#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AFF2	2334	genome.wustl.edu	37	X	147744010	147744010	+	Silent	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chrX:147744010G>A	ENST00000370460.2	+	3	1241	c.762G>A	c.(760-762)gtG>gtA	p.V254V	AFF2_ENST00000342251.3_Silent_p.V250V|AFF2_ENST00000370458.1_Silent_p.V250V|AFF2_ENST00000370457.5_Silent_p.V250V	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	254					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCCCTAGTGGCTTCCTCTT	0.473																																						dbGAP											0													112.0	120.0	118.0					X																	147744010		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.762G>A	X.37:g.147744010G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	pfam_TF_AF4/FMR2	p.V254	ENST00000370460.2	37	c.762	CCDS14684.1	X																																																																																			AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.473	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	35	0.00	0	G	NM_002025		147744010	147744010	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	silent	28	15.15	5	SNP	0.993	A
Unknown	0	genome.wustl.edu	37	2	98127653	98127653	+	IGR	SNP	T	T	G	rs538343994	byFrequency	TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr2:98127653T>G								AC159540.1 (36604 upstream) : ANKRD36B (36374 downstream)																							TTTCGAATGATTCAGTTCATT	0.333													t|||	1370	0.273562	0.0348	0.4078	5008	,	,		20303	0.2183		0.6342	False		,,,				2504	0.1871					dbGAP											0													1.0	1.0	1.0					2																	98127653		152	95	247	-	-	-	SO:0001628	intergenic_variant	0																															2.37:g.98127653T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		2																																																																																			ANKRD36B	-	-	ENSG00000196912	0	0.333					ANKRD36B	HGNC			8	0.00	0	T			98127653	98127653	-1	no_errors	ENST00000497329	ensembl	human	known	69_37n	rna	5	54.55	6	SNP	0.012	G
AFF3	3899	genome.wustl.edu	37	2	100209831	100209831	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr2:100209831C>A	ENST00000409236.2	-	13	2404	c.2292G>T	c.(2290-2292)agG>agT	p.R764S	AFF3_ENST00000356421.2_Missense_Mutation_p.R789S|AFF3_ENST00000317233.4_Missense_Mutation_p.R764S|AFF3_ENST00000409579.1_Missense_Mutation_p.R789S			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	764					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						CCCAGAGAGACCTGATCTCAT	0.582																																						dbGAP											0													71.0	66.0	68.0					2																	100209831		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2292G>T	2.37:g.100209831C>A	ENSP00000387207:p.Arg764Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.R789S	ENST00000409236.2	37	c.2367	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313457	0.40996	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.5	3.61	0.41365	.	0.234286	0.34676	N	0.003763	T	0.55893	0.1949	L	0.47716	1.5	0.34139	D	0.666178	P;P;P	0.43231	0.801;0.514;0.589	B;B;B	0.43082	0.339;0.407;0.085	T	0.65269	-0.6209	10	0.44086	T	0.13	.	10.0146	0.42008	0.0:0.6667:0.2625:0.0708	.	917;764;789	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	S	764;789;789;764;764;917	ENSP00000317421:R764S;ENSP00000348793:R789S;ENSP00000386834:R789S;ENSP00000387207:R764S	ENSP00000317421:R764S	R	-	3	2	AFF3	99576263	0.608000	0.26966	0.990000	0.47175	0.992000	0.81027	0.013000	0.13310	0.621000	0.30232	0.561000	0.74099	AGG	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.582	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	87	0.00	0	C	NM_002285		100209831	100209831	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	81	13.83	13	SNP	0.867	A
ANKRD60	140731	genome.wustl.edu	37	20	56796474	56796474	+	Missense_Mutation	SNP	G	G	A	rs534271895		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr20:56796474G>A	ENST00000457363.1	-	3	646	c.647C>T	c.(646-648)aCg>aTg	p.T216M				Q9BZ19	ANR60_HUMAN	ankyrin repeat domain 60	216										kidney(1)	1						CCTCTGAGACGTCCAGTGCTT	0.488													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21115	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													146.0	129.0	134.0					20																	56796474		692	1591	2283	-	-	-	SO:0001583	missense	0			AL354776		20q13.32	2013-01-10	2008-03-25	2008-03-25	ENSG00000124227	ENSG00000124227		"""Ankyrin repeat domain containing"""	16217	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 86"""	C20orf86			Standard	XM_006710087		Approved	bA196N14.3		Q9BZ19	OTTHUMG00000032837	ENST00000457363.1:c.647C>T	20.37:g.56796474G>A	ENSP00000396747:p.Thr216Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin_supergroup	p.T216M	ENST00000457363.1	37	c.647		20	.	.	.	.	.	.	.	.	.	.	G	11.14	1.551670	0.27739	.	.	ENSG00000124227	ENST00000457363	T	0.68181	-0.31	5.14	-5.4	0.02656	.	1.426540	0.04804	N	0.433993	T	0.64057	0.2564	M	0.63843	1.955	0.09310	N	1	.	.	.	.	.	.	T	0.58509	-0.7624	8	0.31617	T	0.26	1.4509	7.6365	0.28270	0.6469:0.1206:0.2325:0.0	.	.	.	.	M	216	ENSP00000396747:T216M	ENSP00000396747:T216M	T	-	2	0	ANKRD60	56229880	0.001000	0.12720	0.000000	0.03702	0.014000	0.08584	0.057000	0.14279	-0.825000	0.04290	-1.102000	0.02115	ACG	ANKRD60	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000124227		0.488	ANKRD60-201	KNOWN	basic|appris_principal	protein_coding	ANKRD60	HGNC	protein_coding		46	0.00	0	G	XM_001134442		56796474	56796474	-1	no_errors	ENST00000457363	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	0.000	A
ATP8B3	148229	genome.wustl.edu	37	19	1784825	1784825	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:1784825C>T	ENST00000310127.6	-	28	3891	c.3653G>A	c.(3652-3654)cGt>cAt	p.R1218H	ATP8B3_ENST00000525591.1_Missense_Mutation_p.R1181H|ATP8B3_ENST00000539485.1_Missense_Mutation_p.R1228H	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1218					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCTTGGCACGTAGCTCCTT	0.627																																						dbGAP											0													45.0	46.0	46.0					19																	1784825		2083	4210	6293	-	-	-	SO:0001583	missense	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3653G>A	19.37:g.1784825C>T	ENSP00000311336:p.Arg1218His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.R1228H	ENST00000310127.6	37	c.3683	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	C	6.931	0.541416	0.13250	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.43294	0.95;0.95;0.95	2.93	-3.77	0.04346	.	2.970770	0.01691	N	0.026676	T	0.32406	0.0828	L	0.52011	1.625	0.09310	N	1	B;B	0.13594	0.003;0.008	B;B	0.06405	0.001;0.002	T	0.07347	-1.0777	10	0.42905	T	0.14	.	0.8647	0.01201	0.2397:0.3561:0.1292:0.2749	.	1218;1181	O60423;Q7Z485	AT8B3_HUMAN;.	H	1218;1228;1181	ENSP00000311336:R1218H;ENSP00000443574:R1228H;ENSP00000437115:R1181H	ENSP00000311336:R1218H	R	-	2	0	ATP8B3	1735825	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.125000	0.03257	-1.151000	0.02836	-1.367000	0.01198	CGT	ATP8B3	-	NULL	ENSG00000130270		0.627	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	61	0.00	0	C	NM_138813		1784825	1784825	-1	no_errors	ENST00000539485	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.000	T
ATRX	546	genome.wustl.edu	37	X	76812972	76812972	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chrX:76812972C>T	ENST00000373344.5	-	30	6863	c.6649G>A	c.(6649-6651)Gac>Aac	p.D2217N	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.D2179N	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2217	Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GAATTAGGGTCATCTAATAAG	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															dbGAP		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											124.0	123.0	123.0					X																	76812972		2203	4296	6499	-	-	-	SO:0001583	missense	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6649G>A	X.37:g.76812972C>T	ENSP00000362441:p.Asp2217Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D2217N	ENST00000373344.5	37	c.6649	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998185	0.74818	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.93426	-3.22;-3.22	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.95626	0.8578	L	0.48935	1.535	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.87578	0.998;0.9	D	0.96024	0.9011	10	0.72032	D	0.01	-10.8651	18.765	0.91868	0.0:1.0:0.0:0.0	.	2179;2217	P46100-4;P46100	.;ATRX_HUMAN	N	2217;2179	ENSP00000362441:D2217N;ENSP00000378967:D2179N	ENSP00000362441:D2217N	D	-	1	0	ATRX	76699628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.377000	0.81083	0.594000	0.82650	GAC	ATRX	-	NULL	ENSG00000085224		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	72	0.00	0	C	NM_000489		76812972	76812972	-1	no_errors	ENST00000373344	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	1.000	T
CACNA1D	776	genome.wustl.edu	37	3	53765165	53765165	+	Missense_Mutation	SNP	G	G	A	rs537189630		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr3:53765165G>A	ENST00000350061.5	+	17	2909	c.2398G>A	c.(2398-2400)Gac>Aac	p.D800N	CACNA1D_ENST00000288139.4_Missense_Mutation_p.D820N|CACNA1D_ENST00000422281.2_Missense_Mutation_p.D800N	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	800					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGCCAACAGTGACAACAAGGT	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		20050	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													124.0	113.0	117.0					3																	53765165		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2398G>A	3.37:g.53765165G>A	ENSP00000288133:p.Asp800Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.D820N	ENST00000350061.5	37	c.2458	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780383	0.49891	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.95885	-3.81;-3.84;-3.82;-3.82	5.92	5.04	0.67666	.	0.149537	0.44285	D	0.000471	D	0.90133	0.6917	N	0.16743	0.435	0.80722	D	1	P;B;B;B	0.35174	0.488;0.018;0.0;0.0	B;B;B;B	0.32211	0.142;0.024;0.003;0.002	D	0.89249	0.3589	10	0.41790	T	0.15	.	15.2436	0.73490	0.0:0.1398:0.8601:0.0	.	800;493;800;820	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	N	800;820;800;493	ENSP00000288133:D800N;ENSP00000288139:D820N;ENSP00000409174:D800N;ENSP00000418014:D493N	ENSP00000288139:D820N	D	+	1	0	CACNA1D	53740205	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.859000	0.69539	1.498000	0.48600	0.655000	0.94253	GAC	CACNA1D	-	prints_LVDCC_a1dsu	ENSG00000157388		0.368	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	70	0.00	0	G	NM_000720		53765165	53765165	+1	no_errors	ENST00000288139	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	A
CALM3	808	genome.wustl.edu	37	19	47112431	47112431	+	3'UTR	SNP	G	G	A	rs2229577	byFrequency	TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:47112431G>A	ENST00000291295.9	+	0	670				CALM3_ENST00000594523.1_3'UTR|CTB-12A17.3_ENST00000597609.1_RNA|CALM3_ENST00000477244.1_3'UTR|CALM3_ENST00000599839.1_3'UTR|CALM3_ENST00000597743.1_3'UTR|CALM3_ENST00000596362.1_3'UTR|CALM3_ENST00000598871.1_3'UTR|CALM3_ENST00000391918.2_3'UTR	NM_005184.2	NP_005175.2	P62158	CALM_HUMAN	calmodulin 3 (phosphorylase kinase, delta)						activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)			breast(1)|cervix(2)|endometrium(1)|lung(1)|ovary(1)	6		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000683)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0341)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	GGCAGCTGGCGATGCCCGTTC	0.567																																						dbGAP											0													51.0	47.0	48.0					19																	47112431		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS33061.1	19q13.2-q13.3	2013-02-25			ENSG00000160014	ENSG00000160014		"""EF-hand domain containing"", ""Endogenous ligands"""	1449	protein-coding gene	gene with protein product	"""prepro-calmodulin 3"""	114183					Standard	NM_005184		Approved	PHKD	uc002pew.3	P62158	OTTHUMG00000133517	ENST00000291295.9:c.*21G>A	19.37:g.47112431G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	RNA	SNP	-	NULL	ENST00000291295.9	37	NULL	CCDS33061.1	19																																																																																			CALM3	-	-	ENSG00000160014		0.567	CALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALM3	HGNC	protein_coding	OTTHUMT00000257483.2	87	0.00	0	G			47112431	47112431	+1	no_errors	ENST00000477244	ensembl	human	known	69_37n	rna	45	42.31	33	SNP	0.793	A
CCDC144A	9720	genome.wustl.edu	37	17	16593988	16593988	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:16593988G>A	ENST00000360524.8	+	1	350	c.274G>A	c.(274-276)Gac>Aac	p.D92N	CCDC144A_ENST00000340621.5_Missense_Mutation_p.D92N|CCDC144A_ENST00000399273.1_Missense_Mutation_p.D92N|CCDC144A_ENST00000443444.2_Missense_Mutation_p.D92N|RNU6-405P_ENST00000516637.1_RNA|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.D92N|CCDC144A_ENST00000436374.1_3'UTR|CCDC144A_ENST00000456009.1_Missense_Mutation_p.D92N	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	92																	CCGGTCGGGCGACGTCCCTGG	0.642																																						dbGAP											0													105.0	115.0	111.0					17																	16593988		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.274G>A	17.37:g.16593988G>A	ENSP00000353717:p.Asp92Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O60311|Q6ZU57	Missense_Mutation	SNP	pfam_DUF3496	p.D92N	ENST00000360524.8	37	c.274	CCDS45621.1	17	.	.	.	.	.	.	.	.	.	.	.	7.191	0.591459	0.13812	.	.	ENSG00000170160	ENST00000420937;ENST00000340621;ENST00000399273;ENST00000436374;ENST00000399264;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000456009;ENST00000360495	T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83	0.542	-1.08	0.09936	.	.	.	.	.	T	0.10337	0.0253	L	0.29908	0.895	0.09310	N	1	P	0.36837	0.571	B	0.21360	0.034	T	0.30650	-0.9971	8	0.10636	T	0.68	.	.	.	.	.	92	A2RUR9	C144A_HUMAN	N	92	ENSP00000344740:D92N;ENSP00000382215:D92N;ENSP00000439262:D92N;ENSP00000440655:D92N;ENSP00000353717:D92N;ENSP00000394201:D92N;ENSP00000353685:D92N	ENSP00000344740:D92N	D	+	1	0	CCDC144A	16534713	0.638000	0.27225	0.001000	0.08648	0.009000	0.06853	-0.873000	0.04214	-0.490000	0.06707	-0.507000	0.04495	GAC	CCDC144A	-	NULL	ENSG00000170160		0.642	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	HGNC	protein_coding	OTTHUMT00000444093.1	42	0.00	0	G			16593988	16593988	+1	no_errors	ENST00000360524	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	0.002	A
