#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL9	284382	genome.wustl.edu	37	19	8808096	8808096	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr19:8808096G>T	ENST00000324436.3	-	1	1076	c.956C>A	c.(955-957)gCc>gAc	p.A319D		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	319						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						ACTCTGCTTGGCCATGGTGGA	0.647																																						dbGAP											0													38.0	39.0	39.0					19																	8808096		2200	4298	6498	-	-	-	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.956C>A	19.37:g.8808096G>T	ENSP00000316674:p.Ala319Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.A319D	ENST00000324436.3	37	c.956	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	g	14.29	2.490189	0.44249	.	.	ENSG00000181786	ENST00000324436	T	0.08896	3.04	4.45	3.4	0.38934	.	0.509402	0.16103	U	0.229462	T	0.23611	0.0571	M	0.86864	2.845	0.32318	N	0.562744	P	0.48998	0.918	P	0.54210	0.745	T	0.32428	-0.9907	10	0.87932	D	0	.	8.2241	0.31558	0.0893:0.1621:0.7486:0.0	.	319	Q8TC94	ACTL9_HUMAN	D	319	ENSP00000316674:A319D	ENSP00000316674:A319D	A	-	2	0	ACTL9	8669096	0.986000	0.35501	0.697000	0.30258	0.205000	0.24178	3.066000	0.50002	1.221000	0.43506	0.306000	0.20318	GCC	ACTL9	-	pfam_Actin-like,smart_Actin-like	ENSG00000181786		0.647	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	59	0.00	0	G	NM_178525		8808096	8808096	-1	no_errors	ENST00000324436	ensembl	human	known	69_37n	missense	11	65.62	21	SNP	0.947	T
ACY1	95	genome.wustl.edu	37	3	52023054	52023054	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr3:52023054delC	ENST00000404366.2	+	15	1336	c.1190delC	c.(1189-1191)gccfs	p.A397fs	ACY1_ENST00000476351.1_Frame_Shift_Del_p.A362fs|ACY1_ENST00000476854.1_Frame_Shift_Del_p.A332fs|ACY1_ENST00000458031.2_Frame_Shift_Del_p.A487fs|ACY1_ENST00000494103.1_Frame_Shift_Del_p.A325fs|ABHD14A-ACY1_ENST00000463937.1_Frame_Shift_Del_p.A498fs	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	397					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CTGCTGCCTGCCCTTGCCAGT	0.612																																						dbGAP											0													112.0	99.0	103.0					3																	52023054		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.1190delC	3.37:g.52023054delC	ENSP00000384296:p.Ala397fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J6I6|C9J9D8|C9JWD4	Frame_Shift_Del	DEL	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer,tigrfam_N-acyl_aa_amidohydrolase	p.A489fs	ENST00000404366.2	37	c.1460	CCDS2844.1	3																																																																																			ACY1	-	tigrfam_N-acyl_aa_amidohydrolase	ENSG00000243989		0.612	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACY1	HGNC	protein_coding	OTTHUMT00000349657.1	52	0.00	0	C	NM_000666		52023054	52023054	+1	no_errors	ENST00000458031	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.996	-
ADH1C	126	genome.wustl.edu	37	4	100266200	100266200	+	RNA	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr4:100266200C>T	ENST00000510055.1	-	0	560				ADH1C_ENST00000515683.1_RNA			P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	GGTGAACCTCCTGGTGCCATC	0.542																																						dbGAP											0													69.0	69.0	69.0					4																	100266200		2203	4300	6503	-	-	-			0			M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100266200C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	Missense_Mutation	SNP	NULL	p.R129K	ENST00000510055.1	37	c.386		4																																																																																			ADH1C	-	NULL	ENSG00000248144		0.542	ADH1C-004	KNOWN	mRNA_end_NF|basic	processed_transcript	ADH1C	HGNC	polymorphic_pseudogene	OTTHUMT00000365189.2	93	0.00	0	C	NM_000669		100266200	100266200	-1	pseudogene	ENST00000515683	ensembl	human	known	69_37n	missense	97	23.62	30	SNP	0.000	T
AFF4	27125	genome.wustl.edu	37	5	132228739	132228739	+	Silent	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr5:132228739C>T	ENST00000265343.5	-	12	2758	c.2379G>A	c.(2377-2379)aaG>aaA	p.K793K	AFF4_ENST00000378595.3_Silent_p.K793K	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	793					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGCTGGATGGCTTATGGCCTG	0.418																																					Ovarian(126;889 1733 2942 10745 11605)	dbGAP											0													445.0	406.0	420.0					5																	132228739		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2379G>A	5.37:g.132228739C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Silent	SNP	pfam_TF_AF4/FMR2	p.K793	ENST00000265343.5	37	c.2379	CCDS4164.1	5																																																																																			AFF4	-	pfam_TF_AF4/FMR2	ENSG00000072364		0.418	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF4	HGNC	protein_coding	OTTHUMT00000133049.1	391	0.25	1	C	NM_014423		132228739	132228739	-1	no_errors	ENST00000265343	ensembl	human	known	69_37n	silent	109	57.92	150	SNP	1.000	T
AK9	221264	genome.wustl.edu	37	6	109827530	109827530	+	Splice_Site	SNP	C	C	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr6:109827530C>G	ENST00000424296.2	-	35	4925	c.4849G>C	c.(4849-4851)Gga>Cga	p.G1617R	RP5-919F19.5_ENST00000423747.2_RNA|AL109947.2_ENST00000517228.1_RNA	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1617					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										GCTATCTTACCTGCTTTTATT	0.333																																						dbGAP											0													111.0	107.0	109.0					6																	109827530		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.4849+1G>C	6.37:g.109827530C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.G1617R	ENST00000424296.2	37	c.4849	CCDS55048.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	21.0|21.0|21.0	4.076580|4.076580|4.076580	0.76415|0.76415|0.76415	.|.|.	.|.|.	ENSG00000155085|ENSG00000155085|ENSG00000155085	ENST00000424296|ENST00000470564|ENST00000490722	T|.|.	0.68025|.|.	-0.3|.|.	5.01|5.01|5.01	5.01|5.01|5.01	0.66863|0.66863|0.66863	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.72630|0.72630|0.72630	0.3484|0.3484|0.3484	M|M|M	0.78049|0.78049|0.78049	2.395|2.395|2.395	0.80722|0.80722|0.80722	D|D|D	1|1|1	D|.|.	0.89917|.|.	1.0|.|.	D|.|.	0.91635|.|.	0.999|.|.	T|T|T	0.73471|0.73471|0.73471	-0.3972|-0.3972|-0.3972	9|5|5	.|.|.	.|.|.	.|.|.	.|.|.	18.6792|18.6792|18.6792	0.91540|0.91540|0.91540	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	1617|.|.	Q5TCS8|.|.	AKD1_HUMAN|.|.	R|H|T	1617|454|31	ENSP00000410186:G1617R|.|.	.|.|.	G|Q|R	-|-|-	1|3|2	0|2|0	AKD1|AKD1|AKD1	109934223|109934223|109934223	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.731000|0.731000|0.731000	0.41821|0.41821|0.41821	6.951000|6.951000|6.951000	0.75983|0.75983|0.75983	2.465000|2.465000|2.465000	0.83290|0.83290|0.83290	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GGA|CAG|AGA	AKD1	-	NULL	ENSG00000155085		0.333	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		188	0.00	0	C	NM_001145128	Missense_Mutation	109827530	109827530	-1	no_errors	ENST00000424296	ensembl	human	known	69_37n	missense	55	44.44	44	SNP	1.000	G
ALG2	85365	genome.wustl.edu	37	9	101980329	101980329	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr9:101980329G>A	ENST00000476832.1	-	2	1199	c.1138C>T	c.(1138-1140)Cct>Tct	p.P380S	ALG2_ENST00000319033.6_Missense_Mutation_p.P287S	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				TTTAAGGAAGGTTCACGGATG	0.493																																						dbGAP											0													105.0	107.0	107.0					9																	101980329		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.1138C>T	9.37:g.101980329G>A	ENSP00000417764:p.Pro380Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	pfam_Glyco_trans_1	p.P380S	ENST00000476832.1	37	c.1138	CCDS6739.1	9	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925345	0.73213	.	.	ENSG00000119523	ENST00000476832;ENST00000319033	D;D	0.81821	-1.54;-1.54	5.87	5.87	0.94306	Glycosyl transferase, family 1 (1);	0.000000	0.85682	D	0.000000	D	0.87970	0.6312	M	0.76433	2.335	0.80722	D	1	P;P	0.51933	0.729;0.949	B;P	0.56163	0.439;0.793	D	0.85921	0.1446	10	0.40728	T	0.16	-9.2615	20.5827	0.99408	0.0:0.0:1.0:0.0	.	287;380	Q9H553-2;Q9H553	.;ALG2_HUMAN	S	380;287	ENSP00000417764:P380S;ENSP00000326609:P287S	ENSP00000432675:P287S	P	-	1	0	ALG2	101020150	1.000000	0.71417	0.980000	0.43619	0.998000	0.95712	5.332000	0.65911	2.941000	0.99782	0.655000	0.94253	CCT	ALG2	-	pfam_Glyco_trans_1	ENSG00000119523		0.493	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG2	HGNC	protein_coding	OTTHUMT00000215080.1	127	0.00	0	G	NM_033087		101980329	101980329	-1	no_errors	ENST00000476832	ensembl	human	known	69_37n	missense	20	75.61	62	SNP	1.000	A
ASB2	51676	genome.wustl.edu	37	14	94420823	94420823	+	Silent	SNP	C	C	T	rs201823942		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr14:94420823C>T	ENST00000315988.4	-	2	662	c.174G>A	c.(172-174)gcG>gcA	p.A58A	ASB2_ENST00000555019.1_Silent_p.A106A|ASB2_ENST00000556337.1_Intron	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	58					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)	p.A58A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		TCAAGGGGTCCGCAGGCCTGT	0.597																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											72.0	64.0	66.0					14																	94420823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.174G>A	14.37:g.94420823C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDP9|B4E166|Q9NSU5|Q9Y567	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.A58	ENST00000315988.4	37	c.174	CCDS9915.1	14																																																																																			ASB2	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000100628		0.597	ASB2-001	KNOWN	basic|CCDS	protein_coding	ASB2	HGNC	protein_coding	OTTHUMT00000412845.1	32	0.00	0	C			94420823	94420823	-1	no_errors	ENST00000315988	ensembl	human	known	69_37n	silent	12	42.86	9	SNP	0.322	T
ASB7	140460	genome.wustl.edu	37	15	101169774	101169774	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr15:101169774A>G	ENST00000332783.7	+	5	1129	c.344A>G	c.(343-345)aAt>aGt	p.N115S	ASB7_ENST00000343276.4_Missense_Mutation_p.N115S|ASB7_ENST00000558747.1_Intron	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7	115					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			GCAAAAAGCAATGACGGCTGG	0.542																																						dbGAP											0													67.0	67.0	67.0					15																	101169774		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.344A>G	15.37:g.101169774A>G	ENSP00000328327:p.Asn115Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1E5|Q6GSJ6|Q7Z4S3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.N115S	ENST00000332783.7	37	c.344	CCDS10387.1	15	.	.	.	.	.	.	.	.	.	.	A	13.10	2.135763	0.37728	.	.	ENSG00000183475	ENST00000332783;ENST00000343276	T;T	0.52754	0.65;0.65	5.27	5.27	0.74061	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.46833	0.1413	N	0.20807	0.61	0.80722	D	1	P;B	0.38767	0.646;0.002	P;B	0.49752	0.621;0.003	T	0.47749	-0.9093	10	0.44086	T	0.13	0.5064	15.4885	0.75587	1.0:0.0:0.0:0.0	.	115;115	Q9H672;Q9H672-2	ASB7_HUMAN;.	S	115	ENSP00000328327:N115S;ENSP00000339819:N115S	ENSP00000328327:N115S	N	+	2	0	ASB7	98987297	1.000000	0.71417	0.984000	0.44739	0.979000	0.70002	8.740000	0.91579	2.116000	0.64780	0.374000	0.22700	AAT	ASB7	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000183475		0.542	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB7	HGNC	protein_coding	OTTHUMT00000313617.1	227	0.00	0	A	NM_024708		101169774	101169774	+1	no_errors	ENST00000332783	ensembl	human	known	69_37n	missense	421	16.93	86	SNP	1.000	G
