	EP3A_HUMAN	W	105	ENSP00000315098:C105W	ENSP00000315098:C105W	C	+	3	2	EDDM3A	20285894	0.016000	0.18221	0.004000	0.12327	0.306000	0.27790	-0.144000	0.10280	-0.214000	0.10078	0.260000	0.18958	TGT	EDDM3A	-	superfamily_RNaseA_domain	ENSG00000181562		0.448	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDDM3A	HGNC	protein_coding	OTTHUMT00000073742.3	36	0.00	0	T			21216054	21216054	+1	no_errors	ENST00000326842	ensembl	human	known	69_37n	missense	32	10.81	4	SNP	0.001	G
EMR3	84658	genome.wustl.edu	37	19	14743742	14743742	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:14743742T>C	ENST00000253673.5	-	13	1734	c.1634A>G	c.(1633-1635)cAg>cGg	p.Q545R	EMR3_ENST00000443157.2_Missense_Mutation_p.Q419R|EMR3_ENST00000599900.1_Missense_Mutation_p.Q330R|EMR3_ENST00000344373.4_Missense_Mutation_p.Q493R	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	545					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						CCTTGTGTTCTGGATGGTTGA	0.413																																						dbGAP											0													124.0	116.0	118.0					19																	14743742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1634A>G	19.37:g.14743742T>C	ENSP00000253673:p.Gln545Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.Q545R	ENST00000253673.5	37	c.1634	CCDS12315.1	19	.	.	.	.	.	.	.	.	.	.	T	8.043	0.764377	0.15914	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.33216	1.42;1.42;1.42	4.08	3.05	0.35203	GPCR, family 2-like (1);	.	.	.	.	T	0.22898	0.0553	L	0.38649	1.16	0.22050	N	0.999399	B;B;B	0.19073	0.02;0.033;0.02	B;B;B	0.25405	0.016;0.036;0.06	T	0.28267	-1.0049	9	0.20519	T	0.43	.	7.7333	0.28799	0.0:0.1034:0.0:0.8966	.	419;493;545	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	R	419;545;493	ENSP00000396208:Q419R;ENSP00000253673:Q545R;ENSP00000340758:Q493R	ENSP00000253673:Q545R	Q	-	2	0	EMR3	14604742	0.810000	0.29049	0.997000	0.53966	0.477000	0.33069	0.379000	0.20585	0.717000	0.32145	0.533000	0.62120	CAG	EMR3	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt	ENSG00000131355		0.413	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	HGNC	protein_coding	OTTHUMT00000466488.1	39	0.00	0	T	NM_032571		14743742	14743742	-1	no_errors	ENST00000253673	ensembl	human	known	69_37n	missense	42	33.33	21	SNP	1.000	C
ENTHD1	150350	genome.wustl.edu	37	22	40140261	40140261	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr22:40140261G>T	ENST00000325157.6	-	7	1497	c.1247C>A	c.(1246-1248)tCc>tAc	p.S416Y		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	416										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					AGGAGAAAAGGAAGATGCTCC	0.378																																						dbGAP											0													55.0	54.0	55.0					22																	40140261		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.1247C>A	22.37:g.40140261G>T	ENSP00000317431:p.Ser416Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.S416Y	ENST00000325157.6	37	c.1247	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840564	0.51057	.	.	ENSG00000176177	ENST00000325157	T	0.56444	0.46	5.34	5.34	0.76211	.	0.239014	0.29707	N	0.011407	T	0.58004	0.2092	L	0.34521	1.04	0.37569	D	0.919366	D	0.65815	0.995	P	0.58013	0.831	T	0.65051	-0.6262	10	0.87932	D	0	-13.5429	14.9013	0.70681	0.0:0.0:1.0:0.0	.	416	Q8IYW4	ENTD1_HUMAN	Y	416	ENSP00000317431:S416Y	ENSP00000317431:S416Y	S	-	2	0	ENTHD1	38470207	1.000000	0.71417	0.972000	0.41901	0.456000	0.32438	2.082000	0.41605	2.642000	0.89623	0.650000	0.86243	TCC	ENTHD1	-	NULL	ENSG00000176177		0.378	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1	33	0.00	0	G	NM_152512		40140261	40140261	-1	no_errors	ENST00000325157	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.994	T
F11R	50848	genome.wustl.edu	37	1	160969767	160969767	+	Splice_Site	SNP	A	A	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:160969767A>T	ENST00000368026.6	-	6	867	c.593T>A	c.(592-594)gTc>gAc	p.V198D	F11R_ENST00000537746.1_Splice_Site_p.V149D|F11R_ENST00000289779.3_3'UTR|F11R_ENST00000472573.1_5'UTR	NM_016946.4	NP_058642.1	Q9Y624	JAM1_HUMAN	F11 receptor	198	Ig-like V-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)	12	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			GGGATCAAAGACCTGAGGAAG	0.473																																						dbGAP											0													60.0	61.0	61.0					1																	160969767		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF111713	CCDS1213.1	1q21.2-q21.3	2013-01-29	2003-02-07	2003-02-14	ENSG00000158769	ENSG00000158769		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14685	protein-coding gene	gene with protein product		605721	"""junctional adhesion molecule 1"""	JAM1		10395639, 7646439	Standard	NM_016946		Approved	PAM-1, JCAM, JAM-1, JAM-A, JAMA, CD321	uc009wtt.3	Q9Y624	OTTHUMG00000028602	ENST00000368026.6:c.592-1T>A	1.37:g.160969767A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z941	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V202D	ENST00000368026.6	37	c.605	CCDS1213.1	1	.	.	.	.	.	.	.	.	.	.	A	9.224	1.034044	0.19590	.	.	ENSG00000158769	ENST00000368026;ENST00000335772;ENST00000289779;ENST00000537746;ENST00000436182	T;T;T	0.70749	-0.51;-0.51;-0.51	5.41	5.41	0.78517	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.693503	0.14115	N	0.340465	T	0.54791	0.1880	L	0.46614	1.455	0.46131	D	0.998887	D;P;D;D;P	0.56035	0.974;0.737;0.966;0.966;0.922	P;B;B;B;B	0.47376	0.545;0.324;0.37;0.37;0.267	T	0.51332	-0.8719	10	0.15066	T	0.55	.	11.7486	0.51835	1.0:0.0:0.0:0.0	.	202;149;198;198;198	B7Z5W1;B7Z941;Q6FIB4;Q9Y624;D3DVF0	.;.;.;JAM1_HUMAN;.	D	198;198;198;149;202	ENSP00000357005:V198D;ENSP00000440812:V149D;ENSP00000394809:V202D	ENSP00000289779:V198D	V	-	2	0	F11R	159236391	0.322000	0.24634	0.759000	0.31340	0.215000	0.24574	0.979000	0.29500	2.261000	0.74972	0.460000	0.39030	GTC	F11R	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000158769		0.473	F11R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11R	HGNC	protein_coding	OTTHUMT00000071458.3	21	0.00	0	A	NM_016946	Missense_Mutation	160969767	160969767	-1	no_errors	ENST00000436182	ensembl	human	known	69_37n	missense	26	38.64	17	SNP	0.864	T
F8	2157	genome.wustl.edu	37	X	154090058	154090058	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chrX:154090058C>T	ENST00000360256.4	-	24	6858	c.6658G>A	c.(6658-6660)Gcc>Acc	p.A2220T	F8_ENST00000330287.6_Missense_Mutation_p.A85T	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2220	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.		A -> P (in HEMA; mild). {ECO:0000269|PubMed:10910913}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GACCAGGTGGCAAACATATTG	0.433																																						dbGAP											0			GRCh37	CM002005	F8	M							215.0	195.0	202.0					X																	154090058		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6658G>A	X.37:g.154090058C>T	ENSP00000353393:p.Ala2220Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.A2220T	ENST00000360256.4	37	c.6658	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	c	14.89	2.670952	0.47781	.	.	ENSG00000185010	ENST00000330287;ENST00000360256	D;D	0.98313	-4.86;-4.86	5.6	4.7	0.59300	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.559972	0.20743	N	0.086489	D	0.96166	0.8750	L	0.55990	1.75	0.38922	D	0.957752	B;B	0.18968	0.032;0.008	B;B	0.24974	0.057;0.007	D	0.93630	0.6955	10	0.19590	T	0.45	-1.507	10.1739	0.42927	0.0:0.8951:0.0:0.1049	.	2220;85	P00451;Q14286	FA8_HUMAN;.	T	85;2220	ENSP00000327895:A85T;ENSP00000353393:A2220T	ENSP00000327895:A85T	A	-	1	0	F8	153743252	0.995000	0.38212	0.164000	0.22755	0.930000	0.56654	0.181000	0.16880	1.046000	0.40249	0.600000	0.82982	GCC	F8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000185010		0.433	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	40	0.00	0	C			154090058	154090058	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.983	T
ABHD17C	58489	genome.wustl.edu	37	15	81041912	81041912	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:81041912A>G	ENST00000258884.4	+	2	776	c.649A>G	c.(649-651)Acg>Gcg	p.T217A	ABHD17C_ENST00000559506.1_3'UTR|ABHD17C_ENST00000558464.1_Missense_Mutation_p.T217A|ABHD17C_ENST00000560609.1_5'UTR	NM_021214.1	NP_067037.1	Q6PCB6	AB17C_HUMAN	abhydrolase domain containing 17C	217							hydrolase activity (GO:0016787)										GACTGTCCCCACGGTAGACTT	0.493																																						dbGAP											0													144.0	144.0	144.0					15																	81041912		2001	4165	6166	-	-	-	SO:0001583	missense	0				CCDS45323.1	15q25.1	2013-03-15	2013-03-15	2013-03-15	ENSG00000136379	ENSG00000136379		"""Abhydrolase domain containing"""	26925	protein-coding gene	gene with protein product			"""family with sequence similarity 108, member C1"""	FAM108C1			Standard	NM_021214		Approved		uc002bfu.3	Q6PCB6		ENST00000258884.4:c.649A>G	15.37:g.81041912A>G	ENSP00000258884:p.Thr217Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1RMD6|Q9NPM1	Missense_Mutation	SNP	pfam_Peptidase_S9,pfam_Dienelactn_hydro	p.T217A	ENST00000258884.4	37	c.649	CCDS45323.1	15	.	.	.	.	.	.	.	.	.	.	A	12.74	2.027894	0.35797	.	.	ENSG00000136379	ENST00000258884	T	0.22336	1.96	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.15825	0.0381	N	0.12920	0.275	0.80722	D	1	B;B	0.32620	0.151;0.378	B;B	0.40940	0.344;0.233	T	0.14090	-1.0485	10	0.17369	T	0.5	.	13.726	0.62759	1.0:0.0:0.0:0.0	.	217;217	Q6PCB6;Q6PCB6-2	F108C_HUMAN;.	A	217	ENSP00000258884:T217A	ENSP00000258884:T217A	T	+	1	0	FAM108C1	78828967	1.000000	0.71417	0.974000	0.42286	0.052000	0.14988	5.430000	0.66501	1.885000	0.54596	0.533000	0.62120	ACG	FAM108C1	-	pfam_Peptidase_S9,pfam_Dienelactn_hydro	ENSG00000136379		0.493	ABHD17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM108C1	HGNC	protein_coding	OTTHUMT00000417652.1	59	0.00	0	A	NM_021214		81041912	81041912	+1	no_errors	ENST00000258884	ensembl	human	known	69_37n	missense	70	30.69	31	SNP	1.000	G
FAM19A4	151647	genome.wustl.edu	37	3	68788321	68788321	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:68788321G>A	ENST00000295569.7	-	5	808	c.316C>T	c.(316-318)Cac>Tac	p.H106Y		NM_001005527.2|NM_182522.4	NP_001005527.1|NP_872328.1	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A4	106						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(5)|skin(2)	10		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		GGATTCATGTGACACCACCAT	0.408																																						dbGAP											0													170.0	147.0	155.0					3																	68788321		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY325117	CCDS2907.1	3p14.1	2014-08-14			ENSG00000163377	ENSG00000163377			21591	protein-coding gene	gene with protein product						15028294, 25109685	Standard	NM_182522		Approved	TAFA-4	uc021xah.1	Q96LR4	OTTHUMG00000158744	ENST00000295569.7:c.316C>T	3.37:g.68788321G>A	ENSP00000295569:p.His106Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVT2	Missense_Mutation	SNP	pfam_Chemokine-like_FAM19A2	p.H106Y	ENST00000295569.7	37	c.316	CCDS2907.1	3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148086	0.78001	.	.	ENSG00000163377	ENST00000295569	.	.	.	5.46	5.46	0.80206	.	0.054338	0.85682	D	0.000000	T	0.62672	0.2447	L	0.36672	1.1	0.33242	D	0.557353	D	0.54047	0.964	P	0.59012	0.85	T	0.70324	-0.4903	9	0.72032	D	0.01	-15.3016	19.6763	0.95934	0.0:0.0:1.0:0.0	.	106	Q96LR4	F19A4_HUMAN	Y	106	.	ENSP00000295569:H106Y	H	-	1	0	FAM19A4	68871011	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.716000	0.54904	2.725000	0.93324	0.460000	0.39030	CAC	FAM19A4	-	pfam_Chemokine-like_FAM19A2	ENSG00000163377		0.408	FAM19A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM19A4	HGNC	protein_coding	OTTHUMT00000352002.1	53	0.00	0	G	NM_182522		68788321	68788321	-1	no_errors	ENST00000295569	ensembl	human	known	69_37n	missense	37	46.48	33	SNP	1.000	A
BRINP2	57795	genome.wustl.edu	37	1	177250856	177250857	+	3'UTR	DEL	AC	AC	-	rs375159117		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:177250856_177250857delAC	ENST00000361539.4	+	0	2856_2857				BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GCGcacgcatacacacacacac	0.51																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.*193AC>-	1.37:g.177250866_177250867delAC		Somatic		WXS	Illumina GAIIx	Phase_IV	O95560|Q6ZWC1|Q7LCZ9|Q8N360	RNA	DEL	-	NULL	ENST00000361539.4	37	NULL	CCDS1320.1	1																																																																																			FAM5B	-	-	ENSG00000198797		0.510	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5B	HGNC	protein_coding	OTTHUMT00000084599.1	44	0.00	0	AC	NM_021165		177250856	177250857	+1	no_errors	ENST00000478325	ensembl	human	known	69_37n	rna	33	10.81	4	DEL	0.000:0.000	-
FAM71D	161142	genome.wustl.edu	37	14	67671361	67671361	+	3'UTR	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr14:67671361C>G	ENST00000556046.1	+	0	1008							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		CTCTGCACCTCTGCATATAAA	0.478																																						dbGAP											0													98.0	82.0	87.0					14																	67671361		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*523C>G	14.37:g.67671361C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VN4	Missense_Mutation	SNP	pfam_DUF3699	p.S156C	ENST00000556046.1	37	c.467		14																																																																																			FAM71D	-	pfam_DUF3699	ENSG00000172717		0.478	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	FAM71D	HGNC	protein_coding	OTTHUMT00000412390.1	53	0.00	0	C	NM_173526		67671361	67671361	+1	no_errors	ENST00000311864	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	0.913	G
SPATA31A3	727830	genome.wustl.edu	37	9	40705594	40705594	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr9:40705594T>G	ENST00000356699.5	+	4	3280	c.3251T>G	c.(3250-3252)gTg>gGg	p.V1084G	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1084					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGCAAACTGGTGCACGAGGAG	0.542																																						dbGAP											0													57.0	49.0	52.0					9																	40705594		1531	3036	4567	-	-	-	SO:0001583	missense	0					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3251T>G	9.37:g.40705594T>G	ENSP00000349132:p.Val1084Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V1084G	ENST00000356699.5	37	c.3251	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	T	2.191	-0.385311	0.04966	.	.	ENSG00000147926	ENST00000356699	T	0.03607	3.87	2.79	-5.14	0.02875	.	1.482540	0.04369	N	0.358814	T	0.00967	0.0032	N	0.00583	-1.355	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.45234	-0.9275	10	0.09590	T	0.72	.	4.0464	0.09774	0.2213:0.0:0.2884:0.4903	.	1084	Q5VYP0	F75A3_HUMAN	G	1084	ENSP00000349132:V1084G	ENSP00000349132:V1084G	V	+	2	0	FAM75A3	40695594	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	-0.044000	0.12023	-1.200000	0.02662	-0.586000	0.04128	GTG	FAM75A3	-	NULL	ENSG00000147926		0.542	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A3	HGNC	protein_coding	OTTHUMT00000036919.1	74	0.00	0	T	NM_001083124		40705594	40705594	+1	no_errors	ENST00000356699	ensembl	human	known	69_37n	missense	41	61.68	66	SNP	0.000	G
FAM92A1P2	403315	genome.wustl.edu	37	4	183959775	183959775	+	RNA	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr4:183959775G>A	ENST00000502308.1	+	0	958					NR_003612.1				family with sequence similarity 92, member A1 pseudogene 2																		AGAGCCTGAGGGGCTCATTCC	0.483																																						dbGAP											0																																										-	-	-			0			BC022019		4q35.1	2012-04-19	2012-04-19	2012-04-19	ENSG00000230219	ENSG00000230219			32287	pseudogene	pseudogene			"""family with sequence similarity 92, member A3"""	FAM92A3		12477932	Standard	NR_003612		Approved	MGC71735, MGC102964	uc003ivi.4		OTTHUMG00000160675		4.37:g.183959775G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000502308.1	37	NULL		4																																																																																			FAM92A1P2	-	-	ENSG00000230219		0.483	FAM92A1P2-002	KNOWN	basic	processed_transcript	FAM92A1P2	HGNC	pseudogene	OTTHUMT00000361814.1	9	0.00	0	G			183959775	183959775	+1	no_errors	ENST00000502308	ensembl	human	known	69_37n	rna	5	54.55	6	SNP	0.003	A
FRG1	2483	genome.wustl.edu	37	4	190874255	190874255	+	Missense_Mutation	SNP	A	A	T	rs17425201		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr4:190874255A>T	ENST00000226798.4	+	4	514	c.292A>T	c.(292-294)Acg>Tcg	p.T98S	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	98					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.T98S(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAGCAGTTTACGGCTGTCAA	0.269																																						dbGAP											1	Substitution - Missense(1)	NS(1)																																								-	-	-	SO:0001583	missense	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.292A>T	4.37:g.190874255A>T	ENSP00000226798:p.Thr98Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K775	Missense_Mutation	SNP	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	p.T98S	ENST00000226798.4	37	c.292	CCDS34121.1	4	.	.	.	.	.	.	.	.	.	.	.	15.38	2.815686	0.50527	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.52057	1.8;0.68	3.71	3.71	0.42584	Actin cross-linking (1);	0.093692	0.64402	D	0.000001	T	0.23926	0.0579	N	0.02539	-0.55	0.58432	D	0.999999	B	0.20261	0.043	B	0.27796	0.083	T	0.08207	-1.0733	10	0.39692	T	0.17	-1.9466	11.0497	0.47880	1.0:0.0:0.0:0.0	rs17425201	98	Q14331	FRG1_HUMAN	S	98;35	ENSP00000226798:T98S;ENSP00000435943:T35S	ENSP00000226798:T98S	T	+	1	0	FRG1	191111249	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.637000	0.74304	1.645000	0.50612	0.514000	0.50259	ACG	FRG1	-	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	ENSG00000109536		0.269	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	HGNC	protein_coding	OTTHUMT00000359622.4	103	0.96	1	A	NM_004477		190874255	190874255	+1	no_errors	ENST00000226798	ensembl	human	known	69_37n	missense	86	10.42	10	SNP	1.000	T
FRMD8	83786	genome.wustl.edu	37	11	65168222	65168222	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:65168222G>C	ENST00000317568.5	+	9	1118	c.955G>C	c.(955-957)Gag>Cag	p.E319Q	FRMD8_ENST00000355991.5_Missense_Mutation_p.E263Q|FRMD8_ENST00000416776.2_Missense_Mutation_p.E285Q	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	319	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						GCGCTTCCAGGAGCTGTCGTG	0.647																																						dbGAP											0													54.0	43.0	47.0					11																	65168222		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.955G>C	11.37:g.65168222G>C	ENSP00000319726:p.Glu319Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.E319Q	ENST00000317568.5	37	c.955	CCDS8102.1	11	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939536	0.92526	.	.	ENSG00000126391	ENST00000317568;ENST00000355991;ENST00000416776	D;T;D	0.85258	-1.96;-1.35;-1.95	4.49	4.49	0.54785	FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.91768	0.7396	M	0.79475	2.455	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.85130	0.997;0.992;0.991	D	0.92249	0.5807	10	0.52906	T	0.07	-9.1209	15.0229	0.71643	0.0:0.0:1.0:0.0	.	285;263;319	B4E2P1;Q9BZ67-2;Q9BZ67	.;.;FRMD8_HUMAN	Q	319;263;285	ENSP00000319726:E319Q;ENSP00000348270:E263Q;ENSP00000392111:E285Q	ENSP00000319726:E319Q	E	+	1	0	FRMD8	64924798	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.743000	0.74848	2.225000	0.72522	0.549000	0.68633	GAG	FRMD8	-	pfscan_FERM_domain	ENSG00000126391		0.647	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD8	HGNC	protein_coding	OTTHUMT00000388833.1	25	0.00	0	G	NM_031904		65168222	65168222	+1	no_errors	ENST00000317568	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	C
FRMPD1	22844	genome.wustl.edu	37	9	37737221	37737221	+	Silent	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr9:37737221C>T	ENST00000539465.1	+	14	2123	c.1530C>T	c.(1528-1530)caC>caT	p.H510H	FRMPD1_ENST00000377765.3_Silent_p.H510H|FRMPD1_ENST00000536622.1_Silent_p.H332H|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000541302.1_Silent_p.H379H			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	510						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AACAAGCGCACCGGGTATCTG	0.537																																						dbGAP											0													82.0	74.0	77.0					9																	37737221		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1530C>T	9.37:g.37737221C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.H510	ENST00000539465.1	37	c.1530	CCDS6612.1	9																																																																																			FRMPD1	-	NULL	ENSG00000070601		0.537	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	HGNC	protein_coding	OTTHUMT00000402969.1	43	0.00	0	C	NM_014907		37737221	37737221	+1	no_errors	ENST00000377765	ensembl	human	known	69_37n	silent	31	16.22	6	SNP	1.000	T
GDPD4	220032	genome.wustl.edu	37	11	76979571	76979571	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:76979571T>C	ENST00000376217.2	-	9	888	c.638A>G	c.(637-639)aAt>aGt	p.N213S	GDPD4_ENST00000315938.4_Missense_Mutation_p.N213S|GDPD4_ENST00000527489.1_5'Flank			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	213	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						CATCATGGTATTCTCAGGCCC	0.498																																						dbGAP											0													163.0	160.0	161.0					11																	76979571		2200	4292	6492	-	-	-	SO:0001583	missense	0			AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.638A>G	11.37:g.76979571T>C	ENSP00000365390:p.Asn213Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5B0	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.N213S	ENST00000376217.2	37	c.638		11	.	.	.	.	.	.	.	.	.	.	T	18.93	3.728194	0.69074	.	.	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.27256	1.68;1.68	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	M	0.88640	2.97	0.34211	D	0.67434	D	0.61697	0.99	P	0.57371	0.819	T	0.70831	-0.4765	10	0.72032	D	0.01	-19.7141	12.0398	0.53446	0.0:0.0:0.0:1.0	.	213	Q6W3E5-2	.	S	213	ENSP00000365390:N213S;ENSP00000320815:N213S	ENSP00000320815:N213S	N	-	2	0	GDPD4	76657219	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.308000	0.65768	2.098000	0.63641	0.482000	0.46254	AAT	GDPD4	-	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000178795		0.498	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	GDPD4	HGNC	protein_coding	OTTHUMT00000382075.1	60	0.00	0	T	NM_182833		76979571	76979571	-1	no_errors	ENST00000376217	ensembl	human	known	69_37n	missense	54	26.03	19	SNP	1.000	C
