#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AASDH	132949	genome.wustl.edu	37	4	57250392	57250392	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr4:57250392C>G	ENST00000205214.6	-	2	254	c.74G>C	c.(73-75)tGc>tCc	p.C25S	AASDH_ENST00000602986.1_5'UTR|AASDH_ENST00000434343.2_5'UTR|AASDH_ENST00000451613.1_Missense_Mutation_p.C25S|AASDH_ENST00000510762.1_Intron|AASDH_ENST00000502617.1_Missense_Mutation_p.C25S|AASDH_ENST00000513376.1_Intron	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	25					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CTGGTTGTTGCATTCATCAAA	0.378																																						dbGAP											0													123.0	113.0	116.0					4																	57250392		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.74G>C	4.37:g.57250392C>G	ENSP00000205214:p.Cys25Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl_carrier_prot-like,superfamily_Quinonprotein_ADH-like,superfamily_Acyl_carrier_prot-like,smart_PQQ_beta_propeller_repeat,pfscan_Acyl_carrier_prot-like	p.C25S	ENST00000205214.6	37	c.74	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582635	0.46006	.	.	ENSG00000157426	ENST00000205214;ENST00000451613;ENST00000502617	T;T;T	0.46063	0.88;2.97;0.88	5.92	5.92	0.95590	.	0.178398	0.64402	D	0.000007	T	0.28034	0.0691	N	0.17082	0.46	0.23862	N	0.99664	B;B;B;B	0.25955	0.138;0.085;0.138;0.085	B;B;B;B	0.23150	0.044;0.012;0.044;0.012	T	0.12578	-1.0542	10	0.24483	T	0.36	-7.1805	14.7375	0.69427	0.1447:0.8553:0.0:0.0	.	25;25;25;25	Q4L235-4;B4E2K0;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	S	25	ENSP00000205214:C25S;ENSP00000409656:C25S;ENSP00000421171:C25S	ENSP00000205214:C25S	C	-	2	0	AASDH	56945149	0.971000	0.33674	0.976000	0.42696	0.988000	0.76386	2.887000	0.48586	2.822000	0.97130	0.650000	0.86243	TGC	AASDH	-	NULL	ENSG00000157426		0.378	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	HGNC	protein_coding	OTTHUMT00000250780.1	60	0.00	0	C	NM_181806		57250392	57250392	-1	no_errors	ENST00000205214	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	0.936	G
ADAMTS9	56999	genome.wustl.edu	37	3	64536720	64536720	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr3:64536720C>T	ENST00000498707.1	-	31	5059	c.4717G>A	c.(4717-4719)Gaa>Aaa	p.E1573K	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.E1545K	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1573	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTGGAGCCTTCGCCGCAGGTC	0.488																																						dbGAP											0													147.0	131.0	137.0					3																	64536720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4717G>A	3.37:g.64536720C>T	ENSP00000418735:p.Glu1573Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.E1573K	ENST00000498707.1	37	c.4717	CCDS2903.1	3	.	.	.	.	.	.	.	.	.	.	C	12.48	1.951554	0.34471	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.49139	0.79;0.79	5.83	2.03	0.26663	.	0.405123	0.26955	N	0.021655	T	0.22282	0.0537	N	0.21373	0.66	0.80722	D	1	B;P;B	0.46277	0.027;0.875;0.027	B;B;B	0.33960	0.044;0.173;0.044	T	0.30238	-0.9985	10	0.02654	T	1	.	10.7396	0.46145	0.0:0.7402:0.0:0.2598	.	1545;1573;1573	B7ZVX9;Q9P2N4-1;Q9P2N4	.;.;ATS9_HUMAN	K	1545;1573	ENSP00000295903:E1545K;ENSP00000418735:E1573K	ENSP00000295903:E1545K	E	-	1	0	ADAMTS9	64511760	0.000000	0.05858	0.312000	0.25196	0.805000	0.45488	0.368000	0.20399	0.383000	0.24910	0.585000	0.79938	GAA	ADAMTS9	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000163638		0.488	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	98	0.00	0	C			64536720	64536720	-1	no_errors	ENST00000498707	ensembl	human	known	69_37n	missense	81	22.12	23	SNP	0.807	T
C19orf25	148223	genome.wustl.edu	37	19	1474870	1474872	+	3'UTR	DEL	GAC	GAC	-			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	GAC	GAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr19:1474870_1474872delGAC	ENST00000436106.2	-	0	911_913				C19orf25_ENST00000591027.1_5'Flank|C19orf25_ENST00000586564.1_3'UTR|C19orf25_ENST00000588427.1_Intron|C19orf25_ENST00000588871.1_In_Frame_Del_p.R142del|C19orf25_ENST00000427685.2_3'UTR|C19orf25_ENST00000588849.1_3'UTR			Q9UFG5	CS025_HUMAN	chromosome 19 open reading frame 25														Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCATGAATGAGACGACGGATGAA	0.645																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK075267	CCDS45898.1	19p13.3	2012-10-24			ENSG00000119559	ENSG00000119559			26711	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_152482		Approved	FLJ36666	uc010dsk.3	Q9UFG5	OTTHUMG00000180092	ENST00000436106.2:c.*161GTC>-	19.37:g.1474873_1474875delGAC		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQN6|Q8N9R7|Q8WV94	In_Frame_Del	DEL	NULL	p.R142in_frame_del	ENST00000436106.2	37	c.427_425	CCDS45898.1	19																																																																																			C19orf25	-	NULL	ENSG00000119559		0.645	C19orf25-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C19orf25	HGNC	protein_coding	OTTHUMT00000449694.1	59	0.00	0	GAC	NM_152482		1474870	1474872	-1	no_errors	ENST00000588871	ensembl	human	putative	69_37n	in_frame_del	22	29.03	9	DEL	0.004:0.005:0.004	-
C9orf89	84270	genome.wustl.edu	37	9	95874071	95874071	+	3'UTR	SNP	G	G	A	rs55875720	byFrequency	TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr9:95874071G>A	ENST00000488630.1	+	0	1898				C9orf89_ENST00000375464.2_Intron			Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89						negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						GCCCCAGGAGGCAGCAGCAAC	0.602													G|||	8	0.00159744	0.0	0.0014	5008	,	,		17016	0.0		0.004	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	ENST00000488630.1:c.*1895G>A	9.37:g.95874071G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BJH8|Q9BSY2	RNA	SNP	-	NULL	ENST00000488630.1	37	NULL		9																																																																																			C9orf89	-	-	ENSG00000165233		0.602	C9orf89-009	KNOWN	basic	processed_transcript	C9orf89	HGNC	protein_coding	OTTHUMT00000053136.1	67	0.00	0	G	NM_032310		95874071	95874071	+1	no_errors	ENST00000488630	ensembl	human	known	69_37n	rna	35	20.45	9	SNP	0.000	A
CACNA1E	777	genome.wustl.edu	37	1	181767517	181767517	+	Silent	SNP	G	G	A	rs377180948		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr1:181767517G>A	ENST00000367573.2	+	48	6489	c.6489G>A	c.(6487-6489)ccG>ccA	p.P2163P	CACNA1E_ENST00000526775.1_Silent_p.P2101P|CACNA1E_ENST00000357570.5_Silent_p.P2114P|CACNA1E_ENST00000367570.1_Silent_p.P2120P|CACNA1E_ENST00000358338.5_Silent_p.P2052P|CACNA1E_ENST00000367567.4_Silent_p.P1727P|CACNA1E_ENST00000360108.3_Silent_p.P2144P	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2163					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.P2120P(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CACCCGTCCCGCCAAAGCCCC	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16398	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	ovary(1)											79.0	91.0	87.0					1																	181767517		1989	4156	6145	-	-	-	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6489G>A	1.37:g.181767517G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.P2163	ENST00000367573.2	37	c.6489	CCDS55664.1	1																																																																																			CACNA1E	-	NULL	ENSG00000198216		0.627	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	43	0.00	0	G	NM_000721		181767517	181767517	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	silent	32	20.00	8	SNP	0.206	A
CACNB3	784	genome.wustl.edu	37	12	49220166	49220166	+	Silent	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr12:49220166G>A	ENST00000301050.2	+	10	958	c.759G>A	c.(757-759)gaG>gaA	p.E253E	CACNB3_ENST00000540990.1_Silent_p.E240E|CACNB3_ENST00000547230.1_Silent_p.E212E|CACNB3_ENST00000547392.1_Silent_p.E226E|CACNB3_ENST00000536187.2_Silent_p.E252E	NM_000725.3	NP_000716.2	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3 subunit	253					axon guidance (GO:0007411)|calcium ion transport (GO:0006816)|membrane depolarization (GO:0051899)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|membrane (GO:0016020)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(1)|large_intestine(5)|lung(4)|prostate(1)	12					Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	TGCAGAGTGAGATCGAGCGCA	0.602																																						dbGAP											0													84.0	71.0	76.0					12																	49220166		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8769.1, CCDS55821.1, CCDS55822.1, CCDS55823.1	12q13	2008-05-02				ENSG00000167535		"""Calcium channel subunits"""	1403	protein-coding gene	gene with protein product		601958		CACNLB3		8119293	Standard	NM_000725		Approved		uc010sly.2	P54284		ENST00000301050.2:c.759G>A	12.37:g.49220166G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Z4|B7Z4Q1|B7Z973|B7ZAK8|F5GZW7|F5H2P6|F8VSG3|Q13913	Silent	SNP	pfam_Guanylate_kin,pfam_VDCC_L_bsu,superfamily_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,prints_VDCC_L_bsu,prints_VDCC_L_b3su	p.E253	ENST00000301050.2	37	c.759	CCDS8769.1	12																																																																																			CACNB3	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,prints_VDCC_L_bsu	ENSG00000167535		0.602	CACNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNB3	HGNC	protein_coding	OTTHUMT00000408886.1	40	0.00	0	G			49220166	49220166	+1	no_errors	ENST00000301050	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	1.000	A
CARS	833	genome.wustl.edu	37	11	3061080	3061080	+	Silent	SNP	C	C	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr11:3061080C>A	ENST00000397111.5	-	4	533	c.288G>T	c.(286-288)acG>acT	p.T96T	CARS_ENST00000278224.9_Silent_p.T96T|CARS_ENST00000380525.4_Silent_p.T179T|CARS-AS1_ENST00000499962.1_RNA|CARS_ENST00000401769.3_Silent_p.T109T|CARS_ENST00000397114.3_Silent_p.T86T			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	96					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CATCAATATCCGTAATGTTCA	0.299			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)	dbGAP		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	0													119.0	110.0	113.0					11																	3061080		2199	4298	6497	-	-	-	SO:0001819	synonymous_variant	0			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.288G>T	11.37:g.3061080C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Silent	SNP	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-synt	p.T179	ENST00000397111.5	37	c.537	CCDS7742.1	11																																																																																			CARS	-	pfam_Cys-tRNA/MSH_ligase,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-synt	ENSG00000110619		0.299	CARS-001	KNOWN	basic|CCDS	protein_coding	CARS	HGNC	protein_coding	OTTHUMT00000030117.4	69	0.00	0	C	NM_001751		3061080	3061080	-1	no_errors	ENST00000380525	ensembl	human	known	69_37n	silent	33	23.26	10	SNP	0.111	A
CCDC136	64753	genome.wustl.edu	37	7	128441410	128441410	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr7:128441410G>T	ENST00000297788.4	+	4	884	c.517G>T	c.(517-519)Gag>Tag	p.E173*	CCDC136_ENST00000378685.4_Nonsense_Mutation_p.E223*|CCDC136_ENST00000464832.1_Nonsense_Mutation_p.E223*|CCDC136_ENST00000487361.1_Nonsense_Mutation_p.E173*	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	173	Glu-rich.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						ATCCCTGCAGGAGGATCTCTG	0.512																																						dbGAP											0													56.0	58.0	57.0					7																	128441410		2013	4189	6202	-	-	-	SO:0001587	stop_gained	0				CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.517G>T	7.37:g.128441410G>T	ENSP00000297788:p.Glu173*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Nonsense_Mutation	SNP	NULL	p.E173*	ENST00000297788.4	37	c.517	CCDS47704.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.123108|6.123108	0.97305|0.97305	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000378685;ENST00000464832;ENST00000487361;ENST00000297788;ENST00000397697;ENST00000320524|ENST00000494552	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.094405|.	0.64402|.	D|.	0.000001|.	.|T	.|0.73753	.|0.3627	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72276	.|-0.4341	.|3	0.15066|.	T|.	0.55|.	-13.874|-13.874	17.2136|17.2136	0.86937|0.86937	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|S	223;223;173;173;173;173|49	.|.	ENSP00000297788:E173X|.	E|R	+|+	1|3	0|2	CCDC136|CCDC136	128228646|128228646	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.156000|0.156000	0.22039|0.22039	7.865000|7.865000	0.87049|0.87049	2.668000|2.668000	0.90789|0.90789	0.655000|0.655000	0.94253|0.94253	GAG|AGG	CCDC136	-	NULL	ENSG00000128596		0.512	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC136	HGNC	protein_coding	OTTHUMT00000350641.1	27	0.00	0	G	NM_022742		128441410	128441410	+1	no_errors	ENST00000297788	ensembl	human	known	69_37n	nonsense	13	60.61	20	SNP	1.000	T