BAZ1A	11177	genome.wustl.edu	37	14	35243682	35243682	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr14:35243682C>G	ENST00000382422.2	-	18	3175	c.2848G>C	c.(2848-2850)Gat>Cat	p.D950H	BAZ1A_ENST00000358716.4_Missense_Mutation_p.D918H|BAZ1A_ENST00000360310.1_Missense_Mutation_p.D950H			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	950					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GGTTTGCTATCAGGCTGAGGT	0.343																																						dbGAP											0													112.0	108.0	109.0					14																	35243682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.2848G>C	14.37:g.35243682C>G	ENSP00000371859:p.Asp950His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.D950H	ENST00000382422.2	37	c.2848	CCDS9651.1	14	.	.	.	.	.	.	.	.	.	.	C	12.06	1.823477	0.32237	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.72282	-0.64;-0.64;-0.64	5.5	5.5	0.81552	.	0.555807	0.20264	N	0.095802	T	0.76962	0.4061	L	0.45581	1.43	0.51233	D	0.999918	D;D	0.64830	0.994;0.973	P;P	0.61201	0.885;0.786	T	0.77341	-0.2624	10	0.59425	D	0.04	.	12.7093	0.57080	0.0:0.9251:0.0:0.0749	.	918;950	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	H	918;950;950;602	ENSP00000351555:D918H;ENSP00000371859:D950H;ENSP00000353458:D950H	ENSP00000351555:D918H	D	-	1	0	BAZ1A	34313433	1.000000	0.71417	1.000000	0.80357	0.074000	0.17049	3.787000	0.55439	2.596000	0.87737	0.650000	0.86243	GAT	BAZ1A	-	NULL	ENSG00000198604		0.343	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1A	HGNC	protein_coding	OTTHUMT00000276646.1	174	0.00	0	C			35243682	35243682	-1	no_errors	ENST00000360310	ensembl	human	known	69_37n	missense	135	31.66	63	SNP	0.994	G
BPIFB4	149954	genome.wustl.edu	37	20	31685561	31685561	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr20:31685561G>A	ENST00000375483.3	+	11	1537	c.1537G>A	c.(1537-1539)Gac>Aac	p.D513N		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	513						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										CCAGCCCAAAGACCTGGAGAC	0.587																																						dbGAP											0													100.0	71.0	81.0					20																	31685561		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1537G>A	20.37:g.31685561G>A	ENSP00000364632:p.Asp513Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDX6	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.D513N	ENST00000375483.3	37	c.1537	CCDS13213.2	20	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514825	0.64634	.	.	ENSG00000186191	ENST00000375483	T	0.08546	3.08	5.44	5.44	0.79542	.	0.159805	0.43747	D	0.000532	T	0.24586	0.0596	M	0.65975	2.015	0.41124	D	0.985832	D	0.64830	0.994	D	0.66716	0.946	T	0.00487	-1.1710	10	0.26408	T	0.33	-31.2451	15.1038	0.72303	0.0:0.0:1.0:0.0	.	513	P59827	BPIB4_HUMAN	N	513	ENSP00000364632:D513N	ENSP00000364632:D513N	D	+	1	0	BPIFB4	31149222	0.995000	0.38212	0.549000	0.28204	0.614000	0.37383	5.177000	0.65032	2.711000	0.92665	0.462000	0.41574	GAC	BPIFB4	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	ENSG00000186191		0.587	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB4	HGNC	protein_coding	OTTHUMT00000078655.5	88	0.00	0	G	NM_182519		31685561	31685561	+1	no_errors	ENST00000375483	ensembl	human	known	69_37n	missense	72	34.55	38	SNP	0.912	A
CARD6	84674	genome.wustl.edu	37	5	40843565	40843565	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr5:40843565A>G	ENST00000254691.5	+	2	794	c.595A>G	c.(595-597)Aga>Gga	p.R199G	CARD6_ENST00000381677.3_Missense_Mutation_p.R199G	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	199					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						AGATGGACAGAGATATGAGGA	0.388																																						dbGAP											0													42.0	45.0	44.0					5																	40843565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.595A>G	5.37:g.40843565A>G	ENSP00000254691:p.Arg199Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LR2	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.R199G	ENST00000254691.5	37	c.595	CCDS3935.1	5	.	.	.	.	.	.	.	.	.	.	A	17.68	3.449798	0.63290	.	.	ENSG00000132357	ENST00000254691;ENST00000381677;ENST00000444789;ENST00000509771	T;T	0.38077	2.37;1.16	5.23	2.82	0.32997	.	0.352350	0.24762	N	0.035801	T	0.24586	0.0596	L	0.34521	1.04	0.27967	N	0.936556	B	0.21309	0.054	B	0.15052	0.012	T	0.18398	-1.0338	10	0.72032	D	0.01	-11.9969	6.7532	0.23499	0.8124:0.0:0.1876:0.0	.	199	Q9BX69	CARD6_HUMAN	G	199	ENSP00000254691:R199G;ENSP00000371093:R199G	ENSP00000254691:R199G	R	+	1	2	CARD6	40879322	0.732000	0.28121	0.997000	0.53966	0.967000	0.64934	1.208000	0.32345	1.021000	0.39600	0.533000	0.62120	AGA	CARD6	-	NULL	ENSG00000132357		0.388	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3	149	0.00	0	A			40843565	40843565	+1	no_errors	ENST00000254691	ensembl	human	known	69_37n	missense	137	30.81	61	SNP	0.793	G
CCDC102B	79839	genome.wustl.edu	37	18	66721311	66721311	+	Silent	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr18:66721311G>A	ENST00000360242.5	+	8	1596	c.1479G>A	c.(1477-1479)ctG>ctA	p.L493L	CCDC102B_ENST00000319445.6_Silent_p.L493L	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	493										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AGAGGTCTCTGGATGAAGAGA	0.373																																						dbGAP											0													81.0	79.0	80.0					18																	66721311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.1479G>A	18.37:g.66721311G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z467|Q8NDK7|Q9H5C1	Silent	SNP	NULL	p.L493	ENST00000360242.5	37	c.1479	CCDS11996.2	18																																																																																			CCDC102B	-	NULL	ENSG00000150636		0.373	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC102B	HGNC	protein_coding	OTTHUMT00000256225.2	266	0.00	0	G	NM_024781		66721311	66721311	+1	no_errors	ENST00000319445	ensembl	human	known	69_37n	silent	86	51.69	92	SNP	0.994	A
CCDC144A	9720	genome.wustl.edu	37	17	16638380	16638380	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:16638380C>G	ENST00000360524.8	+	12	2871	c.2795C>G	c.(2794-2796)aCa>aGa	p.T932R	RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.T932R|CCDC144A_ENST00000443444.2_Missense_Mutation_p.T932R|CCDC144A_ENST00000399273.1_Missense_Mutation_p.T932R|CCDC144A_ENST00000456009.1_Missense_Mutation_p.T652R	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	932																	CAAAGTCAGACAGCAAGAGAC	0.408																																						dbGAP											0													23.0	21.0	22.0					17																	16638380		1863	4103	5966	-	-	-	SO:0001583	missense	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.2795C>G	17.37:g.16638380C>G	ENSP00000353717:p.Thr932Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O60311|Q6ZU57	Missense_Mutation	SNP	pfam_DUF3496	p.T932R	ENST00000360524.8	37	c.2795	CCDS45621.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.948|9.948	1.219313|1.219313	0.22373|0.22373	.|.	.|.	ENSG00000170160|ENSG00000170160	ENST00000328495|ENST00000399273;ENST00000443444;ENST00000360524;ENST00000456009	.|T;T;T;T	.|0.15834	.|2.39;2.39;2.39;2.39	2.08|2.08	2.08|2.08	0.27032|0.27032	.|.	.|.	.|.	.|.	.|.	T|T	0.31167|0.31167	0.0788|0.0788	L|L	0.48362|0.48362	1.52|1.52	0.22017|0.22017	N|N	0.999412|0.999412	.|D;D	.|0.71674	.|0.998;0.997	.|D;D	.|0.71870	.|0.975;0.92	T|T	0.04855|0.04855	-1.0922|-1.0922	5|9	.|0.87932	.|D	.|0	.|.	9.8235|9.8235	0.40896|0.40896	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|652;932	.|A2RUR9-3;A2RUR9	.|.;C144A_HUMAN	E|R	416|932;932;932;652	.|ENSP00000382215:T932R;ENSP00000439262:T932R;ENSP00000353717:T932R;ENSP00000394201:T652R	.|ENSP00000353717:T932R	Q|T	+|+	1|2	0|0	CCDC144A|CCDC144A	16579105|16579105	0.263000|0.263000	0.24083|0.24083	0.966000|0.966000	0.40874|0.40874	0.039000|0.039000	0.13416|0.13416	1.887000|1.887000	0.39698|0.39698	1.153000|1.153000	0.42468|0.42468	0.393000|0.393000	0.25936|0.25936	CAG|ACA	CCDC144A	-	NULL	ENSG00000170160		0.408	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	HGNC	protein_coding	OTTHUMT00000444093.1	130	0.00	0	C			16638380	16638380	+1	no_errors	ENST00000360524	ensembl	human	known	69_37n	missense	56	48.62	53	SNP	1.000	G
CFP	5199	genome.wustl.edu	37	X	47485756	47485756	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chrX:47485756C>T	ENST00000396992.3	-	7	1223	c.1103G>A	c.(1102-1104)cGg>cAg	p.R368Q	CFP_ENST00000480317.1_5'Flank|CFP_ENST00000247153.3_Missense_Mutation_p.R368Q|CFP_ENST00000377005.2_Missense_Mutation_p.R368Q	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	368	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						GTAGCAGTGCCGGATATCCTG	0.607																																						dbGAP											0													59.0	54.0	55.0					X																	47485756		2203	4300	6503	-	-	-	SO:0001583	missense	0			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.1103G>A	X.37:g.47485756C>T	ENSP00000380189:p.Arg368Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O15134|O15135|O15136|O75826	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.R368Q	ENST00000396992.3	37	c.1103	CCDS14282.1	X	.	.	.	.	.	.	.	.	.	.	C	14.56	2.570843	0.45798	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	T;T;T	0.49720	0.77;0.77;0.77	5.43	5.43	0.79202	.	0.138494	0.49305	D	0.000152	T	0.62122	0.2402	L	0.53729	1.69	0.36638	D	0.876667	D;D	0.76494	0.99;0.999	P;D	0.72075	0.873;0.976	T	0.65857	-0.6066	10	0.37606	T	0.19	.	13.8259	0.63351	0.0:1.0:0.0:0.0	.	304;368	B3KVK6;P27918	.;PROP_HUMAN	Q	368	ENSP00000380189:R368Q;ENSP00000247153:R368Q;ENSP00000366204:R368Q	ENSP00000247153:R368Q	R	-	2	0	CFP	47370700	0.994000	0.37717	0.349000	0.25694	0.027000	0.11550	3.321000	0.51999	2.424000	0.82194	0.468000	0.43344	CGG	CFP	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000126759		0.607	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2	41	0.00	0	C	NM_002621		47485756	47485756	-1	no_errors	ENST00000247153	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	0.499	T
COL19A1	1310	genome.wustl.edu	37	6	70637830	70637830	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr6:70637830A>T	ENST00000322773.4	+	5	398	c.296A>T	c.(295-297)gAg>gTg	p.E99V		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	99	Laminin G-like.				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CTTCCTGAGGAGTACTCAGTA	0.418																																						dbGAP											0													126.0	126.0	126.0					6																	70637830		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.296A>T	6.37:g.70637830A>T	ENSP00000316030:p.Glu99Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.E99V	ENST00000322773.4	37	c.296	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	A	12.84	2.059780	0.36373	.	.	ENSG00000082293	ENST00000322773	T	0.02682	4.2	5.71	5.71	0.89125	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.10380	0.0254	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00812	-1.1556	10	0.72032	D	0.01	.	15.9886	0.80183	1.0:0.0:0.0:0.0	.	99	Q14993	COJA1_HUMAN	V	99	ENSP00000316030:E99V	ENSP00000316030:E99V	E	+	2	0	COL19A1	70694551	1.000000	0.71417	0.992000	0.48379	0.454000	0.32378	8.726000	0.91474	2.173000	0.68751	0.533000	0.62120	GAG	COL19A1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000082293		0.418	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	273	0.00	0	A			70637830	70637830	+1	no_errors	ENST00000322773	ensembl	human	known	69_37n	missense	249	36.80	145	SNP	1.000	T