GIMAP2	26157	genome.wustl.edu	37	7	150390169	150390169	+	Silent	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:150390169C>A	ENST00000223293.5	+	3	889	c.795C>A	c.(793-795)gcC>gcA	p.A265A		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	265						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TAAAAGGAGCCTTAATCAAAA	0.363																																						dbGAP											0													106.0	106.0	106.0					7																	150390169		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.795C>A	7.37:g.150390169C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96L25	Silent	SNP	pfam_AIG1	p.A265	ENST00000223293.5	37	c.795	CCDS5905.1	7																																																																																			GIMAP2	-	NULL	ENSG00000106560		0.363	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP2	HGNC	protein_coding	OTTHUMT00000348948.1	25	0.00	0	C	NM_015660		150390169	150390169	+1	no_errors	ENST00000223293	ensembl	human	known	69_37n	silent	28	24.32	9	SNP	0.001	A
HAUS5	23354	genome.wustl.edu	37	19	36109547	36109547	+	Missense_Mutation	SNP	G	G	C	rs200446038		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:36109547G>C	ENST00000203166.5	+	12	987	c.962G>C	c.(961-963)cGc>cCc	p.R321P	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	321					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						TTGACCCAGCGCCTCCAGGGC	0.647																																						dbGAP											0													52.0	57.0	55.0					19																	36109547		1990	4140	6130	-	-	-	SO:0001583	missense	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.962G>C	19.37:g.36109547G>C	ENSP00000439056:p.Arg321Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	NULL	p.R321P	ENST00000203166.5	37	c.962	CCDS42550.1	19	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005301	0.35415	.	.	ENSG00000249115	ENST00000203166	T	0.32515	1.45	5.6	-1.48	0.08745	.	0.393685	0.25578	N	0.029718	T	0.39963	0.1098	M	0.71581	2.175	0.22050	N	0.999398	D	0.60575	0.988	P	0.55345	0.774	T	0.31475	-0.9942	10	0.66056	D	0.02	-5.5457	8.4709	0.32984	0.51:0.0:0.49:0.0	.	321	O94927	HAUS5_HUMAN	P	321	ENSP00000439056:R321P	ENSP00000439056:R321P	R	+	2	0	HAUS5	40801387	0.043000	0.20138	0.778000	0.31720	0.015000	0.08874	0.098000	0.15189	-0.129000	0.11620	-0.251000	0.11542	CGC	HAUS5	-	NULL	ENSG00000249115		0.647	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	40	0.00	0	G			36109547	36109547	+1	no_errors	ENST00000203166	ensembl	human	known	69_37n	missense	51	23.88	16	SNP	0.148	C
HAUS7	55559	genome.wustl.edu	37	X	152720419	152720419	+	Intron	SNP	A	A	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chrX:152720419A>T	ENST00000370211.4	-	9	1004				HAUS7_ENST00000421080.2_3'UTR|TREX2_ENST00000370232.1_Intron|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000484394.1_5'UTR|TREX2_ENST00000338525.2_Intron|HAUS7_ENST00000370212.3_Missense_Mutation_p.D351E|TREX2_ENST00000334497.2_Intron	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						CAAAATGAACATCACGGAATC	0.547																																						dbGAP											0													111.0	100.0	104.0					X																	152720419		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.961-453T>A	X.37:g.152720419A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	NULL	p.D351E	ENST00000370211.4	37	c.1053	CCDS35438.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.40|14.40	2.523813|2.523813	0.44866|0.44866	.|.	.|.	ENSG00000213397|ENSG00000213397	ENST00000370212|ENST00000435662	.|.	.|.	.|.	3.04|3.04	-5.06|-5.06	0.02946|0.02946	.|.	.|.	.|.	.|.	.|.	T|T	0.31827|0.31827	0.0809|0.0809	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|.	0.33103|.	0.397|.	B|.	0.24701|.	0.055|.	T|T	0.32107|0.32107	-0.9919|-0.9919	7|4	0.25751|.	T|.	0.34|.	.|.	11.3185|11.3185	0.49407|0.49407	0.7986:0.0:0.2014:0.0|0.7986:0.0:0.2014:0.0	.|.	351|.	Q99871-2|.	.|.	E|K	351|135	.|.	ENSP00000359231:D351E|.	D|M	-|-	3|2	2|0	HAUS7|HAUS7	152373613|152373613	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.463000|-0.463000	0.06696|0.06696	-1.684000|-1.684000	0.01443|0.01443	-0.395000|-0.395000	0.06472|0.06472	GAT|ATG	HAUS7	-	NULL	ENSG00000213397		0.547	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HAUS7	HGNC	protein_coding	OTTHUMT00000060963.2	69	0.00	0	A	NM_017518		152720419	152720419	-1	no_errors	ENST00000370212	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	0.000	T
MROH2B	133558	genome.wustl.edu	37	5	41009484	41009484	+	Silent	SNP	C	C	T	rs77379102	byFrequency	TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:41009484C>T	ENST00000399564.4	-	32	3768	c.3318G>A	c.(3316-3318)gcG>gcA	p.A1106A	MROH2B_ENST00000506092.2_Silent_p.A661A	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1106																	TTTCAGCCAGCGCCTTCCACA	0.493													C|||	16	0.00319489	0.0	0.0	5008	,	,		16604	0.0149		0.0	False		,,,				2504	0.001					dbGAP											0													92.0	94.0	93.0					5																	41009484		1858	4104	5962	-	-	-	SO:0001819	synonymous_variant	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3318G>A	5.37:g.41009484C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	superfamily_ARM-type_fold	p.A1106	ENST00000399564.4	37	c.3318	CCDS47202.1	5																																																																																			HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.493	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	36	0.00	0	C	NM_173489		41009484	41009484	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	silent	47	26.56	17	SNP	0.000	T
HERC2P4	100289574	genome.wustl.edu	37	16	32187491	32187491	+	IGR	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:32187491C>A								HERC2P4 (4603 upstream) : RP11-17M15.1 (12162 downstream)																							ACAGTTCTGACCTGTAAAAAA	0.353																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.32187491C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		16																																																																																			HERC2P4	-	-	ENSG00000230267	0	0.353					HERC2P4	HGNC			9	0.00	0	C			32187491	32187491	-1	no_errors	ENST00000566591	ensembl	human	known	69_37n	rna	5	50.00	5	SNP	1.000	A
HNRNPUL1	11100	genome.wustl.edu	37	19	41800328	41800328	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:41800328A>C	ENST00000392006.3	+	9	1525	c.1352A>C	c.(1351-1353)aAc>aCc	p.N451T	HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.N337T|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.N351T|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.N351T|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.N362T|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.N351T|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.N451T	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	451	Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						AAGAAGTACAACATCCTGGGT	0.527																																						dbGAP											0													172.0	135.0	148.0					19																	41800328		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1352A>C	19.37:g.41800328A>C	ENSP00000375863:p.Asn451Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_SAP_DNA-bd,superfamily_ConA-like_lec_gl,smart_SAP_DNA-bd,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_DNA-bd	p.N451T	ENST00000392006.3	37	c.1352	CCDS12576.1	19	.	.	.	.	.	.	.	.	.	.	A	19.49	3.837112	0.71373	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.46	4.45	0.53987	.	0.195083	0.53938	D	0.000057	T	0.38957	0.1060	L	0.47716	1.5	0.38812	D	0.955433	B;B;P;D;B;B	0.57899	0.115;0.236;0.696;0.981;0.114;0.094	B;B;P;P;B;B	0.50270	0.262;0.349;0.535;0.636;0.16;0.171	T	0.31110	-0.9955	10	0.19590	T	0.45	-26.2224	5.9405	0.19189	0.7759:0.0:0.0783:0.1458	.	362;351;451;337;451;351	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	T	351;451;337;362	ENSP00000340857:N351T;ENSP00000375863:N451T;ENSP00000367460:N337T;ENSP00000263367:N362T	ENSP00000263367:N362T	N	+	2	0	HNRNPUL1	46492168	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.996000	0.76263	1.086000	0.41228	0.533000	0.62120	AAC	HNRNPUL1	-	NULL	ENSG00000105323		0.527	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL1	HGNC	protein_coding	OTTHUMT00000463406.1	70	0.00	0	A	NM_144732, NM_007040		41800328	41800328	+1	no_errors	ENST00000392006	ensembl	human	known	69_37n	missense	59	27.16	22	SNP	1.000	C
HIF3A	64344	genome.wustl.edu	37	19	46834472	46834472	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:46834472C>G	ENST00000377670.4	+	13	1803	c.1772C>G	c.(1771-1773)cCt>cGt	p.P591R	HIF3A_ENST00000300862.3_Missense_Mutation_p.P589R|HIF3A_ENST00000472815.1_Intron|HIF3A_ENST00000339613.2_Missense_Mutation_p.P535R|HIF3A_ENST00000244303.6_Missense_Mutation_p.P522R|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000420102.2_Missense_Mutation_p.P540R|HIF3A_ENST00000600383.1_Missense_Mutation_p.P522R	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	591					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GGAGTGAGACCTCCCAAAAGG	0.557																																						dbGAP											0													108.0	83.0	91.0					19																	46834472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1772C>G	19.37:g.46834472C>G	ENSP00000366898:p.Pro591Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HIF_alpha_subunit,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.P591R	ENST00000377670.4	37	c.1772	CCDS12681.2	19	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410439	0.42715	.	.	ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	T;D;T;T;D	0.82893	-0.56;-1.64;-0.73;-0.56;-1.66	4.43	3.39	0.38822	.	2.256930	0.02093	N	0.053268	D	0.87075	0.6087	L	0.29908	0.895	0.32286	N	0.566943	D;P;P;D;D;D	0.89917	1.0;0.914;0.948;1.0;1.0;1.0	D;P;P;D;D;D	0.87578	0.998;0.505;0.7;0.994;0.994;0.994	T	0.74719	-0.3570	10	0.52906	T	0.07	.	8.7654	0.34700	0.0:0.8924:0.0:0.1076	.	540;522;589;535;591;591	F5H884;B4DNA2;Q9Y2N7-2;A8MPQ1;Q9Y2N7;B0M185	.;.;.;.;HIF3A_HUMAN;.	R	591;591;522;535;535;589;540	ENSP00000366898:P591R;ENSP00000244303:P522R;ENSP00000341877:P535R;ENSP00000300862:P589R;ENSP00000407771:P540R	ENSP00000244302:P591R	P	+	2	0	HIF3A	51526312	0.974000	0.33945	0.929000	0.37066	0.392000	0.30506	3.813000	0.55636	0.996000	0.38943	0.650000	0.86243	CCT	HIF3A	-	NULL	ENSG00000124440		0.557	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	43	0.00	0	C			46834472	46834472	+1	no_errors	ENST00000377670	ensembl	human	known	69_37n	missense	67	22.09	19	SNP	0.992	G
HSD17B4	3295	genome.wustl.edu	37	5	118865665	118865665	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:118865665C>G	ENST00000256216.6	+	21	1977	c.1844C>G	c.(1843-1845)aCa>aGa	p.T615R	HSD17B4_ENST00000515320.1_Missense_Mutation_p.T597R|HSD17B4_ENST00000414835.2_Missense_Mutation_p.T475R|HSD17B4_ENST00000504811.1_Missense_Mutation_p.T640R|HSD17B4_ENST00000510025.1_Missense_Mutation_p.T591R|HSD17B4_ENST00000513628.1_Missense_Mutation_p.T478R|HSD17B4_ENST00000509514.1_Missense_Mutation_p.T353R|HSD17B4_ENST00000522415.1_3'UTR	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	615	Enoyl-CoA hydratase 2.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		TCAGCTAAGACACCCTCTGAG	0.378																																					Colon(35;490 801 34689 41394 43344)	dbGAP											0													92.0	86.0	88.0					5																	118865665		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1844C>G	5.37:g.118865665C>G	ENSP00000256216:p.Thr615Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.T615R	ENST00000256216.6	37	c.1844	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	C	6.892	0.534026	0.13188	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	D;T;T;T;T;T;T	0.81659	-1.52;-1.2;-1.16;-1.18;-1.49;-1.36;-0.81	5.58	-2.54	0.06307	.	0.896298	0.09949	N	0.734963	T	0.66025	0.2748	L	0.45581	1.43	0.09310	N	1	B;B;B;B;B	0.15141	0.002;0.0;0.0;0.0;0.012	B;B;B;B;B	0.15484	0.006;0.0;0.001;0.002;0.013	T	0.47774	-0.9091	10	0.18276	T	0.48	-0.8535	2.1574	0.03815	0.1047:0.341:0.1909:0.3634	.	640;597;591;353;615	F5HE57;E9PB82;E7EWE5;E7EPL9;P51659	.;.;.;.;DHB4_HUMAN	R	615;597;591;640;475;478;353	ENSP00000256216:T615R;ENSP00000424613:T597R;ENSP00000424940:T591R;ENSP00000420914:T640R;ENSP00000411960:T475R;ENSP00000425993:T478R;ENSP00000426272:T353R	ENSP00000256216:T615R	T	+	2	0	HSD17B4	118893564	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	-0.618000	0.05578	-0.154000	0.11118	-0.942000	0.02676	ACA	HSD17B4	-	NULL	ENSG00000133835		0.378	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	27	0.00	0	C	NM_000414		118865665	118865665	+1	no_errors	ENST00000256216	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.000	G
HSF5	124535	genome.wustl.edu	37	17	56536233	56536233	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:56536233A>T	ENST00000323777.3	-	5	1725	c.1616T>A	c.(1615-1617)aTt>aAt	p.I539N	AC023992.1_ENST00000581197.1_RNA	NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	539					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CATTTCTGAAATGAGGAATCC	0.443																																						dbGAP											0													217.0	189.0	198.0					17																	56536233		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.1616T>A	17.37:g.56536233A>T	ENSP00000313243:p.Ile539Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08EH7|Q8N7V2	Missense_Mutation	SNP	pfam_HSF_DNA-bd,smart_HSF_DNA-bd	p.I539N	ENST00000323777.3	37	c.1616	CCDS32690.1	17	.	.	.	.	.	.	.	.	.	.	A	15.42	2.829108	0.50845	.	.	ENSG00000176160	ENST00000412540;ENST00000323777	T	0.71817	-0.6	5.53	5.53	0.82687	.	0.091003	0.48286	D	0.000199	T	0.65873	0.2733	N	0.24115	0.695	0.30098	N	0.807714	D	0.64830	0.994	P	0.53912	0.737	T	0.67841	-0.5566	10	0.87932	D	0	.	8.5741	0.33587	0.9136:0.0:0.0864:0.0	.	539	Q4G112	HSF5_HUMAN	N	439;539	ENSP00000313243:I539N	ENSP00000313243:I539N	I	-	2	0	HSF5	53891232	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.975000	0.56859	2.236000	0.73375	0.533000	0.62120	ATT	HSF5	-	NULL	ENSG00000176160		0.443	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF5	HGNC	protein_coding	OTTHUMT00000444719.1	90	0.00	0	A	XM_064190		56536233	56536233	-1	no_errors	ENST00000323777	ensembl	human	known	69_37n	missense	63	32.26	30	SNP	1.000	T
IFITM5	387733	genome.wustl.edu	37	11	299462	299462	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:299462G>A	ENST00000382614.2	-	1	64	c.29C>T	c.(28-30)aCc>aTc	p.T10I		NM_001025295.2	NP_001020466.1	A6NNB3	IFM5_HUMAN	interferon induced transmembrane protein 5	10					bone mineralization (GO:0030282)|regulation of bone mineralization (GO:0030500)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGGGGCCCGGGTGTCCTCGCG	0.687																																						dbGAP											0													21.0	21.0	21.0					11																	299462		2154	4258	6412	-	-	-	SO:0001583	missense	0			AA463818, CR747200, DY654432	CCDS31323.1	11p15.5	2010-05-12			ENSG00000206013	ENSG00000206013			16644	protein-coding gene	gene with protein product		614757				11106657, 12659663, 18442316	Standard	NM_001025295		Approved	fragilis4, Hrmp1, BRIL	uc001low.2	A6NNB3	OTTHUMG00000165355	ENST00000382614.2:c.29C>T	11.37:g.299462G>A	ENSP00000372059:p.Thr10Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Interferon-induced_TM_protein	p.T10I	ENST00000382614.2	37	c.29	CCDS31323.1	11	.	.	.	.	.	.	.	.	.	.	G	2.798	-0.249698	0.05867	.	.	ENSG00000206013	ENST00000382614	D	0.82984	-1.67	4.23	0.83	0.18854	.	0.357838	0.25869	N	0.027772	T	0.64405	0.2595	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44590	-0.9318	10	0.27785	T	0.31	-18.8866	2.7605	0.05306	0.1011:0.134:0.4498:0.315	.	10	A6NNB3	IFM5_HUMAN	I	10	ENSP00000372059:T10I	ENSP00000372059:T10I	T	-	2	0	IFITM5	289462	0.999000	0.42202	0.969000	0.41365	0.074000	0.17049	1.316000	0.33620	0.755000	0.32990	0.561000	0.74099	ACC	IFITM5	-	NULL	ENSG00000206013		0.687	IFITM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFITM5	HGNC	protein_coding	OTTHUMT00000383588.1	33	0.00	0	G	NM_001025295		299462	299462	-1	no_errors	ENST00000382614	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.202	A
IFT122	55764	genome.wustl.edu	37	3	129234420	129234420	+	Silent	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:129234420C>T	ENST00000348417.2	+	26	3320	c.3243C>T	c.(3241-3243)ttC>ttT	p.F1081F	IFT122_ENST00000347300.2_Silent_p.F1022F|IFT122_ENST00000296266.3_Silent_p.F1132F|IFT122_ENST00000431818.2_Silent_p.F931F|IFT122_ENST00000504021.1_Silent_p.F958F|IFT122_ENST00000349441.2_Silent_p.F971F|IFT122_ENST00000507564.1_Silent_p.F1074F|IFT122_ENST00000440957.2_Silent_p.F872F	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	1081					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						GCCAGCCCTTCATCTTCTCCG	0.597																																						dbGAP											0													42.0	31.0	35.0					3																	129234420		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.3243C>T	3.37:g.129234420C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F1132	ENST00000348417.2	37	c.3396	CCDS3061.1	3																																																																																			IFT122	-	NULL	ENSG00000163913		0.597	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT122	HGNC	protein_coding	OTTHUMT00000355852.1	62	0.00	0	C	NM_018262		129234420	129234420	+1	no_errors	ENST00000296266	ensembl	human	known	69_37n	silent	41	36.92	24	SNP	0.999	T
IGHV3-74	28408	genome.wustl.edu	37	14	107218848	107218848	+	RNA	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr14:107218848G>A	ENST00000424969.2	-	0	414									immunoglobulin heavy variable 3-74																		CCCCTTCCCTGGAGCTTGGCG	0.582																																						dbGAP											0													86.0	93.0	90.0					14																	107218848		1986	4145	6131	-	-	-			0			Z12353		14q32.33	2012-02-08			ENSG00000224650	ENSG00000224650		"""Immunoglobulins / IGH locus"""	5624	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151860		14.37:g.107218848G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P60L	ENST00000424969.2	37	c.179		14																																																																																			IGHV3-74	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000224650		0.582	IGHV3-74-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-74	HGNC	IG_V_gene	OTTHUMT00000324205.1	70	0.00	0	G	NG_001019		107218848	107218848	-1	no_stop_codon	ENST00000424969	ensembl	human	known	69_37n	missense	66	25.84	23	SNP	0.962	A
IGLV5-45	28781	genome.wustl.edu	37	22	22730849	22730849	+	RNA	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr22:22730849G>A	ENST00000390296.2	+	0	372									immunoglobulin lambda variable 5-45																		GACTATTACTGTATGATTTGG	0.512																																						dbGAP											0													133.0	128.0	130.0					22																	22730849		1925	4150	6075	-	-	-			0			Z73670		22q11.2	2012-02-08			ENSG00000211650	ENSG00000211650		"""Immunoglobulins / IGL locus"""	5924	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151054		22.37:g.22730849G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.C115Y	ENST00000390296.2	37	c.344		22																																																																																			IGLV5-45	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211650		0.512	IGLV5-45-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV5-45	HGNC	IG_V_gene	OTTHUMT00000321114.2	24	0.00	0	G	NG_000002		22730849	22730849	+1	no_stop_codon	ENST00000390296	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.997	A
IL32	9235	genome.wustl.edu	37	16	3131812	3131812	+	lincRNA	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:3131812T>C	ENST00000571404.1	-	0	210																											CACGGGGTTCTGGCCTGGGTG	0.592																																						dbGAP											0																																										-	-	-			0																															16.37:g.3131812T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L173P	ENST00000571404.1	37	c.518		16	.	.	.	.	.	.	.	.	.	.	T	7.239	0.600845	0.13939	.	.	ENSG00000008517	ENST00000525377	T	0.60171	0.21	2.3	-0.651	0.11454	.	.	.	.	.	T	0.47673	0.1458	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47995	-0.9073	6	0.87932	D	0	.	2.3031	0.04167	0.2421:0.1628:0.0:0.5951	.	.	.	.	P	173	ENSP00000433866:L173P	ENSP00000433866:L173P	L	+	2	0	IL32	3071813	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.019000	0.13444	-0.311000	0.08754	-1.134000	0.01955	CTG	IL32	-	NULL	ENSG00000008517		0.592	RP11-473M20.9-002	KNOWN	basic	lincRNA	IL32	HGNC	lincRNA	OTTHUMT00000437122.1	34	0.00	0	T			3131812	3131812	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000525377	ensembl	human	putative	69_37n	missense	45	23.73	14	SNP	0.002	C
KBTBD7	84078	genome.wustl.edu	37	13	41767027	41767027	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr13:41767027C>A	ENST00000379483.3	-	1	1675	c.1367G>T	c.(1366-1368)tGc>tTc	p.C456F		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	456										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		AACACTGTAGCATTCCACTTC	0.463																																						dbGAP											0													115.0	104.0	108.0					13																	41767027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.1367G>T	13.37:g.41767027C>A	ENSP00000368797:p.Cys456Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.C456F	ENST00000379483.3	37	c.1367	CCDS9377.1	13	.	.	.	.	.	.	.	.	.	.	C	14.72	2.618836	0.46736	.	.	ENSG00000120696	ENST00000379483;ENST00000501885	T	0.78924	-1.22	5.5	5.5	0.81552	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.86543	0.5958	M	0.78456	2.415	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.82920	-0.0218	10	0.10636	T	0.68	.	16.881	0.86063	0.0:1.0:0.0:0.0	.	456	Q8WVZ9	KBTB7_HUMAN	F	456;358	ENSP00000368797:C456F	ENSP00000368797:C456F	C	-	2	0	KBTBD7	40665027	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	5.086000	0.64474	2.571000	0.86741	0.650000	0.86243	TGC	KBTBD7	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000120696		0.463	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD7	HGNC	protein_coding	OTTHUMT00000044660.1	37	0.00	0	C	NM_032138		41767027	41767027	-1	no_errors	ENST00000379483	ensembl	human	known	69_37n	missense	26	32.50	13	SNP	1.000	A