CCDC68	80323	genome.wustl.edu	37	18	52608233	52608233	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr18:52608233C>A	ENST00000591504.1	-	4	473	c.199G>T	c.(199-201)Gca>Tca	p.A67S	CCDC68_ENST00000337363.4_Missense_Mutation_p.A67S|CCDC68_ENST00000432185.1_Missense_Mutation_p.A67S	NM_025214.2	NP_079490.1	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68	67										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|stomach(1)	14				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		ATTACCTTTGCATCTAGTTTG	0.328																																						dbGAP											0													210.0	194.0	199.0					18																	52608233		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11959.1	18q21	2006-02-07			ENSG00000166510	ENSG00000166510			24350	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma associated antigen"""					11149944, 15142679	Standard	NM_025214		Approved	SE57-1	uc002lft.3	Q9H2F9	OTTHUMG00000132708	ENST00000591504.1:c.199G>T	18.37:g.52608233C>A	ENSP00000466690:p.Ala67Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9I3	Missense_Mutation	SNP	superfamily_Prefoldin	p.A67S	ENST00000591504.1	37	c.199	CCDS11959.1	18	.	.	.	.	.	.	.	.	.	.	C	0.497	-0.872713	0.02570	.	.	ENSG00000166510	ENST00000337363;ENST00000432185	T;T	0.21031	2.03;2.03	4.92	-0.411	0.12370	.	0.788027	0.11362	N	0.571848	T	0.10895	0.0266	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.40627	-0.9553	10	0.06891	T	0.86	-0.1316	5.1813	0.15161	0.207:0.5332:0.0:0.2598	.	67	Q9H2F9	CCD68_HUMAN	S	67	ENSP00000337209:A67S;ENSP00000413406:A67S	ENSP00000337209:A67S	A	-	1	0	CCDC68	50759231	0.004000	0.15560	0.082000	0.20525	0.006000	0.05464	-0.295000	0.08298	0.003000	0.14656	-0.961000	0.02630	GCA	CCDC68	-	NULL	ENSG00000166510		0.328	CCDC68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC68	HGNC	protein_coding	OTTHUMT00000256006.1	84	0.00	0	C	NM_025214		52608233	52608233	-1	no_errors	ENST00000337363	ensembl	human	known	69_37n	missense	77	12.50	11	SNP	0.021	A
CCDC74B	91409	genome.wustl.edu	37	2	130898839	130898839	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr2:130898839T>C	ENST00000310463.6	-	4	712	c.575A>G	c.(574-576)aAc>aGc	p.N192S	CCDC74B_ENST00000392984.3_Missense_Mutation_p.N294S|CCDC74B_ENST00000409943.3_Missense_Mutation_p.N126S|CCDC74B_ENST00000409128.1_Missense_Mutation_p.N168S|MED15P9_ENST00000427638.1_RNA	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B	192										endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					ATCTTGCTTGTTGAAGGAGCC	0.592																																						dbGAP											0													96.0	72.0	80.0					2																	130898839		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.575A>G	2.37:g.130898839T>C	ENSP00000308873:p.Asn192Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NW18	Missense_Mutation	SNP	NULL	p.N294S	ENST00000310463.6	37	c.881	CCDS2155.1	2	.	.	.	.	.	.	.	.	.	.	.	2.661	-0.279694	0.05642	.	.	ENSG00000152076	ENST00000409943;ENST00000310463;ENST00000392984;ENST00000409488;ENST00000409128;ENST00000418636	T;T;T;T	0.46063	1.96;1.97;1.89;0.88	2.39	0.446	0.16602	.	0.578855	0.13935	U	0.352616	T	0.20373	0.0490	N	0.14661	0.345	0.18873	N	0.999984	B;B;B	0.28258	0.001;0.002;0.205	B;B;B	0.26770	0.001;0.004;0.073	T	0.13845	-1.0494	10	0.33141	T	0.24	-8.5003	3.8296	0.08868	0.0:0.3681:0.0:0.6319	.	294;126;192	E7ESC5;Q96LY2-2;Q96LY2	.;.;CC74B_HUMAN	S	126;192;294;130;168;151	ENSP00000386294:N126S;ENSP00000308873:N192S;ENSP00000376710:N294S;ENSP00000386644:N168S	ENSP00000308873:N192S	N	-	2	0	CCDC74B	130615309	1.000000	0.71417	0.917000	0.36280	0.122000	0.20287	1.238000	0.32707	0.181000	0.19994	0.248000	0.18094	AAC	CCDC74B	-	NULL	ENSG00000152076		0.592	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74B	HGNC	protein_coding	OTTHUMT00000254522.3	97	0.00	0	T	NM_207310		130898839	130898839	-1	no_errors	ENST00000392984	ensembl	human	known	69_37n	missense	64	11.11	8	SNP	0.598	C
CD72	971	genome.wustl.edu	37	9	35617158	35617158	+	Intron	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr9:35617158C>T	ENST00000396757.1	-	4	427				CD72_ENST00000378430.3_Missense_Mutation_p.A93T|CD72_ENST00000378431.1_Intron|CD72_ENST00000490239.1_Intron|CD72_ENST00000259633.4_Intron			P21854	CD72_HUMAN	CD72 molecule						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGCTGCCCCGCACAGGCACAC	0.711																																						dbGAP											0													15.0	15.0	15.0					9																	35617158		2148	4191	6339	-	-	-	SO:0001627	intron_variant	0				CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.262+14G>A	9.37:g.35617158C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A93T	ENST00000396757.1	37	c.277	CCDS6581.1	9	.	.	.	.	.	.	.	.	.	.	C	10.72	1.430735	0.25726	.	.	ENSG00000137101	ENST00000378430	T	0.60920	0.15	1.67	-2.99	0.05497	.	.	.	.	.	T	0.36744	0.0978	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.27502	-1.0072	6	0.23891	T	0.37	.	3.6447	0.08180	0.2214:0.4345:0.344:0.0	.	.	.	.	T	93	ENSP00000367687:A93T	ENSP00000367687:A93T	A	-	1	0	CD72	35607158	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.232000	0.09055	-0.651000	0.05415	-0.397000	0.06425	GCG	CD72	-	NULL	ENSG00000137101		0.711	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD72	HGNC	protein_coding	OTTHUMT00000052336.1	48	0.00	0	C	NM_001782		35617158	35617158	-1	no_errors	ENST00000378430	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.000	T
CD93	22918	genome.wustl.edu	37	20	23066789	23066791	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	AGC	AGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr20:23066789_23066791delAGC	ENST00000246006.4	-	1	186_188	c.39_41delGCT	c.(37-42)ctgctc>ctc	p.13_14LL>L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	13					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CTGGGTcaggagcagcagcagca	0.709																																						dbGAP											0										4,187,3873		0,0,4,17,153,1858						-10.7	0.0			6	5,391,7426		0,0,5,22,347,3537	no	codingComplex	CD93	NM_012072.3		0,0,9,39,500,5395	A1A1,A1A2,A1R,A2A2,A2R,RR		5.0626,4.6998,4.9386				9,578,11299				-	-	-	SO:0001651	inframe_deletion	0			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.39_41delGCT	20.37:g.23066798_23066800delAGC	ENSP00000246006:p.Leu15del	Somatic		WXS	Illumina GAIIx	Phase_IV	O00274	In_Frame_Del	DEL	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_MFS_dom_general_subst_transpt,smart_C-type_lectin,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_CD93/CD141,pfscan_EG-like_dom,pfscan_C-type_lectin	p.L15in_frame_del	ENST00000246006.4	37	c.41_39	CCDS13149.1	20																																																																																			CD93	-	pirsf_CD93/CD141	ENSG00000125810		0.709	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	HGNC	protein_coding	OTTHUMT00000078312.2	33	0.00	0	AGC	NM_012072		23066789	23066791	-1	no_errors	ENST00000246006	ensembl	human	known	69_37n	in_frame_del	18	14.29	3	DEL	0.176:0.289:0.517	-
CHRNA4	1137	genome.wustl.edu	37	20	61978071	61978071	+	3'UTR	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr20:61978071G>A	ENST00000370263.4	-	0	2124				CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)						action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CCCAGGCCACGCAGGCTCCCG	0.677																																						dbGAP											0													39.0	27.0	31.0					20																	61978071		2193	4295	6488	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.*19C>T	20.37:g.61978071G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JGR7|Q4VAQ5|Q4VAQ6	RNA	SNP	-	NULL	ENST00000370263.4	37	NULL	CCDS13517.1	20																																																																																			CHRNA4	-	-	ENSG00000101204		0.677	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	HGNC	protein_coding	OTTHUMT00000080508.3	44	0.00	0	G			61978071	61978071	-1	no_errors	ENST00000463705	ensembl	human	known	69_37n	rna	36	23.40	11	SNP	0.000	A
CPED1	79974	genome.wustl.edu	37	7	120629843	120629843	+	Silent	SNP	C	C	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr7:120629843C>A	ENST00000310396.5	+	2	635	c.168C>A	c.(166-168)acC>acA	p.T56T	CPED1_ENST00000450913.2_Silent_p.T56T|CPED1_ENST00000340646.5_Silent_p.T56T|CPED1_ENST00000495036.1_3'UTR	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	56						endoplasmic reticulum (GO:0005783)											CCACTGAAACCCAGGCAAGCA	0.532																																						dbGAP											0													108.0	113.0	111.0					7																	120629843		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.168C>A	7.37:g.120629843C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	NULL	p.T56	ENST00000310396.5	37	c.168	CCDS34739.1	7																																																																																			CPED1	-	NULL	ENSG00000106034		0.532	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	59	0.00	0	C	NM_024913		120629843	120629843	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.000	A
CSF2RB	1439	genome.wustl.edu	37	22	37325587	37325587	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr22:37325587C>T	ENST00000403662.3	+	5	757	c.535C>T	c.(535-537)Cag>Tag	p.Q179*	CSF2RB_ENST00000536485.1_Nonsense_Mutation_p.Q120*|CSF2RB_ENST00000262825.5_Nonsense_Mutation_p.Q179*|CSF2RB_ENST00000406230.1_Nonsense_Mutation_p.Q179*			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	179	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CAAGCGGCTTCAGGACTCTTG	0.637																																						dbGAP											0													81.0	84.0	83.0					22																	37325587		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.535C>T	22.37:g.37325587C>T	ENSP00000384053:p.Gln179*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZI1|Q6ICE0	Nonsense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q179*	ENST00000403662.3	37	c.535	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	C	13.32	2.201879	0.38905	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000421539;ENST00000536485	.	.	.	5.37	1.93	0.25924	.	2.368180	0.01676	N	0.025869	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-7.4726	4.0043	0.09593	0.3927:0.4672:0.0:0.1401	.	.	.	.	X	179;179;179;179;99;120	.	ENSP00000262825:Q179X	Q	+	1	0	CSF2RB	35655533	0.329000	0.24696	0.649000	0.29536	0.008000	0.06430	0.492000	0.22435	1.360000	0.45960	0.655000	0.94253	CAG	CSF2RB	-	pirsf_IL3_rcpt_beta,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000100368		0.637	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	114	0.00	0	C	NM_000395		37325587	37325587	+1	no_errors	ENST00000262825	ensembl	human	known	69_37n	nonsense	35	27.08	13	SNP	0.332	T
DPP6	1804	genome.wustl.edu	37	7	154002495	154002495	+	Intron	SNP	C	C	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr7:154002495C>A	ENST00000377770.3	+	2	384				DPP6_ENST00000427557.1_5'Flank|DPP6_ENST00000406326.1_Intron|DPP6_ENST00000332007.3_5'UTR|DPP6_ENST00000404039.1_Intron|DPP6_ENST00000496611.1_3'UTR			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6						cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CACACTCCTCCTTACCTTACC	0.557																																					NSCLC(125;1384 1783 2490 7422 34254)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.244-140804C>A	7.37:g.154002495C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000377770.3	37	NULL		7																																																																																			DPP6	-	-	ENSG00000130226		0.557	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	79	0.00	0	C	NM_130797		154002495	154002495	+1	no_errors	ENST00000496611	ensembl	human	known	69_37n	rna	48	17.24	10	SNP	0.001	A
DPP6	1804	genome.wustl.edu	37	7	154672641	154672641	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr7:154672641G>A	ENST00000377770.3	+	21	2263	c.2122G>A	c.(2122-2124)Gtg>Atg	p.V708M	DPP6_ENST00000332007.3_Missense_Mutation_p.V646M|DPP6_ENST00000404039.1_Missense_Mutation_p.V644M|DPP6_ENST00000427557.1_Missense_Mutation_p.V601M			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	708					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GCGCGTGGCCGTGTTTGGGAA	0.552																																					NSCLC(125;1384 1783 2490 7422 34254)	dbGAP											0													100.0	111.0	107.0					7																	154672641		2129	4234	6363	-	-	-	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2122G>A	7.37:g.154672641G>A	ENSP00000367001:p.Val708Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.V708M	ENST00000377770.3	37	c.2122		7	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995768	0.54147	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	4.54	4.54	0.55810	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.122741	0.56097	D	0.000037	T	0.69079	0.3071	M	0.76574	2.34	0.58432	D	0.999998	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	P;D;D;D	0.81914	0.884;0.991;0.995;0.995	T	0.74583	-0.3617	10	0.72032	D	0.01	-18.7946	17.2999	0.87180	0.0:0.0:1.0:0.0	.	601;646;708;644	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	M	644;708;646;601	ENSP00000385578:V644M;ENSP00000367001:V708M;ENSP00000328226:V646M;ENSP00000397303:V601M	ENSP00000328226:V646M	V	+	1	0	DPP6	154303574	1.000000	0.71417	0.988000	0.46212	0.071000	0.16799	8.135000	0.89608	2.061000	0.61500	0.313000	0.20887	GTG	DPP6	-	pfam_Peptidase_S9	ENSG00000130226		0.552	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	59	0.00	0	G	NM_130797		154672641	154672641	+1	no_errors	ENST00000377770	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	1.000	A