CYP26B1	56603	genome.wustl.edu	37	2	72359509	72359509	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr2:72359509G>C	ENST00000001146.2	-	6	1589	c.1386C>G	c.(1384-1386)agC>agG	p.S462R	CYP26B1_ENST00000546307.1_Missense_Mutation_p.S387R|CYP26B1_ENST00000412253.1_Missense_Mutation_p.S271R	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	462					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						GCTCAAAGCGGCTGGTGCTAG	0.647																																						dbGAP											0													45.0	40.0	42.0					2																	72359509		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1386C>G	2.37:g.72359509G>C	ENSP00000001146:p.Ser462Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B,prints_Cyt_P450	p.S462R	ENST00000001146.2	37	c.1386	CCDS1919.1	2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087131	0.76642	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.68181	-0.31;-0.31;-0.31	5.64	3.83	0.44106	.	0.037786	0.85682	D	0.000000	T	0.68513	0.3009	L	0.32530	0.975	0.58432	D	0.999991	B;P;P	0.43701	0.291;0.815;0.815	B;P;P	0.55871	0.433;0.786;0.786	T	0.71258	-0.4646	10	0.62326	D	0.03	-21.0224	12.1571	0.54083	0.1494:0.0:0.8506:0.0	.	387;445;462	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	R	462;271;387	ENSP00000001146:S462R;ENSP00000401465:S271R;ENSP00000443304:S387R	ENSP00000001146:S462R	S	-	3	2	CYP26B1	72213017	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.791000	0.47829	1.545000	0.49373	0.655000	0.94253	AGC	CYP26B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000003137		0.647	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP26B1	HGNC	protein_coding	OTTHUMT00000251969.1	19	0.00	0	G	NM_019885		72359509	72359509	-1	no_errors	ENST00000001146	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	1.000	C
DNA2	1763	genome.wustl.edu	37	10	70231738	70231738	+	5'Flank	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr10:70231738C>T	ENST00000358410.3	-	0	0				DNA2_ENST00000399179.2_5'UTR|DNA2_ENST00000399180.2_Missense_Mutation_p.V48I	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2						ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						CATGCGCCAACCCGCAGATGT	0.647																																						dbGAP											0													26.0	30.0	28.0					10																	70231738		1884	4106	5990	-	-	-	SO:0001631	upstream_gene_variant	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352		10.37:g.70231738C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	pfam_DNA_replication_fac_Dna2	p.V48I	ENST00000358410.3	37	c.142		10	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383954	0.42308	.	.	ENSG00000138346	ENST00000399180	D	0.91521	-2.86	3.66	-4.23	0.03789	.	.	.	.	.	T	0.78811	0.4342	.	.	.	0.20307	N	0.999914	.	.	.	.	.	.	T	0.66364	-0.5942	5	.	.	.	.	0.464	0.00521	0.2843:0.2133:0.2898:0.2126	.	.	.	.	I	48	ENSP00000382133:V48I	.	V	-	1	0	DNA2	69901744	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-0.475000	0.06599	-0.873000	0.04032	-0.680000	0.03767	GTT	DNA2	-	NULL	ENSG00000138346		0.647	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2	31	0.00	0	C			70231738	70231738	-1	no_errors	ENST00000399180	ensembl	human	known	69_37n	missense	7	56.25	9	SNP	0.000	T
DZANK1	55184	genome.wustl.edu	37	20	18446022	18446022	+	Splice_Site	SNP	C	C	A	rs371169404|rs74875927	byFrequency	TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr20:18446022C>A	ENST00000262547.5	-	2	190		c.e2-1		POLR3F_ENST00000377603.4_5'Flank|DZANK1_ENST00000358866.6_5'UTR|DZANK1_ENST00000329494.5_Splice_Site|DZANK1_ENST00000357236.4_Splice_Site	NM_001099407.1	NP_001092877.1	Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1								zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						ctctctctctctctATATATA	0.368													C|||	559	0.111621	0.1868	0.1009	5008	,	,		12978	0.0377		0.1322	False		,,,				2504	0.0726					dbGAP											0													31.0	27.0	28.0					20																	18446022		1812	4073	5885	-	-	-	SO:0001630	splice_region_variant	0			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000262547.5:c.19-1G>T	20.37:g.18446022C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Splice_Site	SNP	-	e1-1	ENST00000262547.5	37	c.1-1	CCDS46582.1	20																																																																																			DZANK1	-	-	ENSG00000089091		0.368	DZANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	HGNC	protein_coding		26	0.00	0	C	NM_001099407	Intron	18446022	18446022	-1	no_errors	ENST00000262547	ensembl	human	known	69_37n	splice_site	27	28.95	11	SNP	0.000	A
FAM65C	140876	genome.wustl.edu	37	20	49221293	49221293	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr20:49221293G>T	ENST00000327979.2	-	12	1374	c.963C>A	c.(961-963)agC>agA	p.S321R	FAM65C_ENST00000535356.1_Missense_Mutation_p.S325R|FAM65C_ENST00000045083.2_Missense_Mutation_p.S321R			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	321										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACACCAGGAAGCTCTCAGTAT	0.607																																						dbGAP											0													42.0	41.0	42.0					20																	49221293		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.963C>A	20.37:g.49221293G>T	ENSP00000332663:p.Ser321Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.S325R	ENST00000327979.2	37	c.975	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384992	0.42308	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02158	4.42;4.42;4.42	3.95	2.97	0.34412	.	0.286845	0.39759	N	0.001279	T	0.02047	0.0064	L	0.36672	1.1	0.21290	N	0.999733	P;P	0.39424	0.478;0.673	B;B	0.39738	0.308;0.289	T	0.45308	-0.9270	10	0.38643	T	0.18	-12.678	3.1887	0.06609	0.1988:0.0:0.5707:0.2304	.	325;321	F5H0X2;Q96MK2	.;FA65C_HUMAN	R	321;321;325	ENSP00000332663:S321R;ENSP00000045083:S321R;ENSP00000439802:S325R	ENSP00000045083:S321R	S	-	3	2	FAM65C	48654700	0.120000	0.22244	0.988000	0.46212	0.909000	0.53808	1.180000	0.32005	1.921000	0.55644	0.561000	0.74099	AGC	FAM65C	-	NULL	ENSG00000042062		0.607	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	27	0.00	0	G			49221293	49221293	-1	no_errors	ENST00000535356	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.952	T
FAT3	120114	genome.wustl.edu	37	11	92623767	92623767	+	Missense_Mutation	SNP	C	C	T	rs543168460		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr11:92623767C>T	ENST00000298047.6	+	27	13275	c.13258C>T	c.(13258-13260)Cgg>Tgg	p.R4420W	FAT3_ENST00000533797.1_Missense_Mutation_p.R723W|FAT3_ENST00000489716.1_3'UTR|FAT3_ENST00000409404.2_Missense_Mutation_p.R4388W|FAT3_ENST00000525166.1_Missense_Mutation_p.R4270W			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4420					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGGGAGCACACGGGAGCTGGA	0.572										TCGA Ovarian(4;0.039)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18211	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													55.0	65.0	62.0					11																	92623767		2051	4190	6241	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.13258C>T	11.37:g.92623767C>T	ENSP00000298047:p.Arg4420Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.R4420W	ENST00000298047.6	37	c.13258		11	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013223	0.75161	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.66	3.62	0.41486	.	.	.	.	.	T	0.50360	0.1611	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.66084	0.941;0.889	T	0.55386	-0.8149	9	0.66056	D	0.02	.	13.403	0.60893	0.3946:0.6054:0.0:0.0	.	4388;4420	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	W	4420;4388;4270;723	ENSP00000298047:R4420W;ENSP00000387040:R4388W;ENSP00000432586:R4270W;ENSP00000436399:R723W	ENSP00000298047:R4420W	R	+	1	2	FAT3	92263415	0.911000	0.30947	0.883000	0.34634	0.976000	0.68499	2.007000	0.40883	1.365000	0.46057	0.655000	0.94253	CGG	FAT3	-	NULL	ENSG00000165323		0.572	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		63	0.00	0	C	NM_001008781		92623767	92623767	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	47	27.69	18	SNP	0.950	T
FZD3	7976	genome.wustl.edu	37	8	28409124	28409124	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr8:28409124C>T	ENST00000240093.3	+	6	1887	c.1409C>T	c.(1408-1410)aCt>aTt	p.T470I	FZD3_ENST00000537916.1_Missense_Mutation_p.T470I	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	470					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TTCCAGGTTACTCAAATGAGT	0.338																																						dbGAP											0													95.0	90.0	92.0					8																	28409124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.1409C>T	8.37:g.28409124C>T	ENSP00000240093:p.Thr470Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K615	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,prints_Frizzled,pfscan_Frizzled_dom,pfscan_GPCR_2-like	p.T470I	ENST00000240093.3	37	c.1409	CCDS6069.1	8	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186668	0.57909	.	.	ENSG00000104290	ENST00000537916;ENST00000240093	D;D	0.82081	-1.57;-1.57	5.17	5.17	0.71159	GPCR, family 2-like (1);	0.231419	0.43919	D	0.000501	T	0.76997	0.4066	N	0.08118	0	0.45378	D	0.998364	B	0.32071	0.355	B	0.43838	0.433	T	0.76457	-0.2952	10	0.37606	T	0.19	.	18.0226	0.89259	0.0:1.0:0.0:0.0	.	470	Q9NPG1	FZD3_HUMAN	I	470	ENSP00000437489:T470I;ENSP00000240093:T470I	ENSP00000240093:T470I	T	+	2	0	FZD3	28465043	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.457000	0.66672	2.574000	0.86865	0.585000	0.79938	ACT	FZD3	-	pfam_Frizzled,pfscan_GPCR_2-like	ENSG00000104290		0.338	FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD3	HGNC	protein_coding	OTTHUMT00000219986.2	130	0.76	1	C	NM_145866		28409124	28409124	+1	no_errors	ENST00000240093	ensembl	human	known	69_37n	missense	119	29.17	49	SNP	1.000	T
GBGT1	26301	genome.wustl.edu	37	9	136029012	136029012	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr9:136029012delC	ENST00000372040.3	-	7	1307	c.996delG	c.(994-996)ctgfs	p.L332fs	GBGT1_ENST00000472281.1_5'UTR|GBGT1_ENST00000372043.3_3'UTR|RALGDS_ENST00000542690.1_Intron|GBGT1_ENST00000540636.1_Frame_Shift_Del_p.L315fs	NM_001282629.1	NP_001269558.1	Q8N5D6	GBGT1_HUMAN	globoside alpha-1,3-N-acetylgalactosaminyltransferase 1	332					glycolipid biosynthetic process (GO:0009247)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	globoside alpha-N-acetylgalactosaminyltransferase activity (GO:0047277)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(4)|lung(2)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		AAAAGCGGATCAGCTTCAGGC	0.597																																						dbGAP											0													108.0	108.0	108.0					9																	136029012		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY358175	CCDS6960.1, CCDS65175.1, CCDS65176.1	9q34.13-q34.3	2014-07-18			ENSG00000148288	ENSG00000148288		"""Glycosyltransferase family 6 domain containing"""	20460	protein-coding gene	gene with protein product	"""Forssman glycolipid synthetase (FS)"", ""Forssman synthetase"""	606074				10506200, 8855242	Standard	NM_021996		Approved	UDP-GalNAc, A3GALNT, MGC44848, FS		Q8N5D6	OTTHUMG00000020853	ENST00000372040.3:c.996delG	9.37:g.136029012delC	ENSP00000361110:p.Leu332fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K633|B2RA95|B7Z8S5|Q45F07|Q5T7U9|Q5T7V1|Q8N2K4|Q9UKI5	Frame_Shift_Del	DEL	pfam_Glyco_trans_6	p.I333fs	ENST00000372040.3	37	c.996	CCDS6960.1	9																																																																																			GBGT1	-	pfam_Glyco_trans_6	ENSG00000148288		0.597	GBGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBGT1	HGNC	protein_coding	OTTHUMT00000054815.1	25	0.00	0	C	NM_021996		136029012	136029012	-1	no_errors	ENST00000372040	ensembl	human	known	69_37n	frame_shift_del	9	41.18	7	DEL	1.000	-