CNPY3	10695	genome.wustl.edu	37	6	42897358	42897360	+	In_Frame_Del	DEL	TGC	TGC	-	rs570105218	byFrequency	TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr6:42897358_42897360delTGC	ENST00000372836.4	+	1	421_423	c.50_52delTGC	c.(49-54)ttgctg>ttg	p.17_18LL>L	CNPY3_ENST00000394142.3_In_Frame_Del_p.17_18LL>L	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CTTCTTCCCTtgctgctgctgct	0.695																																						dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.50_52delTGC	6.37:g.42897367_42897369delTGC	ENSP00000361926:p.Leu25del	Somatic		WXS	Illumina GAIIx	Phase_IV	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Del	DEL	pfam_DUF3456	p.L21in_frame_del	ENST00000372836.4	37	c.50_52	CCDS4875.1	6																																																																																			CNPY3	-	NULL	ENSG00000137161		0.695	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY3	HGNC	protein_coding	OTTHUMT00000040564.1	38	0.00	0	TGC	NM_006586		42897358	42897360	+1	no_errors	ENST00000372836	ensembl	human	known	69_37n	in_frame_del	23	11.54	3	DEL	0.122:0.131:0.153	-
CRMP1	1400	genome.wustl.edu	37	4	5827283	5827283	+	Missense_Mutation	SNP	G	G	A	rs187171314		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr4:5827283G>A	ENST00000397890.2	-	13	1779	c.1565C>T	c.(1564-1566)tCg>tTg	p.S522L	EVC_ENST00000382674.2_Intron|CRMP1_ENST00000324989.7_Missense_Mutation_p.S636L|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Missense_Mutation_p.S520L	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	522					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.S636L(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TTTAGAAGGCGAAGATTTGGC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		20224	0.0		0.001	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	large_intestine(1)											202.0	193.0	196.0					4																	5827283		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1565C>T	4.37:g.5827283G>A	ENSP00000380987:p.Ser522Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.S636L	ENST00000397890.2	37	c.1907	CCDS43207.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	27.2	4.806469	0.90623	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.85702	-2.02;-1.98;-1.98	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.91901	0.7436	M	0.78916	2.43	0.80722	D	1	D;P;P;D	0.89917	0.999;0.892;0.801;1.0	D;B;B;D	0.87578	0.93;0.217;0.296;0.998	D	0.92830	0.6279	10	0.62326	D	0.03	-18.2589	15.9371	0.79720	0.0:0.0:1.0:0.0	.	636;520;522;459	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	L	636;522;522;520	ENSP00000321606:S636L;ENSP00000380987:S522L;ENSP00000425742:S520L	ENSP00000321606:S636L	S	-	2	0	CRMP1	5878184	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.231000	0.95317	2.313000	0.78055	0.561000	0.74099	TCG	CRMP1	-	NULL	ENSG00000072832		0.532	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	73	0.00	0	G	NM_001313		5827283	5827283	-1	no_errors	ENST00000324989	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	1.000	A
CSF2RA	1438	genome.wustl.edu	37	X	1414387	1414387	+	Intron	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chrX:1414387G>A	ENST00000381524.3	+	9	996				BX649553.1_ENST00000583047.1_RNA|MIR3690_ENST00000580266.1_RNA|CSF2RA_ENST00000355432.3_Intron|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_Intron|BX649553.2_ENST00000578699.1_RNA|CSF2RA_ENST00000498153.1_Intron|CSF2RA_ENST00000361536.3_Intron|CSF2RA_ENST00000417535.2_Intron|CSF2RA_ENST00000432318.2_Intron|CSF2RA_ENST00000381529.3_Intron|CSF2RA_ENST00000381509.3_Intron|CSF2RA_ENST00000501036.2_Intron|CSF2RA_ENST00000355805.2_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)						response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	AACCCTCAGCGTAACCCTACG	0.517													g|||	1	0.000199681	0.0008	0.0	5008	,	,		22039	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(131;723 1707 25334 40494 41806)	dbGAP											0													593.0	528.0	550.0					X																	1414387		2203	4296	6499	-	-	-	SO:0001627	intron_variant	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.810+38G>A	X.37:g.1414387G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	RNA	SNP	-	NULL	ENST00000381524.3	37	NULL	CCDS35191.1	X																																																																																			CSF2RA	-	-	ENSG00000198223		0.517	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	HGNC	protein_coding	OTTHUMT00000035013.2	176	0.00	0	G			1414387	1414387	+1	no_errors	ENST00000491683	ensembl	human	putative	69_37n	rna	114	18.57	26	SNP	0.040	A
DENND4B	9909	genome.wustl.edu	37	1	153916630	153916630	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:153916630delC	ENST00000361217.4	-	2	639	c.221delG	c.(220-222)ggcfs	p.G74fs		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	74	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAAGGGGTGGCCCCCAGCAGA	0.642																																						dbGAP											0													37.0	43.0	41.0					1																	153916630		1960	4151	6111	-	-	-	SO:0001589	frameshift_variant	0			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.221delG	1.37:g.153916630delC	ENSP00000354597:p.Gly74fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4K0	Frame_Shift_Del	DEL	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.G74fs	ENST00000361217.4	37	c.221	CCDS44228.1	1																																																																																			DENND4B	-	pfscan_uDENN_dom	ENSG00000198837		0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	67	0.00	0	C	XM_375806		153916630	153916630	-1	no_errors	ENST00000361217	ensembl	human	known	69_37n	frame_shift_del	61	15.28	11	DEL	1.000	-
DENND4B	9909	genome.wustl.edu	37	1	153916698	153916698	+	Silent	SNP	T	T	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:153916698T>C	ENST00000361217.4	-	2	571	c.153A>G	c.(151-153)gcA>gcG	p.A51A		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	51	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TAGCGATGACTGCCACATCTG	0.642																																						dbGAP											0													26.0	32.0	30.0					1																	153916698		1998	4152	6150	-	-	-	SO:0001819	synonymous_variant	0			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.153A>G	1.37:g.153916698T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4K0	Silent	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.A51	ENST00000361217.4	37	c.153	CCDS44228.1	1																																																																																			DENND4B	-	pfscan_uDENN_dom	ENSG00000198837		0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	90	0.00	0	T	XM_375806		153916698	153916698	-1	no_errors	ENST00000361217	ensembl	human	known	69_37n	silent	62	11.43	8	SNP	0.984	C
DUSP15	128853	genome.wustl.edu	37	20	30451741	30451741	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr20:30451741G>A	ENST00000278979.3	-	5	299	c.223C>T	c.(223-225)Cgc>Tgc	p.R75C	DUSP15_ENST00000339738.5_Missense_Mutation_p.R78C|DUSP15_ENST00000398084.2_5'UTR|DUSP15_ENST00000493115.1_5'UTR|DUSP15_ENST00000375966.4_Missense_Mutation_p.R75C|DUSP15_ENST00000486996.1_5'UTR|DUSP15_ENST00000398083.1_5'UTR			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	75	Tyrosine-protein phosphatase.				positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCATTAAGGCGGCAGCAGTGG	0.532																																						dbGAP											0													130.0	101.0	111.0					20																	30451741		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.223C>T	20.37:g.30451741G>A	ENSP00000278979:p.Arg75Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,superfamily_SMAD_FHA_domain,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP	p.R75C	ENST00000278979.3	37	c.223		20	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420802	0.83559	.	.	ENSG00000149599	ENST00000278979;ENST00000339738;ENST00000375966	T;T;T	0.61742	0.08;0.08;0.08	4.55	4.55	0.56014	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.120232	0.64402	D	0.000019	D	0.82737	0.5102	H	0.95850	3.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.88324	0.2964	10	0.87932	D	0	.	14.0513	0.64739	0.0:0.0:1.0:0.0	.	78;75	Q9H1R2-3;Q9H1R2	.;DUS15_HUMAN	C	75;78;75	ENSP00000278979:R75C;ENSP00000341658:R78C;ENSP00000365133:R75C	ENSP00000278979:R75C	R	-	1	0	DUSP15	29915402	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.618000	0.74214	2.073000	0.62155	0.563000	0.77884	CGC	DUSP15	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000149599		0.532	DUSP15-004	KNOWN	basic	protein_coding	DUSP15	HGNC	protein_coding	OTTHUMT00000078555.3	78	0.00	0	G	NM_080611		30451741	30451741	-1	no_errors	ENST00000278979	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	1.000	A
EFTUD2	9343	genome.wustl.edu	37	17	42928679	42928679	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:42928679A>C	ENST00000426333.2	-	28	3179	c.2882T>G	c.(2881-2883)cTt>cGt	p.L961R	EFTUD2_ENST00000402521.3_Missense_Mutation_p.L926R|EFTUD2_ENST00000592576.1_Missense_Mutation_p.L951R|EFTUD2_ENST00000591382.1_Missense_Mutation_p.L961R	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	961					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				CTGTTTGGCAAGTTCCAGCAA	0.522																																					Ovarian(10;65 485 10258 29980 30707)	dbGAP											0													208.0	180.0	190.0					17																	42928679		2203	4300	6503	-	-	-	SO:0001583	missense	0			D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.2882T>G	17.37:g.42928679A>C	ENSP00000392094:p.Leu961Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.L961R	ENST00000426333.2	37	c.2882	CCDS11489.1	17	.	.	.	.	.	.	.	.	.	.	A	27.4	4.829414	0.90955	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.75154	-0.91;-0.83	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.89164	0.6637	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	D	0.91486	0.5208	10	0.87932	D	0	-23.1512	16.2285	0.82315	1.0:0.0:0.0:0.0	.	951;961	B4DMC0;Q15029	.;U5S1_HUMAN	R	961;951;926	ENSP00000392094:L961R;ENSP00000385873:L926R	ENSP00000262414:L951R	L	-	2	0	EFTUD2	40284205	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.775000	0.91772	2.235000	0.73313	0.460000	0.39030	CTT	EFTUD2	-	NULL	ENSG00000108883		0.522	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD2	HGNC	protein_coding	OTTHUMT00000448672.1	22	0.00	0	A	NM_004247		42928679	42928679	-1	no_errors	ENST00000426333	ensembl	human	known	69_37n	missense	4	42.86	3	SNP	1.000	C
EPB41L2	2037	genome.wustl.edu	37	6	131216142	131216142	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr6:131216142G>A	ENST00000337057.3	-	9	1535	c.1354C>T	c.(1354-1356)Cgc>Tgc	p.R452C	EPB41L2_ENST00000525271.1_Missense_Mutation_p.R452C|EPB41L2_ENST00000368128.2_Missense_Mutation_p.R452C|EPB41L2_ENST00000530481.1_Missense_Mutation_p.R452C|EPB41L2_ENST00000528282.1_Missense_Mutation_p.R452C|EPB41L2_ENST00000445890.2_Missense_Mutation_p.R452C|EPB41L2_ENST00000527411.1_Missense_Mutation_p.R452C|EPB41L2_ENST00000525193.1_Missense_Mutation_p.R452C|EPB41L2_ENST00000529208.1_Missense_Mutation_p.R452C|EPB41L2_ENST00000392427.3_Missense_Mutation_p.R452C|EPB41L2_ENST00000527659.1_Missense_Mutation_p.R452C	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	452	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		AAGTTACTGCGTTTATAGGAA	0.393																																						dbGAP											0													98.0	88.0	91.0					6																	131216142		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.1354C>T	6.37:g.131216142G>A	ENSP00000338481:p.Arg452Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.R452C	ENST00000337057.3	37	c.1354	CCDS5141.1	6	.	.	.	.	.	.	.	.	.	.	G	19.28	3.798107	0.70567	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	D;D;D;D;D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.68	5.68	0.88126	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.91576	0.7339	M	0.84433	2.695	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.999;0.999;0.998	D	0.91894	0.5526	10	0.56958	D	0.05	.	13.8849	0.63702	0.0:0.0:0.7325:0.2675	.	452;452;452;452;452	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	C	452	ENSP00000434308:R452C;ENSP00000434576:R452C;ENSP00000402041:R452C;ENSP00000338481:R452C;ENSP00000376222:R452C;ENSP00000357110:R452C;ENSP00000436348:R452C;ENSP00000432803:R452C;ENSP00000431988:R452C;ENSP00000431647:R452C;ENSP00000436641:R452C	ENSP00000338481:R452C	R	-	1	0	EPB41L2	131257835	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.492000	0.53259	2.689000	0.91719	0.655000	0.94253	CGC	EPB41L2	-	pirsf_Band_41_protein,pfam_FERM_PH-like_C,pfscan_FERM_domain	ENSG00000079819		0.393	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	69	0.00	0	G			131216142	131216142	-1	no_errors	ENST00000337057	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	1.000	A
EPX	8288	genome.wustl.edu	37	17	56281653	56281653	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:56281653C>G	ENST00000225371.5	+	12	2127	c.2017C>G	c.(2017-2019)Cga>Gga	p.R673G		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	673					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	TTCCTTGTCTCGAATTATATG	0.512																																						dbGAP											0													113.0	100.0	104.0					17																	56281653		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.2017C>G	17.37:g.56281653C>G	ENSP00000225371:p.Arg673Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4TVP3	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R673G	ENST00000225371.5	37	c.2017	CCDS11602.1	17	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456584	0.63401	.	.	ENSG00000121053	ENST00000225371	T	0.74315	-0.83	5.65	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.86485	0.5944	M	0.85197	2.74	0.58432	D	0.99999	D	0.89917	1.0	D	0.83275	0.996	D	0.88227	0.2901	10	0.87932	D	0	-2.5207	12.2449	0.54563	0.0:0.9178:0.0:0.0822	.	673	P11678	PERE_HUMAN	G	673	ENSP00000225371:R673G	ENSP00000225371:R673G	R	+	1	2	EPX	53636652	0.915000	0.31059	1.000000	0.80357	0.617000	0.37484	0.502000	0.22594	1.387000	0.46486	0.655000	0.94253	CGA	EPX	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	ENSG00000121053		0.512	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPX	HGNC	protein_coding	OTTHUMT00000443367.1	69	0.00	0	C	NM_000502		56281653	56281653	+1	no_errors	ENST00000225371	ensembl	human	known	69_37n	missense	36	32.08	17	SNP	1.000	G