EFCAB5	374786	genome.wustl.edu	37	17	28384802	28384802	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr17:28384802C>T	ENST00000394835.3	+	13	2666	c.2474C>T	c.(2473-2475)aCa>aTa	p.T825I	EFCAB5_ENST00000378738.3_Missense_Mutation_p.T825I|EFCAB5_ENST00000394832.2_Missense_Mutation_p.T825I|EFCAB5_ENST00000536908.2_Missense_Mutation_p.T769I|AC104984.4_ENST00000583250.1_RNA|EFCAB5_ENST00000541045.1_Missense_Mutation_p.T482I|RNY4P13_ENST00000384284.1_RNA|EFCAB5_ENST00000320856.5_Intron	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	825							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CTCCTGGAGACATTTGTTGGT	0.423																																						dbGAP											0													125.0	116.0	119.0					17																	28384802		1859	4096	5955	-	-	-	SO:0001583	missense	0			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.2474C>T	17.37:g.28384802C>T	ENSP00000378312:p.Thr825Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.T825I	ENST00000394835.3	37	c.2474	CCDS11254.2	17	.	.	.	.	.	.	.	.	.	.	C	14.82	2.650923	0.47362	.	.	ENSG00000176927	ENST00000536908;ENST00000541045;ENST00000394835;ENST00000394832;ENST00000378738;ENST00000423598	T;T;T;T;T	0.54675	1.6;0.56;2.76;2.0;1.67	5.51	3.51	0.40186	.	.	.	.	.	T	0.68668	0.3026	M	0.74258	2.255	0.23559	N	0.997411	D;D;D;D	0.89917	0.997;0.997;0.997;1.0	P;D;D;D	0.77004	0.9;0.954;0.954;0.989	T	0.55860	-0.8074	9	0.44086	T	0.13	-16.7917	9.4238	0.38567	0.0:0.8287:0.0:0.1713	.	769;769;825;825	B4DS75;F5GYL2;B5MEA3;A4FU69	.;.;.;EFCB5_HUMAN	I	769;482;825;825;825;769	ENSP00000440619:T769I;ENSP00000445575:T482I;ENSP00000378312:T825I;ENSP00000378309:T825I;ENSP00000368012:T825I	ENSP00000368012:T825I	T	+	2	0	EFCAB5	25408928	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	2.421000	0.44688	1.454000	0.47793	0.655000	0.94253	ACA	EFCAB5	-	NULL	ENSG00000176927		0.423	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB5	HGNC	protein_coding	OTTHUMT00000256120.4	72	0.00	0	C	NM_198529		28384802	28384802	+1	no_errors	ENST00000394835	ensembl	human	known	69_37n	missense	65	27.78	25	SNP	0.997	T
ESCO1	114799	genome.wustl.edu	37	18	19110361	19110361	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr18:19110361G>T	ENST00000269214.5	-	12	3403	c.2466C>A	c.(2464-2466)taC>taA	p.Y822*		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	822					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						CAGTGCCACAGTACTGTGTTG	0.353																																						dbGAP											0													64.0	70.0	68.0					18																	19110361		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.2466C>A	18.37:g.19110361G>T	ENSP00000269214:p.Tyr822*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Nonsense_Mutation	SNP	NULL	p.Y822*	ENST00000269214.5	37	c.2466	CCDS32800.1	18	.	.	.	.	.	.	.	.	.	.	G	45	12.076892	0.99634	.	.	ENSG00000141446	ENST00000269214	.	.	.	5.65	4.78	0.61160	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1297	10.9151	0.47131	0.1439:0.0:0.8561:0.0	.	.	.	.	X	822	.	ENSP00000269214:Y822X	Y	-	3	2	ESCO1	17364359	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.845000	0.55880	1.392000	0.46585	0.460000	0.39030	TAC	ESCO1	-	NULL	ENSG00000141446		0.353	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESCO1	HGNC	protein_coding	OTTHUMT00000443942.1	45	0.00	0	G	NM_052911		19110361	19110361	-1	no_errors	ENST00000269214	ensembl	human	known	69_37n	nonsense	27	10.00	3	SNP	1.000	T
SPATA31D5P	347127	genome.wustl.edu	37	9	84530389	84530389	+	RNA	SNP	G	G	A	rs199691053		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr9:84530389G>A	ENST00000527857.1	+	0	411					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		CCCAGACCCCGTCTGTCAGGT	0.547													-|||	1	0.000199681	0.0008	0.0	5008	,	,		18073	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84530389G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.547	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	230	0.00	0	G	NR_026851		84530389	84530389	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	114	30.54	51	SNP	0.000	A
FAT3	120114	genome.wustl.edu	37	11	92620185	92620185	+	Silent	SNP	G	G	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr11:92620185G>T	ENST00000298047.6	+	24	12974	c.12957G>T	c.(12955-12957)ccG>ccT	p.P4319P	FAT3_ENST00000409404.2_Silent_p.P4319P|FAT3_ENST00000533797.1_Silent_p.P654P|FAT3_ENST00000489716.1_3'UTR|FAT3_ENST00000525166.1_Silent_p.P4169P			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4319					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTGATGACCCGGGAGAAGTGA	0.488										TCGA Ovarian(4;0.039)																												dbGAP											0													45.0	48.0	47.0					11																	92620185		1881	4115	5996	-	-	-	SO:0001819	synonymous_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12957G>T	11.37:g.92620185G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.P4319	ENST00000298047.6	37	c.12957		11																																																																																			FAT3	-	NULL	ENSG00000165323		0.488	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		84	0.00	0	G	NM_001008781		92620185	92620185	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	silent	35	23.91	11	SNP	0.000	T
FRMPD4	9758	genome.wustl.edu	37	X	12632959	12632959	+	Silent	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chrX:12632959G>A	ENST00000380682.1	+	4	887	c.381G>A	c.(379-381)ccG>ccA	p.P127P	7SK_ENST00000606842.1_RNA	NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	127	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						ATGATGAACCGGTCAGCGCTG	0.522																																						dbGAP											0													116.0	102.0	107.0					X																	12632959		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.381G>A	X.37:g.12632959G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X9|O15032	Silent	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.P127	ENST00000380682.1	37	c.381	CCDS35201.1	X																																																																																			FRMPD4	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000169933		0.522	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	62	0.00	0	G	XM_045712		12632959	12632959	+1	no_errors	ENST00000380682	ensembl	human	known	69_37n	silent	35	30.00	15	SNP	0.288	A
GABBR1	2550	genome.wustl.edu	37	6	29589896	29589896	+	Silent	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr6:29589896G>A	ENST00000377034.4	-	9	1385	c.1050C>T	c.(1048-1050)ccC>ccT	p.P350P	GABBR1_ENST00000377012.4_Silent_p.P233P|GABBR1_ENST00000355973.3_Silent_p.P233P|GABBR1_ENST00000377016.4_Silent_p.P288P|GABBR1_ENST00000376977.3_Silent_p.P350P	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	350					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	GGTTTTTGACGGGCACAGCTG	0.557																																						dbGAP											0													62.0	59.0	60.0					6																	29589896		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1050C>T	6.37:g.29589896G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.P350	ENST00000377034.4	37	c.1050	CCDS4663.1	6																																																																																			GABBR1	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3_GABA_rcpt_B	ENSG00000204681		0.557	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	76	0.00	0	G			29589896	29589896	-1	no_errors	ENST00000377034	ensembl	human	known	69_37n	silent	38	22.45	11	SNP	0.952	A
GOLGA8H	728498	genome.wustl.edu	37	15	30906212	30906212	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr15:30906212G>A	ENST00000566740.1	+	17	1526	c.1526G>A	c.(1525-1527)gGa>gAa	p.G509E	RN7SL628P_ENST00000473920.2_RNA|RP11-932O9.7_ENST00000501830.2_RNA|AC026150.1_ENST00000408431.1_RNA|RP11-932O9.9_ENST00000602594.1_lincRNA			P0CJ92	GOG8H_HUMAN	golgin A8 family, member H	509						Golgi apparatus (GO:0005794)											GCGGCACTGGGAGGAGGACAC	0.647																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS61576.1	15q13.2	2012-10-05			ENSG00000261794	ENSG00000261794			37443	protein-coding gene	gene with protein product	"""golgi autoantigen, golgin subfamily a, 6-like 11"""						Standard	NM_001282490		Approved	GOLGA6L11		P0CJ92	OTTHUMG00000175654	ENST00000566740.1:c.1526G>A	15.37:g.30906212G>A	ENSP00000456894:p.Gly509Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G509E	ENST00000566740.1	37	c.1526		15																																																																																			GOLGA8H	-	NULL	ENSG00000261794		0.647	GOLGA8H-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8H	HGNC	protein_coding	OTTHUMT00000430724.1	48	0.00	0	G	XM_001724395		30906212	30906212	+1	no_errors	ENST00000566740	ensembl	human	novel	69_37n	missense	23	20.69	6	SNP	1.000	A
GPR75	10936	genome.wustl.edu	37	2	54081561	54081561	+	Silent	SNP	A	A	G			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr2:54081561A>G	ENST00000394705.2	-	2	603	c.333T>C	c.(331-333)agT>agC	p.S111S	ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ASB3_ENST00000498475.2_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	111	Phe-rich.				chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CCGGGATACTACTGGCTGAGC	0.493																																						dbGAP											0													73.0	75.0	74.0					2																	54081561		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.333T>C	2.37:g.54081561A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC02|Q6NWR2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S111	ENST00000394705.2	37	c.333	CCDS1849.1	2																																																																																			GPR75	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000119737		0.493	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR75	HGNC	protein_coding	OTTHUMT00000251403.2	48	0.00	0	A			54081561	54081561	-1	no_errors	ENST00000394705	ensembl	human	known	69_37n	silent	24	38.46	15	SNP	0.000	G
HLA-V	352962	genome.wustl.edu	37	6	29759174	29759174	+	RNA	SNP	A	A	T	rs67066743		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr6:29759174A>T	ENST00000457107.1	+	0	0									major histocompatibility complex, class I, V (pseudogene)																		TATGGAATGAAGGTAAATTTA	0.413																																						dbGAP											0																																										-	-	-			0			M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29759174A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			HLA-P	-	-	ENSG00000181126		0.413	HLA-V-003	KNOWN	basic	processed_transcript	HLA-P	HGNC	pseudogene	OTTHUMT00000105231.1	47	0.00	0	A	NG_002729		29759174	29759174	+1	no_errors	ENST00000457931	ensembl	human	known	69_37n	rna	40	11.11	5	SNP	0.005	T
HMGA1	3159	genome.wustl.edu	37	6	34208614	34208616	+	In_Frame_Del	DEL	CGG	CGG	-	rs115010807|rs373699947	byFrequency	TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	CGG	CGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr6:34208614_34208616delCGG	ENST00000447654.1	+	2	546_548	c.57_59delCGG	c.(55-60)gacggc>gac	p.G20del	HMGA1_ENST00000374116.3_In_Frame_Del_p.G20del|HMGA1_ENST00000478214.1_3'UTR|HMGA1_ENST00000395004.3_In_Frame_Del_p.G20del|HMGA1_ENST00000347617.6_In_Frame_Del_p.G20del|HMGA1_ENST00000311487.5_In_Frame_Del_p.G20del|HMGA1_ENST00000401473.3_In_Frame_Del_p.G20del	NM_145901.2|NM_145902.2	NP_665908.1|NP_665909.1	P17096	HMGA1_HUMAN	high mobility group AT-hook 1	20					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA unwinding involved in DNA replication (GO:0006268)|establishment of integrated proviral latency (GO:0075713)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chromatin silencing (GO:0031936)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|oncogene-induced cell senescence (GO:0090402)|positive regulation of cellular senescence (GO:2000774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|senescence-associated heterochromatin focus assembly (GO:0035986)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|AT DNA binding (GO:0003680)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			lung(1)	1						AGGAAAAGGACGGCACTGAGAAG	0.621			T	?	"""microfollicular thyroid adenoma,  various benign mesenchymal tumors,"""																																	dbGAP		Dom	yes		6	6p21	3159	high mobility group AT-hook 1		"""E, M"""	0																																										-	-	-	SO:0001651	inframe_deletion	0			AF176039	CCDS4788.1, CCDS4789.1	6p21	2011-07-01	2002-07-25	2002-07-26	ENSG00000137309	ENSG00000137309		"""High-mobility group / Canonical"""	5010	protein-coding gene	gene with protein product		600701	"""high-mobility group (nonhistone chromosomal) protein isoforms I and Y"""	HMGIY		8414980, 11406267	Standard	NM_145903		Approved		uc011dso.2	P17096	OTTHUMG00000014539	ENST00000447654.1:c.57_59delCGG	6.37:g.34208614_34208616delCGG	ENSP00000399888:p.Gly20del	Somatic		WXS	Illumina GAIIx	Phase_IV	P10910|Q5T6U9|Q9UKB0	In_Frame_Del	DEL	prints_HMGI/HMGY,prints_AT_hook-like	p.G20in_frame_del	ENST00000447654.1	37	c.57_59	CCDS4789.1	6																																																																																			HMGA1	-	NULL	ENSG00000137309		0.621	HMGA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HMGA1	HGNC	protein_coding	OTTHUMT00000040214.2	112	0.00	0	CGG	NM_145899		34208614	34208616	+1	no_errors	ENST00000395004	ensembl	human	known	69_37n	in_frame_del	64	15.38	12	DEL	0.990:1.000:1.000	-
HNRNPUL1	11100	genome.wustl.edu	37	19	41798224	41798224	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr19:41798224delC	ENST00000392006.3	+	8	1247	c.1074delC	c.(1072-1074)atcfs	p.I358fs	HNRNPUL1_ENST00000263367.3_Frame_Shift_Del_p.I269fs|HNRNPUL1_ENST00000595018.1_Frame_Shift_Del_p.I258fs|HNRNPUL1_ENST00000352456.3_Frame_Shift_Del_p.I258fs|HNRNPUL1_ENST00000602130.1_Frame_Shift_Del_p.I358fs|HNRNPUL1_ENST00000593587.1_Frame_Shift_Del_p.I258fs|HNRNPUL1_ENST00000378215.4_Frame_Shift_Del_p.I244fs	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	358	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						CTTTCCGAATCCAGAAGGAAG	0.478																																						dbGAP											0													153.0	154.0	153.0					19																	41798224		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1074delC	19.37:g.41798224delC	ENSP00000375863:p.Ile358fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_SAP_DNA-bd,superfamily_ConA-like_lec_gl,smart_SAP_DNA-bd,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_DNA-bd	p.Q359fs	ENST00000392006.3	37	c.1074	CCDS12576.1	19																																																																																			HNRNPUL1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000105323		0.478	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL1	HGNC	protein_coding	OTTHUMT00000463406.1	78	0.00	0	C	NM_144732, NM_007040		41798224	41798224	+1	no_errors	ENST00000392006	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.998	-