GOLGA1	2800	genome.wustl.edu	37	9	127700866	127700866	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr9:127700866C>G	ENST00000373555.4	-	3	458	c.125G>C	c.(124-126)gGa>gCa	p.G42A		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	42					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						AAAGTCATCTCCTGAGTCAGC	0.403																																						dbGAP											0													124.0	120.0	122.0					9																	127700866		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.125G>C	9.37:g.127700866C>G	ENSP00000362656:p.Gly42Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T164|Q8IYZ9	Missense_Mutation	SNP	pfam_GRIP,superfamily_Prefoldin,superfamily_GRIP,smart_GRIP,pfscan_GRIP	p.G42A	ENST00000373555.4	37	c.125	CCDS6860.1	9	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737516	0.89482	.	.	ENSG00000136935	ENST00000373555;ENST00000421514	T;T	0.17528	2.27;2.27	5.03	5.03	0.67393	.	0.000000	0.41823	U	0.000812	T	0.42131	0.1189	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.26121	-1.0112	10	0.59425	D	0.04	-16.2919	17.7193	0.88345	0.0:1.0:0.0:0.0	.	42	Q92805	GOGA1_HUMAN	A	42	ENSP00000362656:G42A;ENSP00000396966:G42A	ENSP00000362656:G42A	G	-	2	0	GOLGA1	126740687	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.421000	0.80204	2.498000	0.84270	0.557000	0.71058	GGA	GOLGA1	-	NULL	ENSG00000136935		0.403	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA1	HGNC	protein_coding	OTTHUMT00000054049.1	159	0.00	0	C	NM_002077		127700866	127700866	-1	no_errors	ENST00000373555	ensembl	human	known	69_37n	missense	77	23.00	23	SNP	1.000	G
HERC1	8925	genome.wustl.edu	37	15	64050494	64050494	+	Missense_Mutation	SNP	A	A	C	rs35163901	byFrequency	TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr15:64050494A>C	ENST00000443617.2	-	4	1188	c.1101T>G	c.(1099-1101)atT>atG	p.I367M		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	367					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTTCGGAGACAATGGGAGCAT	0.428																																						dbGAP											0													101.0	94.0	96.0					15																	64050494		1873	4112	5985	-	-	-	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.1101T>G	15.37:g.64050494A>C	ENSP00000390158:p.Ile367Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.I367M	ENST00000443617.2	37	c.1101	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	A	12.50	1.957134	0.34565	.	.	ENSG00000103657	ENST00000443617	T	0.23754	1.89	5.35	2.92	0.33932	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (1);	0.091652	0.46758	U	0.000269	T	0.08670	0.0215	N	0.03608	-0.345	0.40174	D	0.977213	B;B	0.10296	0.003;0.002	B;B	0.04013	0.001;0.001	T	0.17837	-1.0356	10	0.20519	T	0.43	.	3.2034	0.06657	0.5255:0.2727:0.0709:0.131	.	367;367	C9JUT5;Q15751	.;HERC1_HUMAN	M	367	ENSP00000390158:I367M	ENSP00000390158:I367M	I	-	3	3	HERC1	61837547	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.941000	0.29005	0.366000	0.24427	0.533000	0.62120	ATT	HERC1	-	superfamily_Reg_csome_cond/b-lactamase_inh	ENSG00000103657		0.428	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	128	0.00	0	A	NM_003922		64050494	64050494	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	missense	89	32.06	42	SNP	0.996	C
HIST2H3D	653604	genome.wustl.edu	37	1	149784867	149784868	+	Missense_Mutation	DNP	CC	CC	AA	rs587674278		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:149784867_149784868CC>AA	ENST00000331491.1	-	1	368_369	c.369_370GG>TT	c.(367-372)aaGGac>aaTTac	p.123_124KD>NY	HIST2H2BF_ENST00000545683.1_5'Flank|HIST2H2BF_ENST00000427880.2_5'Flank|HIST2H2BF_ENST00000469483.1_5'Flank|HIST2H2BF_ENST00000369167.1_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	123					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						AACTGGATGTCCTTGGGCATGA	0.589																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.369_370delinsAA	1.37:g.149784867_149784868delinsAA	ENSP00000333277:p.K123_D124delinsNY	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDF6|A6NFS4|Q6B053	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.D124Y|p.K123N	ENST00000331491.1	37	c.370|c.369	CCDS41388.1	1																																																																																			HIST2H3D	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000183598		0.589	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H3D	HGNC	protein_coding	OTTHUMT00000033452.1	54|57	0.00	0	C	NM_001123375		149784867|149784868	149784867|149784868	-1	no_errors	ENST00000331491	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	1.000	A
HRNR	388697	genome.wustl.edu	37	1	152185557	152185557	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:152185557G>A	ENST00000368801.2	-	3	8623	c.8548C>T	c.(8548-8550)Cag>Tag	p.Q2850*	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2850					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATTATTCACTGATAAAAGTAG	0.348																																						dbGAP											0													35.0	38.0	37.0					1																	152185557		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8548C>T	1.37:g.152185557G>A	ENSP00000357791:p.Gln2850*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Nonsense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.Q2850*	ENST00000368801.2	37	c.8548	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.338860	0.99658	.	.	ENSG00000197915	ENST00000368801	.	.	.	4.75	-7.99	0.01131	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	0.1839	0.00126	0.3531:0.1555:0.2109:0.2805	.	.	.	.	X	2850	.	ENSP00000357791:Q2850X	Q	-	1	0	HRNR	150452181	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.365000	0.02587	-0.968000	0.03578	-1.240000	0.01540	CAG	HRNR	-	NULL	ENSG00000197915		0.348	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	75	0.00	0	G	XM_373868		152185557	152185557	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	nonsense	39	29.09	16	SNP	0.000	A
HSPA12A	259217	genome.wustl.edu	37	10	118439273	118439273	+	Splice_Site	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr10:118439273C>T	ENST00000369209.3	-	10	1132		c.e10-1			NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A							extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		TAGGGTCCGCCTGAATTGAGA	0.398																																						dbGAP											0													56.0	57.0	57.0					10																	118439273		1815	4077	5892	-	-	-	SO:0001630	splice_region_variant	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1028-1G>A	10.37:g.118439273C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e10-1	ENST00000369209.3	37	c.1028-1	CCDS41569.1	10	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023253	0.54683	.	.	ENSG00000165868	ENST00000369209	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HSPA12A	118429263	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	7.487000	0.81328	2.824000	0.97209	0.655000	0.94253	.	HSPA12A	-	-	ENSG00000165868		0.398	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	143	0.00	0	C	NM_025015	Intron	118439273	118439273	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	splice_site	108	32.08	51	SNP	1.000	T
ITK	3702	genome.wustl.edu	37	5	156635917	156635917	+	Silent	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr5:156635917G>A	ENST00000422843.3	+	2	308	c.156G>A	c.(154-156)aaG>aaA	p.K52K	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	52	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	GCACGCTGAAGGGGTCCATTG	0.438			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	dbGAP		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0													105.0	96.0	99.0					5																	156635917		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.156G>A	5.37:g.156635917G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R752|Q32ML7	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.K52	ENST00000422843.3	37	c.156	CCDS4336.1	5																																																																																			ITK	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000113263		0.438	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	117	0.00	0	G			156635917	156635917	+1	no_errors	ENST00000422843	ensembl	human	known	69_37n	silent	22	60.71	34	SNP	1.000	A
KCNT2	343450	genome.wustl.edu	37	1	196227573	196227573	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:196227573C>A	ENST00000294725.9	-	26	3877	c.2962G>T	c.(2962-2964)Gaa>Taa	p.E988*	KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Nonsense_Mutation_p.E921*|KCNT2_ENST00000367431.4_Nonsense_Mutation_p.E922*|KCNT2_ENST00000367433.5_Nonsense_Mutation_p.E964*|KCNT2_ENST00000451324.2_3'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	988					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TGCCCTTGTTCTTTGGAGTCT	0.433																																						dbGAP											0													223.0	183.0	196.0					1																	196227573		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2962G>T	1.37:g.196227573C>A	ENSP00000294725:p.Glu988*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY59|Q5VTN1|Q6ZMT3	Nonsense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.E988*	ENST00000294725.9	37	c.2962	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.111816	0.98659	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	.	.	.	5.41	5.41	0.78517	.	0.201946	0.34362	N	0.004032	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-7.819	19.5795	0.95459	0.0:1.0:0.0:0.0	.	.	.	.	X	964;922;988	.	ENSP00000294725:E988X	E	-	1	0	KCNT2	194494196	0.998000	0.40836	0.394000	0.26270	0.819000	0.46315	2.916000	0.48813	2.710000	0.92621	0.643000	0.83706	GAA	KCNT2	-	NULL	ENSG00000162687		0.433	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	223	0.00	0	C	NM_198503		196227573	196227573	-1	no_errors	ENST00000294725	ensembl	human	known	69_37n	nonsense	213	28.76	86	SNP	0.999	A
KIAA1551	55196	genome.wustl.edu	37	12	32137221	32137221	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr12:32137221C>G	ENST00000312561.4	+	4	3746	c.3332C>G	c.(3331-3333)tCa>tGa	p.S1111*	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1111																	ATATTAAGCTCAGAGCAAATG	0.393																																						dbGAP											0													60.0	62.0	61.0					12																	32137221		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.3332C>G	12.37:g.32137221C>G	ENSP00000310338:p.Ser1111*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Nonsense_Mutation	SNP	NULL	p.S1111*	ENST00000312561.4	37	c.3332	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	C	44	10.896196	0.99485	.	.	ENSG00000174718	ENST00000312561	.	.	.	5.37	4.49	0.54785	.	0.272206	0.26404	N	0.024575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1209	0.53891	0.0:0.9194:0.0:0.0806	.	.	.	.	X	1111	.	.	S	+	2	0	C12orf35	32028488	0.943000	0.32029	0.311000	0.25182	0.616000	0.37450	2.952000	0.49097	1.269000	0.44280	0.563000	0.77884	TCA	KIAA1551	-	NULL	ENSG00000174718		0.393	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	157	0.00	0	C	NM_018169		32137221	32137221	+1	no_errors	ENST00000312561	ensembl	human	known	69_37n	nonsense	161	34.55	85	SNP	0.584	G