FAM160A2	84067	genome.wustl.edu	37	11	6245042	6245042	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr11:6245042G>A	ENST00000449352.2	-	3	838	c.575C>T	c.(574-576)tCa>tTa	p.S192L	FAM160A2_ENST00000265978.4_Missense_Mutation_p.S192L|FAM160A2_ENST00000524416.1_Missense_Mutation_p.S192L			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	192					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCGAGCAATGAAGGCTCCTG	0.597																																						dbGAP											0													70.0	73.0	72.0					11																	6245042		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.575C>T	11.37:g.6245042G>A	ENSP00000416918:p.Ser192Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.S192L	ENST00000449352.2	37	c.575	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821711	0.50633	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.32023	1.47;1.47;1.47	5.05	4.13	0.48395	.	0.507528	0.19934	N	0.102784	T	0.45377	0.1339	M	0.76574	2.34	0.36058	D	0.841249	P;P;B	0.41848	0.763;0.481;0.264	P;B;B	0.49421	0.61;0.41;0.085	T	0.59440	-0.7454	10	0.59425	D	0.04	-11.0016	12.5443	0.56190	0.0799:0.0:0.9201:0.0	.	192;192;192	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	L	192;117;192;192	ENSP00000416918:S192L;ENSP00000265978:S192L;ENSP00000431773:S192L	ENSP00000265978:S192L	S	-	2	0	FAM160A2	6201618	0.971000	0.33674	1.000000	0.80357	0.998000	0.95712	4.374000	0.59543	1.360000	0.45960	0.655000	0.94253	TCA	FAM160A2	-	pfam_RetinoicA-induced_16-like	ENSG00000051009		0.597	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1	25	0.00	0	G	NM_032127		6245042	6245042	-1	no_errors	ENST00000265978	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	0.998	A
FAM98C	147965	genome.wustl.edu	37	19	38895664	38895664	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:38895664G>C	ENST00000252530.5	+	4	485	c.466G>C	c.(466-468)Gaa>Caa	p.E156Q	FAM98C_ENST00000585954.1_3'UTR|FAM98C_ENST00000343358.7_Missense_Mutation_p.E156Q|FAM98C_ENST00000588262.1_Intron	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	156										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CATGGTCCAAGAACTGGACCT	0.647																																						dbGAP											0													72.0	81.0	78.0					19																	38895664		2045	4195	6240	-	-	-	SO:0001583	missense	0				CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.466G>C	19.37:g.38895664G>C	ENSP00000252530:p.Glu156Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMW3|Q66K45	Missense_Mutation	SNP	pfam_Uncharacterised_FAM98	p.E156Q	ENST00000252530.5	37	c.466	CCDS42562.1	19	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236133	0.58886	.	.	ENSG00000130244	ENST00000252530;ENST00000343358	T;T	0.45668	0.89;0.89	4.72	4.72	0.59763	.	0.000000	0.46442	D	0.000288	T	0.62441	0.2428	M	0.76002	2.32	0.45914	D	0.99875	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.971	T	0.62172	-0.6910	10	0.40728	T	0.16	-4.6851	13.1211	0.59327	0.0:0.0:1.0:0.0	.	156;156	Q17RN3-2;Q17RN3	.;FA98C_HUMAN	Q	156	ENSP00000252530:E156Q;ENSP00000340348:E156Q	ENSP00000252530:E156Q	E	+	1	0	FAM98C	43587504	1.000000	0.71417	0.997000	0.53966	0.388000	0.30384	4.603000	0.61105	2.447000	0.82792	0.558000	0.71614	GAA	FAM98C	-	pfam_Uncharacterised_FAM98	ENSG00000130244		0.647	FAM98C-001	KNOWN	basic|CCDS	protein_coding	FAM98C	HGNC	protein_coding	OTTHUMT00000459222.1	61	0.00	0	G	NM_174905		38895664	38895664	+1	no_errors	ENST00000252530	ensembl	human	known	69_37n	missense	35	28.57	14	SNP	1.000	C
GPR61	83873	genome.wustl.edu	37	1	110086413	110086413	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:110086413G>A	ENST00000527748.1	+	2	1452	c.769G>A	c.(769-771)Gaa>Aaa	p.E257K	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		GCAACGCTCCGAATCTCTCAG	0.657																																						dbGAP											0													54.0	63.0	60.0					1																	110086413		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.769G>A	1.37:g.110086413G>A	ENSP00000432456:p.Glu257Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.E257K	ENST00000527748.1	37	c.769	CCDS801.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497938	0.85069	.	.	ENSG00000156097	ENST00000527748;ENST00000286603	T	0.70516	-0.49	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.56920	0.2018	L	0.28458	0.855	0.58432	D	0.999995	D	0.59357	0.985	P	0.48089	0.566	T	0.54125	-0.8340	10	0.25106	T	0.35	-27.1526	18.6337	0.91370	0.0:0.0:1.0:0.0	.	257	Q9BZJ8	GPR61_HUMAN	K	257;385	ENSP00000432456:E257K	ENSP00000286603:E385K	E	+	1	0	GPR61	109887936	1.000000	0.71417	0.963000	0.40424	0.934000	0.57294	9.593000	0.98250	2.718000	0.92993	0.650000	0.86243	GAA	GPR61	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000156097		0.657	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GPR61	HGNC	protein_coding	OTTHUMT00000385575.1	62	0.00	0	G			110086413	110086413	+1	no_errors	ENST00000404129	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	1.000	A
GSX2	170825	genome.wustl.edu	37	4	54967839	54967839	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr4:54967839C>G	ENST00000326902.2	+	2	979	c.665C>G	c.(664-666)tCt>tGt	p.S222C	GSX2_ENST00000503800.1_3'UTR|GSX2_ENST00000548609.1_3'UTR|AC110298.1_ENST00000408292.1_RNA|FIP1L1_ENST00000507166.1_Intron	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2	222					forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			AGAGAATTCTCTTCCAACATG	0.557																																						dbGAP											0													109.0	115.0	113.0					4																	54967839		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.665C>G	4.37:g.54967839C>G	ENSP00000319118:p.Ser222Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.S222C	ENST00000326902.2	37	c.665	CCDS3494.1	4	.	.	.	.	.	.	.	.	.	.	C	21.1	4.094914	0.76870	.	.	ENSG00000180613	ENST00000326902	D	0.96334	-3.98	4.9	4.9	0.64082	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96602	0.8891	L	0.31476	0.935	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.97481	1.0047	10	0.66056	D	0.02	.	18.2636	0.90044	0.0:1.0:0.0:0.0	.	222	Q9BZM3	GSX2_HUMAN	C	222	ENSP00000319118:S222C	ENSP00000319118:S222C	S	+	2	0	GSX2	54662596	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.669000	0.61575	2.535000	0.85469	0.484000	0.47621	TCT	GSX2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000180613		0.557	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSX2	HGNC	protein_coding	OTTHUMT00000250595.1	51	0.00	0	C	NM_133267		54967839	54967839	+1	no_errors	ENST00000326902	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	1.000	G
HDLBP	3069	genome.wustl.edu	37	2	242179047	242179047	+	Silent	SNP	C	C	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr2:242179047C>T	ENST00000391975.1	-	19	2807	c.2580G>A	c.(2578-2580)aaG>aaA	p.K860K	HDLBP_ENST00000391976.2_Silent_p.K860K|HDLBP_ENST00000427183.2_Silent_p.K827K|HDLBP_ENST00000310931.4_Silent_p.K860K	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	860	KH 10. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GAATGCGTTTCTTGGCTGCCT	0.597																																						dbGAP											0													117.0	111.0	113.0					2																	242179047		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.2580G>A	2.37:g.242179047C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.E669K	ENST00000391975.1	37	c.2005	CCDS2547.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.564|9.564	1.119325|1.119325	0.20877|0.20877	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000373292|ENST00000427487	.|.	.|.	.|.	5.41|5.41	2.61|2.61	0.31194|0.31194	.|.	.|.	.|.	.|.	.|.	T|T	0.54431|0.54431	0.1858|0.1858	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.44190|0.44190	-0.9344|-0.9344	4|4	.|.	.|.	.|.	-35.8124|-35.8124	6.2457|6.2457	0.20815|0.20815	0.2662:0.598:0.0:0.1358|0.2662:0.598:0.0:0.1358	.|.	.|.	.|.	.|.	K|K	669|262	.|.	.|.	E|R	-|-	1|2	0|0	HDLBP|HDLBP	241827720|241827720	1.000000|1.000000	0.71417|0.71417	0.771000|0.771000	0.31576|0.31576	0.898000|0.898000	0.52572|0.52572	1.772000|1.772000	0.38552|0.38552	0.343000|0.343000	0.23821|0.23821	0.561000|0.561000	0.74099|0.74099	GAA|AGA	HDLBP	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.597	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	31	0.00	0	C	NM_203346		242179047	242179047	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000373292	ensembl	human	novel	69_37n	missense	16	44.83	13	SNP	1.000	T
IFITM10	402778	genome.wustl.edu	37	11	1756511	1756513	+	Stop_Codon_Del	DEL	TAG	TAG	-			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	TAG	TAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr11:1756511_1756513delTAG	ENST00000340134.4	-	0	832_834				IFITM10_ENST00000482459.1_5'UTR	NM_001170820.3	NP_001164291.2	A6NMD0	IFM10_HUMAN	interferon induced transmembrane protein 10						response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TGGCGGGCCTTAGTAGTCGGTGA	0.591																																						dbGAP											0																																										-	-	-	SO:0001567	stop_retained_variant	0				CCDS53593.1, CCDS53593.2	11p15.5	2011-05-06			ENSG00000244242	ENSG00000244242			40022	protein-coding gene	gene with protein product							Standard	NM_001170820		Approved		uc021qbs.2	A6NMD0	OTTHUMG00000043933	Exception_encountered	11.37:g.1756514_1756516delTAG	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEU7	In_Frame_Del	DEL	pfam_Interferon-induced_TM_protein	p.Y228in_frame_del	ENST00000340134.4	37	c.686_684	CCDS53593.2	11																																																																																			IFITM10	-	NULL	ENSG00000244242		0.591	IFITM10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IFITM10	HGNC	protein_coding	OTTHUMT00000102341.5	57	0.00	0	TAG	NM_001170820		1756511	1756513	-1	no_errors	ENST00000340134	ensembl	human	known	69_37n	in_frame_del	37	13.95	6	DEL	0.622:0.990:1.000	-
INADL	10207	genome.wustl.edu	37	1	62550250	62550250	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:62550250T>A	ENST00000371158.2	+	33	4421	c.4307T>A	c.(4306-4308)aTg>aAg	p.M1436K	INADL_ENST00000545929.1_Missense_Mutation_p.M109K|INADL_ENST00000316485.6_Missense_Mutation_p.M1436K|INADL_ENST00000543708.1_Missense_Mutation_p.M220K	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1436					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GGACAGGAAATGATTATAGAA	0.463																																						dbGAP											0													92.0	90.0	91.0					1																	62550250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4307T>A	1.37:g.62550250T>A	ENSP00000360200:p.Met1436Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.M1436K	ENST00000371158.2	37	c.4307	CCDS617.2	1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.345004	0.24426	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000543708;ENST00000545929	T;T;T;T	0.19806	2.37;2.45;2.12;2.37	5.02	5.02	0.67125	PDZ/DHR/GLGF (1);	0.066783	0.64402	D	0.000013	T	0.24547	0.0595	N	0.12182	0.205	0.46044	D	0.99883	D;B;D;D;P;D	0.69078	0.974;0.0;0.982;0.997;0.598;0.964	P;B;P;P;P;P	0.61940	0.669;0.012;0.893;0.896;0.831;0.62	T	0.10086	-1.0645	10	0.24483	T	0.36	.	15.0292	0.71694	0.0:0.0:0.0:1.0	.	109;220;895;1436;1436;1436	F5GY89;B4DE90;Q8NI35-5;F8W8T2;Q8NI35;Q8NI35-4	.;.;.;.;INADL_HUMAN;.	K	1436;1436;1436;1436;220;109	ENSP00000360200:M1436K;ENSP00000326199:M1436K;ENSP00000445790:M220K;ENSP00000440094:M109K	ENSP00000326199:M1436K	M	+	2	0	INADL	62322838	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.445000	0.52921	2.005000	0.58758	0.533000	0.62120	ATG	INADL	-	superfamily_PDZ	ENSG00000132849		0.463	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	71	0.00	0	T	NM_170605		62550250	62550250	+1	no_errors	ENST00000371158	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	A
INO80E	283899	genome.wustl.edu	37	16	30012782	30012782	+	Silent	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr16:30012782G>A	ENST00000563197.1	+	6	1461	c.444G>A	c.(442-444)ctG>ctA	p.L148L	INO80E_ENST00000304516.7_Intron|INO80E_ENST00000567254.1_Silent_p.L148L|INO80E_ENST00000567705.1_Intron	NM_173618.1	NP_775889.1	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	148	Pro-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	6						ACCTGGCCCTGCAGCTGCCCG	0.706																																						dbGAP											0													23.0	24.0	24.0					16																	30012782		2192	4298	6490	-	-	-	SO:0001819	synonymous_variant	0			AK075133	CCDS10665.1	16p11.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000169592	ENSG00000169592		"""INO80 complex subunits"""	26905	protein-coding gene	gene with protein product			"""coiled-coil domain containing 95"""	CCDC95		16230350	Standard	NM_173618		Approved	FLJ90652	uc002dvg.1	Q8NBZ0	OTTHUMG00000132114	ENST00000563197.1:c.444G>A	16.37:g.30012782G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6Y2K3	Missense_Mutation	SNP	NULL	p.A40T	ENST00000563197.1	37	c.118	CCDS10665.1	16																																																																																			INO80E	-	NULL	ENSG00000169592		0.706	INO80E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80E	HGNC	protein_coding	OTTHUMT00000255156.2	95	0.00	0	G	NM_173618		30012782	30012782	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000562291	ensembl	human	putative	69_37n	missense	120	15.49	22	SNP	1.000	A
ITM2A	9452	genome.wustl.edu	37	X	78616565	78616565	+	3'UTR	SNP	G	G	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chrX:78616565G>T	ENST00000373298.2	-	0	956				ITM2A_ENST00000469541.1_5'UTR|ITM2A_ENST00000434584.2_3'UTR	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						TTATTACCAAGGACACTCTAT	0.353																																						dbGAP											0													51.0	38.0	43.0					X																	78616565		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.*21C>A	X.37:g.78616565G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7X5|B4E062|Q6IBC9	RNA	SNP	-	NULL	ENST00000373298.2	37	NULL	CCDS14444.1	X																																																																																			ITM2A	-	-	ENSG00000078596		0.353	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITM2A	HGNC	protein_coding	OTTHUMT00000057329.1	51	0.00	0	G	NM_004867		78616565	78616565	-1	no_errors	ENST00000469541	ensembl	human	known	69_37n	rna	35	31.37	16	SNP	0.010	T