IFIT2	3433	genome.wustl.edu	37	10	91066002	91066003	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr10:91066002_91066003insG	ENST00000371826.3	+	2	458_459	c.289_290insG	c.(289-291)tggfs	p.W97fs	LIPA_ENST00000487618.1_Intron|LIPA_ENST00000371837.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	97					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				TCTGGTCACCTGGGGAAACTAT	0.485																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.293dupG	10.37:g.91066006_91066006dupG	ENSP00000360891:p.Trp97fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T767	Frame_Shift_Ins	INS	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.N99fs	ENST00000371826.3	37	c.289_290	CCDS41548.1	10																																																																																			IFIT2	-	NULL	ENSG00000119922		0.485	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT2	HGNC	protein_coding	OTTHUMT00000049293.1	53	0.00	0	-	NM_001547		91066002	91066003	+1	no_errors	ENST00000371826	ensembl	human	known	69_37n	frame_shift_ins	15	25.00	5	INS	1.000:1.000	G
KCNIP4	80333	genome.wustl.edu	37	4	20731675	20731675	+	3'UTR	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr4:20731675G>A	ENST00000382152.2	-	0	950				PACRGL_ENST00000507634.1_Intron|KCNIP4_ENST00000382150.4_3'UTR|KCNIP4_ENST00000382149.4_5'UTR|KCNIP4_ENST00000509207.1_3'UTR|KCNIP4_ENST00000447367.2_3'UTR|KCNIP4_ENST00000382148.3_3'UTR|KCNIP4_ENST00000359001.5_3'UTR	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4							dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				GTTCACATTTGTCTGTTGGAT	0.388																																						dbGAP											0													114.0	106.0	109.0					4																	20731675		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.*30C>T	4.37:g.20731675G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	RNA	SNP	-	NULL	ENST00000382152.2	37	NULL	CCDS43216.1	4																																																																																			KCNIP4	-	-	ENSG00000185774		0.388	KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	KCNIP4	HGNC	protein_coding	OTTHUMT00000360407.3	57	0.00	0	G	NM_025221		20731675	20731675	-1	no_errors	ENST00000382149	ensembl	human	known	69_37n	rna	39	13.33	6	SNP	1.000	A
KCNK6	9424	genome.wustl.edu	37	19	38810781	38810781	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr19:38810781A>G	ENST00000263372.3	+	1	298	c.191A>G	c.(190-192)gAg>gGg	p.E64G		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	64					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	GCCTTCGTGGAGCGAGTGCTG	0.731																																						dbGAP											0													6.0	8.0	8.0					19																	38810781		1918	3946	5864	-	-	-	SO:0001583	missense	0			AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.191A>G	19.37:g.38810781A>G	ENSP00000263372:p.Glu64Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HB47	Missense_Mutation	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TWIK2,prints_2pore_dom_K_chnl_TWIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TWIK1	p.E64G	ENST00000263372.3	37	c.191	CCDS12513.1	19	.	.	.	.	.	.	.	.	.	.	A	12.81	2.049384	0.36181	.	.	ENSG00000099337	ENST00000263372	T	0.24908	1.83	4.57	4.57	0.56435	.	0.406049	0.24150	N	0.041084	T	0.19685	0.0473	L	0.35414	1.06	0.30196	N	0.799027	B	0.02656	0.0	B	0.04013	0.001	T	0.07046	-1.0793	10	0.33141	T	0.24	.	11.9676	0.53044	1.0:0.0:0.0:0.0	.	64	Q9Y257	KCNK6_HUMAN	G	64	ENSP00000263372:E64G	ENSP00000263372:E64G	E	+	2	0	KCNK6	43502621	0.034000	0.19679	1.000000	0.80357	0.979000	0.70002	0.099000	0.15210	1.938000	0.56188	0.454000	0.30748	GAG	KCNK6	-	pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TWIK,prints_2pore_dom_K_chnl_TWIK1	ENSG00000099337		0.731	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK6	HGNC	protein_coding	OTTHUMT00000460524.1	44	0.00	0	A	NM_004823		38810781	38810781	+1	no_errors	ENST00000263372	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	0.975	G
KLRF2	100431172	genome.wustl.edu	37	12	10048328	10048328	+	Missense_Mutation	SNP	G	G	A	rs149908207	byFrequency	TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr12:10048328G>A	ENST00000535540.1	+	6	627	c.520G>A	c.(520-522)Gtt>Att	p.V174I		NM_001190765.1	NP_001177694.1	D3W0D1	KLRF2_HUMAN	killer cell lectin-like receptor subfamily F, member 2	174	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine secretion (GO:0050663)|natural killer cell degranulation (GO:0043320)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)										GAGCTGTGCCGTTATCACAGG	0.408													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		18233	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS53743.1	12p13.31	2010-06-30				ENSG00000256797		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	37646	protein-coding gene	gene with protein product						20194751	Standard	NM_001190765		Approved	NKp65	uc021quy.1	D3W0D1		ENST00000535540.1:c.520G>A	12.37:g.10048328G>A	ENSP00000438244:p.Val174Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.V174I	ENST00000535540.1	37	c.520	CCDS53743.1	12	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	G	11.13	1.547445	0.27652	.	.	ENSG00000256797	ENST00000535540	T	0.19250	2.16	1.98	-2.83	0.05769	.	.	.	.	.	T	0.11750	0.0286	L	0.49571	1.57	0.09310	N	1	.	.	.	.	.	.	T	0.33007	-0.9885	7	0.21540	T	0.41	.	3.403	0.07331	0.4678:0.2158:0.3164:0.0	.	.	.	.	I	174	ENSP00000438244:V174I	ENSP00000438244:V174I	V	+	1	0	KLRF2	9939595	0.001000	0.12720	0.002000	0.10522	0.480000	0.33159	-0.242000	0.08928	-0.874000	0.04027	0.313000	0.20887	GTT	KLRF2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000256797		0.408	KLRF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF2	HGNC	protein_coding		90	0.00	0	G	NM_001190765		10048328	10048328	+1	no_errors	ENST00000535540	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	0.003	A
LINC00304	283860	genome.wustl.edu	37	16	89226810	89226810	+	lincRNA	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr16:89226810G>A	ENST00000321214.2	+	0	532					NR_024347.2		Q8N9R0	CP081_HUMAN	long intergenic non-protein coding RNA 304																		AAGACCCCCCGCTTCCTCACC	0.657																																						dbGAP											0																																										-	-	-			0			AK094020		16q24.3	2012-11-19	2011-08-10	2011-08-10	ENSG00000180422	ENSG00000180422		"""Long non-coding RNAs"""	26713	non-coding RNA	RNA, long non-coding			"""chromosome 16 open reading frame 81"", ""non-protein coding RNA 304"""	C16orf81, NCRNA00304			Standard	NR_024347		Approved	FLJ36701	uc002fms.3	Q8N9R0	OTTHUMG00000175524		16.37:g.89226810G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000321214.2	37	NULL		16																																																																																			LINC00304	-	-	ENSG00000180422		0.657	LINC00304-001	KNOWN	basic	lincRNA	LINC00304	HGNC	lincRNA	OTTHUMT00000430368.1	32	0.00	0	G	NR_024347		89226810	89226810	+1	no_errors	ENST00000321214	ensembl	human	known	69_37n	rna	9	40.00	6	SNP	0.668	A
LMBR1L	55716	genome.wustl.edu	37	12	49503575	49503575	+	Intron	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr12:49503575G>A	ENST00000267102.8	-	1	415				LMBR1L_ENST00000547382.1_Intron|LMBR1L_ENST00000553204.1_Intron	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like						endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CAGGGAGGGCGTAAGGAACAG	0.582																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.72+691C>T	12.37:g.49503575G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Silent	SNP	NULL	p.Y54	ENST00000267102.8	37	c.162	CCDS8780.2	12																																																																																			LMBR1L	-	NULL	ENSG00000139636		0.582	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1	62	0.00	0	G	NM_018113		49503575	49503575	-1	no_errors	ENST00000547670	ensembl	human	known	69_37n	silent	61	12.86	9	SNP	0.000	A
MAP2	4133	genome.wustl.edu	37	2	210518057	210518057	+	Nonsense_Mutation	SNP	G	G	T	rs139310749	byFrequency	TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr2:210518057G>T	ENST00000360351.4	+	4	669	c.163G>T	c.(163-165)Gag>Tag	p.E55*	MAP2_ENST00000199940.6_Nonsense_Mutation_p.E55*|MAP2_ENST00000361559.4_Nonsense_Mutation_p.E55*|MAP2_ENST00000447185.1_Nonsense_Mutation_p.E55*|MAP2_ENST00000392194.1_Nonsense_Mutation_p.E55*	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	55					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GGAGGATGAAGAGGGTGCCTT	0.532																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													107.0	94.0	99.0					2																	210518057		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.163G>T	2.37:g.210518057G>T	ENSP00000353508:p.Glu55*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Nonsense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.E55*	ENST00000360351.4	37	c.163	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.048954	0.97236	.	.	ENSG00000078018	ENST00000199940;ENST00000392193;ENST00000360351;ENST00000361559;ENST00000445941;ENST00000392194;ENST00000447185	.	.	.	5.29	5.29	0.74685	.	0.106857	0.41001	D	0.000968	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-10.0109	17.9193	0.88961	0.0:0.0:1.0:0.0	.	.	.	.	X	55	.	ENSP00000199940:E55X	E	+	1	0	MAP2	210226302	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	6.722000	0.74735	2.471000	0.83476	0.643000	0.83706	GAG	MAP2	-	NULL	ENSG00000078018		0.532	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	55	0.00	0	G	NM_001039538		210518057	210518057	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	nonsense	19	48.65	18	SNP	1.000	T
MASP2	10747	genome.wustl.edu	37	1	11105481	11105481	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr1:11105481G>T	ENST00000400897.3	-	4	543	c.528C>A	c.(526-528)aaC>aaA	p.N176K	MASP2_ENST00000400898.3_Missense_Mutation_p.N176K	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	176	EGF-like; calcium-binding.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		AGGTGCGCTTGTTACGGTGCA	0.687																																					GBM(35;611 746 20780 22741 36496)	dbGAP											0													59.0	59.0	59.0					1																	11105481		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.528C>A	1.37:g.11105481G>T	ENSP00000383690:p.Asn176Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.N176K	ENST00000400897.3	37	c.528	CCDS123.1	1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021763	0.54576	.	.	ENSG00000009724	ENST00000400897;ENST00000400898	D;D	0.81996	-1.56;-1.56	4.23	3.31	0.37934	EGF-like region, conserved site (1);EGF-like calcium-binding (2);	0.210089	0.37809	N	0.001926	D	0.87501	0.6193	M	0.71296	2.17	0.45183	D	0.998192	D;D	0.62365	0.991;0.989	P;D	0.64042	0.842;0.921	D	0.86724	0.1944	10	0.87932	D	0	.	7.8379	0.29380	0.1992:0.0:0.8008:0.0	.	176;176	O00187-2;O00187	.;MASP2_HUMAN	K	176	ENSP00000383690:N176K;ENSP00000383691:N176K	ENSP00000383690:N176K	N	-	3	2	MASP2	11028068	1.000000	0.71417	0.761000	0.31378	0.598000	0.36846	4.074000	0.57577	0.885000	0.36088	0.462000	0.41574	AAC	MASP2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000009724		0.687	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP2	HGNC	protein_coding	OTTHUMT00000006072.1	159	0.00	0	G	NM_006610		11105481	11105481	-1	no_errors	ENST00000400897	ensembl	human	known	69_37n	missense	84	20.00	21	SNP	1.000	T
MCM7	4176	genome.wustl.edu	37	7	99696938	99696938	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr7:99696938G>C	ENST00000303887.5	-	4	1010	c.365C>G	c.(364-366)cCc>cGc	p.P122R	AP4M1_ENST00000359593.4_5'Flank|AP4M1_ENST00000422582.1_5'Flank|AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000354230.3_5'UTR|MCM7_ENST00000343023.6_Missense_Mutation_p.P122R|AP4M1_ENST00000429084.1_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	122					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTGGTTCTGGGGGCTTCGGAC	0.507																																						dbGAP											0													116.0	128.0	124.0					7																	99696938		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.365C>G	7.37:g.99696938G>C	ENSP00000307288:p.Pro122Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.P122R	ENST00000303887.5	37	c.365	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773030	0.49680	.	.	ENSG00000166508	ENST00000343023;ENST00000303887;ENST00000542483;ENST00000362082;ENST00000425308	T;T;T	0.11277	2.79;2.79;2.79	4.57	4.57	0.56435	Nucleic acid-binding, OB-fold-like (1);	0.177146	0.49916	D	0.000125	T	0.13756	0.0333	L	0.54323	1.7	0.80722	D	1	B	0.11235	0.004	B	0.16722	0.016	T	0.02852	-1.1102	10	0.51188	T	0.08	-0.0609	14.8981	0.70659	0.0:0.0:1.0:0.0	.	122	P33993	MCM7_HUMAN	R	122;122;59;15;15	ENSP00000344006:P122R;ENSP00000307288:P122R;ENSP00000411295:P15R	ENSP00000307288:P122R	P	-	2	0	MCM7	99534874	1.000000	0.71417	0.929000	0.37066	0.851000	0.48451	6.840000	0.75369	2.351000	0.79841	0.563000	0.77884	CCC	MCM7	-	superfamily_NA-bd_OB-fold-like	ENSG00000166508		0.507	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	40	0.00	0	G			99696938	99696938	-1	no_errors	ENST00000303887	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	1.000	C