KIAA1586	57691	genome.wustl.edu	37	6	56919137	56919137	+	Missense_Mutation	SNP	A	A	C	rs373253483		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr6:56919137A>C	ENST00000370733.4	+	4	2047	c.1840A>C	c.(1840-1842)Atg>Ctg	p.M614L	KIAA1586_ENST00000545356.1_Missense_Mutation_p.M587L	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	614							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AATTCAGCACATGAACCTACG	0.303																																						dbGAP											0													51.0	57.0	55.0					6																	56919137		2186	4280	6466	-	-	-	SO:0001583	missense	0			AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.1840A>C	6.37:g.56919137A>C	ENSP00000359768:p.Met614Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4M3|Q8IW25	Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.M614L	ENST00000370733.4	37	c.1840	CCDS34480.1	6	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.047385	0.00398	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.21543	2.0;2.0	3.34	2.17	0.27698	Ribonuclease H-like (1);	.	.	.	.	T	0.01905	0.0060	N	0.08118	0	0.09310	N	1	B;B	0.21606	0.058;0.058	B;B	0.22880	0.042;0.042	T	0.47686	-0.9098	9	0.02654	T	1	.	4.9813	0.14166	0.8574:0.0:0.1426:0.0	.	587;614	F5H2N6;Q9HCI6	.;K1586_HUMAN	L	614;587	ENSP00000359768:M614L;ENSP00000445507:M587L	ENSP00000359768:M614L	M	+	1	0	KIAA1586	57027096	0.998000	0.40836	0.001000	0.08648	0.910000	0.53928	1.257000	0.32932	0.498000	0.27948	0.528000	0.53228	ATG	KIAA1586	-	superfamily_RNaseH-like_dom	ENSG00000168116		0.303	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1586	HGNC	protein_coding	OTTHUMT00000041033.1	151	0.00	0	A	NM_020931		56919137	56919137	+1	no_errors	ENST00000370733	ensembl	human	known	69_37n	missense	128	21.47	35	SNP	0.004	C
KIF24	347240	genome.wustl.edu	37	9	34255843	34255843	+	Silent	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr9:34255843G>T	ENST00000402558.2	-	10	3786	c.3762C>A	c.(3760-3762)ctC>ctA	p.L1254L	KIF24_ENST00000379166.2_Silent_p.L1254L|KIF24_ENST00000379174.3_Silent_p.L1120L|KIF24_ENST00000345050.2_Silent_p.L1120L			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1254					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			GCCTGGGTTTGAGCCATGTGA	0.552											OREG0019148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													80.0	68.0	72.0					9																	34255843		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3762C>A	9.37:g.34255843G>T		Somatic	846	WXS	Illumina GAIIx	Phase_IV	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	NULL	p.Q206K	ENST00000402558.2	37	c.616	CCDS6551.2	9	.	.	.	.	.	.	.	.	.	.	G	1.993	-0.431400	0.04669	.	.	ENSG00000186638	ENST00000443226	.	.	.	4.93	3.96	0.45880	.	.	.	.	.	T	0.49558	0.1564	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44375	-0.9332	4	.	.	.	.	5.4438	0.16523	0.1013:0.0:0.6862:0.2125	.	.	.	.	K	206	.	.	Q	-	1	0	KIF24	34245843	0.591000	0.26824	0.990000	0.47175	0.324000	0.28378	0.200000	0.17257	2.568000	0.86640	0.650000	0.86243	CAA	KIF24	-	NULL	ENSG00000186638		0.552	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF24	HGNC	protein_coding	OTTHUMT00000052150.5	73	0.00	0	G			34255843	34255843	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443226	ensembl	human	putative	69_37n	missense	52	29.73	22	SNP	0.980	T
KIR3DL2	3812	genome.wustl.edu	37	19	55363521	55363521	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr19:55363521C>T	ENST00000326321.3	+	3	172	c.139C>T	c.(139-141)Ctt>Ttt	p.L47F	KIR3DL2_ENST00000270442.5_Missense_Mutation_p.L47F|KIR3DL1_ENST00000402254.2_Intron	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	47	Ig-like C2-type 1.				cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		ACACGTGGCTCTTCAGTGTCA	0.547																																						dbGAP											0													8.0	7.0	8.0					19																	55363521		2009	3932	5941	-	-	-	SO:0001583	missense	0			L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.139C>T	19.37:g.55363521C>T	ENSP00000325525:p.Leu47Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.L47F	ENST00000326321.3	37	c.139	CCDS12906.1	19	.	.	.	.	.	.	.	.	.	.	c	12.14	1.849597	0.32699	.	.	ENSG00000240403	ENST00000326321;ENST00000270442	T;T	0.01665	4.7;4.7	1.62	1.62	0.23740	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.29745	U	0.011306	T	0.07593	0.0191	M	0.76838	2.35	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.02837	-1.1104	10	0.87932	D	0	.	6.7241	0.23346	0.0:1.0:0.0:0.0	.	47;47	Q95366;P43630	.;KI3L2_HUMAN	F	47	ENSP00000325525:L47F;ENSP00000270442:L47F	ENSP00000270442:L47F	L	+	1	0	KIR3DL2	60055333	0.023000	0.18921	0.004000	0.12327	0.005000	0.04900	1.913000	0.39956	1.221000	0.43506	0.184000	0.17185	CTT	KIR3DL2	-	pfam_Immunoglobulin,smart_Ig_sub	ENSG00000240403		0.547	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIR3DL2	HGNC	protein_coding	OTTHUMT00000141241.1	89	0.00	0	C			55363521	55363521	+1	no_errors	ENST00000326321	ensembl	human	known	69_37n	missense	41	41.43	29	SNP	0.004	T
LECT2	3950	genome.wustl.edu	37	5	135286901	135286901	+	Intron	SNP	A	A	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr5:135286901A>G	ENST00000274507.1	-	3	490				LECT2_ENST00000512872.1_Intron|LECT2_ENST00000522943.1_Intron|LECT2_ENST00000471827.1_Intron|FBXL21_ENST00000467490.1_RNA|LECT2_ENST00000514447.2_Silent_p.G100G	NM_002302.2	NP_002293.2	O14960	LECT2_HUMAN	leukocyte cell-derived chemotaxin 2						chemotaxis (GO:0006935)|negative regulation of Wnt signaling pathway (GO:0030178)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	identical protein binding (GO:0042802)			large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGTAGACTCCACCTCTCTTAC	0.408																																						dbGAP											0													95.0	94.0	94.0					5																	135286901		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB007546	CCDS4190.1	5q31.1	2008-05-15			ENSG00000145826	ENSG00000145826			6550	protein-coding gene	gene with protein product		602882				9545637	Standard	NM_002302		Approved	chm-II, chm2	uc003lbe.1	O14960	OTTHUMG00000129146	ENST00000274507.1:c.289+10T>C	5.37:g.135286901A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA90|O14565|Q52M49	Silent	SNP	NULL	p.G100	ENST00000274507.1	37	c.300	CCDS4190.1	5																																																																																			LECT2	-	NULL	ENSG00000145826		0.408	LECT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LECT2	HGNC	protein_coding	OTTHUMT00000251209.1	170	0.00	0	A	NM_002302		135286901	135286901	-1	no_errors	ENST00000514447	ensembl	human	putative	69_37n	silent	52	50.94	54	SNP	0.036	G
MAP1A	4130	genome.wustl.edu	37	15	43813802	43813802	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr15:43813802C>A	ENST00000300231.5	+	4	581	c.131C>A	c.(130-132)cCa>cAa	p.P44Q	MAP1A_ENST00000399453.1_Missense_Mutation_p.P44Q|MAP1A_ENST00000382031.1_Missense_Mutation_p.P282Q			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	44					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TACATCTTCCCAGGTGGTCGT	0.557																																						dbGAP											0													108.0	107.0	107.0					15																	43813802		2178	4280	6458	-	-	-	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.131C>A	15.37:g.43813802C>A	ENSP00000300231:p.Pro44Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.P44Q	ENST00000300231.5	37	c.131	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733193	0.48939	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.25749	1.78;1.78;1.78	4.92	4.92	0.64577	.	.	.	.	.	T	0.60599	0.2281	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69409	-0.5153	9	0.87932	D	0	-10.1406	18.6574	0.91459	0.0:1.0:0.0:0.0	.	44	P78559	MAP1A_HUMAN	Q	282;44;44;44	ENSP00000371462:P282Q;ENSP00000382380:P44Q;ENSP00000300231:P44Q	ENSP00000300231:P44Q	P	+	2	0	MAP1A	41601094	1.000000	0.71417	0.966000	0.40874	0.993000	0.82548	7.609000	0.82925	2.720000	0.93068	0.561000	0.74099	CCA	MAP1A	-	NULL	ENSG00000166963		0.557	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	113	0.00	0	C	NM_002373		43813802	43813802	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	missense	65	37.50	39	SNP	1.000	A
MCM3	4172	genome.wustl.edu	37	6	52129521	52129521	+	Silent	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr6:52129521G>T	ENST00000229854.7	-	17	2368	c.2292C>A	c.(2290-2292)ggC>ggA	p.G764G	MCM3_ENST00000596288.1_Silent_p.G809G|MCM3_ENST00000419835.2_Silent_p.G718G			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	764					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					GGCGATTCATGCCGATTGACT	0.537																																						dbGAP											0													189.0	172.0	178.0					6																	52129521		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.2292C>A	6.37:g.52129521G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase	p.H310N	ENST00000229854.7	37	c.928		6	.	.	.	.	.	.	.	.	.	.	G	7.645	0.681602	0.14907	.	.	ENSG00000112118	ENST00000340349;ENST00000421471	T	0.32272	1.46	5.39	0.94	0.19513	.	.	.	.	.	T	0.29749	0.0743	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19095	-1.0316	6	0.87932	D	0	-25.1412	10.2765	0.43512	0.3489:0.0:0.6511:0.0	.	.	.	.	N	312;310	ENSP00000407651:H310N	ENSP00000340566:H312N	H	-	1	0	MCM3	52237480	0.960000	0.32886	0.997000	0.53966	0.426000	0.31534	0.132000	0.15891	0.276000	0.22118	-0.140000	0.14226	CAT	MCM3	-	NULL	ENSG00000112118		0.537	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	HGNC	protein_coding	OTTHUMT00000470784.1	352	0.00	0	G			52129521	52129521	-1	no_start_codon	ENST00000421471	ensembl	human	known	69_37n	missense	310	25.48	106	SNP	0.987	T
MIIP	60672	genome.wustl.edu	37	1	12081867	12081867	+	Silent	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:12081867G>A	ENST00000235332.4	+	2	253	c.84G>A	c.(82-84)gtG>gtA	p.V28V	Y_RNA_ENST00000365591.1_RNA|MIIP_ENST00000436478.2_Silent_p.V28V	NM_021933.3	NP_068752.2	Q5JXC2	MIIP_HUMAN	migration and invasion inhibitory protein	28										autonomic_ganglia(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						AGGATGCTGTGCGGCGGTCAG	0.667																																						dbGAP											0													30.0	30.0	30.0					1																	12081867		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022500	CCDS143.1	1p36.22	2009-07-09			ENSG00000116691	ENSG00000116691			25715	protein-coding gene	gene with protein product	"""invasion inhibitory protein 45"""	608772				15867349, 14617774	Standard	NM_021933		Approved	FLJ12438, IIp45	uc001ato.2	Q5JXC2	OTTHUMG00000002439	ENST00000235332.4:c.84G>A	1.37:g.12081867G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C0KL22|Q96HU6|Q9H839|Q9HA00	Silent	SNP	NULL	p.V28	ENST00000235332.4	37	c.84	CCDS143.1	1																																																																																			MIIP	-	NULL	ENSG00000116691		0.667	MIIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIIP	HGNC	protein_coding	OTTHUMT00000006941.1	8	0.00	0	G	NM_021933		12081867	12081867	+1	no_errors	ENST00000235332	ensembl	human	known	69_37n	silent	3	66.67	6	SNP	0.448	A
MIR622	693207	genome.wustl.edu	37	13	90883513	90883513	+	RNA	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr13:90883513G>T	ENST00000385123.1	+	0	78					NR_030754.1				microRNA 622																		GCTGAGGTTGGAGCTGCTGAG	0.527																																						dbGAP											0													46.0	44.0	45.0					13																	90883513		1568	3582	5150	-	-	-			0					13q31.3	2011-09-12		2008-12-18	ENSG00000207858	ENSG00000207858		"""ncRNAs / Micro RNAs"""	32878	non-coding RNA	RNA, micro				MIRN622			Standard	NR_030754		Approved	hsa-mir-622	uc021rld.1				13.37:g.90883513G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000385123.1	37	NULL		13																																																																																			MIR622	-	-	ENSG00000207858		0.527	MIR622-201	KNOWN	basic	miRNA	MIR622	HGNC	miRNA		85	0.00	0	G	NR_030754		90883513	90883513	+1	no_errors	ENST00000385123	ensembl	human	known	69_37n	rna	44	34.33	23	SNP	0.112	T