JUP	3728	genome.wustl.edu	37	17	39925390	39925390	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:39925390T>A	ENST00000393931.3	-	4	656	c.538A>T	c.(538-540)Atg>Ttg	p.M180L	JUP_ENST00000393930.1_Missense_Mutation_p.M180L|JUP_ENST00000310706.5_Missense_Mutation_p.M180L|JUP_ENST00000540235.1_Missense_Mutation_p.M180L	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	180	Interaction with DSC1 and DSG1.				adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GGCGAGCCCATCAGGGCCCGC	0.657																																					Colon(16;42 520 6044 17852 28530)	dbGAP											0													38.0	37.0	37.0					17																	39925390		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.538A>T	17.37:g.39925390T>A	ENSP00000377508:p.Met180Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,prints_Beta-catenin,pfscan_Armadillo	p.M180L	ENST00000393931.3	37	c.538	CCDS11407.1	17	.	.	.	.	.	.	.	.	.	.	T	15.54	2.864903	0.51482	.	.	ENSG00000173801	ENST00000540235;ENST00000393930;ENST00000310706;ENST00000393931;ENST00000449889;ENST00000437187;ENST00000420370;ENST00000424457	T;T;T;T;T;T;T;T	0.62639	1.02;0.01;0.01;0.01;1.02;1.02;1.02;1.02	5.79	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59662	0.2210	L	0.60957	1.885	0.45883	D	0.99873	B;B	0.31077	0.307;0.156	B;B	0.35607	0.206;0.071	T	0.62172	-0.6910	10	0.49607	T	0.09	-58.6597	11.1625	0.48524	0.1376:0.0:0.0:0.8624	.	180;180	B4DE59;P14923	.;PLAK_HUMAN	L	180	ENSP00000441751:M180L;ENSP00000377507:M180L;ENSP00000311113:M180L;ENSP00000377508:M180L;ENSP00000389886:M180L;ENSP00000394146:M180L;ENSP00000411449:M180L;ENSP00000401034:M180L	ENSP00000311113:M180L	M	-	1	0	JUP	37178916	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	6.205000	0.72148	2.216000	0.71823	0.459000	0.35465	ATG	JUP	-	superfamily_ARM-type_fold,smart_Armadillo,prints_Beta-catenin,pfscan_Armadillo	ENSG00000173801		0.657	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257406.1	75	0.00	0	T			39925390	39925390	-1	no_errors	ENST00000310706	ensembl	human	known	69_37n	missense	27	32.50	13	SNP	1.000	A
KIAA0430	9665	genome.wustl.edu	37	16	15702369	15702369	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr16:15702369C>G	ENST00000396368.3	-	21	4167	c.3961G>C	c.(3961-3963)Gaa>Caa	p.E1321Q	KIAA0430_ENST00000540441.2_Missense_Mutation_p.E1156Q|KIAA0430_ENST00000548025.1_Missense_Mutation_p.E1318Q|KIAA0430_ENST00000602337.1_Missense_Mutation_p.E1318Q|KIAA0430_ENST00000344181.3_Missense_Mutation_p.E923Q|KIAA0430_ENST00000551742.1_Missense_Mutation_p.E1321Q|CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000547936.1_5'Flank	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1321	HTH OST-type 5. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TCTCCACATTCCAATACCTTT	0.413																																						dbGAP											0													42.0	40.0	41.0					16																	15702369		1842	4102	5944	-	-	-	SO:0001583	missense	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.3961G>C	16.37:g.15702369C>G	ENSP00000379654:p.Glu1321Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.E1321Q	ENST00000396368.3	37	c.3961	CCDS10562.2	16	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677296	0.88445	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.69124	0.3076	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.996;0.999;0.999;0.998	T	0.68708	-0.5337	10	0.72032	D	0.01	.	20.4239	0.99064	0.0:1.0:0.0:0.0	.	1320;1318;1317;1320	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	Q	1321;1156;1261;923;1318;1321;1101	ENSP00000379654:E1321Q;ENSP00000439819:E1156Q;ENSP00000341939:E923Q;ENSP00000449376:E1318Q;ENSP00000450309:E1321Q	ENSP00000315718:E1261Q	E	-	1	0	KIAA0430	15609870	1.000000	0.71417	0.989000	0.46669	0.945000	0.59286	7.183000	0.77697	2.828000	0.97474	0.655000	0.94253	GAA	KIAA0430	-	NULL	ENSG00000166783		0.413	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	37	0.00	0	C	NM_014647		15702369	15702369	-1	no_errors	ENST00000396368	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	1.000	G
KIAA0922	23240	genome.wustl.edu	37	4	154547320	154547320	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr4:154547320A>G	ENST00000409663.3	+	30	4116	c.4064A>G	c.(4063-4065)gAt>gGt	p.D1355G	KIAA0922_ENST00000440693.1_Missense_Mutation_p.D1272G|KIAA0922_ENST00000409959.3_Missense_Mutation_p.D1356G	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1355						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TCACAAAATGATTTTCCTTCT	0.328																																						dbGAP											0													197.0	211.0	206.0					4																	154547320		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4064A>G	4.37:g.154547320A>G	ENSP00000386574:p.Asp1355Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.D1356G	ENST00000409663.3	37	c.4067	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	A	8.319	0.823914	0.16678	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.18657	2.47;2.2;2.47;2.21	5.4	1.62	0.23740	.	0.539863	0.20220	N	0.096702	T	0.18341	0.0440	L	0.27053	0.805	0.09310	N	0.999998	D;B;B	0.61080	0.989;0.004;0.002	P;B;B	0.56042	0.79;0.006;0.003	T	0.13737	-1.0498	10	0.12430	T	0.62	-3.54	5.0924	0.14715	0.6398:0.1429:0.2174:0.0	.	1272;1356;1355	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	G	1355;1272;1356;1133	ENSP00000386574:D1355G;ENSP00000409663:D1272G;ENSP00000386787:D1356G;ENSP00000240487:D1133G	ENSP00000240487:D1133G	D	+	2	0	KIAA0922	154766770	1.000000	0.71417	0.007000	0.13788	0.408000	0.30992	2.689000	0.46993	0.056000	0.16144	0.533000	0.62120	GAT	KIAA0922	-	NULL	ENSG00000121210		0.328	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	91	0.00	0	A	NM_015196		154547320	154547320	+1	no_errors	ENST00000409959	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	0.253	G
KIF25	3834	genome.wustl.edu	37	6	168434703	168434703	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr6:168434703G>T	ENST00000443060.2	+	5	700	c.309G>T	c.(307-309)gaG>gaT	p.E103D	KIF25_ENST00000354419.2_Missense_Mutation_p.E103D|KIF25_ENST00000351261.3_Missense_Mutation_p.E103D			Q9UIL4	KIF25_HUMAN	kinesin family member 25	103	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TGGCTGAGGAGCTCTTCAGGT	0.532																																						dbGAP											0													57.0	54.0	55.0					6																	168434703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.309G>T	6.37:g.168434703G>T	ENSP00000388878:p.Glu103Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O94775|Q5SZU9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E103D	ENST00000443060.2	37	c.309	CCDS5305.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.714|8.714	0.912794|0.912794	0.17907|0.17907	.|.	.|.	ENSG00000125337|ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261|ENST00000496008	T;T;T|.	0.75050|.	-0.9;-0.9;-0.9|.	4.22|4.22	-0.978|-0.978	0.10279|0.10279	Kinesin, motor domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.12902|0.12902	0.0313|0.0313	N|N	0.25825|0.25825	0.765|0.765	0.27415|0.27415	N|N	0.954463|0.954463	D;P|.	0.89917|.	1.0;0.798|.	D;B|.	0.85130|.	0.997;0.32|.	T|T	0.32534|0.32534	-0.9903|-0.9903	10|5	0.24483|.	T|.	0.36|.	-32.5709|-32.5709	8.7795|8.7795	0.34783|0.34783	0.5604:0.0:0.4396:0.0|0.5604:0.0:0.4396:0.0	.|.	103;103|.	Q9UIL4-2;Q9UIL4|.	.;KIF25_HUMAN|.	D|I	103|9	ENSP00000388878:E103D;ENSP00000346401:E103D;ENSP00000252688:E103D|.	ENSP00000252688:E103D|.	E|S	+|+	3|2	2|0	KIF25|KIF25	168177552|168177552	0.995000|0.995000	0.38212|0.38212	0.378000|0.378000	0.26068|0.26068	0.540000|0.540000	0.34992|0.34992	0.175000|0.175000	0.16762|0.16762	-0.147000|-0.147000	0.11254|0.11254	0.561000|0.561000	0.74099|0.74099	GAG|AGC	KIF25	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000125337		0.532	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KIF25	HGNC	protein_coding	OTTHUMT00000362509.1	77	0.00	0	G			168434703	168434703	+1	no_errors	ENST00000354419	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	0.936	T
KIR3DL1	3811	genome.wustl.edu	37	19	55294960	55294960	+	Intron	SNP	G	G	T	rs543286356		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:55294960G>T	ENST00000538269.1	+	2	61				KIR2DL3_ENST00000434419.2_Missense_Mutation_p.E280D|KIR2DL4_ENST00000396284.2_Intron|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.E280D|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.E306D|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TGGACCAAGAGTCTGCAGGAA	0.502													.|||	1	0.000199681	0.0008	0.0	5008	,	,		16083	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													176.0	174.0	175.0					19																	55294960		2171	4192	6363	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-34029G>T	19.37:g.55294960G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.E280D	ENST00000538269.1	37	c.840		19	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782164	0.31502	.	.	ENSG00000243772;ENSG00000125498;ENSG00000125498	ENST00000434419;ENST00000336077;ENST00000291633	T;T;T	0.00522	7.02;6.98;6.84	0.929	0.929	0.19449	.	.	.	.	.	T	0.01222	0.0040	M	0.91196	3.185	0.09310	N	1	P;B;P;P	0.47962	0.859;0.419;0.771;0.903	P;P;P;P	0.50708	0.574;0.45;0.533;0.648	T	0.36040	-0.9764	9	0.87932	D	0	.	5.2086	0.15304	0.0:0.0:1.0:0.0	.	306;281;280;280	Q6IST4;E3NZD7;Q6H2H3;P43627	.;.;.;KI2L2_HUMAN	D	280;280;306	ENSP00000415758:E280D;ENSP00000336769:E280D;ENSP00000291633:E306D	ENSP00000291633:E306D	E	+	3	2	KIR2DL1;KIR2DL3	59986772	0.087000	0.21565	0.024000	0.17045	0.019000	0.09904	1.541000	0.36126	0.795000	0.33922	0.184000	0.17185	GAG	KIR2DL1	-	NULL	ENSG00000125498		0.502	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL1	HGNC	protein_coding		80	0.00	0	G	NM_013289		55294960	55294960	+1	no_errors	ENST00000336077	ensembl	human	known	69_37n	missense	53	24.29	17	SNP	0.030	T
KLHL17	339451	genome.wustl.edu	37	1	899384	899384	+	Silent	SNP	G	G	A	rs553367821		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:899384G>A	ENST00000338591.3	+	9	1547	c.1440G>A	c.(1438-1440)acG>acA	p.T480T	PLEKHN1_ENST00000379407.3_5'Flank|PLEKHN1_ENST00000379410.3_5'Flank|PLEKHN1_ENST00000379409.2_5'Flank	NM_198317.2	NP_938073.1	Q6TDP4	KLH17_HUMAN	kelch-like family member 17	480	Interaction with F-actin. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|dendrite cytoplasm (GO:0032839)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein complex scaffold (GO:0032947)			central_nervous_system(1)|kidney(2)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GAGTGGCCACGCTTGGTGGGT	0.682																																						dbGAP											0													67.0	72.0	70.0					1																	899384		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0			AY423763	CCDS30550.1	1p36	2013-01-30	2013-01-30		ENSG00000187961	ENSG00000187961		"""Kelch-like"", ""BTB/POZ domain containing"""	24023	protein-coding gene	gene with protein product	"""actinfilin"""		"""kelch-like 17 (Drosophila)"""			12063253	Standard	NM_198317		Approved		uc001aca.2	Q6TDP4	OTTHUMG00000040721	ENST00000338591.3:c.1440G>A	1.37:g.899384G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SV94	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T480	ENST00000338591.3	37	c.1440	CCDS30550.1	1																																																																																			KLHL17	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000187961		0.682	KLHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL17	HGNC	protein_coding	OTTHUMT00000097875.3	46	0.00	0	G	NM_198317		899384	899384	+1	no_errors	ENST00000338591	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	0.992	A
LIG3	3980	genome.wustl.edu	37	17	33325668	33325668	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:33325668G>A	ENST00000378526.4	+	14	2168	c.2035G>A	c.(2035-2037)Gac>Aac	p.D679N	LIG3_ENST00000262327.5_Missense_Mutation_p.D679N	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	679					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	AGTGAAGAAAGACTATTTGAA	0.552								Other BER factors			OREG0024326	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													118.0	127.0	124.0					17																	33325668		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.2035G>A	17.37:g.33325668G>A	ENSP00000367787:p.Asp679Asn	Somatic	839	WXS	Illumina GAIIx	Phase_IV	Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold-like,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.D679N	ENST00000378526.4	37	c.2035	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	G	36	5.888563	0.97068	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.71579	-0.42;-0.58	5.27	5.27	0.74061	DNA ligase, ATP-dependent, central (1);	0.000000	0.85682	D	0.000000	D	0.88489	0.6450	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.91076	0.4896	10	0.87932	D	0	-22.2379	18.0747	0.89423	0.0:0.0:1.0:0.0	.	679;679	P49916;E5KLB6	DNLI3_HUMAN;.	N	679	ENSP00000367787:D679N;ENSP00000262327:D679N	ENSP00000262327:D679N	D	+	1	0	LIG3	30349781	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.419000	0.97397	2.735000	0.93741	0.655000	0.94253	GAC	LIG3	-	pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	ENSG00000005156		0.552	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	HGNC	protein_coding	OTTHUMT00000250330.3	64	0.00	0	G	NM_013975		33325668	33325668	+1	no_errors	ENST00000378526	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	1.000	A
MEGF10	84466	genome.wustl.edu	37	5	126705643	126705643	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr5:126705643C>G	ENST00000274473.6	+	6	628	c.361C>G	c.(361-363)Cca>Gca	p.P121A	MEGF10_ENST00000503335.2_Missense_Mutation_p.P121A|MEGF10_ENST00000418761.2_Missense_Mutation_p.P121A|MEGF10_ENST00000508365.1_Missense_Mutation_p.P121A	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	121	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CTGTATTGCTCCAAACACCTG	0.468																																						dbGAP											0													194.0	160.0	172.0					5																	126705643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.361C>G	5.37:g.126705643C>G	ENSP00000274473:p.Pro121Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE5|Q8WUL3	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.P121A	ENST00000274473.6	37	c.361	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527466	0.85706	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.16	5.16	0.70880	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	T	0.80581	0.4650	H	0.94582	3.555	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.78314	0.986;0.991	D	0.84595	0.0669	10	0.44086	T	0.13	-7.4634	18.7442	0.91787	0.0:1.0:0.0:0.0	.	121;121	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	A	121	ENSP00000423354:P121A;ENSP00000423195:P121A;ENSP00000416284:P121A;ENSP00000274473:P121A	ENSP00000274473:P121A	P	+	1	0	MEGF10	126733542	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.800000	0.85949	2.422000	0.82143	0.558000	0.71614	CCA	MEGF10	-	smart_EGF-like	ENSG00000145794		0.468	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	HGNC	protein_coding	OTTHUMT00000250973.2	91	0.00	0	C	NM_032446		126705643	126705643	+1	no_errors	ENST00000274473	ensembl	human	known	69_37n	missense	73	35.40	40	SNP	1.000	G