KCNU1	157855	genome.wustl.edu	37	8	36793260	36793260	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr8:36793260C>A	ENST00000399881.3	+	27	3309	c.3272C>A	c.(3271-3273)tCt>tAt	p.S1091Y		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	1091					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CCAGTCTATTCTTACCAGCCG	0.383																																						dbGAP											0													145.0	143.0	144.0					8																	36793260		1917	4137	6054	-	-	-	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.3272C>A	8.37:g.36793260C>A	ENSP00000382770:p.Ser1091Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2,prints_K_chnl_Ca-activ_BK_asu	p.S1091Y	ENST00000399881.3	37	c.3272	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	C	7.664	0.685623	0.14973	.	.	ENSG00000215262	ENST00000399881	T	0.34859	1.34	3.72	-2.98	0.05513	.	.	.	.	.	T	0.13200	0.0320	N	0.22421	0.69	0.09310	N	1	B	0.32653	0.379	B	0.27076	0.076	T	0.28138	-1.0053	9	0.02654	T	1	0.2655	1.0217	0.01519	0.1446:0.3042:0.2838:0.2675	.	1091	A8MYU2	KCNU1_HUMAN	Y	1091	ENSP00000382770:S1091Y	ENSP00000382770:S1091Y	S	+	2	0	KCNU1	36912418	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.239000	0.02916	-0.903000	0.03881	-0.175000	0.13238	TCT	KCNU1	-	NULL	ENSG00000215262		0.383	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	43	0.00	0	C	NM_001031836		36793260	36793260	+1	no_errors	ENST00000399881	ensembl	human	known	69_37n	missense	19	47.37	18	SNP	0.000	A
KIAA1210	57481	genome.wustl.edu	37	X	118221386	118221386	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chrX:118221386T>G	ENST00000402510.2	-	11	3806	c.3807A>C	c.(3805-3807)gaA>gaC	p.E1269D		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1269										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCTGTGGGTCTTCAGGCCTCC	0.488																																						dbGAP											0													32.0	31.0	31.0					X																	118221386		1844	4078	5922	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3807A>C	X.37:g.118221386T>G	ENSP00000384670:p.Glu1269Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.E1269D	ENST00000402510.2	37	c.3807	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	T	13.75	2.330011	0.41297	.	.	ENSG00000250423	ENST00000402510	T	0.15139	2.45	4.41	2.02	0.26589	.	.	.	.	.	T	0.21186	0.0510	L	0.29908	0.895	0.09310	N	1	D	0.71674	0.998	D	0.66979	0.948	T	0.15809	-1.0424	9	0.18710	T	0.47	.	5.3133	0.15843	0.0:0.233:0.0:0.767	.	1269	Q9ULL0	K1210_HUMAN	D	1269	ENSP00000384670:E1269D	ENSP00000384670:E1269D	E	-	3	2	RP13-347D8.6	118105414	0.247000	0.23920	0.002000	0.10522	0.049000	0.14656	1.649000	0.37281	0.312000	0.23038	-0.314000	0.08810	GAA	KIAA1210	-	NULL	ENSG00000250423		0.488	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	39	0.00	0	T	NM_020721		118221386	118221386	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	31	45.61	26	SNP	0.002	G
KIF15	56992	genome.wustl.edu	37	3	44826382	44826382	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:44826382T>A	ENST00000326047.4	+	6	556	c.407T>A	c.(406-408)aTc>aAc	p.I136N		NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	136	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		AGAGGAGTAATCCCACGAAGT	0.279																																						dbGAP											0													42.0	44.0	43.0					3																	44826382		2203	4294	6497	-	-	-	SO:0001583	missense	0			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.407T>A	3.37:g.44826382T>A	ENSP00000324020:p.Ile136Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I136N	ENST00000326047.4	37	c.407	CCDS33744.1	3	.	.	.	.	.	.	.	.	.	.	T	21.8	4.198941	0.79015	.	.	ENSG00000163808	ENST00000326047;ENST00000396031	T	0.78707	-1.2	5.65	4.5	0.54988	Kinesin, motor domain (4);	0.125962	0.35262	N	0.003322	D	0.87669	0.6235	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88252	0.2917	10	0.87932	D	0	.	11.3001	0.49300	0.0:0.0711:0.0:0.9289	.	136	Q9NS87	KIF15_HUMAN	N	136;135	ENSP00000324020:I136N	ENSP00000324020:I136N	I	+	2	0	KIF15	44801386	1.000000	0.71417	0.951000	0.38953	0.994000	0.84299	7.884000	0.87274	0.975000	0.38392	0.459000	0.35465	ATC	KIF15	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000163808		0.279	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	HGNC	protein_coding	OTTHUMT00000343831.2	34	0.00	0	T			44826382	44826382	+1	no_errors	ENST00000326047	ensembl	human	known	69_37n	missense	52	23.53	16	SNP	0.998	A
KIN	22944	genome.wustl.edu	37	10	7816805	7816805	+	Silent	SNP	A	A	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr10:7816805A>C	ENST00000379562.4	-	7	704	c.657T>G	c.(655-657)tcT>tcG	p.S219S	KIN_ENST00000535925.1_Silent_p.S219S|KIN_ENST00000543003.1_Silent_p.S113S	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein											endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						TTGACTTGGAAGATGTTGCTC	0.308																																						dbGAP											0													144.0	147.0	146.0					10																	7816805		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.657T>G	10.37:g.7816805A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DNA/RNA-bd_Kin17_cons_domain	p.S219	ENST00000379562.4	37	c.657	CCDS7080.1	10																																																																																			KIN	-	NULL	ENSG00000151657		0.308	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIN	HGNC	protein_coding	OTTHUMT00000046683.2	25	0.00	0	A	NM_012311		7816805	7816805	-1	no_errors	ENST00000379562	ensembl	human	known	69_37n	silent	20	23.08	6	SNP	0.102	C
KMO	8564	genome.wustl.edu	37	1	241731937	241731937	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:241731937G>A	ENST00000366559.4	+	10	1258	c.947G>A	c.(946-948)gGa>gAa	p.G316E	KMO_ENST00000366558.3_Missense_Mutation_p.G316E|KMO_ENST00000366557.4_Missense_Mutation_p.G316E	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TTTGGGCAAGGAATGAATGCG	0.408																																						dbGAP											0													177.0	152.0	161.0					1																	241731937		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.947G>A	1.37:g.241731937G>A	ENSP00000355517:p.Gly316Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_mOase_FAD-bd,prints_Rng_hydrolase-like	p.G316E	ENST00000366559.4	37	c.947	CCDS1618.1	1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.868396	0.91587	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	D;D;D	0.91464	-2.85;-2.85;-2.85	5.8	5.8	0.92144	Monooxygenase, FAD-binding (1);Aromatic-ring hydroxylase-like (1);	0.000000	0.85682	D	0.000000	D	0.97256	0.9103	H	0.97291	3.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98302	1.0519	10	0.87932	D	0	.	17.5448	0.87858	0.0:0.0:1.0:0.0	.	316;316;316	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	E	316	ENSP00000355517:G316E;ENSP00000355516:G316E;ENSP00000355515:G316E	ENSP00000355515:G316E	G	+	2	0	KMO	239798560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.668000	0.98619	2.740000	0.93945	0.650000	0.86243	GGA	KMO	-	pfam_mOase_FAD-bd,prints_Rng_hydrolase-like	ENSG00000117009		0.408	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMO	HGNC	protein_coding	OTTHUMT00000095612.1	59	0.00	0	G	NM_003679		241731937	241731937	+1	no_errors	ENST00000366559	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	1.000	A
LINC00243	401247	genome.wustl.edu	37	6	30782254	30782254	+	RNA	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr6:30782254G>T	ENST00000399196.1	-	0	440									long intergenic non-protein coding RNA 243																		CGGCTTGATGGGGCTTTTAGG	0.453																																						dbGAP											0																																										-	-	-			0			AK098012		6p21.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000236006	ENSG00000214894		"""Long non-coding RNAs"""	30956	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 214 (putative)"", ""non-protein coding RNA 243"""	C6orf214, NCRNA00243			Standard	XR_159458		Approved	bQB230F21.2, FLJ40693, bQB10J12.2			OTTHUMG00000031539		6.37:g.30782254G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000399196.1	37	NULL		6																																																																																			LINC00243	-	-	ENSG00000214894		0.453	LINC00243-001	KNOWN	basic|exp_conf	processed_transcript	LINC00243	HGNC	processed_transcript	OTTHUMT00000076501.3	55	0.00	0	G			30782254	30782254	-1	no_errors	ENST00000399196	ensembl	human	known	69_37n	rna	40	14.89	7	SNP	0.016	T
LAMA2	3908	genome.wustl.edu	37	6	129794470	129794470	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr6:129794470G>T	ENST00000421865.2	+	52	7461	c.7412G>T	c.(7411-7413)gGt>gTt	p.G2471V		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2471	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATATATTTTGGTGGCCTGCCA	0.343																																						dbGAP											0													71.0	70.0	70.0					6																	129794470		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7412G>T	6.37:g.129794470G>T	ENSP00000400365:p.Gly2471Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G2471V	ENST00000421865.2	37	c.7412	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443028	0.83993	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	D	0.98550	-4.99	5.91	5.91	0.95273	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.99130	0.9700	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99267	1.0892	9	.	.	.	.	20.2983	0.98569	0.0:0.0:1.0:0.0	.	2472;2471	A6NF00;P24043	.;LAMA2_HUMAN	V	2471;2470;2471;489	ENSP00000400365:G2471V	.	G	+	2	0	LAMA2	129836163	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.451000	0.90343	2.802000	0.96397	0.655000	0.94253	GGT	LAMA2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000196569		0.343	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	38	0.00	0	G			129794470	129794470	+1	no_errors	ENST00000421865	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170031784	170031784	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr2:170031784C>T	ENST00000263816.3	-	55	10972	c.10687G>A	c.(10687-10689)Ggc>Agc	p.G3563S	LRP2_ENST00000461418.1_5'Flank	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3563	LDL-receptor class A 27. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTGCAGTTGCCGTCACTGCAC	0.527																																						dbGAP											0													81.0	80.0	80.0					2																	170031784		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10687G>A	2.37:g.170031784C>T	ENSP00000263816:p.Gly3563Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.G3563S	ENST00000263816.3	37	c.10687	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352685	0.61293	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.92595	-3.07	5.71	3.9	0.45041	.	0.050715	0.85682	D	0.000000	D	0.95503	0.8539	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93670	0.6989	10	0.25751	T	0.34	.	11.4275	0.50020	0.0:0.8052:0.1269:0.0679	.	3563	P98164	LRP2_HUMAN	S	3563;258	ENSP00000263816:G3563S	ENSP00000263816:G3563S	G	-	1	0	LRP2	169740030	1.000000	0.71417	0.861000	0.33841	0.116000	0.19942	6.089000	0.71384	0.746000	0.32786	-0.300000	0.09419	GGC	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.527	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	27	0.00	0	C	NM_004525		170031784	170031784	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	T
MASP1	5648	genome.wustl.edu	37	3	186944266	186944266	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:186944266G>A	ENST00000337774.5	-	12	1873	c.1484C>T	c.(1483-1485)tCa>tTa	p.S495L		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	495	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CGGATCGAGTGACTGGTGGAG	0.577																																						dbGAP											0													129.0	106.0	114.0					3																	186944266		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1484C>T	3.37:g.186944266G>A	ENSP00000336792:p.Ser495Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S495L	ENST00000337774.5	37	c.1484	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571765	0.45798	.	.	ENSG00000127241	ENST00000337774	D	0.92495	-3.05	5.86	-2.4	0.06583	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.81861	0.4912	N	0.20445	0.575	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.67684	-0.5607	9	0.38643	T	0.18	.	4.8738	0.13646	0.2151:0.0:0.3499:0.435	.	495	P48740	MASP1_HUMAN	L	495	ENSP00000336792:S495L	ENSP00000336792:S495L	S	-	2	0	MASP1	188426960	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.950000	0.03889	-0.113000	0.11958	0.563000	0.77884	TCA	MASP1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000127241		0.577	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	40	0.00	0	G	NM_001879		186944266	186944266	-1	no_errors	ENST00000337774	ensembl	human	known	69_37n	missense	58	10.77	7	SNP	0.000	A
MCCC2	64087	genome.wustl.edu	37	5	70931263	70931263	+	Intron	SNP	G	G	A	rs277985	byFrequency	TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:70931263G>A	ENST00000340941.6	+	10	1128				MCCC2_ENST00000509358.2_Intron|MCCC2_ENST00000510895.2_3'UTR|MCCC2_ENST00000323375.8_Intron	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)						biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	AGTAAATACTGAAAGAGGGGA	0.408													A|||	2656	0.530351	0.5378	0.5922	5008	,	,		20858	0.6478		0.4145	False		,,,				2504	0.4744					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.999+190G>A	5.37:g.70931263G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIY9|Q96C27|Q9Y4L7	RNA	SNP	-	NULL	ENST00000340941.6	37	NULL	CCDS34184.1	5																																																																																			MCCC2	-	-	ENSG00000131844		0.408	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC2	HGNC	protein_coding	OTTHUMT00000369243.4	13	0.00	0	G			70931263	70931263	+1	no_errors	ENST00000510895	ensembl	human	known	69_37n	rna	10	52.38	11	SNP	0.000	A
MED16	10025	genome.wustl.edu	37	19	875298	875298	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:875298C>A	ENST00000589119.1	-	9	1716	c.1717G>T	c.(1717-1719)Gac>Tac	p.D573Y	MED16_ENST00000269814.4_Missense_Mutation_p.D573Y|MED16_ENST00000312090.6_Missense_Mutation_p.D573Y|MED16_ENST00000325464.1_Missense_Mutation_p.D573Y|MED16_ENST00000606828.1_5'UTR|MED16_ENST00000395808.3_Missense_Mutation_p.D573Y			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	573					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCTCTTGTCAGGCGTGTTG	0.617																																						dbGAP											0													66.0	71.0	69.0					19																	875298		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1717G>T	19.37:g.875298C>A	ENSP00000464810:p.Asp573Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	pfam_Mediator_Med16,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D573Y	ENST00000589119.1	37	c.1717	CCDS12047.1	19	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770463	0.69992	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000541440;ENST00000424039	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.67924	0.2945	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.995;0.998;0.998;0.998;0.998;0.999	T	0.72918	-0.4146	10	0.72032	D	0.01	-22.5003	16.1784	0.81884	0.0:1.0:0.0:0.0	.	161;573;573;573;573;573	B9TX03;Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;.;MED16_HUMAN	Y	573;573;573;573;504;429;334;332;291;573	ENSP00000325612:D573Y;ENSP00000308528:D573Y;ENSP00000379153:D573Y;ENSP00000269814:D573Y	ENSP00000269814:D573Y	D	-	1	0	MED16	826298	1.000000	0.71417	0.946000	0.38457	0.467000	0.32768	7.044000	0.76578	2.047000	0.60756	0.561000	0.74099	GAC	MED16	-	pfam_Mediator_Med16	ENSG00000175221		0.617	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MED16	HGNC	protein_coding	OTTHUMT00000457902.3	34	0.00	0	C	NM_005481		875298	875298	-1	no_errors	ENST00000325464	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.999	A
MEIS2	4212	genome.wustl.edu	37	15	37183628	37183628	+	3'UTR	SNP	A	A	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:37183628A>T	ENST00000561208.1	-	0	2598				MEIS2_ENST00000219869.9_3'UTR|MEIS2_ENST00000557796.2_3'UTR|MEIS2_ENST00000382766.2_3'UTR|MEIS2_ENST00000397624.3_3'UTR|MEIS2_ENST00000559085.1_3'UTR|MEIS2_ENST00000340545.5_3'UTR|MEIS2_ENST00000338564.5_3'UTR|MEIS2_ENST00000444725.1_3'UTR			O14770	MEIS2_HUMAN	Meis homeobox 2						eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		GTGTTGAGGAAAGCTGCCCAA	0.393																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.*746T>A	15.37:g.37183628A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	RNA	SNP	-	NULL	ENST00000561208.1	37	NULL	CCDS10044.1	15																																																																																			MEIS2	-	-	ENSG00000134138		0.393	MEIS2-001	KNOWN	basic|CCDS	protein_coding	MEIS2	HGNC	protein_coding	OTTHUMT00000252003.2	8	0.00	0	A	NM_170677		37183628	37183628	-1	no_errors	ENST00000560702	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	1.000	T
MFSD7	84179	genome.wustl.edu	37	4	680419	680419	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr4:680419C>T	ENST00000404286.2	-	2	211	c.196G>A	c.(196-198)Gag>Aag	p.E66K	MFSD7_ENST00000322224.4_Missense_Mutation_p.E66K|MFSD7_ENST00000515118.1_Missense_Mutation_p.E66K|MFSD7_ENST00000503156.1_Missense_Mutation_p.E2K|MFSD7_ENST00000513740.1_5'UTR|MFSD7_ENST00000347950.5_Intron	NM_032219.2	NP_115595.2	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing 7	66					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				cervix(1)|kidney(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	11						TTGATCTGCTCCATGGACAGG	0.632																																						dbGAP											0													135.0	114.0	122.0					4																	680419		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025922	CCDS3338.1, CCDS75086.1	4p16.3	2013-05-22			ENSG00000169026	ENSG00000169026		"""Solute carriers"""	26177	protein-coding gene	gene with protein product						12975309	Standard	XM_005272295		Approved	FLJ22269, LP2561	uc003gax.3	Q6UXD7	OTTHUMG00000119001	ENST00000404286.2:c.196G>A	4.37:g.680419C>T	ENSP00000384616:p.Glu66Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7J5|Q6XYD4|Q8N6H1|Q9H6H6	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.E66K	ENST00000404286.2	37	c.196		4	.	.	.	.	.	.	.	.	.	.	C	2.217	-0.379223	0.05000	.	.	ENSG00000169026	ENST00000322224;ENST00000404286;ENST00000515118;ENST00000503156;ENST00000512249;ENST00000507165	T;T;D;T;T;T	0.94758	0.37;0.37;-3.51;0.28;0.28;0.28	4.62	2.67	0.31697	Major facilitator superfamily domain, general substrate transporter (1);	0.675264	0.14454	N	0.318586	D	0.87042	0.6079	L	0.31664	0.95	0.09310	N	1	B;P;B;B	0.38504	0.164;0.634;0.003;0.005	B;B;B;B	0.33620	0.064;0.167;0.005;0.004	T	0.78383	-0.2225	9	.	.	.	-8.8468	4.8721	0.13639	0.0:0.6549:0.223:0.1221	.	2;66;66;66	D6RIZ6;D6R9R0;Q6UXD7;Q6UXD7-2	.;.;MFSD7_HUMAN;.	K	66;66;66;2;66;2	ENSP00000320234:E66K;ENSP00000384616:E66K;ENSP00000423204:E66K;ENSP00000425753:E2K;ENSP00000425038:E66K;ENSP00000424556:E2K	.	E	-	1	0	MFSD7	670419	0.001000	0.12720	0.045000	0.18777	0.014000	0.08584	1.171000	0.31896	1.126000	0.42016	0.462000	0.41574	GAG	MFSD7	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000169026		0.632	MFSD7-004	KNOWN	basic|appris_candidate_longest	protein_coding	MFSD7	HGNC	protein_coding	OTTHUMT00000358585.1	26	0.00	0	C	NM_032219		680419	680419	-1	no_errors	ENST00000404286	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.099	T
KMT2C	58508	genome.wustl.edu	37	7	151845841	151845841	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:151845841T>A	ENST00000262189.6	-	52	13389	c.13171A>T	c.(13171-13173)Aaa>Taa	p.K4391*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.K4448*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4391					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GGATCAGGTTTAAGGGAAGTG	0.413																																						dbGAP											0													82.0	76.0	78.0					7																	151845841		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13171A>T	7.37:g.151845841T>A	ENSP00000262189:p.Lys4391*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.K4448*	ENST00000262189.6	37	c.13342	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	55|55	24.318097|24.318097	0.99960|0.99960	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	.|.	.|.	.|.	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.000000|.	0.45606|.	U|.	0.000348|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.06891|.	T|.	0.86|.	.|.	15.4242|15.4242	0.75038|0.75038	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	X|L	4391;4448;1008|1951	.|.	ENSP00000262189:K4391X|.	K|X	-|-	1|2	0|2	MLL3|MLL3	151476774|151476774	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.993000|0.993000	0.82548|0.82548	4.246000|4.246000	0.58740|0.58740	2.103000|2.103000	0.63969|0.63969	0.455000|0.455000	0.32223|0.32223	AAA|TAA	MLL3	-	NULL	ENSG00000055609		0.413	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	17	0.00	0	T			151845841	151845841	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	nonsense	11	38.89	7	SNP	0.994	A
KMT2C	58508	genome.wustl.edu	37	7	152132815	152132815	+	Silent	SNP	G	G	C	rs548005028		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:152132815G>C	ENST00000262189.6	-	1	275	c.57C>G	c.(55-57)ccC>ccG	p.P19P	FABP5P3_ENST00000477993.1_RNA|KMT2C_ENST00000355193.2_Silent_p.P19P	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	19					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CAGGCTCCTCGGGGGGTGGTG	0.677													g|||	1	0.000199681	0.0	0.0	5008	,	,		3555	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													3.0	4.0	4.0					7																	152132815		1933	3917	5850	-	-	-	SO:0001819	synonymous_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.57C>G	7.37:g.152132815G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.P19	ENST00000262189.6	37	c.57	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.677	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	22	0.00	0	G			152132815	152132815	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	silent	16	33.33	8	SNP	1.000	C
MORC1	27136	genome.wustl.edu	37	3	108705760	108705760	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:108705760G>A	ENST00000483760.1	-	21	2204	c.2161C>T	c.(2161-2163)Caa>Taa	p.Q721*	MORC1_ENST00000232603.5_Nonsense_Mutation_p.Q742*					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TTTTTTTCTTGTTTCAATGAA	0.264																																						dbGAP											0													36.0	35.0	35.0					3																	108705760		2189	4281	6470	-	-	-	SO:0001587	stop_gained	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2161C>T	3.37:g.108705760G>A	ENSP00000417282:p.Gln721*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Znf_CW,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.Q742*	ENST00000483760.1	37	c.2224		3	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919875	0.73098	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	.	.	.	3.93	2.04	0.26737	.	0.695756	0.12582	N	0.456326	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-3.4338	6.6886	0.23158	0.0:0.1986:0.596:0.2054	.	.	.	.	X	742;721	.	ENSP00000232603:Q742X	Q	-	1	0	MORC1	110188450	1.000000	0.71417	0.991000	0.47740	0.258000	0.26162	0.352000	0.20113	0.578000	0.29487	0.484000	0.47621	CAA	MORC1	-	NULL	ENSG00000114487		0.264	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	101	0.00	0	G			108705760	108705760	-1	no_errors	ENST00000232603	ensembl	human	known	69_37n	nonsense	82	21.15	22	SNP	0.994	A