MUC5B	727897	genome.wustl.edu	37	11	1270826	1270826	+	Missense_Mutation	SNP	T	T	C	rs4046507	byFrequency	TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr11:1270826T>C	ENST00000529681.1	+	31	12774	c.12716T>C	c.(12715-12717)aTg>aCg	p.M4239T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M4242T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4239	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TCTACGGCCATGCCCTCCTCC	0.612																																						dbGAP											0													55.0	62.0	60.0					11																	1270826		1897	4071	5968	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12716T>C	11.37:g.1270826T>C	ENSP00000436812:p.Met4239Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.M4242T	ENST00000529681.1	37	c.12725	CCDS44515.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.170|2.170	-0.390171|-0.390171	0.04932|0.04932	.|.	.|.	ENSG00000117983|ENSG00000117983	ENST00000535652|ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	.|T;T	.|0.15603	.|2.41;2.6	1.98|1.98	-0.546|-0.546	0.11840|0.11840	.|.	.|.	.|.	.|.	.|.	T|T	0.07007|0.07007	0.0178|0.0178	N|N	0.02802|0.02802	-0.49|-0.49	0.09310|0.09310	N|N	1|1	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.33137|0.33137	-0.9880|-0.9880	6|9	0.17369|0.87932	T|D	0.5|0	.|.	7.5765|7.5765	0.27939|0.27939	0.0:0.6436:0.0:0.3564|0.0:0.6436:0.0:0.3564	.|.	.|4712;4242	.|A7Y9J9;E9PBJ0	.|.;.	R|T	19|4239;4242;4183;4089	.|ENSP00000436812:M4239T;ENSP00000415793:M4242T	ENSP00000439776:C19R|ENSP00000343037:M4183T	C|M	+|+	1|2	0|0	MUC5B|MUC5B	1227402|1227402	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.254000|-0.254000	0.08781|0.08781	-0.898000|-0.898000	0.03906|0.03906	-0.534000|-0.534000	0.04291|0.04291	TGC|ATG	MUC5B	-	NULL	ENSG00000117983		0.612	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	8	0.00	0	T	XM_001126093		1270826	1270826	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	0	100.00	3	SNP	0.000	C
MYO19	80179	genome.wustl.edu	37	17	34856996	34856997	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:34856996_34856997insA	ENST00000431794.3	-	22	2681_2682	c.2159_2160insT	c.(2158-2160)cagfs	p.Q720fs	MYO19_ENST00000268852.9_Frame_Shift_Ins_p.Q520fs	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	720	Myosin motor.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TGGCTGCTGCCTGAGTTAGGAC	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.2159_2160insT	17.37:g.34856996_34856997insA	ENSP00000409936:p.Gln720fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GS4|Q9H5X2	Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Q720fs	ENST00000431794.3	37	c.2160_2159	CCDS54112.1	17																																																																																			MYO19	-	smart_Myosin_head_motor_dom	ENSG00000141140		0.584	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO19	HGNC	protein_coding	OTTHUMT00000451074.1	71	0.00	0	-	NM_025109		34856996	34856997	-1	no_errors	ENST00000431794	ensembl	human	known	69_37n	frame_shift_ins	28	48.15	26	INS	0.000:0.000	A
NBPF9	400818	genome.wustl.edu	37	1	144827878	144827879	+	In_Frame_Ins	INS	-	-	AGG			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:144827878_144827879insAGG	ENST00000440491.2	+	15	1757_1758	c.1757_1758insAGG	c.(1756-1761)gaagaa>gaAGGagaa	p.586_587EE>EGE	NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000281815.8_Intron|NBPF9_ENST00000338347.4_In_Frame_Ins_p.513_513R>RR	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	0	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						agaaggaaagaagaaggggaag	0.426																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	Exception_encountered	1.37:g.144827878_144827879insAGG	ENSP00000390934:p.Glu586_Glu587insGly	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Ins	INS	pfam_NBPF_dom	p.587in_frame_insG	ENST00000440491.2	37	c.1757_1758		1																																																																																			NBPF9	-	NULL	ENSG00000168614		0.426	NBPF9-203	KNOWN	basic	protein_coding	NBPF9	HGNC	protein_coding		11	0.00	0	-	NM_001037675		144827878	144827879	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000375552	ensembl	human	known	69_37n	in_frame_ins	28	20.00	7	INS	0.025:0.025	AGG
NCF2	4688	genome.wustl.edu	37	1	183556064	183556064	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:183556064A>C	ENST00000367535.3	-	2	474	c.223T>G	c.(223-225)Ttc>Gtc	p.F75V	NCF2_ENST00000413720.1_Missense_Mutation_p.F75V|NCF2_ENST00000367536.1_Missense_Mutation_p.F75V|NCF2_ENST00000418089.1_Missense_Mutation_p.F75V	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	75					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	CCTCGTTGGAAGTAAGCCACT	0.512																																						dbGAP											0													202.0	168.0	179.0					1																	183556064		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.223T>G	1.37:g.183556064A>C	ENSP00000356505:p.Phe75Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_TPR-1,pfam_OPR_PB1,superfamily_SH3_domain,smart_TPR_repeat,smart_SH3_domain,smart_OPR_PB1,pfscan_SH3_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_p67phox,prints_SH3_domain	p.F75V	ENST00000367535.3	37	c.223	CCDS1356.1	1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.207901	0.79240	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535	T;T;T;T	0.60040	0.22;0.22;0.22;0.22	5.17	5.17	0.71159	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.77384	0.4122	M	0.83483	2.645	0.35248	D	0.778445	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.995;0.999;1.0	D	0.85863	0.1411	10	0.87932	D	0	-19.3218	14.2966	0.66318	1.0:0.0:0.0:0.0	.	75;75;75	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	V	75;103;75;75;75	ENSP00000356506:F75V;ENSP00000399294:F75V;ENSP00000407217:F75V;ENSP00000356505:F75V	ENSP00000356505:F75V	F	-	1	0	NCF2	181822687	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	6.678000	0.74508	2.073000	0.62155	0.459000	0.35465	TTC	NCF2	-	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000116701		0.512	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	HGNC	protein_coding	OTTHUMT00000085483.1	323	0.00	0	A	NM_000433		183556064	183556064	-1	no_errors	ENST00000367535	ensembl	human	known	69_37n	missense	299	20.69	78	SNP	1.000	C
NDNF	79625	genome.wustl.edu	37	4	121958353	121958353	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr4:121958353G>A	ENST00000379692.4	-	4	1299	c.773C>T	c.(772-774)cCt>cTt	p.P258L	NDNF_ENST00000506900.1_5'UTR	NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	258					cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						ATTATCAGAAGGAAATCCAAA	0.468																																						dbGAP											0													87.0	88.0	88.0					4																	121958353		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.773C>T	4.37:g.121958353G>A	ENSP00000369014:p.Pro258Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Q0|Q6UWE5|Q9H5P7	Missense_Mutation	SNP	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.P258L	ENST00000379692.4	37	c.773	CCDS3717.2	4	.	.	.	.	.	.	.	.	.	.	G	9.041	0.989768	0.18966	.	.	ENSG00000173376	ENST00000379692	.	.	.	5.92	5.05	0.67936	.	0.149155	0.64402	D	0.000007	T	0.55955	0.1953	L	0.51422	1.61	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.51124	-0.8745	9	0.27785	T	0.31	-10.3394	13.7679	0.63006	0.0:0.0:0.7001:0.2998	.	258	Q8TB73	NDNF_HUMAN	L	258	.	ENSP00000369014:P258L	P	-	2	0	NDNF	122177803	1.000000	0.71417	0.842000	0.33263	0.582000	0.36321	3.823000	0.55715	1.430000	0.47334	0.655000	0.94253	CCT	NDNF	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000173376		0.468	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNF	HGNC	protein_coding	OTTHUMT00000256532.2	183	0.00	0	G	NM_024574		121958353	121958353	-1	no_errors	ENST00000379692	ensembl	human	known	69_37n	missense	110	14.73	19	SNP	0.994	A
NF1	4763	genome.wustl.edu	37	17	29496956	29496958	+	In_Frame_Del	DEL	ATA	ATA	-	rs112306990	byFrequency	TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	ATA	ATA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:29496956_29496958delATA	ENST00000358273.4	+	5	910_912	c.527_529delATA	c.(526-531)gatata>gta	p.176_177DI>V	NF1_ENST00000356175.3_In_Frame_Del_p.176_177DI>V|NF1_ENST00000431387.4_In_Frame_Del_p.176_177DI>V	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	176			D -> E (found in mismatch repair deficient cancer cells; also found in a cutaneous neurofibroma from a patient with neurofibromatosis; somatic mutation; dbSNP:rs112306990). {ECO:0000269|PubMed:10712197, ECO:0000269|PubMed:12522551, ECO:0000269|PubMed:15060124, ECO:0000269|PubMed:15146469, ECO:0000269|PubMed:22108604}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.D176E(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GATGTTCATGATATAGAATTGTT	0.296			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(4)|Substitution - Missense(2)	soft_tissue(8)|autonomic_ganglia(3)|central_nervous_system(2)|large_intestine(1)	GRCh37	CD000949|CM077302	NF1	D|M	rs112306990																																			-	-	-	SO:0001651	inframe_deletion	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.527_529delATA	17.37:g.29496956_29496958delATA	ENSP00000351015:p.Asp176_Ile177delinsVal	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	In_Frame_Del	DEL	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.DI176in_frame_delV	ENST00000358273.4	37	c.527_529	CCDS42292.1	17																																																																																			NF1	-	NULL	ENSG00000196712		0.296	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	111	0.00	0	ATA	NM_000267		29496956	29496958	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	in_frame_del	62	28.89	26	DEL	1.000:1.000:1.000	-
NF1	4763	genome.wustl.edu	37	17	29496963	29496964	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:29496963_29496964delAT	ENST00000358273.4	+	5	917_918	c.534_535delAT	c.(532-537)gaattgfs	p.EL178fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.EL178fs|NF1_ENST00000431387.4_Frame_Shift_Del_p.EL178fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	178					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.E178_D186del(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATGATATAGAATTGTTACAGTA	0.282			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(4)|Deletion - In frame(1)	soft_tissue(8)|autonomic_ganglia(3)|central_nervous_system(2)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.534_535delAT	17.37:g.29496963_29496964delAT	ENSP00000351015:p.Glu178fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.E178fs	ENST00000358273.4	37	c.534_535	CCDS42292.1	17																																																																																			NF1	-	NULL	ENSG00000196712		0.282	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	106	0.00	0	AT	NM_000267		29496963	29496964	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	frame_shift_del	58	31.76	27	DEL	1.000:1.000	-
NLRP11	204801	genome.wustl.edu	37	19	56320649	56320649	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr19:56320649T>C	ENST00000589093.1	-	3	1420	c.1327A>G	c.(1327-1329)Aaa>Gaa	p.K443E	NLRP11_ENST00000589824.2_Missense_Mutation_p.K443E|NLRP11_ENST00000592953.1_Missense_Mutation_p.K344E|NLRP11_ENST00000360133.3_Missense_Mutation_p.K443E|NLRP11_ENST00000443188.1_Missense_Mutation_p.K443E			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	443	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TAACGGTCTTTATGAGTGTTG	0.473																																						dbGAP											0													60.0	60.0	60.0					19																	56320649		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.1327A>G	19.37:g.56320649T>C	ENSP00000466285:p.Lys443Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.K443E	ENST00000589093.1	37	c.1327	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.974843	0.00452	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.73152	-0.72;-0.65	2.2	-4.4	0.03600	.	.	.	.	.	T	0.32071	0.0817	N	0.01874	-0.695	0.09310	N	1	B;B	0.22276	0.014;0.067	B;B	0.20955	0.018;0.032	T	0.28776	-1.0033	9	0.02654	T	1	.	5.3172	0.15862	0.0:0.2583:0.1719:0.5698	.	443;443	P59045;P59045-2	NAL11_HUMAN;.	E	443	ENSP00000409898:K443E;ENSP00000353251:K443E	ENSP00000353251:K443E	K	-	1	0	NLRP11	61012461	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.190000	0.09615	-1.787000	0.01268	-0.899000	0.02877	AAA	NLRP11	-	NULL	ENSG00000179873		0.473	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1	364	0.00	0	T	NM_145007		56320649	56320649	-1	no_errors	ENST00000443188	ensembl	human	known	69_37n	missense	175	38.81	111	SNP	0.000	C