METTL11B	149281	genome.wustl.edu	37	1	170115286	170115286	+	Missense_Mutation	SNP	G	G	A	rs562751042		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:170115286G>A	ENST00000439373.2	+	1	145	c.38G>A	c.(37-39)cGc>cAc	p.R13H		NM_001136107.1	NP_001129579.1	Q5VVY1	NTM1B_HUMAN	methyltransferase like 11B	13						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)	p.R13H(1)		NS(1)|breast(2)|endometrium(3)|prostate(2)	8						TTTAGATCCCGCTGGCAGAAG	0.463																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											88.0	78.0	81.0					1																	170115286		692	1591	2283	-	-	-	SO:0001583	missense	0			AL445203, CAH72139	CCDS44275.1	1q24.2	2012-11-05	2008-06-11	2008-06-11	ENSG00000203740	ENSG00000203740			31932	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 184"""	C1orf184			Standard	NM_001136107		Approved	HOMT1B	uc009wvv.1	Q5VVY1	OTTHUMG00000035959	ENST00000439373.2:c.38G>A	1.37:g.170115286G>A	ENSP00000408058:p.Arg13His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXI0	Missense_Mutation	SNP	pfam_DUF858_MeTrfase_lik,pfam_Methyltransf_11,pirsf_DUF858_MeTrfase_lik	p.R13H	ENST00000439373.2	37	c.38	CCDS44275.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.696315	0.88830	.	.	ENSG00000203740	ENST00000439373	T	0.27890	1.64	5.12	5.12	0.69794	.	0.050829	0.85682	D	0.000000	T	0.36248	0.0960	L	0.27053	0.805	0.49915	D	0.999839	D	0.89917	1.0	D	0.80764	0.994	T	0.34079	-0.9843	10	0.87932	D	0	-2.2669	18.531	0.90992	0.0:0.0:1.0:0.0	.	13	Q5VVY1	NTM1B_HUMAN	H	13	ENSP00000408058:R13H	ENSP00000408058:R13H	R	+	2	0	METTL11B	168381910	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.093000	0.76937	2.550000	0.86006	0.655000	0.94253	CGC	METTL11B	-	NULL	ENSG00000203740		0.463	METTL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL11B	HGNC	protein_coding	OTTHUMT00000087586.2	34	0.00	0	G	NM_001136107		170115286	170115286	+1	no_errors	ENST00000439373	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	1.000	A
MPP7	143098	genome.wustl.edu	37	10	28412995	28412995	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr10:28412995C>A	ENST00000375732.1	-	8	839	c.580G>T	c.(580-582)Gag>Tag	p.E194*	MPP7_ENST00000337532.5_Nonsense_Mutation_p.E194*|MPP7_ENST00000445954.2_Nonsense_Mutation_p.E69*|MPP7_ENST00000375719.3_Nonsense_Mutation_p.E194*|MPP7_ENST00000540098.1_Nonsense_Mutation_p.E194*|MPP7_ENST00000481244.1_5'Flank			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	194	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						CTTTTATCCTCCACTGGTATC	0.348																																						dbGAP											0													105.0	105.0	105.0					10																	28412995		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.580G>T	10.37:g.28412995C>A	ENSP00000364884:p.Glu194*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Nonsense_Mutation	SNP	pfam_Guanylate_kin,pfam_L27_C,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,prints_SH3_domain,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.E194*	ENST00000375732.1	37	c.580	CCDS7158.1	10	.	.	.	.	.	.	.	.	.	.	C	38	7.249510	0.98164	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000445954	.	.	.	5.58	4.68	0.58851	.	0.133611	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	15.0124	0.71560	0.0:0.9313:0.0:0.0687	.	.	.	.	X	194;194;194;194;69	.	ENSP00000337907:E194X	E	-	1	0	MPP7	28453001	0.988000	0.35896	0.951000	0.38953	0.798000	0.45092	3.074000	0.50065	1.500000	0.48636	-0.263000	0.10527	GAG	MPP7	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000150054		0.348	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP7	HGNC	protein_coding	OTTHUMT00000047345.1	33	0.00	0	C	NM_173496		28412995	28412995	-1	no_errors	ENST00000337532	ensembl	human	known	69_37n	nonsense	11	38.89	7	SNP	1.000	A
MTUS1	57509	genome.wustl.edu	37	8	17612530	17612530	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr8:17612530G>A	ENST00000262102.6	-	2	1011	c.787C>T	c.(787-789)Cag>Tag	p.Q263*	MTUS1_ENST00000381869.3_Nonsense_Mutation_p.Q263*|MTUS1_ENST00000519263.1_Nonsense_Mutation_p.Q263*|MTUS1_ENST00000381862.3_Nonsense_Mutation_p.Q263*	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	263					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		CATGCACACTGATTTCCAATA	0.423																																						dbGAP											0													206.0	187.0	193.0					8																	17612530		1947	4147	6094	-	-	-	SO:0001587	stop_gained	0			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.787C>T	8.37:g.17612530G>A	ENSP00000262102:p.Gln263*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Nonsense_Mutation	SNP	superfamily_Ferritin/RR-like	p.Q263*	ENST00000262102.6	37	c.787	CCDS43717.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.527375	0.96431	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	.	.	.	4.38	2.55	0.30701	.	1.087200	0.07010	N	0.824990	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.1374	8.5093	0.33206	0.085:0.1544:0.7607:0.0	.	.	.	.	X	263	.	.	Q	-	1	0	MTUS1	17656810	0.001000	0.12720	0.010000	0.14722	0.006000	0.05464	0.364000	0.20325	0.765000	0.33221	0.655000	0.94253	CAG	MTUS1	-	NULL	ENSG00000129422		0.423	MTUS1-001	KNOWN	basic|CCDS	protein_coding	MTUS1	HGNC	protein_coding	OTTHUMT00000375247.1	93	0.00	0	G	XM_372031		17612530	17612530	-1	no_errors	ENST00000262102	ensembl	human	known	69_37n	nonsense	51	17.74	11	SNP	0.138	A
MUC17	140453	genome.wustl.edu	37	7	100701312	100701312	+	Missense_Mutation	SNP	C	C	T	rs534194993		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr7:100701312C>T	ENST00000306151.4	+	13	13533	c.13469C>T	c.(13468-13470)aCg>aTg	p.T4490M	RN7SKP54_ENST00000410704.1_RNA	NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4490					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGGTAATGACGACATCATTT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		16188	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													102.0	95.0	98.0					7																	100701312		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13469C>T	7.37:g.100701312C>T	ENSP00000302716:p.Thr4490Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.T4490M	ENST00000306151.4	37	c.13469	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	4.095	0.015603	0.07959	.	.	ENSG00000169876	ENST00000306151	T	0.01933	4.55	3.54	-4.5	0.03493	.	.	.	.	.	T	0.00637	0.0021	N	0.00686	-1.255	0.09310	N	1	B	0.19583	0.037	B	0.06405	0.002	T	0.46062	-0.9218	9	0.33940	T	0.23	.	0.0747	0.00025	0.3193:0.2058:0.1623:0.3126	.	4490	Q685J3	MUC17_HUMAN	M	4490	ENSP00000302716:T4490M	ENSP00000302716:T4490M	T	+	2	0	MUC17	100488032	0.002000	0.14202	0.000000	0.03702	0.009000	0.06853	-0.157000	0.10085	-0.778000	0.04566	-1.769000	0.00663	ACG	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	44	0.00	0	C	NM_001040105		100701312	100701312	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.000	T
MXRA5	25878	genome.wustl.edu	37	X	3261811	3261811	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chrX:3261811G>A	ENST00000217939.6	-	2	218	c.64C>T	c.(64-66)Cga>Tga	p.R22*		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	22						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AGCGCCACTCGCGGATGGCCC	0.657																																						dbGAP											0													33.0	31.0	31.0					X																	3261811		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.64C>T	X.37:g.3261811G>A	ENSP00000217939:p.Arg22*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R22*	ENST00000217939.6	37	c.64	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742462	0.49151	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	.	.	.	3.11	1.62	0.23740	.	1.901630	0.03724	U	0.252359	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	6.1165	0.20130	0.1423:0.1703:0.6874:0.0	.	.	.	.	X	22	.	ENSP00000217939:R22X	R	-	1	2	MXRA5	3271811	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.511000	0.22739	0.065000	0.16485	0.459000	0.35465	CGA	MXRA5	-	NULL	ENSG00000101825		0.657	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	47	0.00	0	G	NM_015419		3261811	3261811	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	nonsense	39	15.22	7	SNP	0.000	A
NCKIPSD	51517	genome.wustl.edu	37	3	48716506	48716506	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr3:48716506G>C	ENST00000294129.2	-	10	1800	c.1681C>G	c.(1681-1683)Ctc>Gtc	p.L561V	NCKIPSD_ENST00000416649.2_Missense_Mutation_p.L554V|NCKIPSD_ENST00000341520.4_Missense_Mutation_p.L561V	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain	561	Leu-rich.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGCAGGTTGAGAGCCAGAAGC	0.627																																						dbGAP											0													57.0	61.0	60.0					3																	48716506		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.1681C>G	3.37:g.48716506G>C	ENSP00000294129:p.Leu561Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Missense_Mutation	SNP	pfam_DUF2013,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.L561V	ENST00000294129.2	37	c.1681	CCDS2776.1	3	.	.	.	.	.	.	.	.	.	.	G	17.04	3.288541	0.59976	.	.	ENSG00000213672	ENST00000341520;ENST00000416649;ENST00000294129;ENST00000413374	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.37	2.01	0.26516	Domain of unknown function DUF2013 (1);	0.065187	0.64402	U	0.000009	T	0.46600	0.1401	L	0.52905	1.665	0.28110	N	0.931024	P;P	0.48911	0.917;0.898	P;P	0.51657	0.676;0.547	T	0.38585	-0.9654	10	0.52906	T	0.07	.	3.7793	0.08674	0.2236:0.5036:0.2728:0.0	.	561;554	Q9NZQ3;Q9NZQ3-3	SPN90_HUMAN;.	V	561;554;561;17	ENSP00000342621:L561V;ENSP00000389059:L554V;ENSP00000294129:L561V;ENSP00000396683:L17V	ENSP00000294129:L561V	L	-	1	0	NCKIPSD	48691510	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	4.996000	0.63914	0.576000	0.29452	0.650000	0.86243	CTC	NCKIPSD	-	pfam_DUF2013	ENSG00000213672		0.627	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKIPSD	HGNC	protein_coding	OTTHUMT00000257520.1	63	0.00	0	G	NM_016453		48716506	48716506	-1	no_errors	ENST00000294129	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	C
MYH11	4629	genome.wustl.edu	37	16	15818436	15818436	+	Intron	SNP	C	C	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr16:15818436C>G	ENST00000300036.5	-	30	4226				MYH11_ENST00000396324.3_Intron|MYH11_ENST00000452625.2_Intron|NDE1_ENST00000342673.5_3'UTR|NDE1_ENST00000571896.1_3'UTR|AF001548.5_ENST00000574212.1_RNA|NDE1_ENST00000396354.1_3'UTR|NDE1_ENST00000396355.1_3'UTR|MYH11_ENST00000576790.2_Intron	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle						axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGCGATCTGCCTGCGGGGGAT	0.592			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0																																										-	-	-	SO:0001627	intron_variant	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.4116+67G>C	16.37:g.15818436C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	RNA	SNP	-	NULL	ENST00000300036.5	37	NULL	CCDS10565.1	16																																																																																			NDE1	-	-	ENSG00000072864		0.592	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDE1	HGNC	protein_coding	OTTHUMT00000252192.2	36	0.00	0	C	NM_001040113		15818436	15818436	+1	no_errors	ENST00000571896	ensembl	human	known	69_37n	rna	27	18.18	6	SNP	0.000	G
NEK9	91754	genome.wustl.edu	37	14	75585575	75585575	+	Silent	SNP	G	G	T	rs201853236		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr14:75585575G>T	ENST00000238616.5	-	5	746	c.588C>A	c.(586-588)ggC>ggA	p.G196G		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	196	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TCTTTGCTAGGCCATAATCTC	0.323																																						dbGAP											0													115.0	114.0	114.0					14																	75585575		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.588C>A	14.37:g.75585575G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G196	ENST00000238616.5	37	c.588	CCDS9839.1	14																																																																																			NEK9	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000119638		0.323	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK9	HGNC	protein_coding	OTTHUMT00000415021.1	37	0.00	0	G	NM_033116		75585575	75585575	-1	no_errors	ENST00000238616	ensembl	human	known	69_37n	silent	35	20.45	9	SNP	1.000	T
NOL11	25926	genome.wustl.edu	37	17	65722667	65722667	+	Silent	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:65722667G>A	ENST00000253247.4	+	7	871	c.756G>A	c.(754-756)aaG>aaA	p.K252K	NOL11_ENST00000535137.1_Silent_p.K70K	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	252					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGCTGCTCAAGGCTGTTGTAT	0.463																																						dbGAP											0													100.0	84.0	90.0					17																	65722667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.756G>A	17.37:g.65722667G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5V9|Q7L5S1|Q9UG18	Silent	SNP	pfam_NUC205	p.K252	ENST00000253247.4	37	c.756	CCDS11671.1	17																																																																																			NOL11	-	NULL	ENSG00000130935		0.463	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL11	HGNC	protein_coding	OTTHUMT00000448074.1	102	0.00	0	G	NM_015462		65722667	65722667	+1	no_errors	ENST00000253247	ensembl	human	known	69_37n	silent	41	24.07	13	SNP	0.014	A
OR13C9	286362	genome.wustl.edu	37	9	107380401	107380402	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr9:107380401_107380402insA	ENST00000259362.1	-	1	83_84	c.84_85insT	c.(82-87)tttgtgfs	p.V29fs		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						AAGATTAGCACAAAAAAGAGTA	0.396																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.85dupT	9.37:g.107380407_107380407dupA	ENSP00000259362:p.Val29fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFL2	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V28fs	ENST00000259362.1	37	c.85_84	CCDS35093.1	9																																																																																			OR13C9	-	prints_7TM_GPCR_Rhodpsn	ENSG00000136839		0.396	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C9	HGNC	protein_coding	OTTHUMT00000053490.1	50	0.00	0	-			107380401	107380402	-1	no_errors	ENST00000259362	ensembl	human	known	69_37n	frame_shift_ins	42	31.15	19	INS	0.245:0.267	A