MRPS27	23107	genome.wustl.edu	37	5	71616174	71616174	+	5'Flank	SNP	A	A	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:71616174A>C	ENST00000261413.5	-	0	0				MRPS27_ENST00000522095.1_5'Flank|MRPS27_ENST00000457646.4_5'Flank|MRPS27_ENST00000513900.1_5'Flank|PTCD2_ENST00000380639.5_5'Flank|PTCD2_ENST00000543322.1_5'Flank|PTCD2_ENST00000503868.1_5'Flank|PTCD2_ENST00000536805.1_5'Flank|MRPS27_ENST00000515404.1_5'Flank	NM_015084.2	NP_055899.2	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27							mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		GACAGGACCGACGCTCCGCCT	0.617																																						dbGAP											0													46.0	51.0	49.0					5																	71616174		2203	4299	6502	-	-	-	SO:0001631	upstream_gene_variant	0			D87453	CCDS4013.1, CCDS68890.1, CCDS75257.1	5q13.2	2012-09-13			ENSG00000113048	ENSG00000113048		"""Mitochondrial ribosomal proteins / small subunits"""	14512	protein-coding gene	gene with protein product		611989					Standard	NM_015084		Approved	KIAA0264	uc003kbz.4	Q92552	OTTHUMG00000100951		5.37:g.71616174A>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRT2|Q6P1S1	RNA	SNP	-	NULL	ENST00000261413.5	37	NULL	CCDS4013.1	5																																																																																			MRPS27	-	-	ENSG00000113048		0.617	MRPS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS27	HGNC	protein_coding	OTTHUMT00000218560.2	41	0.00	0	A	NM_015084		71616174	71616174	-1	no_errors	ENST00000506957	ensembl	human	known	69_37n	rna	47	12.96	7	SNP	0.000	C
MSH5	4439	genome.wustl.edu	37	6	31713097	31713097	+	Splice_Site	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr6:31713097G>T	ENST00000375755.3	+	9	1052		c.e9+1		MSH5_ENST00000375750.3_Splice_Site|MSH5_ENST00000375742.3_Splice_Site|MSH5_ENST00000375740.3_Splice_Site|MSH5_ENST00000375703.3_Splice_Site|MSH5_ENST00000534153.4_Splice_Site|MSH5-SAPCD1_ENST00000493662.2_Splice_Site|MSH5_ENST00000482280.1_Intron|MSH5_ENST00000431848.2_Intron	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5						ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						AGCCTCTTTGGTAGGTGTGCC	0.502								Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP											0													85.0	81.0	83.0					6																	31713097		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.766+1G>T	6.37:g.31713097G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Splice_Site	SNP	-	e8+1	ENST00000375755.3	37	c.817+1	CCDS4720.1	6	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350192	0.61183	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000450148	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5405	0.84383	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MSH5	31821076	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	6.369000	0.73109	2.496000	0.84212	0.585000	0.79938	.	MSH5	-	-	ENSG00000204410		0.502	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MSH5	HGNC	protein_coding	OTTHUMT00000076243.4	34	0.00	0	G		Intron	31713097	31713097	+1	no_errors	ENST00000375742	ensembl	human	known	69_37n	splice_site	24	27.27	9	SNP	1.000	T
MST1R	4486	genome.wustl.edu	37	3	49924860	49924860	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:49924860C>A	ENST00000296474.3	-	20	4110	c.4083G>T	c.(4081-4083)atG>atT	p.M1361I	MST1R_ENST00000344206.4_Missense_Mutation_p.M1312I	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1361					cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GGCCCAAGTTCATGTAGGTTG	0.592																																						dbGAP											0													124.0	112.0	116.0					3																	49924860		2203	4300	6503	-	-	-	SO:0001583	missense	0			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.4083G>T	3.37:g.49924860C>A	ENSP00000296474:p.Met1361Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semaphorin/CD100_Ag,pfscan_Prot_kinase_cat_dom	p.M1361I	ENST00000296474.3	37	c.4083	CCDS2807.1	3	.	.	.	.	.	.	.	.	.	.	C	10.11	1.259465	0.23051	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.72615	-0.67;-0.67	5.91	1.88	0.25563	Protein kinase-like domain (1);	0.053328	0.85682	D	0.000000	T	0.51534	0.1680	N	0.22421	0.69	0.28027	N	0.934273	B	0.02656	0.0	B	0.06405	0.002	T	0.46062	-0.9218	10	0.56958	D	0.05	-16.6308	6.4973	0.22150	0.1178:0.4855:0.3267:0.07	.	1361	Q04912	RON_HUMAN	I	1361;1312	ENSP00000296474:M1361I;ENSP00000341325:M1312I	ENSP00000296474:M1361I	M	-	3	0	MST1R	49899864	1.000000	0.71417	0.996000	0.52242	0.010000	0.07245	0.804000	0.27098	0.389000	0.25086	-0.169000	0.13324	ATG	MST1R	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,superfamily_Kinase-like_dom	ENSG00000164078		0.592	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	HGNC	protein_coding	OTTHUMT00000345403.1	91	0.00	0	C			49924860	49924860	-1	no_errors	ENST00000296474	ensembl	human	known	69_37n	missense	82	28.70	33	SNP	1.000	A
EIF3I	8668	genome.wustl.edu	37	1	32700054	32700054	+	IGR	SNP	G	G	A	rs536610076	byFrequency	TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:32700054G>A	ENST00000373586.1	+	0	1458				MTMR9LP_ENST00000441044.1_RNA	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I											breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				AGGCATAGGCGTGCCCAAACA	0.587													G|||	2	0.000399361	0.0	0.0	5008	,	,		18243	0.0		0.0	False		,,,				2504	0.002				Colon(102;1138 2140 2180 17876)	dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364		1.37:g.32700054G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000373586.1	37	NULL	CCDS357.1	1																																																																																			MTMR9LP	-	-	ENSG00000220785		0.587	EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR9LP	HGNC	protein_coding	OTTHUMT00000019282.2	28	0.00	0	G	NM_003757		32700054	32700054	-1	no_errors	ENST00000441044	ensembl	human	known	69_37n	rna	27	30.77	12	SNP	0.899	A
MUC19	283463	genome.wustl.edu	37	12	40820353	40820353	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:40820353C>T	ENST00000454784.4	+	11	1064	c.331C>T	c.(331-333)Cgc>Tgc	p.R111C	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	111					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						AGAACTGTCCCGCCTCTGTGC	0.453																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.331C>T	12.37:g.40820353C>T	ENSP00000476404:p.Arg111Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_VWC_out,smart_Unchr_dom_Cys-rich	p.R340C	ENST00000454784.4	37	c.1018		12	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244546	0.79912	.	.	ENSG00000205592	ENST00000425730	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	T	0.79493	0.4455	M	0.87547	2.89	0.80722	D	1	.	.	.	.	.	.	T	0.82577	-0.0388	6	0.66056	D	0.02	.	13.8998	0.63797	0.153:0.847:0.0:0.0	.	.	.	.	C	340	.	ENSP00000395253:R340C	R	+	1	0	MUC19	39106620	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	1.679000	0.37597	2.601000	0.87937	0.650000	0.86243	CGC	MUC19	-	NULL	ENSG00000205592		0.453	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	46	0.00	0	C	XM_003403524		40820353	40820353	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425730	ensembl	human	novel	69_37n	missense	80	11.11	10	SNP	1.000	T
MYH10	4628	genome.wustl.edu	37	17	8383634	8383634	+	Silent	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:8383634C>T	ENST00000269243.4	-	38	5436	c.5298G>A	c.(5296-5298)gtG>gtA	p.V1766V	MYH10_ENST00000379980.4_Silent_p.V1782V|MYH10_ENST00000396239.1_Silent_p.V1787V|MYH10_ENST00000360416.3_Silent_p.V1797V|NDEL1_ENST00000299734.7_Intron	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1766					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TCAGTGTGTCCACCTAGAGAG	0.617																																						dbGAP											0													88.0	81.0	83.0					17																	8383634		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5298G>A	17.37:g.8383634C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1787	ENST00000269243.4	37	c.5361	CCDS11144.1	17																																																																																			MYH10	-	pfam_Myosin_tail	ENSG00000133026		0.617	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	46	0.00	0	C			8383634	8383634	-1	no_errors	ENST00000396239	ensembl	human	known	69_37n	silent	31	24.39	10	SNP	1.000	T
MYO16	23026	genome.wustl.edu	37	13	109445911	109445911	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr13:109445911A>G	ENST00000357550.2	+	5	639	c.598A>G	c.(598-600)Agt>Ggt	p.S200G	MYO16_ENST00000251041.5_Missense_Mutation_p.S200G|MYO16_ENST00000356711.2_Missense_Mutation_p.S200G	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GAGACCAATGAGTATGTTAAC	0.423																																						dbGAP											0													137.0	127.0	131.0					13																	109445911		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.598A>G	13.37:g.109445911A>G	ENSP00000350160:p.Ser200Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S200G	ENST00000357550.2	37	c.598	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	A	15.76	2.927604	0.52759	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	T;T;T	0.53423	0.62;0.62;0.62	5.76	5.76	0.90799	Ankyrin repeat-containing domain (3);	0.150973	0.30210	U	0.010142	T	0.24774	0.0601	N	0.05124	-0.11	0.80722	D	1	B;P	0.39576	0.452;0.679	B;B	0.38156	0.228;0.266	T	0.10870	-1.0611	9	.	.	.	.	8.5494	0.33442	0.9146:0.0:0.0854:0.0	.	200;200	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	G	200;200;200;200;8	ENSP00000349145:S200G;ENSP00000350160:S200G;ENSP00000251041:S200G	.	S	+	1	0	MYO16	108243912	0.972000	0.33761	0.931000	0.37212	0.801000	0.45260	1.347000	0.33975	2.197000	0.70478	0.482000	0.46254	AGT	MYO16	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000041515		0.423	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	17	0.00	0	A	NM_015011		109445911	109445911	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	0.983	G
MYO5B	4645	genome.wustl.edu	37	18	47527678	47527678	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr18:47527678C>T	ENST00000285039.7	-	5	858	c.559G>A	c.(559-561)Gcc>Acc	p.A187T		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	187	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GTTTCACTGGCCGAGCCACCA	0.557																																						dbGAP											0													97.0	97.0	97.0					18																	47527678		1959	4138	6097	-	-	-	SO:0001583	missense	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.559G>A	18.37:g.47527678C>T	ENSP00000285039:p.Ala187Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A187T	ENST00000285039.7	37	c.559	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365890	0.61513	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.86865	-2.18	5.3	5.3	0.74995	Myosin head, motor domain (2);	0.059093	0.64402	D	0.000003	D	0.82618	0.5076	L	0.33485	1.01	0.80722	D	1	B;B	0.12630	0.006;0.001	B;B	0.18871	0.023;0.008	T	0.77935	-0.2401	10	0.45353	T	0.12	.	17.548	0.87867	0.0:1.0:0.0:0.0	.	186;187	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	T	187;186	ENSP00000285039:A187T	ENSP00000285039:A187T	A	-	1	0	MYO5B	45781676	0.984000	0.35163	1.000000	0.80357	0.744000	0.42396	2.648000	0.46647	2.457000	0.83068	0.655000	0.94253	GCC	MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000167306		0.557	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	73	0.00	0	C			47527678	47527678	-1	no_errors	ENST00000285039	ensembl	human	known	69_37n	missense	86	18.10	19	SNP	1.000	T
NCAPD2	9918	genome.wustl.edu	37	12	6630254	6630254	+	Missense_Mutation	SNP	T	T	A	rs538316667		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:6630254T>A	ENST00000315579.5	+	14	2491	c.1692T>A	c.(1690-1692)aaT>aaA	p.N564K	NCAPD2_ENST00000545962.1_Missense_Mutation_p.N519K	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	564	Interactions with SMC2 and SMC4.				mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						GGCTCTTGAATATCTTAGGAC	0.423																																						dbGAP											0													75.0	72.0	73.0					12																	6630254		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.1692T>A	12.37:g.6630254T>A	ENSP00000325017:p.Asn564Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUR4|Q8N6U3	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	p.N564K	ENST00000315579.5	37	c.1692	CCDS8548.1	12	.	.	.	.	.	.	.	.	.	.	T	11.57	1.678772	0.29783	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	T;T;T	0.28454	2.61;1.61;2.34	5.84	2.3	0.28687	Armadillo-type fold (1);	0.942102	0.09165	N	0.839648	T	0.19525	0.0469	N	0.22421	0.69	0.09310	N	1	B;B;B	0.32573	0.376;0.025;0.259	B;B;B	0.36845	0.234;0.021;0.034	T	0.19353	-1.0308	10	0.06236	T	0.91	-2.2922	8.5311	0.33335	0.0:0.4043:0.0:0.5957	.	519;525;564	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	K	564;436;519;436	ENSP00000325017:N564K;ENSP00000371895:N436K;ENSP00000444417:N519K	ENSP00000325017:N564K	N	+	3	2	NCAPD2	6500515	0.586000	0.26782	0.032000	0.17829	0.799000	0.45148	0.441000	0.21611	0.486000	0.27676	0.454000	0.30748	AAT	NCAPD2	-	superfamily_ARM-type_fold,pirsf_Condensin_cplx_su1	ENSG00000010292		0.423	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD2	HGNC	protein_coding	OTTHUMT00000399964.1	19	0.00	0	T	NM_014865		6630254	6630254	+1	no_errors	ENST00000315579	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.035	A
NCKAP1	10787	genome.wustl.edu	37	2	183817883	183817883	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr2:183817883T>C	ENST00000361354.4	-	21	2702	c.2330A>G	c.(2329-2331)gAc>gGc	p.D777G	NCKAP1_ENST00000360982.2_Missense_Mutation_p.D783G	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	777					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCCATGACTGTCTAAATGTTG	0.338																																						dbGAP											0													106.0	102.0	103.0					2																	183817883		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2330A>G	2.37:g.183817883T>C	ENSP00000355348:p.Asp777Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	pfam_Nck-associated_protein-1	p.D783G	ENST00000361354.4	37	c.2348	CCDS2287.1	2	.	.	.	.	.	.	.	.	.	.	T	29.5	5.010693	0.93346	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.39406	1.08;1.08	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.70193	0.3196	M	0.87758	2.905	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.981	T	0.75402	-0.3330	10	0.72032	D	0.01	-14.3261	16.8222	0.85835	0.0:0.0:0.0:1.0	.	777;783	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	G	777;783	ENSP00000355348:D777G;ENSP00000354251:D783G	ENSP00000354251:D783G	D	-	2	0	NCKAP1	183526128	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.997000	0.88414	2.371000	0.80710	0.533000	0.62120	GAC	NCKAP1	-	pfam_Nck-associated_protein-1	ENSG00000061676		0.338	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	HGNC	protein_coding	OTTHUMT00000255867.2	62	0.00	0	T	NM_205842		183817883	183817883	-1	no_errors	ENST00000360982	ensembl	human	known	69_37n	missense	71	10.13	8	SNP	1.000	C
NF1	4763	genome.wustl.edu	37	17	29562791	29562791	+	Splice_Site	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:29562791G>T	ENST00000358273.4	+	28	4253		c.e28+1		NF1_ENST00000356175.3_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTGTTTCAAGGTTTGTATCAT	0.383			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	GRCh37	CS011840|CS012213|CS072250	NF1	S							118.0	115.0	116.0					17																	29562791		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3870+1G>T	17.37:g.29562791G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	-	e28+1	ENST00000358273.4	37	c.3870+1	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792753	0.90453	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26586917	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.278000	0.95766	2.937000	0.99478	0.650000	0.86243	.	NF1	-	-	ENSG00000196712		0.383	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	30	0.00	0	G	NM_000267	Intron	29562791	29562791	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	splice_site	22	24.14	7	SNP	1.000	T
NLRP9	338321	genome.wustl.edu	37	19	56243877	56243877	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:56243877A>T	ENST00000332836.2	-	2	1347	c.1320T>A	c.(1318-1320)tgT>tgA	p.C440*		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	440	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TGAAGGCAAAACAGTCCCCTC	0.488																																						dbGAP											0													120.0	120.0	120.0					19																	56243877		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1320T>A	19.37:g.56243877A>T	ENSP00000331857:p.Cys440*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN12|Q86W27	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.C440*	ENST00000332836.2	37	c.1320	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	A	17.56	3.421093	0.62622	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	.	.	.	2.56	-5.13	0.02884	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4731	0.22020	0.5467:0.1302:0.323:0.0	.	.	.	.	X	440	.	ENSP00000331857:C440X	C	-	3	2	NLRP9	60935689	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.561000	0.05957	-1.660000	0.01486	-1.140000	0.01884	TGT	NLRP9	-	NULL	ENSG00000185792		0.488	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	29	0.00	0	A	NM_176820		56243877	56243877	-1	no_errors	ENST00000332836	ensembl	human	known	69_37n	nonsense	23	31.43	11	SNP	0.000	T
NOP14	8602	genome.wustl.edu	37	4	2939875	2939875	+	3'UTR	SNP	G	G	A	rs115626814	byFrequency	TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr4:2939875G>A	ENST00000314262.6	-	0	2682				NOP14_ENST00000416614.2_3'UTR|NOP14-AS1_ENST00000503709.1_RNA|NOP14-AS1_ENST00000512802.1_RNA|NOP14_ENST00000398071.4_3'UTR|NOP14-AS1_ENST00000512712.2_RNA|NOP14_ENST00000502735.1_3'UTR|NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000507702.1_RNA|NOP14_ENST00000507120.1_5'UTR|NOP14-AS1_ENST00000507999.1_RNA|NOP14-AS1_ENST00000505731.1_RNA	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						ATCAGGTGACGTTTTAACAGA	0.448													G|||	29	0.00579073	0.0197	0.0043	5008	,	,		17535	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.*60C>T	4.37:g.2939875G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	RNA	SNP	-	NULL	ENST00000314262.6	37	NULL	CCDS33945.1	4																																																																																			NOP14	-	-	ENSG00000087269		0.448	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	HGNC	protein_coding	OTTHUMT00000358135.2	9	0.00	0	G	NM_003703		2939875	2939875	-1	no_errors	ENST00000507120	ensembl	human	known	69_37n	rna	5	58.33	7	SNP	0.004	A
NTRK3	4916	genome.wustl.edu	37	15	88678430	88678430	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:88678430G>T	ENST00000360948.2	-	9	1267	c.1106C>A	c.(1105-1107)aCc>aAc	p.T369N	NTRK3_ENST00000357724.2_Missense_Mutation_p.T369N|NTRK3_ENST00000540489.2_Missense_Mutation_p.T369N|NTRK3_ENST00000558676.1_Missense_Mutation_p.T369N|NTRK3_ENST00000542733.2_Missense_Mutation_p.T271N|NTRK3_ENST00000317501.3_Missense_Mutation_p.T369N|NTRK3_ENST00000557856.1_Missense_Mutation_p.T369N|NTRK3_ENST00000355254.2_Missense_Mutation_p.T369N|NTRK3_ENST00000394480.2_Missense_Mutation_p.T369N	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	369	Ig-like C2-type 2.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GTTGTAGTGGGTGGGCTTGTT	0.537			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																												dbGAP		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													258.0	234.0	242.0					15																	88678430		2201	4299	6500	-	-	-	SO:0001583	missense	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1106C>A	15.37:g.88678430G>T	ENSP00000354207:p.Thr369Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T369N	ENST00000360948.2	37	c.1106	CCDS32322.1	15	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622173	0.87460	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	5.02	5.02	0.67125	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81884	0.4917	M	0.76727	2.345	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;0.998;1.0;0.998;0.997;0.998	D	0.84474	0.0601	10	0.87932	D	0	.	17.3435	0.87304	0.0:0.0:1.0:0.0	.	271;369;369;369;369;369	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	N	369;369;369;369;271;369;369	ENSP00000377990:T369N;ENSP00000354207:T369N;ENSP00000350356:T369N;ENSP00000347397:T369N;ENSP00000437773:T271N;ENSP00000444673:T369N;ENSP00000318328:T369N	ENSP00000318328:T369N	T	-	2	0	NTRK3	86479434	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.404000	0.97306	2.324000	0.78689	0.563000	0.77884	ACC	NTRK3	-	pfam_Ig_I-set,prints_Tyr_kinase_NGF_rcpt	ENSG00000140538		0.537	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		124	0.00	0	G			88678430	88678430	-1	no_errors	ENST00000360948	ensembl	human	known	69_37n	missense	103	28.47	41	SNP	1.000	T
NUP54	53371	genome.wustl.edu	37	4	77038820	77038820	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr4:77038820C>A	ENST00000264883.3	-	11	1532	c.1392G>T	c.(1390-1392)aaG>aaT	p.K464N	NUP54_ENST00000514987.1_Missense_Mutation_p.K416N|NUP54_ENST00000342467.6_Missense_Mutation_p.K248N|NUP54_ENST00000458189.2_Missense_Mutation_p.K284N	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	464					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						CACTTACCTGCTTGATTTCTC	0.373																																						dbGAP											0													112.0	102.0	105.0					4																	77038820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.1392G>T	4.37:g.77038820C>A	ENSP00000264883:p.Lys464Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Missense_Mutation	SNP	NULL	p.K464N	ENST00000264883.3	37	c.1392	CCDS3576.1	4	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774426	0.70107	.	.	ENSG00000138750	ENST00000264883;ENST00000342467;ENST00000514987;ENST00000458189	.	.	.	6.04	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	M	0.63843	1.955	0.58432	D	0.999999	D;P;D	0.61697	0.975;0.943;0.99	P;P;P	0.52454	0.649;0.699;0.567	T	0.58869	-0.7560	9	0.36615	T	0.2	-15.138	9.3025	0.37853	0.0:0.6709:0.0:0.3291	.	416;248;464	B4DT35;Q7Z3B4-2;Q7Z3B4	.;.;NUP54_HUMAN	N	464;248;416;284	.	ENSP00000264883:K464N	K	-	3	2	NUP54	77257844	0.993000	0.37304	1.000000	0.80357	0.965000	0.64279	0.343000	0.19944	0.911000	0.36747	0.561000	0.74099	AAG	NUP54	-	NULL	ENSG00000138750		0.373	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP54	HGNC	protein_coding	OTTHUMT00000252402.3	25	0.00	0	C			77038820	77038820	-1	no_errors	ENST00000264883	ensembl	human	known	69_37n	missense	24	31.43	11	SNP	1.000	A