NRXN3	9369	genome.wustl.edu	37	14	79423678	79423678	+	Nonsense_Mutation	SNP	T	T	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr14:79423678T>G	ENST00000554719.1	+	8	1741	c.1250T>G	c.(1249-1251)tTa>tGa	p.L417*	NRXN3_ENST00000335750.5_Nonsense_Mutation_p.L417*	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	187					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AGCCTTAAGTTAACCGTGGAT	0.493																																						dbGAP											0													297.0	258.0	271.0					14																	79423678		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1250T>G	14.37:g.79423678T>G	ENSP00000451648:p.Leu417*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Nonsense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.L779*	ENST00000554719.1	37	c.2336	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	T	43	10.241585	0.99367	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	.	.	.	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1617	0.81721	0.0:0.0:0.0:1.0	.	.	.	.	X	790;779;417;417	.	.	L	+	2	0	NRXN3	78493431	0.995000	0.38212	0.920000	0.36463	0.933000	0.57130	7.997000	0.88414	2.275000	0.75901	0.528000	0.53228	TTA	NRXN3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000021645		0.493	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413787.1	209	0.00	0	T	NM_001105250		79423678	79423678	+1	no_errors	ENST00000554738	ensembl	human	known	69_37n	nonsense	143	32.55	69	SNP	0.956	G
ODF2	4957	genome.wustl.edu	37	9	131246284	131246284	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr9:131246284A>G	ENST00000434106.3	+	11	1418	c.1055A>G	c.(1054-1056)cAg>cGg	p.Q352R	ODF2_ENST00000604420.1_Missense_Mutation_p.Q352R|ODF2_ENST00000372807.5_Missense_Mutation_p.Q347R|ODF2_ENST00000351030.3_Missense_Mutation_p.Q347R|ODF2_ENST00000444119.2_Missense_Mutation_p.Q328R|ODF2_ENST00000372814.3_Missense_Mutation_p.Q396R|ODF2_ENST00000448249.3_Missense_Mutation_p.Q271R|ODF2_ENST00000393527.3_Missense_Mutation_p.Q328R|ODF2_ENST00000372791.3_Missense_Mutation_p.Q333R|ODF2_ENST00000546203.1_Missense_Mutation_p.Q333R|ODF2_ENST00000393533.2_Missense_Mutation_p.Q352R	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	352					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						TTGCAGGCACAGCTTCGGTCC	0.532																																						dbGAP											0													110.0	101.0	104.0					9																	131246284		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1055A>G	9.37:g.131246284A>G	ENSP00000403453:p.Gln352Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	NULL	p.Q352R	ENST00000434106.3	37	c.1055	CCDS56588.1	9	.	.	.	.	.	.	.	.	.	.	A	22.6	4.312961	0.81358	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.55;1.02;1.02;1.02	5.8	5.8	0.92144	.	0.104295	0.64402	D	0.000004	T	0.57814	0.2079	L	0.55481	1.735	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.998;1.0;1.0;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D;D	0.71414	0.943;0.973;0.973;0.962;0.96;0.973;0.96;0.943;0.95;0.95	T	0.52946	-0.8507	10	0.27785	T	0.31	-26.9906	14.9623	0.71166	1.0:0.0:0.0:0.0	.	333;347;271;286;352;396;347;333;352;328	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;.;ODFP2_HUMAN;.	R	352;396;347;352;328;271;333;333	ENSP00000377166:Q352R;ENSP00000361901:Q396R;ENSP00000342581:Q347R;ENSP00000361882:Q352R;ENSP00000307781:Q328R;ENSP00000396687:Q271R;ENSP00000437579:Q333R;ENSP00000361877:Q333R	ENSP00000307781:Q328R	Q	+	2	0	ODF2	130286105	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.783000	0.68982	2.219000	0.72066	0.533000	0.62120	CAG	ODF2	-	NULL	ENSG00000136811		0.532	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3	113	0.88	1	A			131246284	131246284	+1	no_errors	ENST00000372796	ensembl	human	known	69_37n	missense	33	61.18	52	SNP	1.000	G
OR52K2	119774	genome.wustl.edu	37	11	4471319	4471319	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr11:4471319C>G	ENST00000325719.4	+	1	795	c.750C>G	c.(748-750)atC>atG	p.I250M		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		TAGGTGCCATCTTAGCCTTCT	0.498																																						dbGAP											0													245.0	216.0	226.0					11																	4471319		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.750C>G	11.37:g.4471319C>G	ENSP00000318956:p.Ile250Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUY8|B2RP35|Q6IFK4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I250M	ENST00000325719.4	37	c.750	CCDS31351.1	11	.	.	.	.	.	.	.	.	.	.	C	10.37	1.331972	0.24167	.	.	ENSG00000181963	ENST00000325719	T	0.00220	8.52	4.16	0.389	0.16269	GPCR, rhodopsin-like superfamily (1);	0.133681	0.33753	N	0.004592	T	0.00328	0.0010	M	0.62266	1.93	0.22531	N	0.999013	D	0.63880	0.993	P	0.61533	0.89	T	0.49835	-0.8897	10	0.45353	T	0.12	.	8.0458	0.30549	0.0:0.6437:0.0:0.3563	.	250	Q8NGK3	O52K2_HUMAN	M	250	ENSP00000318956:I250M	ENSP00000318956:I250M	I	+	3	3	OR52K2	4427895	0.000000	0.05858	0.991000	0.47740	0.438000	0.31896	-0.426000	0.07008	0.185000	0.20105	0.586000	0.80456	ATC	OR52K2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181963		0.498	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K2	HGNC	protein_coding	OTTHUMT00000385844.1	2295	0.00	0	C	NM_001005172		4471319	4471319	+1	no_errors	ENST00000325719	ensembl	human	known	69_37n	missense	517	42.97	391	SNP	0.678	G
OR4X1	390113	genome.wustl.edu	37	11	48286093	48286093	+	Silent	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr11:48286093C>T	ENST00000320048.1	+	1	681	c.681C>T	c.(679-681)aaC>aaT	p.N227N		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						GAAGCCACAACTTGGAGGGGC	0.537																																						dbGAP											0													114.0	101.0	105.0					11																	48286093		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.681C>T	11.37:g.48286093C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF74	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N227	ENST00000320048.1	37	c.681	CCDS31487.1	11																																																																																			OR4X1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176567		0.537	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X1	HGNC	protein_coding	OTTHUMT00000383373.1	235	0.00	0	C	NM_001004726		48286093	48286093	+1	no_errors	ENST00000320048	ensembl	human	known	69_37n	silent	138	37.56	83	SNP	0.000	T
PACS1	55690	genome.wustl.edu	37	11	65998376	65998376	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr11:65998376A>T	ENST00000320580.4	+	13	1624	c.1591A>T	c.(1591-1593)Agc>Tgc	p.S531C	PACS1_ENST00000529757.1_Missense_Mutation_p.S67C	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	531					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						CAGTTCCGACAGCGAGCGCTC	0.607																																						dbGAP											0													47.0	44.0	45.0					11																	65998376		2199	4294	6493	-	-	-	SO:0001583	missense	0			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1591A>T	11.37:g.65998376A>T	ENSP00000316454:p.Ser531Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.S531C	ENST00000320580.4	37	c.1591	CCDS8129.1	11	.	.	.	.	.	.	.	.	.	.	A	16.35	3.098890	0.56183	.	.	ENSG00000175115	ENST00000320580;ENST00000529757	T;T	0.50001	1.79;0.76	4.49	4.49	0.54785	.	0.089181	0.85682	D	0.000000	T	0.61375	0.2342	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	P	0.61328	0.887	T	0.65467	-0.6161	10	0.66056	D	0.02	-22.0864	12.9181	0.58216	1.0:0.0:0.0:0.0	.	531	Q6VY07	PACS1_HUMAN	C	531;67	ENSP00000316454:S531C;ENSP00000432858:S67C	ENSP00000316454:S531C	S	+	1	0	PACS1	65754952	1.000000	0.71417	1.000000	0.80357	0.331000	0.28603	5.789000	0.69029	1.893000	0.54813	0.459000	0.35465	AGC	PACS1	-	NULL	ENSG00000175115		0.607	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACS1	HGNC	protein_coding	OTTHUMT00000391690.2	167	0.00	0	A	NM_018026		65998376	65998376	+1	no_errors	ENST00000320580	ensembl	human	known	69_37n	missense	122	24.22	39	SNP	1.000	T
PCDHAC1	56135	genome.wustl.edu	37	5	140306692	140306692	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr5:140306692delG	ENST00000253807.2	+	1	215	c.215delG	c.(214-216)agcfs	p.S72fs	PCDHAC1_ENST00000409700.3_Frame_Shift_Del_p.S72fs|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	72	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATCTACCCAGCGGCAATTTG	0.642																																						dbGAP											0													43.0	47.0	46.0					5																	140306692		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.215delG	5.37:g.140306692delG	ENSP00000253807:p.Ser72fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5F5|Q9Y5I5	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S72fs	ENST00000253807.2	37	c.215	CCDS4241.1	5																																																																																			PCDHAC1	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000248383		0.642	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	60	0.00	0	G	NM_018898		140306692	140306692	+1	no_errors	ENST00000253807	ensembl	human	known	69_37n	frame_shift_del	7	50.00	7	DEL	0.809	-
PCDHGB4	8641	genome.wustl.edu	37	5	140768682	140768682	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr5:140768682G>T	ENST00000519479.1	+	1	1231	c.1231G>T	c.(1231-1233)Gag>Tag	p.E411*	PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTAGACCGCGAGCAGAATCC	0.433																																						dbGAP											0													133.0	135.0	134.0					5																	140768682		1941	4139	6080	-	-	-	SO:0001587	stop_gained	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1231G>T	5.37:g.140768682G>T	ENSP00000428288:p.Glu411*	Somatic		WXS	Illumina GAIIx	Phase_IV	O15099|Q2M267|Q9UN64	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E411*	ENST00000519479.1	37	c.1231	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	21.5	4.164694	0.78339	.	.	ENSG00000253953	ENST00000519479	.	.	.	5.14	4.27	0.50696	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.6028	0.62029	0.0758:0.0:0.9242:0.0	.	.	.	.	X	411	.	ENSP00000428288:E411X	E	+	1	0	PCDHGB4	140748866	1.000000	0.71417	0.024000	0.17045	0.048000	0.14542	9.706000	0.98722	1.304000	0.44892	0.650000	0.86243	GAG	PCDHGB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253953		0.433	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	205	0.00	0	G	NM_003736		140768682	140768682	+1	no_errors	ENST00000519479	ensembl	human	known	69_37n	nonsense	36	40.00	24	SNP	0.992	T