OR4M1	441670	genome.wustl.edu	37	14	20248532	20248532	+	Silent	SNP	A	A	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr14:20248532A>G	ENST00000315957.4	+	1	132	c.51A>G	c.(49-51)ctA>ctG	p.L17L		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCACTGGCCTATCCCAGACTC	0.353																																						dbGAP											0													151.0	165.0	160.0					14																	20248532		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.51A>G	14.37:g.20248532A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH18|Q6IFA3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L17	ENST00000315957.4	37	c.51	CCDS32021.1	14																																																																																			OR4M1	-	NULL	ENSG00000176299		0.353	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	HGNC	protein_coding	OTTHUMT00000409770.1	58	0.00	0	A			20248532	20248532	+1	no_errors	ENST00000315957	ensembl	human	known	69_37n	silent	41	10.87	5	SNP	0.050	G
PHF2	5253	genome.wustl.edu	37	9	96439907	96439907	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr9:96439907G>C	ENST00000359246.4	+	22	3607	c.3240G>C	c.(3238-3240)caG>caC	p.Q1080H	PHF2_ENST00000375376.4_Missense_Mutation_p.Q311H	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	1080					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CCGCCAAGCAGAGGCTTGGGA	0.537																																						dbGAP											0													115.0	133.0	127.0					9																	96439907		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.3240G>C	9.37:g.96439907G>C	ENSP00000352185:p.Gln1080His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.Q1080H	ENST00000359246.4	37	c.3240	CCDS35069.1	9	.	.	.	.	.	.	.	.	.	.	G	12.22	1.871999	0.33069	.	.	ENSG00000197724	ENST00000359246;ENST00000375376	T;T	0.60920	0.15;0.63	5.25	2.1	0.27182	.	0.000000	0.85682	D	0.000000	T	0.65923	0.2738	L	0.46157	1.445	0.49687	D	0.999817	D	0.67145	0.996	D	0.75484	0.986	T	0.64236	-0.6455	10	0.87932	D	0	-23.5062	9.789	0.40695	0.2878:0.0:0.7122:0.0	.	1080	O75151	PHF2_HUMAN	H	1080;311	ENSP00000352185:Q1080H;ENSP00000364525:Q311H	ENSP00000352185:Q1080H	Q	+	3	2	PHF2	95479728	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.811000	0.55620	0.146000	0.19002	0.561000	0.74099	CAG	PHF2	-	NULL	ENSG00000197724		0.537	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF2	HGNC	protein_coding	OTTHUMT00000053162.1	56	0.00	0	G	NM_005392		96439907	96439907	+1	no_errors	ENST00000359246	ensembl	human	known	69_37n	missense	24	50.00	24	SNP	1.000	C
PIGP	51227	genome.wustl.edu	37	21	38437924	38437924	+	Silent	SNP	T	T	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr21:38437924T>C	ENST00000464265.1	-	4	658	c.435A>G	c.(433-435)caA>caG	p.Q145Q	PIGP_ENST00000399098.1_Silent_p.Q95Q|PIGP_ENST00000329667.3_5'UTR|PIGP_ENST00000399103.1_Silent_p.Q121Q|PIGP_ENST00000399102.1_Silent_p.Q121Q|PIGP_ENST00000360525.4_Silent_p.Q121Q	NM_153681.2	NP_710148.1	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class P	145					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			kidney(1)|urinary_tract(1)	2		Myeloproliferative disorder(46;0.0412)				GAAAGAACATTTGGTTTACTT	0.338																																						dbGAP											0													129.0	126.0	127.0					21																	38437924		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037162	CCDS13649.1, CCDS13650.1	21q22.2	2013-02-26	2006-06-28	2005-11-10	ENSG00000185808	ENSG00000185808	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	3046	protein-coding gene	gene with protein product	"""phosphatidylinositol-n-acetylglucosaminyltranferase subunit"""	605938	"""Down syndrome critical region gene 5"", ""phosphatidylinositol glycan, class P"""	DSCR5		10814524, 15221505	Standard	NR_028352		Approved	DCRC, DSRC	uc002yvw.1	P57054	OTTHUMG00000086653	ENST00000464265.1:c.435A>G	21.37:g.38437924T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB18|B2RE99|B5BU92|D3DSG7|J3KR75|Q53Y28|Q96KI1|Q9NZA6	Silent	SNP	pfam_PIG-P,pirsf_PIG-P_GPI19	p.Q145	ENST00000464265.1	37	c.435	CCDS13649.1	21																																																																																			PIGP	-	pfam_PIG-P,pirsf_PIG-P_GPI19	ENSG00000185808		0.338	PIGP-004	KNOWN	basic|CCDS	protein_coding	PIGP	HGNC	protein_coding	OTTHUMT00000194769.2	50	0.00	0	T	NM_153681		38437924	38437924	-1	no_errors	ENST00000464265	ensembl	human	known	69_37n	silent	44	21.43	12	SNP	0.752	C
PMM1	5372	genome.wustl.edu	37	22	41985728	41985728	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr22:41985728G>C	ENST00000216259.7	-	1	166	c.82C>G	c.(82-84)Cgc>Ggc	p.R28G	PMM1_ENST00000466645.1_5'UTR	NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	28					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)			NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						CCTACCTGGCGAGCCGGCGTG	0.692																																						dbGAP											0													24.0	24.0	24.0					22																	41985728		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.82C>G	22.37:g.41985728G>C	ENSP00000216259:p.Arg28Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K003|Q92586	Missense_Mutation	SNP	pfam_PMM,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	p.R28G	ENST00000216259.7	37	c.82	CCDS14020.1	22	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373413	0.42105	.	.	ENSG00000100417	ENST00000216259	D	0.98493	-4.96	4.95	4.95	0.65309	HAD-like domain (2);	0.054479	0.64402	D	0.000002	D	0.98698	0.9563	M	0.79123	2.44	0.80722	D	1	D	0.63046	0.992	D	0.67725	0.953	D	0.99679	1.0998	10	0.87932	D	0	-19.208	14.9355	0.70951	0.0:0.0:1.0:0.0	.	28	Q92871	PMM1_HUMAN	G	28	ENSP00000216259:R28G	ENSP00000216259:R28G	R	-	1	0	PMM1	40315674	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	2.969000	0.49232	2.294000	0.77228	0.650000	0.86243	CGC	PMM1	-	pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	ENSG00000100417		0.692	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMM1	HGNC	protein_coding	OTTHUMT00000320711.3	88	0.00	0	G	NM_002676		41985728	41985728	-1	no_errors	ENST00000216259	ensembl	human	known	69_37n	missense	23	36.11	13	SNP	1.000	C
PRAMEF7	441871	genome.wustl.edu	37	1	12980074	12980074	+	Silent	SNP	T	T	A	rs139206769		TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:12980074T>A	ENST00000361079.2	+	4	1349	c.1266T>A	c.(1264-1266)ggT>ggA	p.G422G	RNU6-1072P_ENST00000384703.1_RNA			Q5VXH5	PRAM7_HUMAN	PRAME family member 7	422					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(2)|kidney(5)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)	18	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACACCCAGGGTGCTCTCTGCT	0.587																																						dbGAP											0													36.0	39.0	38.0					1																	12980074		1261	2762	4023	-	-	-	SO:0001819	synonymous_variant	0				CCDS30593.1	1p36.21	2013-01-17			ENSG00000204510	ENSG00000204510		"""-"""	28415	protein-coding gene	gene with protein product							Standard	NM_001012277		Approved			Q5VXH5	OTTHUMG00000001982	ENST00000361079.2:c.1266T>A	1.37:g.12980074T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIP0	Silent	SNP	NULL	p.G422	ENST00000361079.2	37	c.1266	CCDS30593.1	1																																																																																			PRAMEF7	-	NULL	ENSG00000204510		0.587	PRAMEF7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF7	HGNC	protein_coding		25	0.00	0	T	NM_001012277		12980074	12980074	+1	no_errors	ENST00000330881	ensembl	human	known	69_37n	silent	4	50.00	4	SNP	0.000	A
PRDM4	11108	genome.wustl.edu	37	12	108154313	108154313	+	5'UTR	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr12:108154313G>A	ENST00000228437.5	-	0	439				RP11-864J10.4_ENST00000546714.1_RNA|PRDM4_ENST00000547268.1_5'UTR	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4						cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						CCAAATATCAGAGAAAGGAGC	0.592																																						dbGAP											0													104.0	83.0	90.0					12																	108154313		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.-21C>T	12.37:g.108154313G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UFA6	RNA	SNP	-	NULL	ENST00000228437.5	37	NULL	CCDS9115.1	12																																																																																			PRDM4	-	-	ENSG00000110851		0.592	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM4	HGNC	protein_coding	OTTHUMT00000406546.1	39	0.00	0	G	NM_012406		108154313	108154313	-1	no_errors	ENST00000547268	ensembl	human	known	69_37n	rna	31	18.42	7	SNP	0.000	A
PRKDC	5591	genome.wustl.edu	37	8	48811108	48811108	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr8:48811108T>A	ENST00000314191.2	-	29	3442	c.3386A>T	c.(3385-3387)gAt>gTt	p.D1129V	PRKDC_ENST00000338368.3_Missense_Mutation_p.D1129V|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1129					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATCAATGGCATCACAACACTG	0.348								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											0													83.0	78.0	80.0					8																	48811108		1871	4107	5978	-	-	-	SO:0001583	missense	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.3386A>T	8.37:g.48811108T>A	ENSP00000313420:p.Asp1129Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.D1129V	ENST00000314191.2	37	c.3386		8	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660788	0.67700	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.65916	-0.18;-0.18	5.46	4.27	0.50696	Armadillo-like helical (1);Armadillo-type fold (1);	0.232864	0.44688	D	0.000434	T	0.56321	0.1977	.	.	.	0.58432	D	0.999999	P;P	0.51057	0.807;0.941	B;B	0.42087	0.302;0.375	T	0.56329	-0.7997	9	0.44086	T	0.13	.	12.4065	0.55443	0.0:0.0:0.1407:0.8593	.	1129;1129	E7EUY0;P78527	.;PRKDC_HUMAN	V	1129	ENSP00000313420:D1129V;ENSP00000345182:D1129V	ENSP00000313420:D1129V	D	-	2	0	PRKDC	48973661	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.650000	0.46665	0.873000	0.35799	0.455000	0.32223	GAT	PRKDC	-	superfamily_ARM-type_fold	ENSG00000253729		0.348	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		21	0.00	0	T	NM_001081640		48811108	48811108	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	A
PTEN	5728	genome.wustl.edu	37	10	89692864	89692865	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr10:89692864_89692865insA	ENST00000371953.3	+	5	1705_1706	c.348_349insA	c.(349-351)aatfs	p.N117fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	117	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.Y27fs*1(2)|p.D116fs*18(2)|p.D116fs*9(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GTGAAGATGACAATCATGTTGC	0.396		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	53	Whole gene deletion(37)|Deletion - Frameshift(10)|Unknown(5)|Insertion - Frameshift(1)	prostate(16)|central_nervous_system(13)|skin(6)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|breast(3)|ovary(3)|soft_tissue(1)|endometrium(1)|urinary_tract(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.350dupA	10.37:g.89692866_89692866dupA	ENSP00000361021:p.Asn117fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Ins	INS	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.N116fs	ENST00000371953.3	37	c.348_349	CCDS31238.1	10																																																																																			PTEN	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ	ENSG00000171862		0.396	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	80	0.00	0	-	NM_000314		89692864	89692865	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	frame_shift_ins	29	56.72	38	INS	1.000:1.000	A
SEMA5A	9037	genome.wustl.edu	37	5	9066748	9066748	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr5:9066748G>C	ENST00000382496.5	-	17	2749	c.2084C>G	c.(2083-2085)tCt>tGt	p.S695C		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	695	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GGTGTTGCAAGACTGGTACTC	0.542																																						dbGAP											0													135.0	124.0	128.0					5																	9066748		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2084C>G	5.37:g.9066748G>C	ENSP00000371936:p.Ser695Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.S695C	ENST00000382496.5	37	c.2084	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500650	0.85176	.	.	ENSG00000112902	ENST00000382496	T	0.53423	0.62	5.52	5.52	0.82312	.	0.207951	0.52532	D	0.000067	T	0.64249	0.2581	M	0.87180	2.865	0.41882	D	0.990327	B	0.33171	0.4	B	0.42851	0.4	T	0.67921	-0.5545	10	0.56958	D	0.05	.	17.2904	0.87154	0.0:0.0:1.0:0.0	.	695	Q13591	SEM5A_HUMAN	C	695	ENSP00000371936:S695C	ENSP00000371936:S695C	S	-	2	0	SEMA5A	9119748	1.000000	0.71417	0.997000	0.53966	0.941000	0.58515	9.468000	0.97676	2.761000	0.94854	0.591000	0.81541	TCT	SEMA5A	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000112902		0.542	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	83	0.00	0	G			9066748	9066748	-1	no_errors	ENST00000382496	ensembl	human	known	69_37n	missense	58	25.64	20	SNP	1.000	C
SH3RF1	57630	genome.wustl.edu	37	4	170017808	170017808	+	Silent	SNP	C	C	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr4:170017808C>T	ENST00000284637.9	-	12	2870	c.2529G>A	c.(2527-2529)caG>caA	p.Q843Q		NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	843	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Q843H(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		CTGCCTCACTCTGAGGAGGAT	0.393																																						dbGAP											1	Substitution - Missense(1)	lung(1)											115.0	102.0	106.0					4																	170017808		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.2529G>A	4.37:g.170017808C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_p67phox,prints_SH3_domain	p.Q843	ENST00000284637.9	37	c.2529	CCDS34099.1	4																																																																																			SH3RF1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000154447		0.393	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3RF1	HGNC	protein_coding	OTTHUMT00000363382.3	79	0.00	0	C	NM_020870		170017808	170017808	-1	no_errors	ENST00000284637	ensembl	human	known	69_37n	silent	30	30.23	13	SNP	1.000	T