MED12	9968	genome.wustl.edu	37	X	70350046	70350047	+	In_Frame_Ins	INS	-	-	ATA			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chrX:70350046_70350047insATA	ENST00000374080.3	+	28	4061_4062	c.4029_4030insATA	c.(4030-4032)ata>ATAata	p.1344_1344I>II	MED12_ENST00000333646.6_In_Frame_Ins_p.1344_1344I>II|MED12_ENST00000374102.1_In_Frame_Ins_p.1344_1344I>II			Q93074	MED12_HUMAN	mediator complex subunit 12	1344					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGCGGCAGCGCATAAAGCGCAT	0.574			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0																																										-	-	-	SO:0001652	inframe_insertion	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4030_4032dupATA	X.37:g.70350047_70350049dupATA	ENSP00000363193:p.Ile1344dup	Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	In_Frame_Ins	INS	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.1344in_frame_insI	ENST00000374080.3	37	c.4029_4030	CCDS43970.1	X																																																																																			MED12	-	NULL	ENSG00000184634		0.574	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	51	0.00	0	-	NM_005120		70350046	70350047	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	in_frame_ins	46	28.12	18	INS	0.995:1.000	ATA
MECP2	4204	genome.wustl.edu	37	X	153296805	153296805	+	Silent	SNP	C	C	T	rs61748413		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chrX:153296805C>T	ENST00000303391.6	-	4	723	c.474G>A	c.(472-474)acG>acA	p.T158T	MECP2_ENST00000407218.1_Intron|MECP2_ENST00000453960.2_Silent_p.T170T|MECP2_ENST00000460227.1_5'Flank	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	158	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.		T -> A (in RTT). {ECO:0000269|PubMed:11269512, ECO:0000269|PubMed:15057977}.|T -> M (in RTT; dbSNP:rs28934906). {ECO:0000269|PubMed:10508514, ECO:0000269|PubMed:10577905, ECO:0000269|PubMed:10745042, ECO:0000269|PubMed:10767337, ECO:0000269|PubMed:10814719, ECO:0000269|PubMed:10944854, ECO:0000269|PubMed:10991688, ECO:0000269|PubMed:10991689, ECO:0000269|PubMed:11055898, ECO:0000269|PubMed:11241840, ECO:0000269|PubMed:11269512, ECO:0000269|PubMed:11376998, ECO:0000269|PubMed:11402105, ECO:0000269|PubMed:11738883, ECO:0000269|PubMed:12567420, ECO:0000269|PubMed:12966523, ECO:0000269|PubMed:15057977}.		adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCCAGTTACCGTGAAGTCAA	0.557																																						dbGAP											0													70.0	68.0	68.0					X																	153296805		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.474G>A	X.37:g.153296805C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15233|Q6QHH9|Q7Z384	Silent	SNP	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,superfamily_Ig_E-set,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MeCP2,pfscan_Methyl_CpG_DNA-bd	p.T158	ENST00000303391.6	37	c.474	CCDS14741.1	X																																																																																			MECP2	-	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MeCP2,pfscan_Methyl_CpG_DNA-bd	ENSG00000169057		0.557	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECP2	HGNC	protein_coding	OTTHUMT00000061144.1	80	0.00	0	C	NM_004992		153296805	153296805	-1	no_errors	ENST00000303391	ensembl	human	known	69_37n	silent	41	24.07	13	SNP	1.000	T
MEGF8	1954	genome.wustl.edu	37	19	42875524	42875524	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr19:42875524G>A	ENST00000251268.6	+	41	7159	c.7159G>A	c.(7159-7161)Gac>Aac	p.D2387N	MEGF8_ENST00000334370.4_Missense_Mutation_p.D2320N|MEGF8_ENST00000378073.4_Intron	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2387	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGCCACGCGGACACATGTAA	0.587																																						dbGAP											0													70.0	53.0	59.0					19																	42875524		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7159G>A	19.37:g.42875524G>A	ENSP00000251268:p.Asp2387Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.D2387N	ENST00000251268.6	37	c.7159		19	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983487	0.93044	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.25912	1.79;1.77	4.91	4.91	0.64330	EGF-like, laminin (1);	0.000000	0.85682	D	0.000000	T	0.42810	0.1219	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.989;0.998	T	0.06427	-1.0827	10	0.14656	T	0.56	-32.2486	17.7317	0.88379	0.0:0.0:1.0:0.0	.	2387;2320	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	N	2320;2387	ENSP00000334219:D2320N;ENSP00000251268:D2387N	ENSP00000251268:D2387N	D	+	1	0	MEGF8	47567364	1.000000	0.71417	0.951000	0.38953	0.969000	0.65631	8.529000	0.90602	2.659000	0.90383	0.561000	0.74099	GAC	MEGF8	-	NULL	ENSG00000105429		0.587	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	59	0.00	0	G	NM_001410		42875524	42875524	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	A
SNCAIP	9627	genome.wustl.edu	37	5	121790167	121790167	+	Intron	SNP	G	G	A	rs200455964		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr5:121790167G>A	ENST00000261368.8	+	10	3016				CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000379533.2_Intron|CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000379538.3_Intron|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000379536.2_Intron|SNCAIP_ENST00000261367.7_Intron|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000542191.1_Intron|CTC-210G5.1_ENST00000506053.1_RNA	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein						cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		cggcctcaccggggcagggaa	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		17820	0.0		0.001	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.2754+2871G>A	5.37:g.121790167G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	RNA	SNP	-	NULL	ENST00000261368.8	37	NULL	CCDS4131.1	5																																																																																			CTC-210G5.1	-	-	ENSG00000250328		0.512	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGC32805	Clone_based_vega_gene	protein_coding	OTTHUMT00000250888.1	71	0.00	0	G			121790167	121790167	-1	no_errors	ENST00000510972	ensembl	human	known	69_37n	rna	34	15.00	6	SNP	0.000	A
RP11-24M17.4	0	genome.wustl.edu	37	15	76053570	76053570	+	RNA	SNP	A	A	G	rs8026234	byFrequency	TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr15:76053570A>G	ENST00000569596.1	+	0	62				MIR4313_ENST00000580760.1_lincRNA																							CTAGGGGAGAAGGCAGAGCTG	0.592													.|||	1151	0.229832	0.1392	0.3473	5008	,	,		16954	0.2381		0.2634	False		,,,				2504	0.226					dbGAP											0																																										-	-	-			0																															15.37:g.76053570A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000569596.1	37	NULL		15																																																																																			MIR4313	-	-	ENSG00000261043		0.592	RP11-24M17.4-002	KNOWN	basic	lincRNA	MIR4313	HGNC	processed_transcript	OTTHUMT00000420499.1	8	0.00	0	A			76053570	76053570	-1	no_errors	ENST00000561777	ensembl	human	known	69_37n	rna	2	66.67	4	SNP	0.022	G
MMP14	4323	genome.wustl.edu	37	14	23313595	23313595	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr14:23313595C>T	ENST00000311852.6	+	7	1288	c.1027C>T	c.(1027-1029)Cgg>Tgg	p.R343W	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	343					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	CTGGTTCTGGCGGGTGAGGAA	0.572																																						dbGAP											0													152.0	157.0	155.0					14																	23313595		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.1027C>T	14.37:g.23313595C>T	ENSP00000308208:p.Arg343Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.R343W	ENST00000311852.6	37	c.1027	CCDS9577.1	14	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717072	0.68844	.	.	ENSG00000157227	ENST00000311852	T	0.04406	3.63	6.06	0.783	0.18572	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.28896	0.0717	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47302	-0.9128	10	0.87932	D	0	.	16.3058	0.82848	0.587:0.413:0.0:0.0	.	343	P50281	MMP14_HUMAN	W	343	ENSP00000308208:R343W	ENSP00000308208:R343W	R	+	1	2	MMP14	22383435	0.997000	0.39634	0.994000	0.49952	0.946000	0.59487	0.609000	0.24238	-0.129000	0.11620	-0.158000	0.13435	CGG	MMP14	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000157227		0.572	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP14	HGNC	protein_coding	OTTHUMT00000071660.3	67	0.00	0	C	NM_004995		23313595	23313595	+1	no_errors	ENST00000311852	ensembl	human	known	69_37n	missense	42	17.65	9	SNP	1.000	T
MYBL2	4605	genome.wustl.edu	37	20	42333911	42333911	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr20:42333911T>A	ENST00000217026.4	+	9	1545	c.1418T>A	c.(1417-1419)cTg>cAg	p.L473Q	MYBL2_ENST00000396863.4_Missense_Mutation_p.L449Q	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	473					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGCCCCTCGCTGACATCCACC	0.547																																						dbGAP											0													99.0	89.0	92.0					20																	42333911		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1418T>A	20.37:g.42333911T>A	ENSP00000217026:p.Leu473Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L473Q	ENST00000217026.4	37	c.1418	CCDS13322.1	20	.	.	.	.	.	.	.	.	.	.	T	22.0	4.236809	0.79800	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.38887	1.11;1.11	4.48	4.48	0.54585	C-myb, C-terminal (1);	0.147283	0.46758	D	0.000263	T	0.63331	0.2502	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.991;1.0	T	0.68066	-0.5507	10	0.72032	D	0.01	-13.4745	13.0978	0.59202	0.0:0.0:0.0:1.0	.	449;473	F8W6N6;P10244	.;MYBB_HUMAN	Q	449;473	ENSP00000380072:L449Q;ENSP00000217026:L473Q	ENSP00000217026:L473Q	L	+	2	0	MYBL2	41767325	1.000000	0.71417	0.959000	0.39883	0.988000	0.76386	7.589000	0.82641	1.805000	0.52779	0.459000	0.35465	CTG	MYBL2	-	pfam_C-myb_C	ENSG00000101057		0.547	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL2	HGNC	protein_coding	OTTHUMT00000080408.1	87	0.00	0	T	NM_002466		42333911	42333911	+1	no_errors	ENST00000217026	ensembl	human	known	69_37n	missense	57	22.97	17	SNP	1.000	A
NTM	50863	genome.wustl.edu	37	11	132177693	132177693	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr11:132177693C>T	ENST00000374786.1	+	4	1116	c.637C>T	c.(637-639)Cgg>Tgg	p.R213W	NTM_ENST00000539799.1_Missense_Mutation_p.R213W|NTM_ENST00000374784.1_Missense_Mutation_p.R213W|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_Missense_Mutation_p.R213W|NTM_ENST00000425719.2_Missense_Mutation_p.R213W|NTM_ENST00000427481.2_Missense_Mutation_p.R204W	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	213	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R213W(2)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GCCCGTGGTACGGAGAGTAAA	0.582																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											83.0	72.0	76.0					11																	132177693		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.637C>T	11.37:g.132177693C>T	ENSP00000363918:p.Arg213Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R213W	ENST00000374786.1	37	c.637	CCDS8491.1	11	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547537	0.65311	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.78	4.82	0.62117	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.046634	0.85682	D	0.000000	D	0.82852	0.5127	M	0.82433	2.59	0.49582	D	0.999802	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.81914	0.995;0.995;0.995;0.993;0.988;0.988	D	0.85003	0.0901	10	0.87932	D	0	-20.1674	16.8142	0.85729	0.1289:0.8711:0.0:0.0	.	213;204;213;213;213;213	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	W	213;213;204;213;213;213	ENSP00000363923:R213W;ENSP00000437668:R213W;ENSP00000416320:R204W;ENSP00000363918:R213W;ENSP00000396722:R213W;ENSP00000363916:R213W	ENSP00000363916:R213W	R	+	1	2	NTM	131682903	0.991000	0.36638	0.969000	0.41365	0.207000	0.24258	2.989000	0.49393	2.894000	0.99253	0.591000	0.81541	CGG	NTM	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000182667		0.582	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1	83	0.00	0	C	NM_016522		132177693	132177693	+1	no_errors	ENST00000539799	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	0.990	T
OBSL1	23363	genome.wustl.edu	37	2	220435007	220435007	+	Silent	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr2:220435007G>A	ENST00000404537.1	-	1	1004	c.948C>T	c.(946-948)ctC>ctT	p.L316L	OBSL1_ENST00000373873.4_Silent_p.L316L|OBSL1_ENST00000373876.1_Silent_p.L316L|INHA_ENST00000489456.1_Intron|OBSL1_ENST00000289656.3_Intron|INHA_ENST00000243786.2_5'Flank|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000603926.1_Silent_p.L316L|OBSL1_ENST00000265318.4_Silent_p.L316L	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	316	Ig-like 3.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CGCAGACGTAGAGCCCACGAT	0.711																																						dbGAP											0													23.0	27.0	26.0					2																	220435007		2049	4162	6211	-	-	-	SO:0001819	synonymous_variant	0			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.948C>T	2.37:g.220435007G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L316	ENST00000404537.1	37	c.948	CCDS46520.1	2																																																																																			OBSL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000124006		0.711	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	19	0.00	0	G			220435007	220435007	-1	no_errors	ENST00000404537	ensembl	human	known	69_37n	silent	9	35.71	5	SNP	0.967	A