NXF1	10482	genome.wustl.edu	37	11	62572859	62572859	+	5'UTR	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:62572859C>T	ENST00000532297.1	-	0	599				RP11-727F15.13_ENST00000596971.1_RNA|NXF1_ENST00000531131.1_5'UTR|NXF1_ENST00000439713.2_5'UTR|NXF1_ENST00000531709.2_5'UTR|NXF1_ENST00000294172.2_5'UTR			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGGGCTCAGGCGCTGGCCGCT	0.637																																						dbGAP											0													40.0	35.0	37.0					11																	62572859		2201	4298	6499	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.-31G>A	11.37:g.62572859C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E269|Q99799|Q9UQL2	RNA	SNP	-	NULL	ENST00000532297.1	37	NULL	CCDS8037.1	11																																																																																			NXF1	-	-	ENSG00000162231		0.637	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF1	HGNC	protein_coding	OTTHUMT00000395365.2	46	0.00	0	C	NM_006362		62572859	62572859	-1	no_errors	ENST00000526163	ensembl	human	known	69_37n	rna	86	13.00	13	SNP	0.002	T
OR2T1	26696	genome.wustl.edu	37	1	248570403	248570403	+	Nonstop_Mutation	SNP	T	T	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:248570403T>G	ENST00000366474.1	+	1	1108	c.1108T>G	c.(1108-1110)Tga>Gga	p.*370G		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGTGTCTTTTGACAGTCGAC	0.507																																						dbGAP											0													103.0	112.0	109.0					1																	248570403		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.1108T>G	1.37:g.248570403T>G	ENSP00000355430:p.*370Glyext*?	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEZ9	Nonstop_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.*370G	ENST00000366474.1	37	c.1108	CCDS31115.1	1	.	.	.	.	.	.	.	.	.	.	t	11.56	1.675576	0.29783	.	.	ENSG00000175143	ENST00000366474	.	.	.	4.33	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0811	0.42391	0.0:0.0:0.0:1.0	.	.	.	.	G	370	.	.	X	+	1	0	OR2T1	246637026	0.008000	0.16893	0.036000	0.18154	0.085000	0.17905	1.798000	0.38814	1.946000	0.56461	0.482000	0.46254	TGA	OR2T1	-	NULL	ENSG00000175143		0.507	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T1	HGNC	protein_coding	OTTHUMT00000097346.2	36	0.00	0	T			248570403	248570403	+1	no_errors	ENST00000366474	ensembl	human	known	69_37n	nonstop	30	30.23	13	SNP	0.016	G
OR51E2	81285	genome.wustl.edu	37	11	4712419	4712419	+	Intron	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:4712419G>C	ENST00000396950.3	-	1	190					NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2						cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		ACTTGGCTGTGGCAGTAGGAA	0.493																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.49+6463C>G	11.37:g.4712419G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA63|Q6IF94	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H170D	ENST00000396950.3	37	c.508	CCDS7751.1	11	.	.	.	.	.	.	.	.	.	.	G	2.102	-0.405939	0.04832	.	.	ENSG00000197674	ENST00000357764	T	0.00099	8.73	4.67	1.51	0.23008	.	1.404940	0.04544	N	0.388625	T	0.00144	0.0004	.	.	.	0.18873	N	0.999988	.	.	.	.	.	.	T	0.25502	-1.0130	7	0.56958	D	0.05	.	5.2007	0.15262	0.0777:0.113:0.5424:0.2669	.	.	.	.	D	170	ENSP00000350408:H170D	ENSP00000350408:H170D	H	-	1	0	OR51C1P	4668995	0.000000	0.05858	0.033000	0.17914	0.203000	0.24098	-1.668000	0.01959	-0.028000	0.13850	-0.813000	0.03139	CAC	OR51C1P	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197674		0.493	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51C1P	HGNC	protein_coding	OTTHUMT00000257198.1	44	0.00	0	G	NM_030774		4712419	4712419	-1	no_errors	ENST00000357764	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.217	C
OR5AU1	390445	genome.wustl.edu	37	14	21623712	21623712	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr14:21623712A>C	ENST00000304418.3	-	1	510	c.473T>G	c.(472-474)tTt>tGt	p.F158C		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		ACTGGTGGCAAAACCCGCATA	0.517																																						dbGAP											0													73.0	71.0	72.0					14																	21623712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.473T>G	14.37:g.21623712A>C	ENSP00000302057:p.Phe158Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F158C	ENST00000304418.3	37	c.473	CCDS32042.1	14	.	.	.	.	.	.	.	.	.	.	A	7.953	0.745355	0.15710	.	.	ENSG00000169327	ENST00000304418	T	0.01388	4.95	4.12	4.12	0.48240	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01905	0.0060	L	0.37897	1.145	0.09310	N	1	B	0.24768	0.111	B	0.25291	0.059	T	0.41662	-0.9496	9	0.66056	D	0.02	.	11.1359	0.48375	1.0:0.0:0.0:0.0	.	158	Q8NGC0	O5AU1_HUMAN	C	158	ENSP00000302057:F158C	ENSP00000302057:F158C	F	-	2	0	OR5AU1	20693552	0.046000	0.20272	0.951000	0.38953	0.591000	0.36615	2.009000	0.40903	1.730000	0.51580	0.260000	0.18958	TTT	OR5AU1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000169327		0.517	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AU1	HGNC	protein_coding	OTTHUMT00000410213.1	28	0.00	0	A			21623712	21623712	-1	no_errors	ENST00000304418	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.002	C
OR7D2	162998	genome.wustl.edu	37	19	9296887	9296887	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:9296887C>G	ENST00000344248.2	+	1	609	c.430C>G	c.(430-432)Ctg>Gtg	p.L144V		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	144					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						CTGTGGCCTCCTGGTTTTTGT	0.478																																						dbGAP											0													147.0	141.0	143.0					19																	9296887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.430C>G	19.37:g.9296887C>G	ENSP00000345563:p.Leu144Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFJ7|Q8N133	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L144V	ENST00000344248.2	37	c.430	CCDS32900.1	19	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705856	0.30232	.	.	ENSG00000188000	ENST00000344248	T	0.39229	1.09	2.21	-1.34	0.09143	GPCR, rhodopsin-like superfamily (1);	0.287948	0.18358	U	0.143666	T	0.61223	0.2330	M	0.89968	3.075	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51325	-0.8720	10	0.72032	D	0.01	.	3.5354	0.07792	0.1894:0.2989:0.0:0.5117	.	144	Q96RA2	OR7D2_HUMAN	V	144	ENSP00000345563:L144V	ENSP00000345563:L144V	L	+	1	2	OR7D2	9157887	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-0.982000	0.03762	-0.201000	0.10284	0.511000	0.50034	CTG	OR7D2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000188000		0.478	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D2	HGNC	protein_coding	OTTHUMT00000449002.1	74	0.00	0	C			9296887	9296887	+1	no_errors	ENST00000344248	ensembl	human	known	69_37n	missense	71	17.44	15	SNP	0.001	G
OTOGL	283310	genome.wustl.edu	37	12	80707310	80707310	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:80707310C>G	ENST00000547103.1	+	30	3484	c.3478C>G	c.(3478-3480)Ctt>Gtt	p.L1160V	OTOGL_ENST00000458043.2_Missense_Mutation_p.L1160V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1160					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TAACTGCAATCTTGGTGGCGA	0.353																																						dbGAP											0													166.0	173.0	171.0					12																	80707310		2191	4294	6485	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3478C>G	12.37:g.80707310C>G	ENSP00000447211:p.Leu1160Val	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.L1160V	ENST00000547103.1	37	c.3478		12	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620746	0.66787	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.76060	-0.99;-0.99	5.83	5.83	0.93111	.	.	.	.	.	T	0.74604	0.3738	L	0.35644	1.08	0.52099	D	0.999942	.	.	.	.	.	.	T	0.66948	-0.5794	7	0.14656	T	0.56	.	20.111	0.97911	0.0:1.0:0.0:0.0	.	.	.	.	V	1160	ENSP00000447211:L1160V;ENSP00000400895:L1160V	ENSP00000400895:L1160V	L	+	1	0	OTOGL	79231441	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.682000	0.68182	2.747000	0.94245	0.650000	0.86243	CTT	OTOGL	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000165899		0.353	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	42	0.00	0	C	NM_173591		80707310	80707310	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	28	36.36	16	SNP	1.000	G
PARP9	83666	genome.wustl.edu	37	3	122274209	122274209	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:122274209G>T	ENST00000360356.2	-	4	1141	c.914C>A	c.(913-915)aCc>aAc	p.T305N	PARP9_ENST00000471785.1_Missense_Mutation_p.T270N|PARP9_ENST00000477522.2_Missense_Mutation_p.T270N|PARP9_ENST00000462315.1_Missense_Mutation_p.T270N|PARP9_ENST00000492382.1_Intron	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	305					cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		AGAAGGGGTGGTTTCTTGTCC	0.463																																						dbGAP											0													170.0	166.0	167.0					3																	122274209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.914C>A	3.37:g.122274209G>T	ENSP00000353512:p.Thr305Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	pfam_A1pp,smart_A1pp,pfscan_A1pp,pfscan_Poly(ADP-ribose)pol_cat_dom	p.T305N	ENST00000360356.2	37	c.914	CCDS3014.1	3	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439194	0.25900	.	.	ENSG00000138496	ENST00000360356;ENST00000477522;ENST00000471785;ENST00000452457;ENST00000462315	T;T;T;T	0.19806	3.14;3.0;3.0;2.12	4.59	3.72	0.42706	.	0.777462	0.11310	N	0.577174	T	0.26011	0.0634	L	0.42245	1.32	0.09310	N	1	B;D;B	0.54397	0.008;0.966;0.134	B;P;B	0.49012	0.004;0.598;0.017	T	0.08432	-1.0722	10	0.62326	D	0.03	.	10.1422	0.42742	0.0941:0.0:0.9059:0.0	.	270;305;270	E9PFM7;Q8IXQ6;Q8IXQ6-2	.;PARP9_HUMAN;.	N	305;270;270;228;270	ENSP00000353512:T305N;ENSP00000419506:T270N;ENSP00000419001:T270N;ENSP00000418894:T270N	ENSP00000353512:T305N	T	-	2	0	PARP9	123756899	0.001000	0.12720	0.007000	0.13788	0.008000	0.06430	0.565000	0.23578	1.321000	0.45227	0.655000	0.94253	ACC	PARP9	-	NULL	ENSG00000138496		0.463	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARP9	HGNC	protein_coding	OTTHUMT00000355957.1	50	0.00	0	G	NM_031458		122274209	122274209	-1	no_errors	ENST00000360356	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.001	T
PCDHA5	56143	genome.wustl.edu	37	5	140203199	140203199	+	Silent	SNP	G	G	A	rs569811082		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:140203199G>A	ENST00000529859.1	+	1	1839	c.1839G>A	c.(1837-1839)gcG>gcA	p.A613A	PCDHA5_ENST00000378126.3_Silent_p.A613A|PCDHA5_ENST00000529619.1_Silent_p.A613A|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	613	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAGCCAGCGCCTGGCAGTG	0.657													.|||	1	0.000199681	0.0	0.0014	5008	,	,		18114	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													72.0	75.0	74.0					5																	140203199		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1839G>A	5.37:g.140203199G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75284|Q8N4R3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A613	ENST00000529859.1	37	c.1839	CCDS54917.1	5																																																																																			PCDHA5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204965		0.657	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	HGNC	protein_coding	OTTHUMT00000372883.2	97	0.00	0	G	NM_018908		140203199	140203199	+1	no_errors	ENST00000529859	ensembl	human	known	69_37n	silent	116	27.78	45	SNP	0.001	A
PCDHB2	56133	genome.wustl.edu	37	5	140475626	140475626	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:140475626G>A	ENST00000194155.4	+	1	1400	c.1252G>A	c.(1252-1254)Gaa>Aaa	p.E418K		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	418	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACCAGATCCGAATACAACAT	0.517																																						dbGAP											0													135.0	125.0	128.0					5																	140475626		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1252G>A	5.37:g.140475626G>A	ENSP00000194155:p.Glu418Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E418K	ENST00000194155.4	37	c.1252	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	G	9.118	1.008182	0.19199	.	.	ENSG00000112852	ENST00000194155	T	0.01705	4.68	5.11	2.22	0.28083	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02688	0.0081	M	0.66378	2.025	0.24947	N	0.991818	P	0.35656	0.514	B	0.34931	0.192	T	0.39035	-0.9633	9	0.59425	D	0.04	.	5.2867	0.15706	0.0746:0.2754:0.5155:0.1345	.	418	Q9Y5E7	PCDB2_HUMAN	K	418	ENSP00000194155:E418K	ENSP00000194155:E418K	E	+	1	0	PCDHB2	140455810	0.000000	0.05858	0.165000	0.22776	0.025000	0.11179	0.146000	0.16180	0.223000	0.20920	0.650000	0.86243	GAA	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.517	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	58	0.00	0	G	NM_018936		140475626	140475626	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	missense	93	11.43	12	SNP	0.733	A
PEAK1	79834	genome.wustl.edu	37	15	77472354	77472354	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:77472354C>G	ENST00000560626.2	-	4	2390	c.1915G>C	c.(1915-1917)Gct>Cct	p.A639P	PEAK1_ENST00000312493.4_Missense_Mutation_p.A639P|PEAK1_ENST00000558305.1_Missense_Mutation_p.A639P			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	639					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TTGTAGATAGCTAGATTGTCA	0.353																																						dbGAP											0													124.0	114.0	117.0					15																	77472354		1831	4095	5926	-	-	-	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.1915G>C	15.37:g.77472354C>G	ENSP00000452796:p.Ala639Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.A639P	ENST00000560626.2	37	c.1915	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980482	0.74474	.	.	ENSG00000173517	ENST00000312493	T	0.52754	0.65	5.88	5.88	0.94601	.	0.000000	0.32952	U	0.005446	T	0.62073	0.2398	L	0.34521	1.04	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.63180	-0.6695	10	0.87932	D	0	-11.0817	20.2207	0.98324	0.0:1.0:0.0:0.0	.	639	Q9H792	PEAK1_HUMAN	P	639	ENSP00000309230:A639P	ENSP00000309230:A639P	A	-	1	0	AC087465.1	75259409	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.777000	0.68931	2.790000	0.95986	0.591000	0.81541	GCT	PEAK1	-	NULL	ENSG00000173517		0.353	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Clone_based_vega_gene	protein_coding	OTTHUMT00000419483.3	70	0.00	0	C			77472354	77472354	-1	no_errors	ENST00000312493	ensembl	human	known	69_37n	missense	63	24.10	20	SNP	1.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	25	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	G
PKD1	5310	genome.wustl.edu	37	16	2166035	2166035	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:2166035C>A	ENST00000262304.4	-	9	2015	c.1807G>T	c.(1807-1809)Gcc>Tcc	p.A603S	PKD1_ENST00000423118.1_Missense_Mutation_p.A603S|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	603					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CGCAGCTGGGCGGGCCGCCGG	0.706																																						dbGAP											0													4.0	6.0	5.0					16																	2166035		1699	3380	5079	-	-	-	SO:0001583	missense	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.1807G>T	16.37:g.2166035C>A	ENSP00000262304:p.Ala603Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_LipOase_LH2,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like,pfscan_WSC_carb-bd,prints_PKD_1,tigrfam_Polycystin_cat	p.A603S	ENST00000262304.4	37	c.1807	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	C	11.45	1.642484	0.29246	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.35236	1.32;1.32	4.89	3.94	0.45596	Polycystin cation channel (1);	0.628215	0.16498	N	0.211802	T	0.32763	0.0840	L	0.57536	1.79	0.22435	N	0.999101	P;B	0.43352	0.804;0.357	B;B	0.41988	0.372;0.101	T	0.14924	-1.0455	10	0.06625	T	0.88	.	11.8568	0.52441	0.0:0.9139:0.0:0.0861	.	603;603	P98161-3;P98161	.;PKD1_HUMAN	S	603;603;551	ENSP00000262304:A603S;ENSP00000399501:A603S	ENSP00000262304:A603S	A	-	1	0	PKD1	2106036	0.068000	0.21057	0.786000	0.31890	0.174000	0.22865	0.475000	0.22164	1.044000	0.40200	0.555000	0.69702	GCC	PKD1	-	tigrfam_Polycystin_cat	ENSG00000008710		0.706	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	81	0.00	0	C			2166035	2166035	-1	no_errors	ENST00000262304	ensembl	human	known	69_37n	missense	85	30.33	37	SNP	0.934	A
PKD1L2	114780	genome.wustl.edu	37	16	81187874	81187874	+	RNA	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:81187874C>G	ENST00000525539.1	-	0	4194				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CGTCGGTGTCCTGTGTAGACT	0.532																																						dbGAP											0													116.0	115.0	115.0					16																	81187874		2094	4216	6310	-	-	-			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81187874C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	NULL	p.G1399R	ENST00000525539.1	37	c.4195		16																																																																																			PKD1L2	-	NULL	ENSG00000166473		0.532	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387972.2	41	0.00	0	C			81187874	81187874	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525539	ensembl	human	known	69_37n	missense	20	45.95	17	SNP	0.992	G
POP1	10940	genome.wustl.edu	37	8	99162829	99162829	+	Silent	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr8:99162829G>A	ENST00000401707.2	+	14	2100	c.2019G>A	c.(2017-2019)gcG>gcA	p.A673A	POP1_ENST00000349693.3_Silent_p.A673A	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	673					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			TGCTGTTTGCGGAAGAGCAAG	0.438																																						dbGAP											0													89.0	88.0	88.0					8																	99162829		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.2019G>A	8.37:g.99162829G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5W9|Q15037	Silent	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.A673	ENST00000401707.2	37	c.2019	CCDS6277.1	8																																																																																			POP1	-	pfam_POPLD	ENSG00000104356		0.438	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	33	0.00	0	G	NM_015029		99162829	99162829	+1	no_errors	ENST00000349693	ensembl	human	known	69_37n	silent	28	42.86	21	SNP	0.984	A
PPFIA2	8499	genome.wustl.edu	37	12	81732974	81732974	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:81732974G>A	ENST00000549396.1	-	21	2693	c.2533C>T	c.(2533-2535)Cga>Tga	p.R845*	PPFIA2_ENST00000550584.2_Nonsense_Mutation_p.R845*|PPFIA2_ENST00000549325.1_Nonsense_Mutation_p.R827*|PPFIA2_ENST00000541017.1_Nonsense_Mutation_p.R62*|PPFIA2_ENST00000541570.2_Nonsense_Mutation_p.R412*|PPFIA2_ENST00000548586.1_Nonsense_Mutation_p.R845*|PPFIA2_ENST00000333447.7_Nonsense_Mutation_p.R827*|PPFIA2_ENST00000407050.4_Nonsense_Mutation_p.R771*|PPFIA2_ENST00000550359.2_Nonsense_Mutation_p.R692*|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000443686.3_Nonsense_Mutation_p.R746*|PPFIA2_ENST00000552948.1_Nonsense_Mutation_p.R845*	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	845					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.R845*(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TGCCCAAGTCGAGCTTTTTCT	0.413																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											197.0	195.0	196.0					12																	81732974		1863	4103	5966	-	-	-	SO:0001587	stop_gained	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2533C>T	12.37:g.81732974G>A	ENSP00000450337:p.Arg845*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Nonsense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R845*	ENST00000549396.1	37	c.2533	CCDS55857.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.981454|3.981454	0.74474|0.74474	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000551147	.|.	.|.	.|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.79805	.|0.4509	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77905	.|-0.2413	.|3	0.02654|.	T|.	1|.	-9.8226|-9.8226	19.7201|19.7201	0.96139|0.96139	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	845;827;412;62;771;856;827;845;746;845|7	.|.	ENSP00000327416:R827X|.	R|S	-|-	1|2	2|0	PPFIA2|PPFIA2	80257105|80257105	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.679000|0.679000	0.39708|0.39708	3.168000|3.168000	0.50801|0.50801	2.661000|2.661000	0.90470|0.90470	0.561000|0.561000	0.74099|0.74099	CGA|TCG	PPFIA2	-	NULL	ENSG00000139220		0.413	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	27	0.00	0	G			81732974	81732974	-1	no_errors	ENST00000549396	ensembl	human	known	69_37n	nonsense	16	33.33	8	SNP	1.000	A
PSMA8	143471	genome.wustl.edu	37	18	23713980	23713980	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr18:23713980C>A	ENST00000308268.6	+	1	140	c.51C>A	c.(49-51)caC>caA	p.H17Q	PSMA8_ENST00000343848.6_Missense_Mutation_p.H17Q|PSMA8_ENST00000415576.2_Missense_Mutation_p.H17Q	NM_001025096.1|NM_144662.2	NP_001020267.1|NP_653263.2	Q8TAA3	PSA7L_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 8	17					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome core complex, alpha-subunit complex (GO:0019773)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|skin(2)	16	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			CAGACGGACACCTTTTTCAAG	0.562																																						dbGAP											0													120.0	108.0	112.0					18																	23713980		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047355	CCDS32808.1, CCDS45842.1, CCDS45843.1	18q11.2	2006-12-18				ENSG00000154611		"""Proteasome (prosome, macropain) subunits"""	22985	protein-coding gene	gene with protein product							Standard	XM_005258199		Approved	MGC26605, PSMA7L	uc002kvq.3	Q8TAA3		ENST00000308268.6:c.51C>A	18.37:g.23713980C>A	ENSP00000311121:p.His17Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ75|Q8IVP4|Q8TA98|Q8TAA2	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.H17Q	ENST00000308268.6	37	c.51	CCDS32808.1	18	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669044	0.29604	.	.	ENSG00000154611	ENST00000308268;ENST00000415576;ENST00000343848;ENST00000536423	T;T;T	0.42131	0.98;0.98;0.98	5.08	3.3	0.37823	Proteasome, alpha-subunit, conserved site (3);	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	M	0.86268	2.805	0.54753	D	0.999987	P;P;P	0.37636	0.603;0.549;0.516	B;B;B	0.39660	0.306;0.203;0.187	T	0.52208	-0.8606	10	0.72032	D	0.01	-10.4781	9.156	0.36994	0.0:0.8234:0.0:0.1766	.	17;17;17	Q8TAA3;Q8TAA3-5;Q8TAA3-2	PSA7L_HUMAN;.;.	Q	17	ENSP00000311121:H17Q;ENSP00000409284:H17Q;ENSP00000345584:H17Q	ENSP00000311121:H17Q	H	+	3	2	PSMA8	21967978	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.359000	0.34113	0.723000	0.32274	0.655000	0.94253	CAC	PSMA8	-	pfam_Proteasome_asu_N,smart_Proteasome_asu_N	ENSG00000154611		0.562	PSMA8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMA8	HGNC	protein_coding	OTTHUMT00000446255.1	32	0.00	0	C	NM_144662		23713980	23713980	+1	no_errors	ENST00000308268	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	A