SIGLEC10	89790	genome.wustl.edu	37	19	51920051	51920051	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:51920051G>A	ENST00000339313.5	-	3	691	c.575C>T	c.(574-576)cCa>cTa	p.P192L	SIGLEC10_ENST00000436984.2_Missense_Mutation_p.P144L|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.P192L|SIGLEC10_ENST00000441969.3_Intron|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Intron|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.P192L|CTD-2616J11.3_ENST00000532473.1_RNA|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.P192L|SIGLEC10_ENST00000432469.2_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	192	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGAGGTCGTTGGTTTGGTTCC	0.587																																						dbGAP											0													125.0	108.0	113.0					19																	51920051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.575C>T	19.37:g.51920051G>A	ENSP00000345243:p.Pro192Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P192L	ENST00000339313.5	37	c.575	CCDS12832.1	19	.	.	.	.	.	.	.	.	.	.	.	12.23	1.876637	0.33162	.	.	ENSG00000142512	ENST00000353836;ENST00000356298;ENST00000525998;ENST00000436984;ENST00000339313;ENST00000530476	T;T;T;D;T;T	0.85484	3.92;3.92;3.92;-1.99;3.92;3.92	4.58	-2.33	0.06724	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.780999	0.11610	N	0.546852	D	0.88213	0.6376	M	0.74881	2.28	0.09310	N	1	B;D;D;P	0.76494	0.264;0.999;0.971;0.819	B;D;P;B	0.79784	0.109;0.993;0.878;0.3	T	0.76424	-0.2964	10	0.72032	D	0.01	.	2.2104	0.03946	0.1842:0.2681:0.4116:0.1361	.	144;192;192;192	C9JM10;E9PL79;Q96LC7-2;Q96LC7	.;.;.;SIG10_HUMAN	L	192;192;192;144;192;159	ENSP00000342389:P192L;ENSP00000348646:P192L;ENSP00000431444:P192L;ENSP00000414324:P144L;ENSP00000345243:P192L;ENSP00000433838:P159L	ENSP00000345243:P192L	P	-	2	0	SIGLEC10	56611863	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.299000	0.08254	0.044000	0.15775	0.313000	0.20887	CCA	SIGLEC10	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000142512		0.587	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC10	HGNC	protein_coding	OTTHUMT00000384620.2	129	0.00	0	G	NM_033130		51920051	51920051	-1	no_errors	ENST00000339313	ensembl	human	known	69_37n	missense	124	20.00	31	SNP	0.000	A
SLC6A6	6533	genome.wustl.edu	37	3	14487331	14487331	+	Silent	SNP	C	C	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr3:14487331C>T	ENST00000454876.2	+	4	665	c.336C>T	c.(334-336)tgC>tgT	p.C112C	SLC6A6_ENST00000416216.2_Silent_p.C112C|SLC6A6_ENST00000360861.3_Silent_p.C112C|SLC6A6_ENST00000484191.1_3'UTR			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	112					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						GCATCACCTGCTGGGAAAAGA	0.493																																						dbGAP											0													125.0	112.0	116.0					3																	14487331		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.336C>T	3.37:g.14487331C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_taurine	p.C112	ENST00000454876.2	37	c.336	CCDS33705.1	3																																																																																			SLC6A6	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000131389		0.493	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A6	HGNC	protein_coding	OTTHUMT00000340507.1	88	0.00	0	C	NM_003043		14487331	14487331	+1	no_errors	ENST00000360861	ensembl	human	known	69_37n	silent	53	18.46	12	SNP	1.000	T
SLCO5A1	81796	genome.wustl.edu	37	8	70594539	70594539	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr8:70594539G>T	ENST00000260126.4	-	7	2368	c.1662C>A	c.(1660-1662)agC>agA	p.S554R	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.S499R|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.S554R	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	554	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TAACGTTGCAGCTTCCTGTCA	0.418																																						dbGAP											0													148.0	133.0	138.0					8																	70594539		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1662C>A	8.37:g.70594539G>T	ENSP00000260126:p.Ser554Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.S554R	ENST00000260126.4	37	c.1662	CCDS6205.1	8	.	.	.	.	.	.	.	.	.	.	G	17.03	3.283603	0.59867	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.41400	1.0;1.0;1.0	5.77	3.96	0.45880	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.313378	0.36665	N	0.002476	T	0.50888	0.1642	M	0.74546	2.27	0.42105	D	0.991355	P;P;D	0.55800	0.822;0.85;0.973	P;P;P	0.53809	0.653;0.658;0.735	T	0.48258	-0.9051	10	0.28530	T	0.3	.	8.2929	0.31969	0.1374:0.128:0.7345:0.0	.	499;554;554	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	R	554;554;499	ENSP00000260126:S554R;ENSP00000434422:S554R;ENSP00000431611:S499R	ENSP00000260126:S554R	S	-	3	2	SLCO5A1	70757093	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.731000	0.47343	0.762000	0.33152	0.561000	0.74099	AGC	SLCO5A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000137571		0.418	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	HGNC	protein_coding	OTTHUMT00000381990.3	39	0.00	0	G	NM_030958		70594539	70594539	-1	no_errors	ENST00000260126	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	T
STARD3	10948	genome.wustl.edu	37	17	37819130	37819130	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:37819130A>G	ENST00000336308.5	+	15	1525	c.1307A>G	c.(1306-1308)cAg>cGg	p.Q436R	STARD3_ENST00000544210.2_Missense_Mutation_p.Q436R|STARD3_ENST00000580611.1_Missense_Mutation_p.S418G|STARD3_ENST00000394250.4_Missense_Mutation_p.Q418R|TCAP_ENST00000578283.1_5'Flank|TCAP_ENST00000309889.2_5'Flank	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	436	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CACCTGCGACAGCGCATCAGC	0.672																																						dbGAP											0													98.0	96.0	97.0					17																	37819130		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.1307A>G	17.37:g.37819130A>G	ENSP00000337446:p.Gln436Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Missense_Mutation	SNP	pfam_MENTAL,pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	p.Q436R	ENST00000336308.5	37	c.1307	CCDS11341.1	17	.	.	.	.	.	.	.	.	.	.	A	19.27	3.794604	0.70452	.	.	ENSG00000131748	ENST00000336308;ENST00000544210;ENST00000394250	D;D;D	0.82984	-1.67;-1.67;-1.67	5.42	5.42	0.78866	Lipid-binding START (3);START-like domain (1);	0.234524	0.44902	D	0.000412	T	0.78553	0.4301	L	0.45051	1.395	0.34866	D	0.743092	B;B;B;B;B	0.14438	0.01;0.001;0.003;0.003;0.003	B;B;B;B;B	0.15870	0.009;0.004;0.014;0.004;0.004	T	0.80054	-0.1543	10	0.48119	T	0.1	.	15.1297	0.72514	1.0:0.0:0.0:0.0	.	436;201;436;418;436	F5H0G2;Q59EN9;B4DUY1;A8MXA4;Q14849	.;.;.;.;STAR3_HUMAN	R	436;436;418	ENSP00000337446:Q436R;ENSP00000439869:Q436R;ENSP00000377794:Q418R	ENSP00000337446:Q436R	Q	+	2	0	STARD3	35072656	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	4.905000	0.63286	2.058000	0.61347	0.459000	0.35465	CAG	STARD3	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	ENSG00000131748		0.672	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	HGNC	protein_coding	OTTHUMT00000256933.1	48	0.00	0	A			37819130	37819130	+1	no_errors	ENST00000336308	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	G
SPPL2C	162540	genome.wustl.edu	37	17	43923001	43923001	+	Silent	SNP	T	T	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:43923001T>C	ENST00000329196.5	+	1	746	c.729T>C	c.(727-729)gaT>gaC	p.D243D	MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000579244.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	243						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										AGAAGGAAGATAATGAGGACA	0.612																																						dbGAP											0													60.0	60.0	60.0					17																	43923001		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.729T>C	17.37:g.43923001T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TC67|Q8WVZ6	Silent	SNP	pfam_Peptidase_A22B_SPP,pfam_Protease-assoc_domain,smart_Peptidase_A22	p.D243	ENST00000329196.5	37	c.729	CCDS32673.1	17																																																																																			SPPL2C	-	NULL	ENSG00000185294		0.612	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2C	HGNC	protein_coding	OTTHUMT00000441156.1	53	0.00	0	T	NM_175882		43923001	43923001	+1	no_errors	ENST00000329196	ensembl	human	known	69_37n	silent	22	15.38	4	SNP	0.003	C
TEX2	55852	genome.wustl.edu	37	17	62232305	62232305	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr17:62232305G>C	ENST00000583097.1	-	9	2999	c.2827C>G	c.(2827-2829)Ctg>Gtg	p.L943V	TEX2_ENST00000581812.1_5'UTR|TEX2_ENST00000584379.1_Missense_Mutation_p.L943V|TEX2_ENST00000258991.3_Missense_Mutation_p.L950V			Q8IWB9	TEX2_HUMAN	testis expressed 2	943					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CTGTCCGCCAGACAGAATGCC	0.617																																						dbGAP											0													40.0	37.0	38.0					17																	62232305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2827C>G	17.37:g.62232305G>C	ENSP00000462665:p.Leu943Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	pfam_DUF2404	p.L950V	ENST00000583097.1	37	c.2848		17	.	.	.	.	.	.	.	.	.	.	G	11.73	1.725877	0.30593	.	.	ENSG00000136478	ENST00000258991	T	0.52754	0.65	5.83	2.76	0.32466	.	0.150079	0.46758	D	0.000278	T	0.59891	0.2227	M	0.71581	2.175	0.51233	D	0.999918	P;P	0.49559	0.925;0.78	P;B	0.56474	0.799;0.417	T	0.61397	-0.7071	10	0.66056	D	0.02	-2.9023	11.5171	0.50529	0.1949:0.0:0.8051:0.0	.	950;943	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	V	950	ENSP00000258991:L950V	ENSP00000258991:L950V	L	-	1	2	TEX2	59586037	1.000000	0.71417	0.554000	0.28268	0.566000	0.35808	4.778000	0.62368	0.386000	0.24997	0.650000	0.86243	CTG	TEX2	-	NULL	ENSG00000136478		0.617	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	TEX2	HGNC	protein_coding	OTTHUMT00000443745.1	27	0.00	0	G	NM_018469		62232305	62232305	-1	no_errors	ENST00000258991	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	C
TMPRSS15	5651	genome.wustl.edu	37	21	19698785	19698785	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr21:19698785C>T	ENST00000284885.3	-	16	1918	c.1885G>A	c.(1885-1887)Gca>Aca	p.A629T		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	629	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						GTAAAGTTTGCTTTAAACCCT	0.453																																						dbGAP											0													229.0	194.0	205.0					21																	19698785		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1885G>A	21.37:g.19698785C>T	ENSP00000284885:p.Ala629Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_MAM_dom,pfam_SEA,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_Srcr_rcpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_ConA-like_lec_gl,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_CUB,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.A629T	ENST00000284885.3	37	c.1885	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551259	0.86127	.	.	ENSG00000154646	ENST00000284885	T	0.25414	1.8	5.27	5.27	0.74061	CUB (5);	0.000000	0.85682	D	0.000000	T	0.61837	0.2379	H	0.94925	3.6	0.53005	D	0.999966	D	0.76494	0.999	D	0.65573	0.936	T	0.73685	-0.3905	9	.	.	.	.	16.7401	0.85457	0.0:1.0:0.0:0.0	.	629	P98073	ENTK_HUMAN	T	629	ENSP00000284885:A629T	.	A	-	1	0	TMPRSS15	18620656	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.518000	0.67068	2.612000	0.88384	0.650000	0.86243	GCA	TMPRSS15	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000154646		0.453	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	72	0.00	0	C	NM_002772		19698785	19698785	-1	no_errors	ENST00000284885	ensembl	human	known	69_37n	missense	66	16.46	13	SNP	1.000	T
TRAPPC8	22878	genome.wustl.edu	37	18	29437586	29437586	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr18:29437586C>G	ENST00000283351.4	-	20	3440	c.3105G>C	c.(3103-3105)tgG>tgC	p.W1035C	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.W981C	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1035					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GCCCACGTAACCACATTGGCA	0.433																																						dbGAP											0													68.0	64.0	65.0					18																	29437586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3105G>C	18.37:g.29437586C>G	ENSP00000283351:p.Trp1035Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	NULL	p.W1035C	ENST00000283351.4	37	c.3105	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813898	0.32053	.	.	ENSG00000153339	ENST00000283351	T	0.26810	1.71	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.54062	0.1835	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55438	-0.8141	10	0.59425	D	0.04	.	19.3241	0.94254	0.0:1.0:0.0:0.0	.	1035	Q9Y2L5	TPPC8_HUMAN	C	1035	ENSP00000283351:W1035C	ENSP00000283351:W1035C	W	-	3	0	TRAPPC8	27691584	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.205000	0.77881	2.629000	0.89072	0.563000	0.77884	TGG	TRAPPC8	-	NULL	ENSG00000153339		0.433	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	72	0.00	0	C	NM_014939		29437586	29437586	-1	no_errors	ENST00000283351	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	1.000	G
USP31	57478	genome.wustl.edu	37	16	23083474	23083474	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr16:23083474G>A	ENST00000219689.7	-	15	2379	c.2380C>T	c.(2380-2382)Ccg>Tcg	p.P794S	USP31_ENST00000567975.1_Missense_Mutation_p.P87S	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		TTGCTGCCCGGGAGCCGGCTC	0.617																																						dbGAP											0													52.0	55.0	54.0					16																	23083474		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2380C>T	16.37:g.23083474G>A	ENSP00000219689:p.Pro794Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.P794S	ENST00000219689.7	37	c.2380	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590867	0.86851	.	.	ENSG00000103404	ENST00000219689;ENST00000381162	T	0.08370	3.1	5.84	5.84	0.93424	.	0.317972	0.28688	N	0.014462	T	0.27313	0.0670	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.999	D;P;D	0.87578	0.998;0.841;0.981	T	0.00062	-1.2156	10	0.34782	T	0.22	-9.7553	19.1415	0.93448	0.0:0.0:1.0:0.0	.	97;794;87	Q70CQ4-2;Q70CQ4;B3KS48	.;UBP31_HUMAN;.	S	794;97	ENSP00000219689:P794S	ENSP00000219689:P794S	P	-	1	0	USP31	22990975	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.812000	0.62613	2.758000	0.94735	0.655000	0.94253	CCG	USP31	-	NULL	ENSG00000103404		0.617	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1	34	0.00	0	G	NM_020718		23083474	23083474	-1	no_errors	ENST00000219689	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	1.000	A