OMD	4958	genome.wustl.edu	37	9	95177547	95177547	+	Missense_Mutation	SNP	C	C	G	rs369559603		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr9:95177547C>G	ENST00000375550.4	-	3	1428	c.1153G>C	c.(1153-1155)Gat>Cat	p.D385H	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	385	Asp/Glu-rich (acidic).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						TCATCATCATCTGGAAATCTC	0.393			T	USP6	aneurysmal bone cysts																																	dbGAP		Dom	yes		9	9q22.31	4958	osteomodulin		M	0													220.0	201.0	208.0					9																	95177547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.1153G>C	9.37:g.95177547C>G	ENSP00000364700:p.Asp385His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBF4	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.D385H	ENST00000375550.4	37	c.1153	CCDS6696.1	9	.	.	.	.	.	.	.	.	.	.	C	13.92	2.382172	0.42207	.	.	ENSG00000127083	ENST00000375550	T	0.38887	1.11	5.44	5.44	0.79542	.	1.900950	0.04541	U	0.388161	T	0.52435	0.1734	L	0.51422	1.61	0.23665	N	0.997163	P	0.46395	0.877	B	0.43916	0.436	T	0.61840	-0.6980	10	0.66056	D	0.02	-5.0829	19.6536	0.95828	0.0:1.0:0.0:0.0	.	385	Q99983	OMD_HUMAN	H	385	ENSP00000364700:D385H	ENSP00000364700:D385H	D	-	1	0	OMD	94217368	0.990000	0.36364	0.072000	0.20136	0.711000	0.40976	3.135000	0.50546	2.717000	0.92951	0.555000	0.69702	GAT	OMD	-	NULL	ENSG00000127083		0.393	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMD	HGNC	protein_coding	OTTHUMT00000053090.1	187	0.00	0	C	NM_005014		95177547	95177547	-1	no_errors	ENST00000375550	ensembl	human	known	69_37n	missense	68	44.72	55	SNP	0.560	G
OPN5	221391	genome.wustl.edu	37	6	47754321	47754321	+	Silent	SNP	C	C	T	rs74388536		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr6:47754321C>T	ENST00000371211.2	+	2	229	c.201C>T	c.(199-201)ccC>ccT	p.P67P	OPN5_ENST00000489301.2_Silent_p.P67P|OPN5_ENST00000393699.2_Silent_p.P67P	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	67					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						AGCTGAGACCCGCTGAAATAA	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		18540	0.001		0.0	False		,,,				2504	0.0				Melanoma(28;740 973 10870 42660 45347)	dbGAP											0													133.0	124.0	127.0					6																	47754321		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.201C>T	6.37:g.47754321C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Peropsin	p.P67	ENST00000371211.2	37	c.201	CCDS4923.1	6																																																																																			OPN5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000124818		0.388	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPN5	HGNC	protein_coding	OTTHUMT00000359451.1	97	0.00	0	C	NM_181744		47754321	47754321	+1	no_errors	ENST00000371211	ensembl	human	known	69_37n	silent	89	10.10	10	SNP	0.995	T
OVCH1	341350	genome.wustl.edu	37	12	29630469	29630469	+	Splice_Site	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr12:29630469C>T	ENST00000318184.5	-	10	1111	c.1112G>A	c.(1111-1113)cGt>cAt	p.R371H	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	371	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GAAACTTACACGTTTGTTTTG	0.368																																						dbGAP											0													98.0	95.0	96.0					12																	29630469		1863	4098	5961	-	-	-	SO:0001630	splice_region_variant	0			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1113+1G>A	12.37:g.29630469C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,smart_Peptidase_S1_S6,smart_CUB,prints_Peptidase_S1A,pfscan_CUB,pfscan_Peptidase_S1_S6	p.R371H	ENST00000318184.5	37	c.1112		12	.	.	.	.	.	.	.	.	.	.	C	6.018	0.371637	0.11409	.	.	ENSG00000187950	ENST00000318184	T	0.23950	1.88	2.31	-3.79	0.04320	CUB (3);	.	.	.	.	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.04013	0.001	T	0.22556	-1.0213	9	0.54805	T	0.06	.	3.7116	0.08421	0.1807:0.31:0.0:0.5093	.	371	Q7RTY7	OVCH1_HUMAN	H	371	ENSP00000326708:R371H	ENSP00000326708:R371H	R	-	2	0	OVCH1	29521736	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.150000	0.10189	-1.139000	0.02881	-0.793000	0.03317	CGT	OVCH1	-	superfamily_CUB,pfscan_CUB	ENSG00000187950		0.368	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	34	0.00	0	C	NM_183378	Missense_Mutation	29630469	29630469	-1	no_errors	ENST00000318184	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.000	T
OTOGL	283310	genome.wustl.edu	37	12	80762006	80762006	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr12:80762006C>T	ENST00000547103.1	+	54	6475	c.6469C>T	c.(6469-6471)Cca>Tca	p.P2157S	OTOGL_ENST00000546620.1_Missense_Mutation_p.P188S|OTOGL_ENST00000458043.2_Missense_Mutation_p.P2169S			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2157					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TACTCCATCCCCAAGTGATTA	0.358																																						dbGAP											0													127.0	114.0	118.0					12																	80762006		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6469C>T	12.37:g.80762006C>T	ENSP00000447211:p.Pro2157Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.P2169S	ENST00000547103.1	37	c.6505		12	.	.	.	.	.	.	.	.	.	.	C	9.688	1.151208	0.21371	.	.	ENSG00000165899	ENST00000547103;ENST00000458043;ENST00000546620;ENST00000550182	T;T;T;T	0.40476	2.32;2.32;2.22;1.03	5.47	0.958	0.19619	.	0.478288	0.19511	N	0.112510	T	0.13372	0.0324	N	0.02736	-0.51	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.29761	-1.0001	10	0.07030	T	0.85	.	5.3917	0.16247	0.2967:0.4827:0.0:0.2205	.	534	Q3ZCN5	OTOGL_HUMAN	S	2157;2169;188;186	ENSP00000447211:P2157S;ENSP00000400895:P2169S;ENSP00000449094:P188S;ENSP00000449641:P186S	ENSP00000400895:P2169S	P	+	1	0	OTOGL	79286137	0.000000	0.05858	0.994000	0.49952	0.938000	0.57974	0.031000	0.13710	0.579000	0.29504	0.585000	0.79938	CCA	OTOGL	-	NULL	ENSG00000165899		0.358	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	70	0.00	0	C	NM_173591		80762006	80762006	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.047	T
PALD1	27143	genome.wustl.edu	37	10	72291097	72291097	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr10:72291097G>A	ENST00000263563.6	+	5	788	c.520G>A	c.(520-522)Gat>Aat	p.D174N		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	174						cytosol (GO:0005829)											CCTGCGTGCAGATGAGGACTT	0.597																																						dbGAP											0													166.0	128.0	141.0					10																	72291097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.520G>A	10.37:g.72291097G>A	ENSP00000263563:p.Asp174Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	smart_Tyr_Pase_cat	p.D174N	ENST00000263563.6	37	c.520	CCDS31215.1	10	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059081	0.55325	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.23552	1.9	4.99	2.12	0.27331	.	0.833919	0.11260	N	0.582687	T	0.22627	0.0546	L	0.41961	1.31	0.09310	N	1	B	0.28552	0.215	B	0.29598	0.104	T	0.19582	-1.0301	10	0.37606	T	0.19	0.0034	10.1529	0.42805	0.2237:0.0:0.7763:0.0	.	174	Q9ULE6	PALD_HUMAN	N	174	ENSP00000263563:D174N	ENSP00000263563:D174N	D	+	1	0	KIAA1274	71961103	0.997000	0.39634	0.000000	0.03702	0.535000	0.34838	5.458000	0.66679	0.356000	0.24157	-0.136000	0.14681	GAT	PALD1	-	NULL	ENSG00000107719		0.597	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALD1	HGNC	protein_coding	OTTHUMT00000048515.2	176	0.00	0	G	NM_014431		72291097	72291097	+1	no_errors	ENST00000263563	ensembl	human	known	69_37n	missense	86	20.37	22	SNP	0.005	A
PALD1	27143	genome.wustl.edu	37	10	72291103	72291103	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr10:72291103G>T	ENST00000263563.6	+	5	794	c.526G>T	c.(526-528)Gac>Tac	p.D176Y		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	176						cytosol (GO:0005829)											TGCAGATGAGGACTTTGTGTC	0.597																																						dbGAP											0													164.0	126.0	139.0					10																	72291103		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.526G>T	10.37:g.72291103G>T	ENSP00000263563:p.Asp176Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	smart_Tyr_Pase_cat	p.D176Y	ENST00000263563.6	37	c.526	CCDS31215.1	10	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051632	0.75960	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.34859	1.34	5.08	5.08	0.68730	.	0.045842	0.85682	D	0.000000	T	0.64583	0.2611	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68804	-0.5312	10	0.87932	D	0	-44.6768	18.9672	0.92701	0.0:0.0:1.0:0.0	.	176	Q9ULE6	PALD_HUMAN	Y	176	ENSP00000263563:D176Y	ENSP00000263563:D176Y	D	+	1	0	KIAA1274	71961109	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	4.532000	0.60608	2.736000	0.93811	0.655000	0.94253	GAC	PALD1	-	NULL	ENSG00000107719		0.597	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALD1	HGNC	protein_coding	OTTHUMT00000048515.2	173	0.00	0	G	NM_014431		72291103	72291103	+1	no_errors	ENST00000263563	ensembl	human	known	69_37n	missense	85	19.05	20	SNP	1.000	T
PARP4	143	genome.wustl.edu	37	13	25029332	25029332	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr13:25029332G>C	ENST00000381989.3	-	22	2686	c.2581C>G	c.(2581-2583)Caa>Gaa	p.Q861E	PARP4_ENST00000480576.1_5'Flank	NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	861					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AGATCGGGTTGAAAGACAAGC	0.468																																						dbGAP											0													98.0	86.0	90.0					13																	25029332		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.2581C>G	13.37:g.25029332G>C	ENSP00000371419:p.Gln861Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.Q861E	ENST00000381989.3	37	c.2581	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	G	11.73	1.725822	0.30593	.	.	ENSG00000102699	ENST00000381989	T	0.01804	4.63	4.72	4.72	0.59763	.	0.370505	0.28742	N	0.014294	T	0.02970	0.0088	L	0.57536	1.79	0.32868	D	0.50887	B	0.32918	0.39	B	0.31547	0.132	T	0.25984	-1.0116	10	0.30854	T	0.27	-6.7207	15.2724	0.73712	0.0:0.0:1.0:0.0	.	861	Q9UKK3	PARP4_HUMAN	E	861	ENSP00000371419:Q861E	ENSP00000371419:Q861E	Q	-	1	0	PARP4	23927332	1.000000	0.71417	0.996000	0.52242	0.717000	0.41224	4.981000	0.63819	2.471000	0.83476	0.638000	0.83543	CAA	PARP4	-	NULL	ENSG00000102699		0.468	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	28	0.00	0	G	NM_006437		25029332	25029332	-1	no_errors	ENST00000381989	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	C
PCDHA5	56143	genome.wustl.edu	37	5	140203028	140203028	+	Silent	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr5:140203028C>T	ENST00000529859.1	+	1	1668	c.1668C>T	c.(1666-1668)gaC>gaT	p.D556D	PCDHA5_ENST00000378126.3_Silent_p.D556D|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Silent_p.D556D|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	556	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGTGCTGGACGAGAACGACA	0.706																																						dbGAP											0													55.0	60.0	58.0					5																	140203028		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1668C>T	5.37:g.140203028C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75284|Q8N4R3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D556	ENST00000529859.1	37	c.1668	CCDS54917.1	5																																																																																			PCDHA5	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000204965		0.706	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	HGNC	protein_coding	OTTHUMT00000372883.2	174	0.00	0	C	NM_018908		140203028	140203028	+1	no_errors	ENST00000529859	ensembl	human	known	69_37n	silent	92	30.83	41	SNP	0.995	T
PLSCR4	57088	genome.wustl.edu	37	3	145912230	145912230	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr3:145912230A>C	ENST00000354952.2	-	9	1198	c.958T>G	c.(958-960)Ttt>Gtt	p.F320V	PLSCR4_ENST00000433593.2_Missense_Mutation_p.F215V|PLSCR4_ENST00000493382.1_Missense_Mutation_p.F320V|PLSCR4_ENST00000446574.2_Missense_Mutation_p.F320V|PLSCR4_ENST00000383083.2_Missense_Mutation_p.F230V	NM_020353.2	NP_065086.2	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4	320					cellular response to lipopolysaccharide (GO:0071222)|phospholipid scrambling (GO:0017121)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|enzyme binding (GO:0019899)|phospholipid scramblase activity (GO:0017128)			kidney(1)|large_intestine(6)|lung(9)|urinary_tract(1)	17						GATCTTTCAAAATACATGAAG	0.328																																						dbGAP											0													120.0	120.0	120.0					3																	145912230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF199023	CCDS3133.1, CCDS54651.1	3q24	2008-07-18			ENSG00000114698	ENSG00000114698			16497	protein-coding gene	gene with protein product		607612				10930526	Standard	NM_020353		Approved		uc003evt.4	Q9NRQ2	OTTHUMG00000159415	ENST00000354952.2:c.958T>G	3.37:g.145912230A>C	ENSP00000347038:p.Phe320Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2E9|Q2TTR3|Q658L3|Q6ZR73|Q7Z505	Missense_Mutation	SNP	pfam_Scramblase	p.F320V	ENST00000354952.2	37	c.958	CCDS3133.1	3	.	.	.	.	.	.	.	.	.	.	A	14.95	2.689772	0.48097	.	.	ENSG00000114698	ENST00000354952;ENST00000383083;ENST00000433593;ENST00000446574;ENST00000493382	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	4.76	4.76	0.60689	.	0.000000	0.64402	D	0.000019	T	0.59074	0.2167	M	0.89658	3.05	0.43408	D	0.99554	P;P	0.52170	0.951;0.925	P;P	0.49451	0.611;0.572	T	0.70004	-0.4991	10	0.87932	D	0	.	12.527	0.56091	1.0:0.0:0.0:0.0	.	230;320	E9PHR9;Q9NRQ2	.;PLS4_HUMAN	V	320;230;215;320;320	ENSP00000347038:F320V;ENSP00000372561:F230V;ENSP00000415605:F215V;ENSP00000399315:F320V;ENSP00000419040:F320V	ENSP00000347038:F320V	F	-	1	0	PLSCR4	147394920	1.000000	0.71417	0.999000	0.59377	0.004000	0.04260	4.803000	0.62546	2.124000	0.65301	0.477000	0.44152	TTT	PLSCR4	-	pfam_Scramblase	ENSG00000114698		0.328	PLSCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLSCR4	HGNC	protein_coding	OTTHUMT00000355172.1	151	0.00	0	A	NM_020353		145912230	145912230	-1	no_errors	ENST00000354952	ensembl	human	known	69_37n	missense	10	88.76	79	SNP	1.000	C