PTPRQ	374462	genome.wustl.edu	37	12	80935422	80935422	+	Silent	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:80935422C>T	ENST00000266688.5	+	26	3231	c.3231C>T	c.(3229-3231)aaC>aaT	p.N1077N				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1123	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CTCAACCAAACGGTCTAGTCT	0.423																																						dbGAP											0													121.0	102.0	108.0					12																	80935422		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.3231C>T	12.37:g.80935422C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.T778M	ENST00000266688.5	37	c.2333		12	.	.	.	.	.	.	.	.	.	.	C	7.152	0.583971	0.13749	.	.	ENSG00000139304	ENST00000532722	.	.	.	5.89	-8.16	0.01061	.	.	.	.	.	T	0.63034	0.2477	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69224	-0.5201	4	.	.	.	.	16.8503	0.85992	0.0:0.5929:0.0:0.4071	.	.	.	.	M	778	.	.	T	+	2	0	PTPRQ	79459553	0.272000	0.24172	0.555000	0.28281	0.950000	0.60333	-0.834000	0.04391	-1.581000	0.01642	0.655000	0.94253	ACG	PTPRQ	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.423	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		38	0.00	0	C	NM_001145026		80935422	80935422	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000532722	ensembl	human	novel	69_37n	missense	29	23.68	9	SNP	0.540	T
RAB11FIP2	22841	genome.wustl.edu	37	10	119805656	119805656	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr10:119805656C>G	ENST00000355624.3	-	1	458	c.19G>C	c.(19-21)Gcc>Ccc	p.A7P	RP11-354M20.3_ENST00000417968.4_RNA|RP11-354M20.3_ENST00000451610.2_RNA|CASC2_ENST00000435944.1_RNA|CASC2_ENST00000426021.1_RNA|CASC2_ENST00000454781.1_RNA|RAB11FIP2_ENST00000369199.3_Missense_Mutation_p.A7P|CASC2_ENST00000414722.1_RNA|CASC2_ENST00000454857.1_RNA	NM_014904.2	NP_055719.1	Q7L804	RFIP2_HUMAN	RAB11 family interacting protein 2 (class I)	7	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				establishment of cell polarity (GO:0030010)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(8)	19		Colorectal(252;0.235)		all cancers(201;0.0238)		CACTTTTGGGCTTGCTCGGAC	0.522																																						dbGAP											0													195.0	183.0	187.0					10																	119805656		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY037299	CCDS7602.1	10q26.12	2004-07-22			ENSG00000107560	ENSG00000107560			29152	protein-coding gene	gene with protein product		608599				11994279, 10231032	Standard	NM_014904		Approved	KIAA0941, nRip11, Rab11-FIP2	uc001ldj.2	Q7L804	OTTHUMG00000019128	ENST00000355624.3:c.19G>C	10.37:g.119805656C>G	ENSP00000347839:p.Ala7Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEI4|Q3I768|Q9Y2F0	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A7P	ENST00000355624.3	37	c.19	CCDS7602.1	10	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012738	0.54468	.	.	ENSG00000107560	ENST00000355624;ENST00000369199	T;T	0.66815	-0.23;-0.23	4.55	4.55	0.56014	.	0.173386	0.51477	D	0.000094	T	0.57917	0.2086	L	0.38531	1.155	0.49582	D	0.999808	P;P	0.47910	0.835;0.902	B;B	0.44278	0.445;0.445	T	0.56038	-0.8045	10	0.28530	T	0.3	-8.7731	12.2473	0.54578	0.0:0.917:0.0:0.083	.	7;7	Q3I768;Q7L804	.;RFIP2_HUMAN	P	7	ENSP00000347839:A7P;ENSP00000358200:A7P	ENSP00000347839:A7P	A	-	1	0	RAB11FIP2	119795646	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.754000	0.55189	2.255000	0.74692	0.549000	0.68633	GCC	RAB11FIP2	-	NULL	ENSG00000107560		0.522	RAB11FIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP2	HGNC	protein_coding	OTTHUMT00000050583.1	41	0.00	0	C	NM_014904		119805656	119805656	-1	no_errors	ENST00000369199	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	1.000	G
RAG1	5896	genome.wustl.edu	37	11	36597221	36597221	+	Silent	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:36597221G>A	ENST00000299440.5	+	2	2479	c.2367G>A	c.(2365-2367)gaG>gaA	p.E789E		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	789					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				CTTTCATTGAGACAGTCCCTT	0.488									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	dbGAP											0													89.0	84.0	86.0					11																	36597221		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2367G>A	11.37:g.36597221G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PPC4|Q8IY72|Q8NER2	Silent	SNP	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.E789	ENST00000299440.5	37	c.2367	CCDS7902.1	11																																																																																			RAG1	-	NULL	ENSG00000166349		0.488	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	HGNC	protein_coding	OTTHUMT00000389535.1	27	0.00	0	G	NM_000448		36597221	36597221	+1	no_errors	ENST00000299440	ensembl	human	known	69_37n	silent	25	34.21	13	SNP	1.000	A
RNF212	285498	genome.wustl.edu	37	4	1087508	1087508	+	Intron	SNP	G	G	C	rs562675797		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr4:1087508G>C	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_Missense_Mutation_p.H181D|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		TAACAGACATGTTTTATGAAC	0.572																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2882C>G	4.37:g.1087508G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Missense_Mutation	SNP	pfscan_Znf_RING	p.H181D	ENST00000433731.2	37	c.541	CCDS46996.1	4	.	.	.	.	.	.	.	.	.	.	G	0.661	-0.805826	0.02819	.	.	ENSG00000178222	ENST00000333673	.	.	.	1.03	0.135	0.14775	.	0.283506	0.25285	N	0.031771	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	P	0.50710	0.938	B	0.34722	0.188	T	0.32402	-0.9908	9	0.87932	D	0	.	3.2568	0.06835	0.308:0.0:0.692:0.0	.	181	C9J8N0	.	D	181	.	ENSP00000327481:H181D	H	-	1	0	RNF212	1077508	0.000000	0.05858	0.003000	0.11579	0.025000	0.11179	-1.194000	0.03046	0.021000	0.15133	0.462000	0.41574	CAT	RNF212	-	NULL	ENSG00000178222		0.572	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	HGNC	protein_coding	OTTHUMT00000359124.2	87	0.00	0	G	NM_194439		1087508	1087508	-1	no_errors	ENST00000333673	ensembl	human	known	69_37n	missense	84	13.40	13	SNP	0.003	C
RNF213	57674	genome.wustl.edu	37	17	78320862	78320862	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:78320862G>T	ENST00000582970.1	+	29	8870	c.8727G>T	c.(8725-8727)gaG>gaT	p.E2909D	RNF213_ENST00000336301.6_Missense_Mutation_p.E982D|RNF213_ENST00000508628.2_Missense_Mutation_p.E2958D	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2909					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACGAGACAGAGCTCATAGAGA	0.567																																						dbGAP											0													56.0	52.0	53.0					17																	78320862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.8727G>T	17.37:g.78320862G>T	ENSP00000464087:p.Glu2909Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.E2909D	ENST00000582970.1	37	c.8727	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	4.691	0.128573	0.08981	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.34275	1.37	5.82	3.52	0.40303	ATPase, AAA+ type, core (1);	0.062970	0.64402	D	0.000009	T	0.42765	0.1217	M	0.80028	2.48	0.28542	N	0.912047	B	0.28584	0.216	B	0.35727	0.209	T	0.38628	-0.9652	10	0.22706	T	0.39	.	12.3924	0.55366	0.2026:0.0:0.7974:0.0	.	982	Q63HN8	RN213_HUMAN	D	2909;2958;982	ENSP00000338218:E982D	ENSP00000338218:E982D	E	+	3	2	RNF213	75935457	1.000000	0.71417	0.999000	0.59377	0.009000	0.06853	2.518000	0.45537	1.476000	0.48215	-0.222000	0.12452	GAG	RNF213	-	smart_AAA+_ATPase	ENSG00000173821		0.567	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	37	0.00	0	G	NM_020914		78320862	78320862	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	missense	61	17.57	13	SNP	1.000	T
ROBO1	6091	genome.wustl.edu	37	3	78676606	78676606	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:78676606G>A	ENST00000464233.1	-	26	3853	c.3740C>T	c.(3739-3741)gCt>gTt	p.A1247V	ROBO1_ENST00000436010.2_Missense_Mutation_p.A1208V|ROBO1_ENST00000495273.1_Missense_Mutation_p.A1202V|ROBO1_ENST00000467549.1_Missense_Mutation_p.A1147V	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1247					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGGAGAAGAAGCTGCTCCCCG	0.547																																						dbGAP											0													57.0	72.0	67.0					3																	78676606		2112	4227	6339	-	-	-	SO:0001583	missense	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3740C>T	3.37:g.78676606G>A	ENSP00000420321:p.Ala1247Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A1247V	ENST00000464233.1	37	c.3740	CCDS54611.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.351670|4.351670	0.82132|0.82132	.|.	.|.	ENSG00000169855|ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414|ENST00000472273	T;T;T;T|.	0.64991|.	-0.08;-0.1;-0.1;-0.13|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71913|0.71913	0.3396|0.3396	L|L	0.55743|0.55743	1.74|1.74	0.80722|0.80722	D|D	1|1	D;B;P;P;P|.	0.67145|.	0.996;0.063;0.74;0.932;0.594|.	D;B;B;B;P|.	0.77557|.	0.99;0.074;0.253;0.293;0.561|.	T|T	0.68633|0.68633	-0.5357|-0.5357	9|5	.|.	.|.	.|.	.|.	19.2858|19.2858	0.94069|0.94069	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1211;1247;1202;1147;1208|.	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4|.	.;ROBO1_HUMAN;.;.;.|.	V|F	1208;1202;1247;1202;1147;1251|174	ENSP00000406043:A1208V;ENSP00000420321:A1247V;ENSP00000420637:A1202V;ENSP00000417992:A1147V|.	.|.	A|L	-|-	2|1	0|0	ROBO1|ROBO1	78759296|78759296	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.687000|0.687000	0.40016|0.40016	7.778000|7.778000	0.85637|0.85637	2.630000|2.630000	0.89119|0.89119	0.561000|0.561000	0.74099|0.74099	GCT|CTT	ROBO1	-	NULL	ENSG00000169855		0.547	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	15	0.00	0	G	NM_002941		78676606	78676606	-1	no_errors	ENST00000464233	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	A
RPL10	6134	genome.wustl.edu	37	X	153628161	153628161	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chrX:153628161A>C	ENST00000369817.2	+	6	784	c.208A>C	c.(208-210)Att>Ctt	p.I70L	SNORA70_ENST00000384436.1_RNA|RPL10_ENST00000424325.2_Missense_Mutation_p.I70L|RPL10_ENST00000406022.2_Missense_Mutation_p.I19L			P27635	RL10_HUMAN	ribosomal protein L10	70					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCTGCCCGAATTTGTGCCAA	0.488																																						dbGAP											0													75.0	73.0	73.0					X																	153628161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.208A>C	X.37:g.153628161A>C	ENSP00000358832:p.Ile70Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.I70L	ENST00000369817.2	37	c.208	CCDS14746.1	X	.	.	.	.	.	.	.	.	.	.	A	13.57	2.277600	0.40294	.	.	ENSG00000147403	ENST00000369817;ENST00000424325;ENST00000436473;ENST00000344746;ENST00000458500;ENST00000406022;ENST00000451365	T;T;T;T	0.74421	-0.79;-0.79;-0.79;-0.84	4.88	3.72	0.42706	Ribosomal protein L10e/L16 (2);	0.000000	0.64402	U	0.000001	D	0.85600	0.5734	M	0.90019	3.08	0.80722	D	1	P;B	0.38767	0.646;0.014	P;B	0.56434	0.798;0.142	D	0.84639	0.0694	10	0.87932	D	0	-9.796	8.0691	0.30678	0.901:0.0:0.099:0.0	.	70;70	A6QRI9;P27635	.;RL10_HUMAN	L	70;70;70;70;70;19;53	ENSP00000358832:I70L;ENSP00000413436:I70L;ENSP00000341730:I70L;ENSP00000385621:I19L	ENSP00000341730:I70L	I	+	1	0	RPL10	153281355	1.000000	0.71417	0.798000	0.32154	0.385000	0.30292	8.538000	0.90634	0.549000	0.28973	-0.466000	0.05196	ATT	RPL10	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000147403		0.488	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10	HGNC	protein_coding	OTTHUMT00000127774.5	50	0.00	0	A	NM_006013		153628161	153628161	+1	no_errors	ENST00000344746	ensembl	human	known	69_37n	missense	30	42.31	22	SNP	0.984	C
SASH1	23328	genome.wustl.edu	37	6	148593509	148593509	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr6:148593509G>A	ENST00000367469.1	+	1	70	c.17G>A	c.(16-18)tGc>tAc	p.C6Y	RP11-631F7.1_ENST00000423268.1_RNA			O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	0					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GAACAAGATTGCAGGGTATGT	0.428																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367469.1:c.17G>A	6.37:g.148593509G>A	ENSP00000356439:p.Cys6Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	NULL	p.C6Y	ENST00000367469.1	37	c.17		6	.	.	.	.	.	.	.	.	.	.	G	8.551	0.875636	0.17395	.	.	ENSG00000111961	ENST00000367469	.	.	.	6.06	-6.05	0.02172	.	.	.	.	.	T	0.18467	0.0443	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.45234	-0.9275	5	0.87932	D	0	.	6.7004	0.23223	0.0806:0.4037:0.4085:0.1072	.	.	.	.	Y	6	.	ENSP00000356439:C6Y	C	+	2	0	SASH1	148635202	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.605000	0.05661	-1.496000	0.01828	-1.844000	0.00574	TGC	SASH1	-	NULL	ENSG00000111961		0.428	SASH1-002	KNOWN	basic	protein_coding	SASH1	HGNC	protein_coding	OTTHUMT00000042620.1	88	0.00	0	G	NM_015278		148593509	148593509	+1	no_errors	ENST00000367469	ensembl	human	known	69_37n	missense	68	36.45	39	SNP	0.000	A
SEC24C	9632	genome.wustl.edu	37	10	75525331	75525331	+	Silent	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr10:75525331C>T	ENST00000339365.2	+	10	1512	c.1350C>T	c.(1348-1350)tgC>tgT	p.C450C	SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Silent_p.C331C|SEC24C_ENST00000546025.1_Silent_p.C228C|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000345254.4_Silent_p.C450C	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	450	Zinc finger-like.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GCTGTTTTTGCAGCTGTATCA	0.463																																						dbGAP											0													167.0	130.0	143.0					10																	75525331		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1350C>T	10.37:g.75525331C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZT4|Q8WV25	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.C450	ENST00000339365.2	37	c.1350	CCDS7332.1	10																																																																																			SEC24C	-	pfam_Znf_Sec23_Sec24,superfamily_Znf_Sec23_Sec24	ENSG00000176986		0.463	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	66	0.00	0	C			75525331	75525331	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	silent	73	14.94	13	SNP	1.000	T
SEZ6L2	26470	genome.wustl.edu	37	16	29896968	29896968	+	Silent	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:29896968G>C	ENST00000308713.5	-	8	1838	c.1311C>G	c.(1309-1311)ctC>ctG	p.L437L	SEZ6L2_ENST00000562159.1_5'Flank|SEZ6L2_ENST00000350527.3_Silent_p.L367L|SEZ6L2_ENST00000537485.1_Silent_p.L393L|SEZ6L2_ENST00000346932.5_Silent_p.L323L	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	437	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCTCCACGTAGAGGGACTGGG	0.602																																						dbGAP											0													81.0	77.0	78.0					16																	29896968		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1311C>G	16.37:g.29896968G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.S109C	ENST00000308713.5	37	c.326	CCDS10659.1	16																																																																																			SEZ6L2	-	superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000174938		0.602	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	29	0.00	0	G	NM_012410		29896968	29896968	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000563118	ensembl	human	putative	69_37n	missense	27	37.21	16	SNP	1.000	C
SFXN1	94081	genome.wustl.edu	37	5	174948932	174948932	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr5:174948932G>T	ENST00000321442.5	+	9	1039	c.785G>T	c.(784-786)tGg>tTg	p.W262L		NM_022754.5	NP_073591.2	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	262					erythrocyte differentiation (GO:0030218)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(3)	15	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AGGTTCCCATGGATGAGTGCA	0.358																																						dbGAP											0													124.0	130.0	128.0					5																	174948932		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF327346	CCDS4394.1	5q35.3	2008-02-05			ENSG00000164466	ENSG00000164466		"""Sideroflexins"""	16085	protein-coding gene	gene with protein product		615569					Standard	NM_022754		Approved	FLJ12876	uc003mda.2	Q9H9B4	OTTHUMG00000130555	ENST00000321442.5:c.785G>T	5.37:g.174948932G>T	ENSP00000316905:p.Trp262Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPW3|D3DQN2|Q9HA53	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.W262L	ENST00000321442.5	37	c.785	CCDS4394.1	5	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252488	0.39797	.	.	ENSG00000164466	ENST00000321442	T	0.29397	1.57	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.32285	0.0824	L	0.58302	1.8	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.16217	-1.0410	10	0.11485	T	0.65	-5.4591	18.6781	0.91535	0.0:0.0:1.0:0.0	.	262	Q9H9B4	SFXN1_HUMAN	L	262	ENSP00000316905:W262L	ENSP00000316905:W262L	W	+	2	0	SFXN1	174881538	1.000000	0.71417	0.998000	0.56505	0.719000	0.41307	7.450000	0.80656	2.760000	0.94817	0.655000	0.94253	TGG	SFXN1	-	pfam_Mtc,tigrfam_Mtc	ENSG00000164466		0.358	SFXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN1	HGNC	protein_coding	OTTHUMT00000252980.2	45	0.00	0	G	NM_022754		174948932	174948932	+1	no_errors	ENST00000321442	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	1.000	T
SH3RF1	57630	genome.wustl.edu	37	4	170037434	170037434	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr4:170037434C>G	ENST00000284637.9	-	10	2466	c.2125G>C	c.(2125-2127)Gac>Cac	p.D709H	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	709					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		CTATCCTTGTCTGGTTTGGTT	0.458																																						dbGAP											0													116.0	96.0	103.0					4																	170037434		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2125G>C	4.37:g.170037434C>G	ENSP00000284637:p.Asp709His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_p67phox,prints_SH3_domain	p.D709H	ENST00000284637.9	37	c.2125	CCDS34099.1	4	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515463	0.64634	.	.	ENSG00000154447	ENST00000284637	T	0.14516	2.5	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.37999	0.1024	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.05989	-1.0852	10	0.66056	D	0.02	-33.2634	19.3637	0.94453	0.0:1.0:0.0:0.0	.	709	Q7Z6J0	SH3R1_HUMAN	H	709	ENSP00000284637:D709H	ENSP00000284637:D709H	D	-	1	0	SH3RF1	170274009	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	6.981000	0.76166	2.576000	0.86940	0.555000	0.69702	GAC	SH3RF1	-	NULL	ENSG00000154447		0.458	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3RF1	HGNC	protein_coding	OTTHUMT00000363382.3	53	0.00	0	C	NM_020870		170037434	170037434	-1	no_errors	ENST00000284637	ensembl	human	known	69_37n	missense	64	17.95	14	SNP	1.000	G
SLC12A5	57468	genome.wustl.edu	37	20	44681681	44681681	+	Silent	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr20:44681681C>T	ENST00000454036.2	+	19	2581	c.2532C>T	c.(2530-2532)ttC>ttT	p.F844F	SLC12A5_ENST00000243964.3_Silent_p.F821F	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	844					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CTGAGCGCTTCTCTGAGGGCA	0.592																																						dbGAP											0													166.0	123.0	137.0					20																	44681681		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2532C>T	20.37:g.44681681C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.F844	ENST00000454036.2	37	c.2532	CCDS46610.1	20																																																																																			SLC12A5	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.592	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	73	0.00	0	C			44681681	44681681	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	silent	86	21.82	24	SNP	1.000	T
SLC44A1	23446	genome.wustl.edu	37	9	108072014	108072014	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr9:108072014T>C	ENST00000374720.3	+	3	383	c.136T>C	c.(136-138)Tgt>Cgt	p.C46R	SLC44A1_ENST00000374724.1_Missense_Mutation_p.C46R|SLC44A1_ENST00000607692.1_3'UTR|SLC44A1_ENST00000374723.1_Missense_Mutation_p.C46R	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	46					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	GGGATTTATTTGTGGCTTTTC	0.373																																						dbGAP											0													88.0	87.0	87.0					9																	108072014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.136T>C	9.37:g.108072014T>C	ENSP00000363852:p.Cys46Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.C46R	ENST00000374720.3	37	c.136	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	T	14.33	2.502687	0.44558	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724	T;T;T	0.78364	-1.17;-1.17;-1.17	5.44	4.29	0.51040	.	0.000000	0.85682	D	0.000000	D	0.84552	0.5497	L	0.59436	1.845	0.80722	D	1	P;D	0.71674	0.935;0.998	P;D	0.80764	0.785;0.994	D	0.84823	0.0797	10	0.72032	D	0.01	-13.5243	11.7209	0.51680	0.1324:0.0:0.0:0.8676	.	46;46	Q8WWI5-3;Q8WWI5	.;CTL1_HUMAN	R	46	ENSP00000363855:C46R;ENSP00000363852:C46R;ENSP00000363856:C46R	ENSP00000363852:C46R	C	+	1	0	SLC44A1	107111835	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	7.225000	0.78051	0.876000	0.35872	-0.490000	0.04691	TGT	SLC44A1	-	NULL	ENSG00000070214		0.373	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	HGNC	protein_coding	OTTHUMT00000053500.1	83	0.00	0	T	NM_080546		108072014	108072014	+1	no_errors	ENST00000374720	ensembl	human	known	69_37n	missense	70	15.66	13	SNP	1.000	C