USP33	23032	genome.wustl.edu	37	1	78163138	78163138	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr1:78163138G>C	ENST00000370793.1	-	25	3039	c.2693C>G	c.(2692-2694)tCt>tGt	p.S898C	USP33_ENST00000370794.3_Missense_Mutation_p.S867C|USP33_ENST00000357428.1_Missense_Mutation_p.S898C	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	898	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						TGTTTCTTCAGAAATCTGGCC	0.393																																					Melanoma(152;72 1870 11110 26780 42647)	dbGAP											0													76.0	83.0	81.0					1																	78163138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.2693C>G	1.37:g.78163138G>C	ENSP00000359829:p.Ser898Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.S898C	ENST00000370793.1	37	c.2693	CCDS678.1	1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561674	0.86335	.	.	ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428	T;T;T	0.11712	2.76;2.75;2.75	5.0	5.0	0.66597	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (3);	0.000000	0.85682	D	0.000000	T	0.35451	0.0932	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.45877	-0.9231	10	0.72032	D	0.01	.	18.6967	0.91603	0.0:0.0:1.0:0.0	.	898	Q8TEY7	UBP33_HUMAN	C	867;898;898	ENSP00000359830:S867C;ENSP00000359829:S898C;ENSP00000350009:S898C	ENSP00000350009:S898C	S	-	2	0	USP33	77935726	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.318000	0.96334	2.486000	0.83907	0.650000	0.86243	TCT	USP33	-	pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP	ENSG00000077254		0.393	USP33-002	KNOWN	basic|CCDS	protein_coding	USP33	HGNC	protein_coding	OTTHUMT00000026923.2	52	0.00	0	G	NM_015017		78163138	78163138	-1	no_errors	ENST00000357428	ensembl	human	known	69_37n	missense	33	41.07	23	SNP	1.000	C
VGLL4	9686	genome.wustl.edu	37	3	11712738	11712738	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr3:11712738T>C	ENST00000404339.1	-	3	545	c.77A>G	c.(76-78)cAt>cGt	p.H26R	VGLL4_ENST00000273038.3_Intron			Q14135	VGLL4_HUMAN	vestigial-like family member 4	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ATTTTTACCATGGTGCAGACC	0.353																																						dbGAP											0													92.0	87.0	89.0					3																	11712738		876	1991	2867	-	-	-	SO:0001583	missense	0			D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000404339.1:c.77A>G	3.37:g.11712738T>C	ENSP00000384705:p.His26Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Missense_Mutation	SNP	smart_TDU_repeat	p.H26R	ENST00000404339.1	37	c.77		3	.	.	.	.	.	.	.	.	.	.	T	5.795	0.331079	0.10956	.	.	ENSG00000144560	ENST00000404339	T	0.46063	0.88	2.59	-1.4	0.08968	.	.	.	.	.	T	0.26412	0.0645	.	.	.	0.19575	N	0.999963	B	0.06786	0.001	B	0.01281	0.0	T	0.26121	-1.0112	8	0.66056	D	0.02	.	2.9364	0.05816	0.0:0.2934:0.2417:0.4648	.	26	G5E9F4	.	R	26	ENSP00000384705:H26R	ENSP00000384705:H26R	H	-	2	0	VGLL4	11687738	0.000000	0.05858	0.000000	0.03702	0.164000	0.22412	-0.113000	0.10774	-0.299000	0.08909	0.379000	0.24179	CAT	VGLL4	-	NULL	ENSG00000144560		0.353	VGLL4-201	KNOWN	basic	protein_coding	VGLL4	HGNC	protein_coding		43	0.00	0	T	NM_014667		11712738	11712738	-1	no_errors	ENST00000404339	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.000	C
XIST	7503	genome.wustl.edu	37	X	73072487	73072487	+	lincRNA	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chrX:73072487G>A	ENST00000429829.1	-	0	101					NR_001564.2				X inactive specific transcript (non-protein coding)																		GTTCTAGAAAGAACCCCAAGT	0.388																																						dbGAP											0													6.0	6.0	6.0					X																	73072487		862	1946	2808	-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73072487G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.388	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	18	0.00	0	G	NR_001564		73072487	73072487	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.191	A
XKR4	114786	genome.wustl.edu	37	8	56436523	56436523	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr8:56436523G>A	ENST00000327381.6	+	3	1790	c.1690G>A	c.(1690-1692)Gca>Aca	p.A564T	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	564						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TCAGAAATTCGCAGAGCGGGA	0.567																																						dbGAP											0													70.0	73.0	72.0					8																	56436523		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1690G>A	8.37:g.56436523G>A	ENSP00000328326:p.Ala564Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ8	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.A564T	ENST00000327381.6	37	c.1690	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	G	3.984	-0.005753	0.07773	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.82893	-1.66	5.95	1.98	0.26296	.	0.430579	0.28635	N	0.014658	T	0.57007	0.2024	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.42327	-0.9458	10	0.12103	T	0.63	-1.5829	6.1409	0.20259	0.1313:0.0:0.4803:0.3884	.	564	Q5GH76	XKR4_HUMAN	T	564	ENSP00000328326:A564T	ENSP00000328326:A564T	A	+	1	0	XKR4	56599077	0.627000	0.27129	0.470000	0.27216	0.071000	0.16799	1.833000	0.39161	0.075000	0.16796	-0.182000	0.12963	GCA	XKR4	-	NULL	ENSG00000206579		0.567	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	67	0.00	0	G	NM_052898		56436523	56436523	+1	no_errors	ENST00000327381	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	0.098	A
YY2	404281	genome.wustl.edu	37	X	21874663	21874663	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chrX:21874663G>C	ENST00000429584.2	+	1	559	c.61G>C	c.(61-63)Gag>Cag	p.E21Q	MBTPS2_ENST00000365779.2_Intron|MBTPS2_ENST00000379484.5_Intron|MBTPS2_ENST00000465888.1_3'UTR	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						AGATATTGTGGAGCTCCACGA	0.537																																						dbGAP											0													99.0	90.0	93.0					X																	21874663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.61G>C	X.37:g.21874663G>C	ENSP00000389381:p.Glu21Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP10|Q6Q1S4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.E21Q	ENST00000429584.2	37	c.61	CCDS14202.1	X	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195945	0.38806	.	.	ENSG00000230797	ENST00000429584	T	0.17528	2.27	3.69	1.89	0.25635	.	0.367204	0.24583	U	0.037292	T	0.12987	0.0315	L	0.39898	1.24	0.36433	D	0.865025	B	0.22003	0.063	B	0.22152	0.038	T	0.08827	-1.0703	10	0.87932	D	0	.	6.0577	0.19820	0.1164:0.1911:0.6925:0.0	.	21	O15391	TYY2_HUMAN	Q	21	ENSP00000389381:E21Q	ENSP00000389381:E21Q	E	+	1	0	YY2	21784584	1.000000	0.71417	0.001000	0.08648	0.005000	0.04900	5.477000	0.66799	0.378000	0.24764	0.556000	0.70494	GAG	YY2	-	pirsf_TF_Yin_yang	ENSG00000230797		0.537	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY2	HGNC	protein_coding	OTTHUMT00000056025.1	54	0.00	0	G	NM_206923		21874663	21874663	+1	no_errors	ENST00000429584	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	0.932	C
ZFHX2	85446	genome.wustl.edu	37	14	23993874	23993874	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr14:23993874C>G	ENST00000419474.3	-	9	5632	c.5277G>C	c.(5275-5277)gaG>gaC	p.E1759D	ZFHX2_ENST00000606808.1_5'Flank|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1759	Glu-rich.				adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GAGTAGCCTTCTCTTCAGGCT	0.582																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.5277G>C	14.37:g.23993874C>G	ENSP00000413418:p.Glu1759Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UPU6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E1759D	ENST00000419474.3	37	c.5277	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	C	9.782	1.175510	0.21704	.	.	ENSG00000136367	ENST00000419474	T	0.78924	-1.22	4.28	1.41	0.22369	.	0.441350	0.19181	N	0.120680	T	0.54255	0.1847	N	0.14661	0.345	0.09310	N	1	B	0.19200	0.034	B	0.20767	0.031	T	0.31806	-0.9930	10	0.20046	T	0.44	.	3.9257	0.09262	0.0:0.4559:0.1749:0.3692	.	1759	Q9C0A1	ZFHX2_HUMAN	D	1759	ENSP00000413418:E1759D	ENSP00000413418:E1759D	E	-	3	2	ZFHX2	23063714	0.224000	0.23674	0.798000	0.32154	0.156000	0.22039	0.910000	0.28571	0.181000	0.19994	0.313000	0.20887	GAG	ZFHX2	-	NULL	ENSG00000136367		0.582	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	47	0.00	0	C	NM_014894		23993874	23993874	-1	no_errors	ENST00000419474	ensembl	human	known	69_37n	missense	31	49.18	30	SNP	0.604	G
ZNF429	353088	genome.wustl.edu	37	19	21719636	21719636	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:21719636G>C	ENST00000358491.4	+	4	989	c.781G>C	c.(781-783)Gaa>Caa	p.E261Q	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	261				Missing (in Ref. 2; AAP30884 and 3; AAK01422). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						CAAATGTAAAGAATGTGGCAA	0.398																																						dbGAP											0													40.0	44.0	42.0					19																	21719636		2141	4267	6408	-	-	-	SO:0001583	missense	0			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.781G>C	19.37:g.21719636G>C	ENSP00000351280:p.Glu261Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLV7|Q9BZE6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E261Q	ENST00000358491.4	37	c.781	CCDS42537.1	19	.	.	.	.	.	.	.	.	.	.	.	14.07	2.426261	0.43020	.	.	ENSG00000197013	ENST00000358491	T	0.07444	3.19	0.876	-1.63	0.08345	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08088	0.0202	N	0.17345	0.48	0.09310	N	1	P	0.52061	0.95	P	0.52710	0.707	T	0.39781	-0.9597	9	0.41790	T	0.15	.	7.4658	0.27320	0.0:0.27:0.7299:0.0	.	261	Q86V71	ZN429_HUMAN	Q	261	ENSP00000351280:E261Q	ENSP00000351280:E261Q	E	+	1	0	ZNF429	21511476	0.000000	0.05858	0.563000	0.28383	0.564000	0.35744	-0.232000	0.09055	0.293000	0.22520	0.298000	0.19748	GAA	ZNF429	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197013		0.398	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF429	HGNC	protein_coding	OTTHUMT00000463981.1	15	0.00	0	G	NM_001001415		21719636	21719636	+1	no_errors	ENST00000358491	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.003	C
ZNF700	90592	genome.wustl.edu	37	19	12036032	12036032	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:12036032T>G	ENST00000254321.5	+	1	150	c.7T>G	c.(7-9)Tgc>Ggc	p.C3G	ZNF763_ENST00000590798.1_Missense_Mutation_p.C3G|ZNF763_ENST00000538752.1_Missense_Mutation_p.C3G|ZNF763_ENST00000591944.1_Missense_Mutation_p.C3G	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	3					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						CGCTATGCCCTGCTGTAGTCA	0.652																																						dbGAP											0													69.0	61.0	63.0					19																	12036032		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.7T>G	19.37:g.12036032T>G	ENSP00000254321:p.Cys3Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGU4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C3G	ENST00000254321.5	37	c.7	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	t	11.85	1.763135	0.31228	.	.	ENSG00000197054;ENSG00000196757	ENST00000538752;ENST00000254321	T;T	0.08193	3.24;3.12	0.735	-0.486	0.12064	.	.	.	.	.	T	0.09992	0.0245	N	0.22421	0.69	0.09310	N	0.99999	P;P	0.47106	0.89;0.462	P;B	0.54965	0.765;0.227	T	0.27502	-1.0072	8	0.59425	D	0.04	.	.	.	.	.	3;3	F5H0A9;Q9H0M5	.;ZN700_HUMAN	G	3	ENSP00000438117:C3G;ENSP00000254321:C3G	ENSP00000254321:C3G	C	+	1	0	ZNF763;ZNF700	11897032	0.007000	0.16637	0.015000	0.15790	0.032000	0.12392	0.002000	0.13061	-0.266000	0.09339	0.260000	0.18958	TGC	ZNF700	-	NULL	ENSG00000196757		0.652	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	51	0.00	0	T	NM_144566		12036032	12036032	+1	no_errors	ENST00000254321	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	0.018	G
ZNF541	84215	genome.wustl.edu	37	19	48025241	48025241	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A62Y-01A-11D-A29N-09	TCGA-AC-A62Y-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	305901ca-3086-4ca5-81d1-825a0ca5bdf3	5cb6799d-58c1-4424-a38d-a1e6d50ff772	g.chr19:48025241T>A	ENST00000391901.3	-	13	3580	c.3581A>T	c.(3580-3582)aAg>aTg	p.K1194M	ZNF541_ENST00000314121.4_Missense_Mutation_p.K1213M|ZNF541_ENST00000448976.1_Missense_Mutation_p.K936M			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	1194	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						AGCTACCGTCTTTGTCTGGAT	0.527																																						dbGAP											0													73.0	62.0	66.0					19																	48025241		692	1591	2283	-	-	-	SO:0001583	missense	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.3581A>T	19.37:g.48025241T>A	ENSP00000375770:p.Lys1194Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDK8	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R527*	ENST00000391901.3	37	c.1579		19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.19|19.19	3.779779|3.779779	0.70222|0.70222	.|.	.|.	ENSG00000118156|ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976|ENST00000263351	T;T;T|.	0.58210|.	0.78;0.78;0.35|.	5.6|5.6	4.52|4.52	0.55395|0.55395	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);|.	0.108387|.	0.41294|.	D|.	0.000917|.	T|.	0.70422|.	0.3222|.	M|M	0.90019|0.90019	3.08|3.08	0.29518|0.29518	N|N	0.853694|0.853694	P;D;D|.	0.89917|.	0.869;1.0;1.0|.	B;D;D|.	0.87578|.	0.237;0.997;0.998|.	T|.	0.70722|.	-0.4794|.	10|.	0.87932|.	D|.	0|.	-41.0047|-41.0047	9.6778|9.6778	0.40052|0.40052	0.155:0.0:0.0:0.845|0.155:0.0:0.0:0.845	.|.	1213;936;1194|.	Q9H0D2;Q9H0D2-2;Q9H0D2-3|.	ZN541_HUMAN;.;.|.	M|X	1194;1213;936|527	ENSP00000375770:K1194M;ENSP00000313258:K1213M;ENSP00000410847:K936M|.	ENSP00000313258:K1213M|.	K|R	-|-	2|1	0|2	ZNF541|ZNF541	52717053|52717053	1.000000|1.000000	0.71417|0.71417	0.353000|0.353000	0.25747|0.25747	0.946000|0.946000	0.59487|0.59487	4.330000|4.330000	0.59266|0.59266	2.254000|2.254000	0.74563|0.74563	0.460000|0.460000	0.39030|0.39030	AAG|AGA	ZNF541	-	superfamily_Homeodomain-like	ENSG00000118156		0.527	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	57	0.00	0	T	NM_032255		48025241	48025241	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000263351	ensembl	human	novel	69_37n	nonsense	53	20.90	14	SNP	0.955	A