RYR1	6261	genome.wustl.edu	37	19	38980895	38980895	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr19:38980895delC	ENST00000359596.3	+	36	5994	c.5994delC	c.(5992-5994)ttcfs	p.F1998fs	RYR1_ENST00000360985.3_Frame_Shift_Del_p.F1998fs|RYR1_ENST00000355481.4_Frame_Shift_Del_p.F1998fs			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1998	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCCGCGAGTTCCGCTCCCCAC	0.572																																						dbGAP											0													48.0	46.0	47.0					19																	38980895		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5994delC	19.37:g.38980895delC	ENSP00000352608:p.Phe1998fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Frame_Shift_Del	DEL	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R1999fs	ENST00000359596.3	37	c.5994	CCDS33011.1	19																																																																																			RYR1	-	superfamily_MG_RAP_rcpt_1	ENSG00000196218		0.572	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	26	0.00	0	C			38980895	38980895	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	frame_shift_del	15	16.67	3	DEL	1.000	-
SEPT12	124404	genome.wustl.edu	37	16	4834057	4834057	+	Silent	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr16:4834057G>A	ENST00000268231.8	-	5	650	c.387C>T	c.(385-387)atC>atT	p.I129I	SEPT12_ENST00000591861.1_5'Flank|SEPT12_ENST00000396693.5_Intron	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	129	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)	p.I129I(1)		NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						TGTAGCCCAGGATGGGGTCCC	0.647																																						dbGAP											1	Substitution - coding silent(1)	skin(1)											156.0	139.0	145.0					16																	4834057		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.387C>T	16.37:g.4834057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6B0|Q1PBH0|Q96LL0	Silent	SNP	pfam_Cell_div_GTP-bd,pfam_AIG1,pirsf_Septin	p.I129	ENST00000268231.8	37	c.387	CCDS10522.1	16																																																																																			SEPT12	-	pfam_Cell_div_GTP-bd,pirsf_Septin	ENSG00000140623		0.647	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT12	HGNC	protein_coding	OTTHUMT00000251645.2	65	0.00	0	G	NM_144605		4834057	4834057	-1	no_errors	ENST00000268231	ensembl	human	known	69_37n	silent	58	10.77	7	SNP	1.000	A
SIPA1	6494	genome.wustl.edu	37	11	65417234	65417234	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr11:65417234C>A	ENST00000394224.3	+	12	2940	c.2644C>A	c.(2644-2646)Cca>Aca	p.P882T	SIPA1_ENST00000394227.3_Missense_Mutation_p.P780T|MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000527525.1_Missense_Mutation_p.P780T|SIPA1_ENST00000534313.1_Missense_Mutation_p.P882T	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	882					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						ACAGGACAGGCCAGGCAGTCC	0.607																																						dbGAP											0													71.0	69.0	69.0					11																	65417234		2201	4297	6498	-	-	-	SO:0001583	missense	0			AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.2644C>A	11.37:g.65417234C>A	ENSP00000377771:p.Pro882Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.P882T	ENST00000394224.3	37	c.2644	CCDS8108.1	11	.	.	.	.	.	.	.	.	.	.	C	8.785	0.929211	0.18131	.	.	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.82433	-1.61;-1.6;-1.61;-1.6	4.47	0.413	0.16401	.	1.601870	0.04373	U	0.359471	T	0.70937	0.3281	N	0.24115	0.695	0.09310	N	1	B;B	0.20052	0.0;0.041	B;B	0.19391	0.002;0.025	T	0.53627	-0.8412	10	0.38643	T	0.18	-1.4831	3.2632	0.06856	0.1838:0.4987:0.0:0.3176	.	780;882	F6RY50;Q96FS4	.;SIPA1_HUMAN	T	882;780;882;780	ENSP00000436269:P882T;ENSP00000433686:P780T;ENSP00000377771:P882T;ENSP00000377774:P780T	ENSP00000377771:P882T	P	+	1	0	SIPA1	65173810	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.390000	0.07332	-0.211000	0.10124	-0.360000	0.07572	CCA	SIPA1	-	NULL	ENSG00000213445		0.607	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SIPA1	HGNC	protein_coding	OTTHUMT00000390356.1	53	0.00	0	C	NM_006747		65417234	65417234	+1	no_errors	ENST00000394224	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	0.000	A
SPEF2	79925	genome.wustl.edu	37	5	35807318	35807318	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr5:35807318delA	ENST00000356031.3	+	36	5496	c.5342delA	c.(5341-5343)caafs	p.Q1781fs	SPEF2_ENST00000440995.2_Frame_Shift_Del_p.Q1776fs|SPEF2_ENST00000303129.4_Frame_Shift_Del_p.Q578fs|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1781					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTTTTATTCAAGACCTGATT	0.398																																						dbGAP											0													149.0	145.0	146.0					5																	35807318		1816	4090	5906	-	-	-	SO:0001589	frameshift_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.5342delA	5.37:g.35807318delA	ENSP00000348314:p.Gln1781fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Del	DEL	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.D1782fs	ENST00000356031.3	37	c.5342	CCDS43309.1	5																																																																																			SPEF2	-	pfam_HATC	ENSG00000152582		0.398	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	46	0.00	0	A	NM_144722		35807318	35807318	+1	no_errors	ENST00000356031	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	1.000	-
DBP	1628	genome.wustl.edu	37	19	49133694	49133694	+	3'UTR	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr19:49133694G>A	ENST00000222122.5	-	0	1821				SPHK2_ENST00000443164.1_Missense_Mutation_p.R703H|SPHK2_ENST00000599029.1_Missense_Mutation_p.R605H	NM_001352.3	NP_001343.2	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box) binding protein						liver development (GO:0001889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		CCGACAGCCCGCGGGAGGACT	0.592																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U06936	CCDS12728.1	19q13.33	2013-09-20			ENSG00000105516	ENSG00000105516			2697	protein-coding gene	gene with protein product		124097				1535333, 7835883	Standard	XR_243907		Approved	DABP	uc002pjx.4	Q10586	OTTHUMG00000183319	ENST00000222122.5:c.*400C>T	19.37:g.49133694G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2I2P4	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.R703H	ENST00000222122.5	37	c.2108	CCDS12728.1	19	.	.	.	.	.	.	.	.	.	.	G	14.26	2.481461	0.44147	.	.	ENSG00000063176	ENST00000443164	T	0.30981	1.51	3.21	-6.42	0.01932	.	.	.	.	.	T	0.21267	0.0512	.	.	.	0.09310	N	0.999996	D	0.56287	0.975	B	0.42062	0.374	T	0.18524	-1.0334	8	0.66056	D	0.02	-38.2106	7.4529	0.27248	0.2059:0.5781:0.216:0.0	.	703	A0T4C8	.	H	703	ENSP00000413369:R703H	ENSP00000413369:R703H	R	+	2	0	SPHK2	53825506	0.000000	0.05858	0.000000	0.03702	0.195000	0.23768	-0.552000	0.06020	-1.416000	0.02019	0.313000	0.20887	CGC	SPHK2	-	NULL	ENSG00000063176		0.592	DBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466167.1	83	0.00	0	G	NM_001352		49133694	49133694	+1	no_errors	ENST00000443164	ensembl	human	known	69_37n	missense	65	15.58	12	SNP	0.000	A
SUZ12	23512	genome.wustl.edu	37	17	30303623	30303623	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr17:30303623G>C	ENST00000322652.5	+	8	1136	c.907G>C	c.(907-909)Gat>Cat	p.D303H	SUZ12_ENST00000580398.1_Missense_Mutation_p.D280H	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	303					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				GACAGTATTTGATAAAAACAG	0.328			T	JAZF1	endometrial stromal tumours																																	dbGAP		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0													60.0	60.0	60.0					17																	30303623		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.907G>C	17.37:g.30303623G>C	ENSP00000316578:p.Asp303His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BD9	Missense_Mutation	SNP	pfam_Polycomb_protein_VEFS-Box	p.D303H	ENST00000322652.5	37	c.907	CCDS11270.1	17	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691020	0.48097	.	.	ENSG00000178691	ENST00000322652	T	0.60672	0.17	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.75140	0.3809	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.988;0.995	T	0.78283	-0.2264	10	0.87932	D	0	-14.5837	18.0892	0.89469	0.0:0.0:1.0:0.0	.	303;303	A8K1U9;Q15022	.;SUZ12_HUMAN	H	303	ENSP00000316578:D303H	ENSP00000316578:D303H	D	+	1	0	SUZ12	27327736	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.790000	0.99075	2.364000	0.80123	0.603000	0.83216	GAT	SUZ12	-	NULL	ENSG00000178691		0.328	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	HGNC	protein_coding	OTTHUMT00000256260.2	61	0.00	0	G	NM_015355		30303623	30303623	+1	no_errors	ENST00000322652	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	C
TAGAP	117289	genome.wustl.edu	37	6	159457355	159457355	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr6:159457355C>T	ENST00000367066.3	-	10	2031	c.1700G>A	c.(1699-1701)cGc>cAc	p.R567H	RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|TAGAP_ENST00000326965.6_Missense_Mutation_p.R389H|RP1-111C20.4_ENST00000607796.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	567					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GCAGAAGCCGCGGGCTGTTTG	0.597																																						dbGAP											0													59.0	67.0	64.0					6																	159457355		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.1700G>A	6.37:g.159457355C>T	ENSP00000356033:p.Arg567His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R567H	ENST00000367066.3	37	c.1700	CCDS5261.1	6	.	.	.	.	.	.	.	.	.	.	C	12.82	2.053996	0.36277	.	.	ENSG00000164691	ENST00000367066;ENST00000326965;ENST00000539071	T;T	0.17528	2.27;2.53	5.54	-0.426	0.12314	.	1.289820	0.05495	N	0.557396	T	0.02193	0.0068	N	0.08118	0	0.09310	N	0.999999	P	0.47302	0.893	B	0.35182	0.197	T	0.30650	-0.9971	10	0.87932	D	0	-0.0297	4.2374	0.10632	0.4753:0.3432:0.0731:0.1085	.	567	Q8N103	TAGAP_HUMAN	H	567;389;232	ENSP00000356033:R567H;ENSP00000322650:R389H	ENSP00000322650:R389H	R	-	2	0	TAGAP	159377343	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.384000	0.20668	0.033000	0.15463	-0.266000	0.10368	CGC	TAGAP	-	NULL	ENSG00000164691		0.597	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAGAP	HGNC	protein_coding	OTTHUMT00000042890.1	41	0.00	0	C	NM_054114		159457355	159457355	-1	no_errors	ENST00000367066	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.000	T
TBC1D2B	23102	genome.wustl.edu	37	15	78305170	78305170	+	Silent	SNP	T	T	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr15:78305170T>A	ENST00000300584.3	-	9	2264	c.2265A>T	c.(2263-2265)ctA>ctT	p.L755L	TBC1D2B_ENST00000409931.3_Silent_p.L755L	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	755	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						CCCACCTGTTTAGGCCTTGAC	0.542																																						dbGAP											0													85.0	71.0	76.0					15																	78305170		2196	4293	6489	-	-	-	SO:0001819	synonymous_variant	0			AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2265A>T	15.37:g.78305170T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD42|Q8N1F9|Q9NXM0	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Prefoldin,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.L755	ENST00000300584.3	37	c.2265	CCDS45314.1	15	.	.	.	.	.	.	.	.	.	.	T	1.391	-0.580729	0.03854	.	.	ENSG00000167202	ENST00000418039	.	.	.	5.32	-10.6	0.00265	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2057	0.82126	0.0:0.3443:0.5568:0.0989	.	.	.	.	L	637	.	.	X	-	2	2	TBC1D2B	76092225	0.000000	0.05858	0.015000	0.15790	0.376000	0.30014	-5.036000	0.00158	-4.273000	0.00060	-1.482000	0.00985	TAA	TBC1D2B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000167202		0.542	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D2B	HGNC	protein_coding	OTTHUMT00000328369.3	64	0.00	0	T	NM_015079		78305170	78305170	-1	no_errors	ENST00000300584	ensembl	human	known	69_37n	silent	43	21.82	12	SNP	0.009	A
TES	26136	genome.wustl.edu	37	7	115850679	115850679	+	5'UTR	SNP	G	G	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr7:115850679G>T	ENST00000358204.4	+	0	133				TES_ENST00000537767.1_5'UTR	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)						negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			GGTTTCCCGTGTTCGCAGCGG	0.697																																						dbGAP											0													29.0	42.0	38.0					7																	115850679		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.-83G>T	7.37:g.115850679G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0U6|Q9GZQ1|Q9HAJ9	RNA	SNP	-	NULL	ENST00000358204.4	37	NULL	CCDS5763.1	7																																																																																			TES	-	-	ENSG00000135269		0.697	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TES	HGNC	protein_coding	OTTHUMT00000059413.2	66	0.00	0	G	NM_015641		115850679	115850679	+1	no_errors	ENST00000496871	ensembl	human	putative	69_37n	rna	40	21.57	11	SNP	0.000	T
THUMPD3	25917	genome.wustl.edu	37	3	9406884	9406884	+	Silent	SNP	A	A	G			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr3:9406884A>G	ENST00000345094.3	+	2	466	c.132A>G	c.(130-132)gtA>gtG	p.V44V	SETD5-AS1_ENST00000468186.1_RNA|RP11-380O24.1_ENST00000491930.2_RNA|THUMPD3_ENST00000515662.2_Silent_p.V44V|THUMPD3_ENST00000452837.2_Silent_p.V44V|RP11-380O24.1_ENST00000466431.2_RNA|RP11-380O24.1_ENST00000517846.1_RNA|RP11-380O24.1_ENST00000517687.1_RNA|RP11-380O24.1_ENST00000518331.1_RNA	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	44						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		GAGCCACTGTACCTACTGGCT	0.438																																						dbGAP											0													92.0	94.0	93.0					3																	9406884		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.132A>G	3.37:g.9406884A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H8V6|Q9NVC1|Q9UFS3	Silent	SNP	pfam_RNA_methylase_dom,pfam_THUMP,smart_THUMP,pfscan_THUMP	p.V44	ENST00000345094.3	37	c.132	CCDS2573.1	3																																																																																			THUMPD3	-	NULL	ENSG00000134077		0.438	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THUMPD3	HGNC	protein_coding	OTTHUMT00000214127.1	74	0.00	0	A	NM_015453		9406884	9406884	+1	no_errors	ENST00000345094	ensembl	human	known	69_37n	silent	40	29.82	17	SNP	0.975	G