SLCO1C1	53919	genome.wustl.edu	37	12	20876178	20876178	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr12:20876178C>A	ENST00000266509.2	+	9	1544	c.1176C>A	c.(1174-1176)aaC>aaA	p.N392K	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.N392K|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.N274K|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.N343K|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.N392K	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	392					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	CCAGGGCCAACTTTGTGATCG	0.453																																						dbGAP											0													148.0	128.0	134.0					12																	20876178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1176C>A	12.37:g.20876178C>A	ENSP00000266509:p.Asn392Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.N392K	ENST00000266509.2	37	c.1176	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350116	0.41599	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.80738	0.31;0.31;0.31;0.31;-1.41	4.54	2.71	0.32032	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.89594	0.6760	M	0.90198	3.095	0.49130	D	0.999756	D;D;D;D	0.89917	1.0;0.999;0.992;0.984	D;D;D;D	0.83275	0.996;0.995;0.969;0.958	D	0.89514	0.3773	10	0.56958	D	0.05	.	9.4097	0.38485	0.0:0.7296:0.0:0.2704	.	274;343;392;392	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	K	392;343;392;392;274	ENSP00000444149:N392K;ENSP00000438665:N343K;ENSP00000266509:N392K;ENSP00000370964:N392K;ENSP00000444527:N274K	ENSP00000266509:N392K	N	+	3	2	SLCO1C1	20767445	1.000000	0.71417	1.000000	0.80357	0.514000	0.34195	1.144000	0.31565	1.267000	0.44247	0.561000	0.74099	AAC	SLCO1C1	-	pfam_OA_transporter,pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.453	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	58	0.00	0	C	NM_017435		20876178	20876178	+1	no_errors	ENST00000381552	ensembl	human	known	69_37n	missense	41	44.59	33	SNP	1.000	A
SRCAP	10847	genome.wustl.edu	37	16	30718605	30718606	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:30718605_30718606insT	ENST00000262518.4	+	5	793_794	c.408_409insT	c.(409-411)tggfs	p.W137fs	SRCAP_ENST00000395059.2_Frame_Shift_Ins_p.W137fs|SRCAP_ENST00000344771.4_Frame_Shift_Ins_p.W137fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	137	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCAAAGGTCACTGGGACTATTT	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.409dupT	16.37:g.30718606_30718606dupT	ENSP00000262518:p.Trp137fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Ins	INS	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.W136fs	ENST00000262518.4	37	c.408_409	CCDS10689.2	16																																																																																			SRCAP	-	pfam_HSA,smart_HAS_subgr,pfscan_Helicase/SANT-assoc_DNA-bd	ENSG00000080603		0.604	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	50	0.00	0	-	NM_006662		30718605	30718606	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	frame_shift_ins	65	22.62	19	INS	1.000:1.000	T
STRC	161497	genome.wustl.edu	37	15	43892280	43892280	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:43892280G>A	ENST00000450892.2	-	28	5194	c.5117C>T	c.(5116-5118)tCt>tTt	p.S1706F	STRC_ENST00000541030.1_Missense_Mutation_p.S933F|RNU6-554P_ENST00000410466.1_RNA	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	1706					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)				skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GGTGAGACTAGATAGTTGGAT	0.572																																						dbGAP											0													93.0	79.0	83.0					15																	43892280		2199	4295	6494	-	-	-	SO:0001583	missense	0			BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.5117C>T	15.37:g.43892280G>A	ENSP00000401513:p.Ser1706Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S1706F	ENST00000450892.2	37	c.5117	CCDS10098.1	15	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023311	0.54683	.	.	ENSG00000242866	ENST00000450892;ENST00000299992;ENST00000541030	T;T	0.79247	-1.25;-1.21	4.81	2.88	0.33553	.	0.152228	0.44902	D	0.000403	T	0.76364	0.3977	L	0.32530	0.975	0.38266	D	0.942012	P;B	0.44877	0.845;0.047	P;B	0.55871	0.786;0.021	T	0.76812	-0.2821	10	0.59425	D	0.04	-7.9442	8.2784	0.31885	0.0882:0.1581:0.7536:0.0	.	933;1706	F5GXA4;Q7RTU9	.;STRC_HUMAN	F	1706;1706;933	ENSP00000401513:S1706F;ENSP00000440413:S933F	ENSP00000299992:S1706F	S	-	2	0	STRC	41679572	0.796000	0.28864	0.992000	0.48379	0.962000	0.63368	1.924000	0.40065	0.715000	0.32103	0.491000	0.48974	TCT	STRC	-	NULL	ENSG00000242866		0.572	STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRC	HGNC	protein_coding	OTTHUMT00000133140.1	99	0.00	0	G	NM_153700		43892280	43892280	-1	no_errors	ENST00000450892	ensembl	human	known	69_37n	missense	110	20.86	29	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152708494	152708494	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr6:152708494G>C	ENST00000367255.5	-	54	8801	c.8200C>G	c.(8200-8202)Caa>Gaa	p.Q2734E	SYNE1_ENST00000448038.1_Missense_Mutation_p.Q2741E|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q2773E|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q2734E|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q2741E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2734					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCATTCCATTGGCTAATCACA	0.368										HNSCC(10;0.0054)																												dbGAP											0													141.0	130.0	134.0					6																	152708494		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.8200C>G	6.37:g.152708494G>C	ENSP00000356224:p.Gln2734Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q2734E	ENST00000367255.5	37	c.8200	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533265	0.45073	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29	5.85	4.97	0.65823	.	0.206032	0.33813	N	0.004540	T	0.25158	0.0611	M	0.69823	2.125	0.80722	D	1	B;B;B;P	0.39352	0.089;0.398;0.398;0.669	B;B;B;B	0.43536	0.061;0.16;0.16;0.423	T	0.29458	-1.0011	10	0.06365	T	0.9	.	16.1027	0.81194	0.0:0.0:0.8585:0.1415	.	2717;2734;2734;2741	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	E	2734;2741;2734;2741;2773	ENSP00000356224:Q2734E;ENSP00000396024:Q2741E;ENSP00000265368:Q2734E;ENSP00000390975:Q2741E;ENSP00000341887:Q2773E	ENSP00000265368:Q2734E	Q	-	1	0	SYNE1	152750187	1.000000	0.71417	0.971000	0.41717	0.982000	0.71751	5.236000	0.65354	1.439000	0.47511	0.655000	0.94253	CAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.368	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	45	0.00	0	G	NM_182961		152708494	152708494	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	0.989	C
SYNRG	11276	genome.wustl.edu	37	17	35898428	35898428	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:35898428delA	ENST00000339208.6	-	18	3655	c.3515delT	c.(3514-3516)ttafs	p.L1172fs	SYNRG_ENST00000585472.1_Frame_Shift_Del_p.L1093fs|SYNRG_ENST00000591288.1_Frame_Shift_Del_p.L966fs|SYNRG_ENST00000345615.4_Frame_Shift_Del_p.L1094fs|SYNRG_ENST00000394378.2_Frame_Shift_Del_p.L1094fs|SYNRG_ENST00000346661.4_Frame_Shift_Del_p.L1172fs|SYNRG_ENST00000502449.2_Frame_Shift_Del_p.L1049fs	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	1172					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						GAACATACCTAATAAATATTC	0.313																																						dbGAP											0													111.0	117.0	115.0					17																	35898428		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.3515delT	17.37:g.35898428delA	ENSP00000343610:p.Leu1172fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Frame_Shift_Del	DEL	smart_EPS15_homology,pfscan_EPS15_homology	p.L1172fs	ENST00000339208.6	37	c.3515	CCDS11321.1	17																																																																																			SYNRG	-	NULL	ENSG00000006114		0.313	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNRG	HGNC	protein_coding	OTTHUMT00000256811.2	13	0.00	0	A	NM_007247		35898428	35898428	-1	no_errors	ENST00000339208	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
TCTEX1D1	200132	genome.wustl.edu	37	1	67243195	67243195	+	3'UTR	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:67243195G>T	ENST00000282670.2	+	0	726					NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1											large_intestine(2)|lung(10)|skin(1)	13						CTGTATGTCTGTACACAAAAG	0.328																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.*58G>T	1.37:g.67243195G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q06YR9|Q5VYE1	RNA	SNP	-	NULL	ENST00000282670.2	37	NULL	CCDS633.1	1																																																																																			TCTEX1D1	-	-	ENSG00000152760		0.328	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D1	HGNC	protein_coding	OTTHUMT00000025399.2	28	0.00	0	G	NM_152665		67243195	67243195	+1	no_errors	ENST00000489510	ensembl	human	known	69_37n	rna	18	25.00	6	SNP	0.002	T
TFCP2L1	29842	genome.wustl.edu	37	2	121995228	121995228	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr2:121995228T>C	ENST00000263707.5	-	10	1071	c.974A>G	c.(973-975)cAg>cGg	p.Q325R		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	325					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					CCGGCAGAACTGCGAGAACCT	0.567																																						dbGAP											0													89.0	93.0	92.0					2																	121995228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.974A>G	2.37:g.121995228T>C	ENSP00000263707:p.Gln325Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG43	Missense_Mutation	SNP	pfam_CP2,superfamily_SAM/pointed	p.Q325R	ENST00000263707.5	37	c.974	CCDS2134.1	2	.	.	.	.	.	.	.	.	.	.	T	13.93	2.383571	0.42207	.	.	ENSG00000115112	ENST00000263707	T	0.17213	2.29	5.69	2.11	0.27256	Sterile alpha motif/pointed domain (1);	0.382442	0.29609	N	0.011679	T	0.11410	0.0278	L	0.29908	0.895	0.31544	N	0.659599	B	0.06786	0.001	B	0.14023	0.01	T	0.12811	-1.0533	10	0.28530	T	0.3	.	9.2506	0.37554	0.0936:0.0:0.2945:0.6119	.	325	Q9NZI6	TF2L1_HUMAN	R	325	ENSP00000263707:Q325R	ENSP00000263707:Q325R	Q	-	2	0	TFCP2L1	121711698	1.000000	0.71417	0.999000	0.59377	0.762000	0.43233	3.215000	0.51169	0.433000	0.26313	0.533000	0.62120	CAG	TFCP2L1	-	superfamily_SAM/pointed	ENSG00000115112		0.567	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2L1	HGNC	protein_coding	OTTHUMT00000338539.1	29	0.00	0	T	NM_014553		121995228	121995228	-1	no_errors	ENST00000263707	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	0.977	C
TJP1	7082	genome.wustl.edu	37	15	30024834	30024834	+	Splice_Site	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:30024834C>T	ENST00000346128.6	-	14	2396		c.e14+1		TJP1_ENST00000400011.2_Splice_Site|TJP1_ENST00000545208.2_Splice_Site|TJP1_ENST00000356107.6_Splice_Site	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1						apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		AAATAAACTACCTTCTCGAAG	0.368																																					Melanoma(77;681 1843 6309 6570)	dbGAP											0													70.0	68.0	68.0					15																	30024834		1827	4088	5915	-	-	-	SO:0001630	splice_region_variant	0				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1921+1G>A	15.37:g.30024834C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Splice_Site	SNP	-	e14+1	ENST00000346128.6	37	c.1921+1	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459120	0.84317	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1092	0.97906	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TJP1	27812126	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.745000	0.94114	0.655000	0.94253	.	TJP1	-	-	ENSG00000104067		0.368	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	23	0.00	0	C	NM_003257	Intron	30024834	30024834	-1	no_errors	ENST00000346128	ensembl	human	known	69_37n	splice_site	16	23.81	5	SNP	1.000	T
TGM7	116179	genome.wustl.edu	37	15	43579533	43579533	+	Silent	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:43579533G>A	ENST00000452443.2	-	6	814	c.810C>T	c.(808-810)ggC>ggT	p.G270G		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	270					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	CAGGCTGCCCGCCCCTGGCTG	0.577																																						dbGAP											0													62.0	48.0	52.0					15																	43579533		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.810C>T	15.37:g.43579533G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G270	ENST00000452443.2	37	c.810	CCDS32213.1	15																																																																																			TGM7	-	NULL	ENSG00000159495		0.577	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	HGNC	protein_coding	OTTHUMT00000432489.1	27	0.00	0	G	NM_052955		43579533	43579533	-1	no_errors	ENST00000452443	ensembl	human	known	69_37n	silent	29	18.92	7	SNP	0.039	A
TLR9	54106	genome.wustl.edu	37	3	52257959	52257959	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr3:52257959G>C	ENST00000360658.2	-	2	1006	c.373C>G	c.(373-375)Ctg>Gtg	p.L125V	TLR9_ENST00000597542.1_Missense_Mutation_p.L149V|TLR9_ENST00000494383.1_Missense_Mutation_p.P278R	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	125					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	AGCTCTTCCAGGGTGGGCACA	0.572																																						dbGAP											0													179.0	164.0	169.0					3																	52257959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.373C>G	3.37:g.52257959G>C	ENSP00000353874:p.Leu125Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_TIR_dom,pfscan_TIR_dom	p.L125V	ENST00000360658.2	37	c.373	CCDS2848.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.47|18.47	3.630918|3.630918	0.67015|0.67015	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.60299|.	0.2|.	5.43|5.43	4.55|4.55	0.56014|0.56014	.|.	0.000000|.	0.29355|.	N|.	0.012399|.	D|D	0.82407|0.82407	0.5030|0.5030	H|H	0.95950|0.95950	3.745|3.745	0.42227|0.42227	D|D	0.991877|0.991877	D;D|.	0.69078|.	0.997;0.964|.	P;P|.	0.61800|.	0.894;0.828|.	D|D	0.85480|0.85480	0.1178|0.1178	10|5	0.87932|.	D|.	0|.	.|.	8.7062|8.7062	0.34356|0.34356	0.1749:0.0:0.8251:0.0|0.1749:0.0:0.8251:0.0	.|.	222;125|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	V|R	125|278	ENSP00000353874:L125V|.	ENSP00000353874:L125V|.	L|P	-|-	1|2	2|0	TLR9|RP11-330H6.5	52232999|52232999	0.989000|0.989000	0.36119|0.36119	1.000000|1.000000	0.80357|0.80357	0.809000|0.809000	0.45718|0.45718	2.124000|2.124000	0.42006|0.42006	1.287000|1.287000	0.44583|0.44583	0.561000|0.561000	0.74099|0.74099	CTG|CCT	TLR9	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000239732		0.572	TLR9-001	KNOWN	basic|CCDS	protein_coding	TLR9	HGNC	protein_coding	OTTHUMT00000350203.1	93	0.00	0	G			52257959	52257959	-1	no_errors	ENST00000360658	ensembl	human	known	69_37n	missense	119	27.27	45	SNP	0.933	C
TMC8	147138	genome.wustl.edu	37	17	76135316	76135316	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:76135316G>C	ENST00000318430.5	+	15	2271	c.1897G>C	c.(1897-1899)Gtg>Ctg	p.V633L	TMC8_ENST00000591144.1_3'UTR|TMC8_ENST00000589691.1_Missense_Mutation_p.V410L	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	633					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GAAGCAGCTGGTGTGGGTGAG	0.632																																						dbGAP											0													67.0	59.0	62.0					17																	76135316		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1897G>C	17.37:g.76135316G>C	ENSP00000325561:p.Val633Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Missense_Mutation	SNP	pfam_TMC	p.V633L	ENST00000318430.5	37	c.1897	CCDS32749.1	17	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678349	0.47886	.	.	ENSG00000167895	ENST00000318430	T	0.76448	-1.02	5.01	-7.23	0.01480	.	0.669464	0.13450	N	0.387004	T	0.57446	0.2054	L	0.31664	0.95	0.28779	N	0.899923	B	0.09022	0.002	B	0.06405	0.002	T	0.39461	-0.9613	10	0.28530	T	0.3	-2.203	9.0041	0.36100	0.0717:0.5109:0.3216:0.0958	.	633	Q8IU68	TMC8_HUMAN	L	633	ENSP00000325561:V633L	ENSP00000325561:V633L	V	+	1	0	TMC8	73646911	1.000000	0.71417	0.959000	0.39883	0.958000	0.62258	0.294000	0.19047	-0.825000	0.04290	-0.353000	0.07706	GTG	TMC8	-	NULL	ENSG00000167895		0.632	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC8	HGNC	protein_coding	OTTHUMT00000436900.3	15	0.00	0	G			76135316	76135316	+1	no_errors	ENST00000318430	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.962	C
TMEM163	81615	genome.wustl.edu	37	2	135260481	135260481	+	Silent	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr2:135260481G>A	ENST00000281924.6	-	5	610	c.546C>T	c.(544-546)ctC>ctT	p.L182L		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	182						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		CCACTTCTGGGAGCAGCCTAG	0.532																																						dbGAP											0													135.0	109.0	118.0					2																	135260481		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.546C>T	2.37:g.135260481G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Silent	SNP	NULL	p.L182	ENST00000281924.6	37	c.546	CCDS2172.1	2																																																																																			TMEM163	-	NULL	ENSG00000152128		0.532	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM163	HGNC	protein_coding	OTTHUMT00000254631.2	55	0.00	0	G	NM_030923		135260481	135260481	-1	no_errors	ENST00000281924	ensembl	human	known	69_37n	silent	45	23.73	14	SNP	0.980	A
TMEM57	55219	genome.wustl.edu	37	1	25775352	25775352	+	Silent	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:25775352G>C	ENST00000374343.4	+	3	455	c.276G>C	c.(274-276)ctG>ctC	p.L92L	TMEM57_ENST00000399766.3_Silent_p.L92L|TMEM57_ENST00000399763.3_Intron	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	92					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		TAATATGCCTGCTGTTCATCC	0.358																																						dbGAP											0													151.0	141.0	144.0					1																	25775352		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.276G>C	1.37:g.25775352G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Silent	SNP	pfam_Macoilin,superfamily_Prefoldin	p.L92	ENST00000374343.4	37	c.276	CCDS30638.1	1																																																																																			TMEM57	-	pfam_Macoilin	ENSG00000204178		0.358	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	HGNC	protein_coding	OTTHUMT00000009659.2	45	0.00	0	G	NM_018202		25775352	25775352	+1	no_errors	ENST00000374343	ensembl	human	known	69_37n	silent	23	34.29	12	SNP	1.000	C
TNC	3371	genome.wustl.edu	37	9	117798471	117798471	+	Silent	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr9:117798471C>G	ENST00000350763.4	-	21	5973	c.5562G>C	c.(5560-5562)ctG>ctC	p.L1854L	TNC_ENST00000341037.4_Silent_p.L1672L|TNC_ENST00000346706.3_Silent_p.L1308L|TNC_ENST00000535648.1_Silent_p.L1399L|TNC_ENST00000537320.1_Silent_p.L1217L|TNC_ENST00000345230.3_Silent_p.L1217L|TNC_ENST00000542877.1_Silent_p.L1491L|TNC_ENST00000340094.3_Silent_p.L1490L|TNC_ENST00000423613.2_Silent_p.L1581L	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1854	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CGAGGTCGGTCAGAGCATACT	0.507																																						dbGAP											0													173.0	143.0	153.0					9																	117798471		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5562G>C	9.37:g.117798471C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.D417H	ENST00000350763.4	37	c.1249	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	9.816	1.184374	0.21870	.	.	ENSG00000041982	ENST00000544972	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	T	0.71467	0.3343	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70171	-0.4945	4	.	.	.	.	15.4761	0.75481	0.0:0.8611:0.1389:0.0	.	.	.	.	H	417	.	.	D	-	1	0	TNC	116838292	0.845000	0.29573	0.780000	0.31762	0.985000	0.73830	1.548000	0.36201	2.509000	0.84616	0.655000	0.94253	GAC	TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000041982		0.507	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	67	0.00	0	C	NM_002160		117798471	117798471	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000544972	ensembl	human	novel	69_37n	missense	37	44.78	30	SNP	0.999	G
TNFRSF8	943	genome.wustl.edu	37	1	12202521	12202521	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:12202521A>T	ENST00000263932.2	+	15	1943	c.1721A>T	c.(1720-1722)gAt>gTt	p.D574V	TNFRSF8_ENST00000413146.2_Missense_Mutation_p.D111V|TNFRSF8_ENST00000417814.2_Missense_Mutation_p.D462V|TNFRSF8_ENST00000479933.2_3'UTR	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	574					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	AGCTGCAGCGATGTCATGCTC	0.652																																						dbGAP											0													39.0	41.0	41.0					1																	12202521		2199	4298	6497	-	-	-	SO:0001583	missense	0			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.1721A>T	1.37:g.12202521A>T	ENSP00000263932:p.Asp574Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_8	p.D574V	ENST00000263932.2	37	c.1721	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	A	12.53	1.965338	0.34659	.	.	ENSG00000120949	ENST00000263932;ENST00000417814;ENST00000413146	T;T;T	0.33654	1.4;1.4;1.4	5.51	4.38	0.52667	.	0.613848	0.15313	N	0.268958	T	0.48589	0.1508	L	0.58101	1.795	0.28373	N	0.919927	D;D	0.63880	0.987;0.993	P;P	0.58660	0.726;0.843	T	0.43972	-0.9358	10	0.87932	D	0	-15.1267	8.2555	0.31754	0.9092:0.0:0.0908:0.0	.	462;574	D3YTD8;P28908	.;TNR8_HUMAN	V	574;462;111	ENSP00000263932:D574V;ENSP00000390650:D462V;ENSP00000398337:D111V	ENSP00000263932:D574V	D	+	2	0	TNFRSF8	12125108	0.557000	0.26546	0.354000	0.25760	0.032000	0.12392	2.463000	0.45058	0.922000	0.37019	0.533000	0.62120	GAT	TNFRSF8	-	prints_TNFR_8	ENSG00000120949		0.652	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	HGNC	protein_coding	OTTHUMT00000005130.1	64	0.00	0	A			12202521	12202521	+1	no_errors	ENST00000263932	ensembl	human	known	69_37n	missense	67	16.25	13	SNP	0.285	T
TP53	7157	genome.wustl.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:7578268A>C	ENST00000269305.4	-	6	770	c.581T>G	c.(580-582)cTt>cGt	p.L194R	TP53_ENST00000455263.2_Missense_Mutation_p.L194R|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.L194R|TP53_ENST00000445888.2_Missense_Mutation_p.L194R|TP53_ENST00000420246.2_Missense_Mutation_p.L194R|TP53_ENST00000359597.4_Missense_Mutation_p.L194R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	194	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L194R(47)|p.L194P(8)|p.L194H(8)|p.0?(8)|p.?(6)|p.L101R(5)|p.L62R(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.L194fs*15(1)|p.L194fs*14(1)|p.L101H(1)|p.L194fs*52(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.L62H(1)|p.I195fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTCGGATAAGATGCTGAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	108	Substitution - Missense(75)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(19)|lung(14)|ovary(14)|large_intestine(11)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(6)|oesophagus(6)|biliary_tract(5)|skin(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(2)|pancreas(2)|liver(2)|soft_tissue(1)|prostate(1)											97.0	87.0	90.0					17																	7578268		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.581T>G	17.37:g.7578268A>C	ENSP00000269305:p.Leu194Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L194R	ENST00000269305.4	37	c.581	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029856	0.54790	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.984;1.0;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-29.6709	13.709	0.62656	1.0:0.0:0.0:0.0	.	155;194;194;101;194;194;194	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	194;194;194;194;194;194;183;101;62;101;62	ENSP00000410739:L194R;ENSP00000352610:L194R;ENSP00000269305:L194R;ENSP00000398846:L194R;ENSP00000391127:L194R;ENSP00000391478:L194R;ENSP00000425104:L62R;ENSP00000423862:L101R	ENSP00000269305:L194R	L	-	2	0	TP53	7518993	1.000000	0.71417	0.300000	0.25030	0.031000	0.12232	9.287000	0.95975	2.183000	0.69458	0.533000	0.62120	CTT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	47	0.00	0	A	NM_000546		7578268	7578268	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	24	45.45	20	SNP	0.996	C
TRAV41	28640	genome.wustl.edu	37	14	22789079	22789079	+	RNA	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr14:22789079G>T	ENST00000390468.1	+	0	292									T cell receptor alpha variable 41																		GCACATCACAGCCTCCCATCC	0.493																																						dbGAP											0													35.0	38.0	37.0					14																	22789079		2046	4205	6251	-	-	-			0			AE000661		14q11.2	2012-02-07			ENSG00000211820	ENSG00000211820		"""T cell receptors / TRA locus"""	12142	other	T cell receptor gene						8188290	Standard	NG_001332		Approved	TCRAV19S1, TCRAV41S1			OTTHUMG00000170841		14.37:g.22789079G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A98S	ENST00000390468.1	37	c.292		14																																																																																			TRAV41	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211820		0.493	TRAV41-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRAV41	HGNC	TR_V_gene	OTTHUMT00000410667.1	18	0.00	0	G	NG_001332		22789079	22789079	+1	no_stop_codon	ENST00000390468	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.001	T
TRBV11-1	28582	genome.wustl.edu	37	7	142223866	142223866	+	RNA	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:142223866C>T	ENST00000390367.3	-	0	317									T cell receptor beta variable 11-1																		CCAAGCTCTGCAGGCTGGATC	0.512																																						dbGAP											0													101.0	100.0	101.0					7																	142223866		1968	4169	6137	-	-	-			0			M33233		7q34	2012-02-07			ENSG00000211720	ENSG00000211720		"""T cell receptors / TRB locus"""	12180	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV111, TCRBV11S1, TCRBV21S1			OTTHUMG00000158505		7.37:g.142223866C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.A101T	ENST00000390367.3	37	c.301		7																																																																																			TRBV11-1	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211720		0.512	TRBV11-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV11-1	HGNC	TR_V_gene	OTTHUMT00000351211.1	44	0.00	0	C	NG_001333		142223866	142223866	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390367	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	0.000	T
TRIM6	117854	genome.wustl.edu	37	11	5617965	5617965	+	Intron	SNP	C	C	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr11:5617965C>T	ENST00000278302.5	+	1	73				TRIM6_ENST00000380107.1_Intron|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000445329.1_5'Flank|HBG2_ENST00000380259.2_Intron|TRIM6_ENST00000515022.1_5'Flank|TRIM6_ENST00000507320.1_Intron|TRIM6_ENST00000506134.1_5'Flank|TRIM6-TRIM34_ENST00000354852.5_5'UTR|TRIM6_ENST00000380097.3_5'UTR	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6						protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTGCCTTTCTCGGAACGGAAC	0.557																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.-68+554C>T	11.37:g.5617965C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	RNA	SNP	-	NULL	ENST00000278302.5	37	NULL	CCDS31390.1	11																																																																																			TRIM6	-	-	ENSG00000121236		0.557	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6	HGNC	protein_coding	OTTHUMT00000143376.2	10	0.00	0	C	NM_001003818		5617965	5617965	+1	no_errors	ENST00000511284	ensembl	human	known	69_37n	rna	3	57.14	4	SNP	0.001	T
TRIOBP	11078	genome.wustl.edu	37	22	38150910	38150910	+	Silent	SNP	C	C	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr22:38150910C>G	ENST00000406386.3	+	13	5661	c.5406C>G	c.(5404-5406)acC>acG	p.T1802T	TRIOBP_ENST00000407319.2_Silent_p.T89T|TRIOBP_ENST00000403663.2_Silent_p.T89T	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1802	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCACCACCACCTCTACTTCGC	0.512																																						dbGAP											0													184.0	138.0	153.0					22																	38150910		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.5406C>G	22.37:g.38150910C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	NULL	p.P91R	ENST00000406386.3	37	c.272	CCDS43015.1	22																																																																																			TRIOBP	-	NULL	ENSG00000100106		0.512	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	58	0.00	0	C			38150910	38150910	+1	no_start_codon	ENST00000413051	ensembl	human	known	69_37n	missense	64	18.99	15	SNP	0.003	G
TSPEAR	54084	genome.wustl.edu	37	21	45953581	45953581	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr21:45953581G>A	ENST00000323084.4	-	3	594	c.529C>T	c.(529-531)Ctc>Ttc	p.L177F	TSPEAR_ENST00000397916.1_Missense_Mutation_p.L109F	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	177	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						TCCACCGGGAGGCCGCAGTCC	0.682																																						dbGAP											0													20.0	20.0	20.0					21																	45953581		2183	4269	6452	-	-	-	SO:0001583	missense	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.529C>T	21.37:g.45953581G>A	ENSP00000321987:p.Leu177Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_EAR	p.L177F	ENST00000323084.4	37	c.529	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	g	9.175	1.022108	0.19433	.	.	ENSG00000175894	ENST00000323084;ENST00000397916;ENST00000341581	T;T	0.46819	0.86;0.86	4.99	-0.638	0.11500	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);	0.857289	0.10253	N	0.696889	T	0.41190	0.1148	M	0.63428	1.95	0.21355	N	0.999711	P	0.43633	0.813	B	0.41988	0.372	T	0.33523	-0.9865	10	0.51188	T	0.08	-1.2105	3.7053	0.08398	0.1503:0.3806:0.329:0.14	.	177	Q8WU66	TSEAR_HUMAN	F	177;109;177	ENSP00000321987:L177F;ENSP00000381012:L109F	ENSP00000321987:L177F	L	-	1	0	TSPEAR	44778009	0.000000	0.05858	0.909000	0.35828	0.094000	0.18550	-0.522000	0.06237	0.120000	0.18254	-0.165000	0.13383	CTC	TSPEAR	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000175894		0.682	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	52	0.00	0	G	NM_144991		45953581	45953581	-1	no_errors	ENST00000323084	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	0.194	A
TTBK2	146057	genome.wustl.edu	37	15	43044687	43044687	+	Silent	SNP	A	A	G	rs552522869		TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr15:43044687A>G	ENST00000267890.6	-	14	2865	c.2757T>C	c.(2755-2757)tgT>tgC	p.C919C		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	919					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		TCTCTGAAACACAATGAAATA	0.448													A|||	1	0.000199681	0.0008	0.0	5008	,	,		20482	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													90.0	90.0	90.0					15																	43044687		1885	4096	5981	-	-	-	SO:0001819	synonymous_variant	0			AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2757T>C	15.37:g.43044687A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O94932|Q6ZN52|Q8IVV1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C919	ENST00000267890.6	37	c.2757	CCDS42029.1	15																																																																																			TTBK2	-	NULL	ENSG00000128881		0.448	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	HGNC	protein_coding	OTTHUMT00000431106.2	33	0.00	0	A	NM_173500		43044687	43044687	-1	no_errors	ENST00000267890	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	1.000	G
UNC13A	23025	genome.wustl.edu	37	19	17774364	17774364	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:17774364T>G	ENST00000519716.2	-	8	535	c.536A>C	c.(535-537)tAt>tCt	p.Y179S	UNC13A_ENST00000550896.1_Missense_Mutation_p.Y179S|UNC13A_ENST00000428389.2_Missense_Mutation_p.Y267S|UNC13A_ENST00000551649.1_Missense_Mutation_p.Y179S|UNC13A_ENST00000552293.1_Missense_Mutation_p.Y179S|UNC13A_ENST00000252773.7_Missense_Mutation_p.Y179S	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	179					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CCAGCCAAAATAATTCCAGTT	0.547																																						dbGAP											0													58.0	54.0	55.0					19																	17774364		1923	4127	6050	-	-	-	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.536A>C	19.37:g.17774364T>G	ENSP00000429562:p.Tyr179Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.Y267S	ENST00000519716.2	37	c.800	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	T	13.18	2.159602	0.38119	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.81330	-1.46;-1.48;-1.46;-1.33;-1.33;-1.46	4.33	4.33	0.51752	.	0.210227	0.31697	U	0.007218	T	0.80259	0.4590	N	0.19112	0.55	0.35065	D	0.761975	D	0.65815	0.995	D	0.70487	0.969	T	0.83172	-0.0093	10	0.33940	T	0.23	-8.5042	11.7661	0.51930	0.0:0.0:0.0:1.0	.	179	Q9UPW8	UN13A_HUMAN	S	179;267;179;179;179;179	ENSP00000429562:Y179S;ENSP00000400409:Y267S;ENSP00000252773:Y179S;ENSP00000447236:Y179S;ENSP00000447572:Y179S;ENSP00000446831:Y179S	ENSP00000252773:Y179S	Y	-	2	0	UNC13A	17635364	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.389000	0.73199	1.724000	0.51502	0.254000	0.18369	TAT	UNC13A	-	NULL	ENSG00000130477		0.547	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	19	0.00	0	T	XM_038604		17774364	17774364	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	1.000	G
VIT	5212	genome.wustl.edu	37	2	36986166	36986166	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr2:36986166C>A	ENST00000389975.3	+	6	766	c.464C>A	c.(463-465)tCg>tAg	p.S155*	VIT_ENST00000401530.1_Nonsense_Mutation_p.S155*|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000457137.2_Nonsense_Mutation_p.S155*|VIT_ENST00000404084.1_Nonsense_Mutation_p.S133*|VIT_ENST00000379242.3_Nonsense_Mutation_p.S155*|VIT_ENST00000379241.3_Nonsense_Mutation_p.S155*	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	155					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				TACTCATCATCGAAAAGTCCA	0.423																																						dbGAP											0													136.0	138.0	137.0					2																	36986166		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.464C>A	2.37:g.36986166C>A	ENSP00000374625:p.Ser155*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Nonsense_Mutation	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.S155*	ENST00000389975.3	37	c.464	CCDS54347.1	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807820	0.90623	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000402257;ENST00000457137;ENST00000404084;ENST00000379241;ENST00000401530	.	.	.	5.06	4.16	0.48862	.	0.619812	0.17931	N	0.157175	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0873	12.3949	0.55378	0.0:0.8305:0.1695:0.0	.	.	.	.	X	155;155;155;155;133;155;155	.	ENSP00000368543:S155X	S	+	2	0	VIT	36839670	0.046000	0.20272	0.085000	0.20634	0.845000	0.48019	3.648000	0.54410	1.097000	0.41459	0.555000	0.69702	TCG	VIT	-	NULL	ENSG00000205221		0.423	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		35	0.00	0	C			36986166	36986166	+1	no_errors	ENST00000379242	ensembl	human	known	69_37n	nonsense	31	29.55	13	SNP	0.022	A
VRTN	55237	genome.wustl.edu	37	14	74825096	74825096	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr14:74825096C>A	ENST00000256362.4	+	2	1851	c.1610C>A	c.(1609-1611)tCa>tAa	p.S537*		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	537					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						CCCAGCCTGTCACCTTCTGCC	0.657																																						dbGAP											0													76.0	78.0	77.0					14																	74825096		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1610C>A	14.37:g.74825096C>A	ENSP00000256362:p.Ser537*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVC7	Nonsense_Mutation	SNP	pfam_Transposase_8	p.S537*	ENST00000256362.4	37	c.1610	CCDS9830.1	14	.	.	.	.	.	.	.	.	.	.	C	38	6.903287	0.97924	.	.	ENSG00000133980	ENST00000256362	.	.	.	4.29	3.4	0.38934	.	0.081535	0.51477	U	0.000094	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.598	10.1068	0.42539	0.0:0.9071:0.0:0.0929	.	.	.	.	X	537	.	ENSP00000256362:S537X	S	+	2	0	VRTN	73894849	1.000000	0.71417	0.601000	0.28877	0.662000	0.39071	3.757000	0.55212	1.012000	0.39366	0.491000	0.48974	TCA	VRTN	-	NULL	ENSG00000133980		0.657	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VRTN	HGNC	protein_coding	OTTHUMT00000412339.1	66	0.00	0	C	NM_018228		74825096	74825096	+1	no_errors	ENST00000256362	ensembl	human	known	69_37n	nonsense	82	20.39	21	SNP	0.959	A
WDR24	84219	genome.wustl.edu	37	16	737252	737252	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr16:737252T>A	ENST00000248142.6	-	7	1213	c.1214A>T	c.(1213-1215)gAc>gTc	p.D405V	LA16c-313D11.12_ENST00000566927.1_RNA|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000412368.2_5'Flank|JMJD8_ENST00000562111.1_5'Flank|WDR24_ENST00000293883.4_Missense_Mutation_p.D275V|JMJD8_ENST00000454700.1_5'Flank|JMJD8_ENST00000609261.1_5'Flank			Q96S15	WDR24_HUMAN	WD repeat domain 24	405										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				GATGTTGTGGTCCACCATCAT	0.637																																						dbGAP											0													47.0	49.0	48.0					16																	737252		2200	4300	6500	-	-	-	SO:0001583	missense	0			AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.1214A>T	16.37:g.737252T>A	ENSP00000248142:p.Asp405Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D405V	ENST00000248142.6	37	c.1214		16	.	.	.	.	.	.	.	.	.	.	T	14.86	2.662513	0.47572	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.50813	0.73;0.73	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.67720	0.2923	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72727	-0.4206	10	0.87932	D	0	-38.1027	12.6687	0.56855	0.0:0.0:0.0:1.0	.	275	Q96S15-2	.	V	405;275	ENSP00000248142:D405V;ENSP00000293883:D275V	ENSP00000248142:D405V	D	-	2	0	WDR24	677253	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	7.117000	0.77129	1.921000	0.55644	0.533000	0.62120	GAC	WDR24	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000127580		0.637	WDR24-201	KNOWN	basic	protein_coding	WDR24	HGNC	protein_coding		31	0.00	0	T	NM_032259		737252	737252	-1	no_errors	ENST00000248142	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	1.000	A
WDTC1	23038	genome.wustl.edu	37	1	27633956	27633956	+	3'UTR	SNP	C	C	T	rs41291072	byFrequency	TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr1:27633956C>T	ENST00000319394.3	+	0	3651				WDTC1_ENST00000361771.3_3'UTR	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1						cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		CCTCTGCCCCCGGCTCTTAGC	0.622													C|||	24	0.00479233	0.0008	0.0014	5008	,	,		15103	0.0		0.0169	False		,,,				2504	0.0051					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.*1082C>T	1.37:g.27633956C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	RNA	SNP	-	NULL	ENST00000319394.3	37	NULL		1																																																																																			WDTC1	-	-	ENSG00000142784		0.622	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	WDTC1	HGNC	protein_coding		31	0.00	0	C	NM_015023		27633956	27633956	+1	no_errors	ENST00000491239	ensembl	human	known	69_37n	rna	34	17.07	7	SNP	0.004	T
WFIKKN2	124857	genome.wustl.edu	37	17	48917995	48917995	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr17:48917995A>T	ENST00000311378.4	+	2	1874	c.1346A>T	c.(1345-1347)aAg>aTg	p.K449M	RP11-506D12.5_ENST00000572491.2_RNA|WFIKKN2_ENST00000426127.1_Missense_Mutation_p.K356M	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	449	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CGGGCCTGCAAGCCTCGGCAG	0.642																																						dbGAP											0													41.0	43.0	42.0					17																	48917995		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.1346A>T	17.37:g.48917995A>T	ENSP00000311184:p.Lys449Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXZ9	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Netrin_module_non-TIMP,pfam_Whey_acidic_protein_4-diS_core,pfam_Kazal-type_dom,pfam_Ig_V-set,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like,prints_Prot_inh_Kunz-m	p.K449M	ENST00000311378.4	37	c.1346	CCDS11575.1	17	.	.	.	.	.	.	.	.	.	.	A	17.56	3.420049	0.62622	.	.	ENSG00000173714	ENST00000426127;ENST00000311378;ENST00000393226	T;T	0.35421	1.31;1.31	5.38	3.06	0.35304	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.000000	0.85682	D	0.000000	T	0.50820	0.1638	M	0.71581	2.175	0.58432	D	0.999996	D	0.69078	0.997	P	0.62813	0.907	T	0.53697	-0.8402	10	0.72032	D	0.01	.	7.8935	0.29693	0.7893:0.1384:0.0723:0.0	.	449	Q8TEU8	WFKN2_HUMAN	M	356;449;155	ENSP00000405889:K356M;ENSP00000311184:K449M	ENSP00000311184:K449M	K	+	2	0	WFIKKN2	46272994	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	4.461000	0.60115	2.050000	0.60909	0.454000	0.30748	AAG	WFIKKN2	-	superfamily_TIMP-like_OB-fold,pfscan_Netrin_domain	ENSG00000173714		0.642	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN2	HGNC	protein_coding	OTTHUMT00000368358.1	26	0.00	0	A	NM_175575		48917995	48917995	+1	no_errors	ENST00000311378	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	T
ZNF208	7757	genome.wustl.edu	37	19	22156813	22156813	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:22156813G>T	ENST00000397126.4	-	4	1171	c.1023C>A	c.(1021-1023)taC>taA	p.Y341*	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTTTACATTTGTAGGGCTTCT	0.398																																						dbGAP											0													47.0	49.0	49.0					19																	22156813		2047	4203	6250	-	-	-	SO:0001587	stop_gained	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1023C>A	19.37:g.22156813G>T	ENSP00000380315:p.Tyr341*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y341*	ENST00000397126.4	37	c.1023	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460762	0.63513	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	.	.	.	2.65	-1.87	0.07737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8699	0.29561	0.5104:0.0:0.4896:0.0	.	.	.	.	X	341	.	ENSP00000380315:Y341X	Y	-	3	2	ZNF208	21948653	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.090000	0.11163	-0.264000	0.09365	0.306000	0.20318	TAC	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.398	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	28	0.00	0	G	NM_007153		22156813	22156813	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	nonsense	12	57.14	16	SNP	0.000	T
ZNF394	84124	genome.wustl.edu	37	7	99092017	99092017	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr7:99092017C>A	ENST00000337673.6	-	3	1024	c.821G>T	c.(820-822)gGt>gTt	p.G274V	ZNF394_ENST00000394177.3_5'Flank|ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000426306.2_3'UTR	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	274					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TTCTATGGAACCATTCTTATT	0.473																																					Ovarian(24;589 697 9939 12704 40742)	dbGAP											0													134.0	127.0	130.0					7																	99092017		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.821G>T	7.37:g.99092017C>A	ENSP00000337363:p.Gly274Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.G274V	ENST00000337673.6	37	c.821	CCDS5666.1	7	.	.	.	.	.	.	.	.	.	.	C	7.317	0.616105	0.14129	.	.	ENSG00000160908	ENST00000337673	T	0.04917	3.53	3.65	-0.653	0.11447	.	0.617589	0.14510	N	0.315162	T	0.02533	0.0077	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.43653	-0.9378	10	0.27082	T	0.32	.	2.8716	0.05618	0.3223:0.4337:0.1477:0.0963	.	274	Q53GI3	ZN394_HUMAN	V	274	ENSP00000337363:G274V	ENSP00000337363:G274V	G	-	2	0	ZNF394	98929953	0.021000	0.18746	0.000000	0.03702	0.038000	0.13279	0.680000	0.25306	-0.136000	0.11475	-0.140000	0.14226	GGT	ZNF394	-	NULL	ENSG00000160908		0.473	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF394	HGNC	protein_coding	OTTHUMT00000336498.1	27	0.00	0	C	NM_032164		99092017	99092017	-1	no_errors	ENST00000337673	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.000	A
ZNRF4	148066	genome.wustl.edu	37	19	5456653	5456653	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5EH-01A-11D-A28B-09	TCGA-AC-A5EH-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	571dac9a-a2d6-4d29-ae22-111cd9822c1a	8eea835b-f1ff-4efc-805e-149e5e2bd9c5	g.chr19:5456653G>C	ENST00000222033.4	+	1	1228	c.1151G>C	c.(1150-1152)tGg>tCg	p.W384S		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	384						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CCCCCCATCTGGGCCATTCAA	0.657																																						dbGAP											0													36.0	43.0	41.0					19																	5456653		1967	4146	6113	-	-	-	SO:0001583	missense	0			AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.1151G>C	19.37:g.5456653G>C	ENSP00000222033:p.Trp384Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K886|O75866	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.W384S	ENST00000222033.4	37	c.1151	CCDS42475.1	19	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750733	0.31046	.	.	ENSG00000105428	ENST00000222033	T	0.04406	3.63	3.47	3.47	0.39725	.	0.166737	0.40640	U	0.001042	T	0.09642	0.0237	L	0.32530	0.975	0.48632	D	0.999682	D	0.76494	0.999	D	0.66716	0.946	T	0.41106	-0.9527	10	0.16896	T	0.51	-19.7131	11.1698	0.48565	0.0:0.0:1.0:0.0	.	384	Q8WWF5	ZNRF4_HUMAN	S	384	ENSP00000222033:W384S	ENSP00000222033:W384S	W	+	2	0	ZNRF4	5407653	1.000000	0.71417	0.959000	0.39883	0.043000	0.13939	1.686000	0.37669	1.891000	0.54761	0.561000	0.74099	TGG	ZNRF4	-	NULL	ENSG00000105428		0.657	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF4	HGNC	protein_coding	OTTHUMT00000450924.1	20	0.00	0	G	NM_181710		5456653	5456653	+1	no_errors	ENST00000222033	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.944	C