TIMM44	10469	genome.wustl.edu	37	19	7992107	7992107	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr19:7992107C>T	ENST00000270538.3	-	13	1592	c.1324G>A	c.(1324-1326)Gac>Aac	p.D442N	CTXN1_ENST00000318978.4_5'Flank|CTD-3193O13.8_ENST00000594308.1_RNA|TIMM44_ENST00000598968.1_5'UTR	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	442					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						GCCGAGATGTCCAGGAGCCGC	0.672																																						dbGAP											0													37.0	37.0	37.0					19																	7992107		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.1324G>A	19.37:g.7992107C>T	ENSP00000270538:p.Asp442Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0R9|D6W664|Q8N193	Missense_Mutation	SNP	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45,pirsf_Tim44,tigrfam_Tim44	p.D442N	ENST00000270538.3	37	c.1324	CCDS12192.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.497792	0.96355	.	.	ENSG00000104980	ENST00000270538	T	0.78707	-1.2	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.87192	0.6116	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.88981	0.3408	10	0.87932	D	0	-29.9734	15.1788	0.72938	0.0:1.0:0.0:0.0	.	442	O43615	TIM44_HUMAN	N	442	ENSP00000270538:D442N	ENSP00000270538:D442N	D	-	1	0	TIMM44	7898107	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.450000	0.66626	2.167000	0.68274	0.561000	0.74099	GAC	TIMM44	-	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45,pirsf_Tim44,tigrfam_Tim44	ENSG00000104980		0.672	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	TIMM44	HGNC	protein_coding	OTTHUMT00000461596.3	83	0.00	0	C			7992107	7992107	-1	no_errors	ENST00000270538	ensembl	human	known	69_37n	missense	64	20.99	17	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7574002	7574002	+	Missense_Mutation	SNP	C	C	G	rs375338359		TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr17:7574002C>G	ENST00000269305.4	-	10	1214	c.1025G>C	c.(1024-1026)cGa>cCa	p.R342P	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R342P|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R342P(3)|p.R342Q(2)|p.?(1)|p.R342_N345delRELN(1)|p.E343fs*3(1)|p.R342fs*3(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATTCAGCTCTCGGAACATCTC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	18	Whole gene deletion(8)|Substitution - Missense(5)|Deletion - Frameshift(3)|Unknown(1)|Deletion - In frame(1)	upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|ovary(2)|large_intestine(1)|stomach(1)											62.0	48.0	53.0					17																	7574002		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1025G>C	17.37:g.7574002C>G	ENSP00000269305:p.Arg342Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R342P	ENST00000269305.4	37	c.1025	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097822	0.56075	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.93019	-3.15;-3.15	5.43	2.35	0.29111	p53, tetramerisation domain (3);	0.217683	0.37906	N	0.001893	D	0.93802	0.8018	M	0.70595	2.14	0.19575	N	0.999962	P	0.50943	0.94	P	0.57911	0.829	D	0.86800	0.1991	10	0.59425	D	0.04	-0.3792	4.3338	0.11076	0.1588:0.5914:0.0:0.2498	.	342	P04637	P53_HUMAN	P	342;342;331	ENSP00000269305:R342P;ENSP00000391478:R342P	ENSP00000269305:R342P	R	-	2	0	TP53	7514727	0.035000	0.19736	0.264000	0.24511	0.867000	0.49689	-0.268000	0.08607	0.271000	0.22005	0.561000	0.74099	CGA	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	35	0.00	0	C	NM_000546		7574002	7574002	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.071	G
TREX2	11219	genome.wustl.edu	37	X	152710883	152710883	+	Silent	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chrX:152710883G>A	ENST00000334497.2	-	11	1276	c.135C>T	c.(133-135)tcC>tcT	p.S45S	TREX2_ENST00000370232.1_Silent_p.S45S|TREX2_ENST00000393862.2_Silent_p.S2S|TREX2_ENST00000330912.2_Silent_p.S2S|TREX2_ENST00000414588.1_Silent_p.S44S|HAUS7_ENST00000484394.1_5'Flank|TREX2_ENST00000338525.2_Silent_p.S2S|TREX2_ENST00000370231.2_Silent_p.S2S|TREX2_ENST00000402951.1_Silent_p.S45S			Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2	45					DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)	nucleus (GO:0005634)	3'-5'-exodeoxyribonuclease activity (GO:0008296)|exodeoxyribonuclease III activity (GO:0008853)|magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)			endometrium(4)|large_intestine(2)|lung(3)|ovary(2)	11	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGGTGCCTCGGACATGGTGA	0.632								Editing and processing nucleases																														dbGAP											0													12.0	14.0	14.0					X																	152710883		2111	4153	6264	-	-	-	SO:0001819	synonymous_variant	0			AF151107	CCDS35437.1	Xq28	2012-05-08			ENSG00000183479	ENSG00000183479			12270	protein-coding gene	gene with protein product		300370				10391904	Standard	NM_080701		Approved		uc011myp.2	Q9BQ50	OTTHUMG00000159319	ENST00000334497.2:c.135C>T	X.37:g.152710883G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q45F08|Q9UN77	Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.S45	ENST00000334497.2	37	c.135		X																																																																																			TREX2	-	superfamily_RNaseH-like_dom	ENSG00000183479		0.632	TREX2-001	KNOWN	alternative_5_UTR|basic	protein_coding	TREX2	HGNC	protein_coding	OTTHUMT00000060966.1	88	0.00	0	G	NM_080701		152710883	152710883	-1	no_errors	ENST00000334497	ensembl	human	known	69_37n	silent	53	10.17	6	SNP	0.011	A
TUBB1	81027	genome.wustl.edu	37	20	57598974	57598974	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr20:57598974G>A	ENST00000217133.1	+	4	761	c.492G>A	c.(490-492)atG>atA	p.M164I		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	164					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	ACCGGATCATGAATTCCTTCA	0.572																																						dbGAP											0													124.0	128.0	127.0					20																	57598974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.492G>A	20.37:g.57598974G>A	ENSP00000217133:p.Met164Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	p.M164I	ENST00000217133.1	37	c.492	CCDS13475.1	20	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919817	0.52653	.	.	ENSG00000101162	ENST00000217133	T	0.67865	-0.29	5.39	-9.3	0.00649	Tubulin/FtsZ, GTPase domain (4);	0.324340	0.38548	N	0.001641	T	0.49012	0.1532	L	0.35793	1.09	0.44946	D	0.997963	B	0.10296	0.003	B	0.14023	0.01	T	0.11665	-1.0578	10	0.87932	D;D	0;0	.	14.3456	0.66662	0.1182:0.6244:0.2574:0.0	.	164	Q9H4B7	TBB1_HUMAN	I	164	ENSP00000217133:M164I	ENSP00000217133:M164I;ENSP00000217133:M164I	M	+	3	0	TUBB1	57032369	1.000000	0.71417	0.103000	0.21229	0.974000	0.67602	0.990000	0.29642	-2.055000	0.00899	-0.150000	0.13652	ATG	TUBB1	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Tubulin	ENSG00000101162		0.572	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB1	HGNC	protein_coding	OTTHUMT00000079903.1	76	0.00	0	G	NM_030773		57598974	57598974	+1	no_errors	ENST00000217133	ensembl	human	known	69_37n	missense	70	10.26	8	SNP	0.997	A
WDR4	10785	genome.wustl.edu	37	21	44270219	44270219	+	Silent	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr21:44270219C>T	ENST00000398208.2	-	11	1238	c.1179G>A	c.(1177-1179)ccG>ccA	p.P393P	WDR4_ENST00000492742.1_5'UTR|WDR4_ENST00000330317.2_Silent_p.P393P	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4											haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		CGGGCCCAGGCGGGGGACTCC	0.587																																						dbGAP											0													84.0	92.0	89.0					21																	44270219		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.1179G>A	21.37:g.44270219C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P393	ENST00000398208.2	37	c.1179	CCDS13691.1	21																																																																																			WDR4	-	NULL	ENSG00000160193		0.587	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR4	HGNC	protein_coding	OTTHUMT00000195479.1	43	0.00	0	C			44270219	44270219	-1	no_errors	ENST00000330317	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.000	T
WDR64	128025	genome.wustl.edu	37	1	241933895	241933895	+	Intron	SNP	C	C	T			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr1:241933895C>T	ENST00000366552.2	+	17	2360				WDR64_ENST00000437684.2_Intron	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TAAAGTTTTACCTGTGGGCTT	0.443																																						dbGAP											0													83.0	67.0	72.0					1																	241933895		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2154-28C>T	1.37:g.241933895C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANT0|Q7Z573|Q96LY9	RNA	SNP	-	NULL	ENST00000366552.2	37	NULL		1																																																																																			WDR64	-	-	ENSG00000162843		0.443	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		45	0.00	0	C	NM_144625		241933895	241933895	+1	no_errors	ENST00000478331	ensembl	human	known	69_37n	rna	44	16.98	9	SNP	0.000	T
WFS1	7466	genome.wustl.edu	37	4	6304103	6304103	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr4:6304103G>A	ENST00000226760.1	+	8	2751	c.2581G>A	c.(2581-2583)Gtg>Atg	p.V861M	WFS1_ENST00000503569.1_Missense_Mutation_p.V861M	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	861					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		CAGGCGGCACGTGAAGATCGA	0.627																																						dbGAP											0													48.0	46.0	47.0					4																	6304103		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.2581G>A	4.37:g.6304103G>A	ENSP00000226760:p.Val861Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	NULL	p.V861M	ENST00000226760.1	37	c.2581	CCDS3386.1	4	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695369	0.30052	.	.	ENSG00000109501	ENST00000503569;ENST00000226760;ENST00000540337	D;D	0.94793	-3.52;-3.52	4.68	4.68	0.58851	.	0.143965	0.44688	D	0.000428	D	0.95069	0.8403	L	0.29908	0.895	0.42707	D	0.993636	D	0.89917	1.0	D	0.79108	0.992	D	0.95515	0.8589	10	0.52906	T	0.07	-42.9186	16.7484	0.85479	0.0:0.0:1.0:0.0	.	861	O76024	WFS1_HUMAN	M	861;861;239	ENSP00000423337:V861M;ENSP00000226760:V861M	ENSP00000226760:V861M	V	+	1	0	WFS1	6355004	1.000000	0.71417	0.970000	0.41538	0.249000	0.25844	2.793000	0.47845	2.440000	0.82611	0.561000	0.74099	GTG	WFS1	-	NULL	ENSG00000109501		0.627	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFS1	HGNC	protein_coding	OTTHUMT00000206863.1	100	0.00	0	G			6304103	6304103	+1	no_errors	ENST00000226760	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	1.000	A
ZNF623	9831	genome.wustl.edu	37	8	144732992	144732992	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr8:144732992G>A	ENST00000501748.2	+	1	1039	c.950G>A	c.(949-951)aGa>aAa	p.R317K	ZNF623_ENST00000526926.1_Missense_Mutation_p.R277K|ZNF623_ENST00000458270.2_Missense_Mutation_p.R277K	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	317					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACCGGAGAGAGACCCTTTGAA	0.458																																						dbGAP											0													90.0	86.0	88.0					8																	144732992		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.950G>A	8.37:g.144732992G>A	ENSP00000445979:p.Arg317Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R317K	ENST00000501748.2	37	c.950	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	G	3.195	-0.164912	0.06502	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.12361	2.69;2.69;2.69	4.25	3.37	0.38596	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07503	0.0189	N	0.20574	0.59	0.23050	N	0.998378	P	0.36909	0.573	B	0.36666	0.23	T	0.10823	-1.0613	9	0.02654	T	1	-19.407	9.8284	0.40925	0.1047:0.0:0.8953:0.0	.	317	O75123	ZN623_HUMAN	K	277;277;277;317;317	ENSP00000435232:R277K;ENSP00000411139:R277K;ENSP00000445979:R317K	ENSP00000330358:R277K	R	+	2	0	ZNF623	144804135	0.000000	0.05858	0.751000	0.31187	0.762000	0.43233	0.238000	0.18004	2.359000	0.80004	0.655000	0.94253	AGA	ZNF623	-	pfscan_Znf_C2H2	ENSG00000183309		0.458	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	57	0.00	0	G	NM_014789		144732992	144732992	+1	no_errors	ENST00000501748	ensembl	human	known	69_37n	missense	38	30.91	17	SNP	0.918	A
ZNF648	127665	genome.wustl.edu	37	1	182026756	182026756	+	Silent	SNP	G	G	A			TCGA-AC-A5XU-01A-11D-A28B-09	TCGA-AC-A5XU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bb1dbae-1f3c-4986-8493-e49981155689	f3058a74-3da8-4367-b662-dc1cf4e4392b	g.chr1:182026756G>A	ENST00000339948.3	-	2	597	c.390C>T	c.(388-390)ctC>ctT	p.L130L		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						ATTTGTGTGCGAGACCACTGG	0.562																																					NSCLC(71;908 1374 5429 20458 35642)	dbGAP											0													88.0	85.0	86.0					1																	182026756		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.390C>T	1.37:g.182026756G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP16	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L130	ENST00000339948.3	37	c.390	CCDS30952.1	1																																																																																			ZNF648	-	NULL	ENSG00000179930		0.562	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	44	0.00	0	G	XM_060597		182026756	182026756	-1	no_errors	ENST00000339948	ensembl	human	known	69_37n	silent	32	31.91	15	SNP	0.000	A