PLEKHG3	26030	genome.wustl.edu	37	14	65207860	65207860	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr14:65207860A>G	ENST00000394691.1	+	16	1772	c.1625A>G	c.(1624-1626)gAg>gGg	p.E542G	PLEKHG3_ENST00000484731.2_Missense_Mutation_p.E47G|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.E75G|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.E486G			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	542							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GAAGTCCTGGAGACACAGCTT	0.602																																						dbGAP											0													96.0	99.0	98.0					14																	65207860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.1625A>G	14.37:g.65207860A>G	ENSP00000378183:p.Glu542Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E542G	ENST00000394691.1	37	c.1625		14	.	.	.	.	.	.	.	.	.	.	A	9.183	1.024018	0.19433	.	.	ENSG00000126822	ENST00000247226;ENST00000394691;ENST00000471182;ENST00000484731	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	5.76	4.56	0.56223	.	0.381500	0.24899	N	0.034715	T	0.34658	0.0905	M	0.67953	2.075	0.20764	N	0.999852	P;P;P;P	0.39903	0.675;0.675;0.568;0.694	B;B;B;B	0.39379	0.298;0.205;0.195;0.281	T	0.33803	-0.9854	10	0.46703	T	0.11	.	5.9336	0.19152	0.6416:0.154:0.0:0.2044	.	75;47;542;486	A1L390-2;G3V311;A1L390;A1L390-3	.;.;PKHG3_HUMAN;.	G	486;542;75;47	ENSP00000247226:E486G;ENSP00000378183:E542G;ENSP00000450945:E75G;ENSP00000450973:E47G	ENSP00000247226:E486G	E	+	2	0	PLEKHG3	64277613	0.795000	0.28851	0.003000	0.11579	0.144000	0.21451	1.528000	0.35985	0.865000	0.35603	0.528000	0.53228	GAG	PLEKHG3	-	NULL	ENSG00000126822		0.602	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	PLEKHG3	HGNC	protein_coding	OTTHUMT00000412028.1	24	0.00	0	A	NM_015549		65207860	65207860	+1	no_errors	ENST00000394691	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.388	G
PTCHD4	442213	genome.wustl.edu	37	6	47847116	47847116	+	Silent	SNP	T	T	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr6:47847116T>C	ENST00000339488.4	-	3	1497	c.1464A>G	c.(1462-1464)ggA>ggG	p.G488G		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	488						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TGATGTTGGCTCCGTCACTGA	0.418																																						dbGAP											0													77.0	70.0	72.0					6																	47847116		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1464A>G	6.37:g.47847116T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ29|B4DRK3|Q5T884	Silent	SNP	pfam_Patched,pfscan_SSD	p.G488	ENST00000339488.4	37	c.1464	CCDS34473.2	6																																																																																			PTCHD4	-	pfam_Patched	ENSG00000244694		0.418	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	78	0.00	0	T	NM_001013732		47847116	47847116	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	silent	92	42.50	68	SNP	0.969	C
PTPRN2	5799	genome.wustl.edu	37	7	157370811	157370811	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr7:157370811C>T	ENST00000389418.4	-	18	2527	c.2518G>A	c.(2518-2520)Gtg>Atg	p.V840M	PTPRN2_ENST00000389413.3_Missense_Mutation_p.V811M|PTPRN2_ENST00000409483.1_Missense_Mutation_p.V802M|PTPRN2_ENST00000404321.2_Missense_Mutation_p.V863M|PTPRN2_ENST00000389416.4_Missense_Mutation_p.V823M	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	840	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACGATCACCACGCAGCCGCTC	0.592																																						dbGAP											0													84.0	69.0	74.0					7																	157370811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2518G>A	7.37:g.157370811C>T	ENSP00000374069:p.Val840Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V863M	ENST00000389418.4	37	c.2587	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	C	18.46	3.627874	0.66901	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73	5.33	5.33	0.75918	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.149457	0.44285	D	0.000474	D	0.91287	0.7253	M	0.77103	2.36	0.54753	D	0.999985	D;D;D;D;D	0.89917	0.998;0.99;0.988;1.0;0.995	P;P;P;D;P	0.74348	0.693;0.69;0.563;0.983;0.594	D	0.91961	0.5579	10	0.66056	D	0.02	.	19.0335	0.92967	0.0:1.0:0.0:0.0	.	863;802;811;823;840	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	M	802;811;823;840;863	ENSP00000387114:V802M;ENSP00000374064:V811M;ENSP00000374067:V823M;ENSP00000374069:V840M;ENSP00000385464:V863M	ENSP00000374064:V811M	V	-	1	0	PTPRN2	157063572	1.000000	0.71417	0.134000	0.22075	0.102000	0.19082	5.771000	0.68881	2.488000	0.83962	0.655000	0.94253	GTG	PTPRN2	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000155093		0.592	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	36	0.00	0	C			157370811	157370811	-1	no_errors	ENST00000404321	ensembl	human	known	69_37n	missense	7	65.00	13	SNP	1.000	T
RASGEF1A	221002	genome.wustl.edu	37	10	43697381	43697381	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr10:43697381delA	ENST00000395809.1	-	4	2840	c.334delT	c.(334-336)tctfs	p.S112fs	RASGEF1A_ENST00000472864.1_5'UTR|RASGEF1A_ENST00000395810.1_Frame_Shift_Del_p.S112fs|RASGEF1A_ENST00000374459.1_Frame_Shift_Del_p.S120fs			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	112	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						GCTGAGAAAGACTTCAGCTTG	0.572																																						dbGAP											0													59.0	49.0	53.0					10																	43697381		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.334delT	10.37:g.43697381delA	ENSP00000379154:p.Ser112fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBF1	Frame_Shift_Del	DEL	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S112fs	ENST00000395809.1	37	c.334	CCDS7202.2	10																																																																																			RASGEF1A	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000198915		0.572	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	RASGEF1A	HGNC	protein_coding	OTTHUMT00000313989.1	10	0.00	0	A	NM_145313		43697381	43697381	-1	no_errors	ENST00000395809	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.986	-
RBL1	5933	genome.wustl.edu	37	20	35651110	35651110	+	Silent	SNP	T	T	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr20:35651110T>C	ENST00000373664.3	-	17	2568	c.2502A>G	c.(2500-2502)ctA>ctG	p.L834L	RBL1_ENST00000344359.3_Silent_p.L834L	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	834	Domain B.|Pocket; binds T and E1A.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				TGTCTTTCATTAGATCAGGAC	0.408																																						dbGAP											0													123.0	114.0	117.0					20																	35651110		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.2502A>G	20.37:g.35651110T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Silent	SNP	pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,pfam_Rb_C,superfamily_Cyclin-like,smart_Cyclin-like	p.L834	ENST00000373664.3	37	c.2502	CCDS13289.1	20																																																																																			RBL1	-	pfam_RB_B,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000080839		0.408	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL1	HGNC	protein_coding	OTTHUMT00000079067.2	100	0.00	0	T	NM_002895		35651110	35651110	-1	no_errors	ENST00000373664	ensembl	human	known	69_37n	silent	63	30.00	27	SNP	0.713	C
RCC1	1104	genome.wustl.edu	37	1	28856409	28856410	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:28856409_28856410insC	ENST00000373833.6	+	5	316_317	c.31_32insC	c.(31-33)tccfs	p.S11fs	RCC1_ENST00000373831.3_Frame_Shift_Ins_p.S11fs|RCC1_ENST00000398958.2_Frame_Shift_Ins_p.S11fs|RCC1_ENST00000373832.1_Frame_Shift_Ins_p.S11fs			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	11					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		TAAAAGAAGGTCCCCCCCAGCA	0.5																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.38dupC	1.37:g.28856416_28856416dupC	ENSP00000362939:p.Ser11fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16269|Q6NT97	Frame_Shift_Ins	INS	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.A14fs	ENST00000373833.6	37	c.31_32	CCDS323.1	1																																																																																			RCC1	-	NULL	ENSG00000180198		0.500	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RCC1	HGNC	protein_coding	OTTHUMT00000010323.3	22	0.00	0	-	NM_001269		28856409	28856410	+1	no_errors	ENST00000373831	ensembl	human	known	69_37n	frame_shift_ins	7	22.22	2	INS	0.985:0.987	C
RFPL3	10738	genome.wustl.edu	37	22	32756346	32756346	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr22:32756346G>A	ENST00000249007.4	+	2	686	c.481G>A	c.(481-483)Gag>Aag	p.E161K	RFPL3_ENST00000382088.3_Missense_Mutation_p.E132K|RFPL3S_ENST00000461833.1_5'Flank|RFPL3S_ENST00000382084.4_3'UTR|RFPL3_ENST00000397468.1_Missense_Mutation_p.E132K|RFPL3S_ENST00000400234.1_3'UTR	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	161	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						AGACCTTGCCGAGAGATTTGA	0.572																																						dbGAP											0													132.0	120.0	124.0					22																	32756346		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.481G>A	22.37:g.32756346G>A	ENSP00000249007:p.Glu161Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.E161K	ENST00000249007.4	37	c.481	CCDS43011.1	22	.	.	.	.	.	.	.	.	.	.	G	11.05	1.523639	0.27299	.	.	ENSG00000128276	ENST00000397468;ENST00000249007;ENST00000382088	T;T;T	0.15256	2.44;2.44;2.44	0.664	-0.628	0.11537	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.27169	0.0666	M	0.67397	2.05	0.09310	N	1	D	0.62365	0.991	P	0.60415	0.874	T	0.12477	-1.0546	9	0.46703	T	0.11	.	2.3774	0.04346	0.2738:0.3258:0.4004:0.0	.	161	O75679	RFPL3_HUMAN	K	132;161;132	ENSP00000380609:E132K;ENSP00000249007:E161K;ENSP00000371520:E132K	ENSP00000249007:E161K	E	+	1	0	RFPL3	31086346	0.000000	0.05858	0.003000	0.11579	0.012000	0.07955	-1.413000	0.02473	-0.224000	0.09928	0.194000	0.17425	GAG	RFPL3	-	superfamily_ConA-like_lec_gl,smart_PRY,pfscan_B30.2/SPRY	ENSG00000128276		0.572	RFPL3-001	KNOWN	basic|CCDS	protein_coding	RFPL3	HGNC	protein_coding	OTTHUMT00000075172.3	89	0.00	0	G	NM_006604		32756346	32756346	+1	no_errors	ENST00000249007	ensembl	human	known	69_37n	missense	122	25.45	42	SNP	0.011	A
RGAG1	57529	genome.wustl.edu	37	X	109697417	109697417	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chrX:109697417C>A	ENST00000465301.2	+	3	3818	c.3572C>A	c.(3571-3573)tCt>tAt	p.S1191Y	RGAG1_ENST00000540313.1_Missense_Mutation_p.S1191Y	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1191										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TTTCTGGTATCTCTTCATCTG	0.483																																						dbGAP											0													114.0	108.0	110.0					X																	109697417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3572C>A	X.37:g.109697417C>A	ENSP00000419786:p.Ser1191Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.S1191Y	ENST00000465301.2	37	c.3572	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691216	0.48097	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.66099	-0.19;-0.19	4.26	4.26	0.50523	.	0.000000	0.39341	N	0.001381	T	0.65943	0.2740	L	0.29908	0.895	0.34142	D	0.666456	D	0.89917	1.0	D	0.91635	0.999	T	0.71151	-0.4676	9	.	.	.	-7.8176	10.9798	0.47488	0.0:1.0:0.0:0.0	.	1191	Q8NET4	RGAG1_HUMAN	Y	1191;1191;752	ENSP00000419786:S1191Y;ENSP00000441452:S1191Y	.	S	+	2	0	RGAG1	109584073	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.018000	0.49625	2.356000	0.79943	0.600000	0.82982	TCT	RGAG1	-	NULL	ENSG00000243978		0.483	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	511	0.00	0	C	NM_020769		109697417	109697417	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	202	34.63	107	SNP	1.000	A
SELE	6401	genome.wustl.edu	37	1	169702097	169702097	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:169702097G>C	ENST00000333360.7	-	3	219	c.80C>G	c.(79-81)tCc>tGc	p.S27C	SELE_ENST00000367781.4_Missense_Mutation_p.S27C|SELE_ENST00000367782.4_Missense_Mutation_p.S27C|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367780.4_Missense_Mutation_p.S27C|SELE_ENST00000367774.1_Missense_Mutation_p.S27C|SELE_ENST00000367779.4_Missense_Mutation_p.S27C|SELE_ENST00000367777.1_Missense_Mutation_p.S27C|SELE_ENST00000367775.1_Missense_Mutation_p.S27C|SELE_ENST00000367776.1_Missense_Mutation_p.S27C	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	27	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	AGCTTCCGTGGAGGTGTTGTA	0.418																																						dbGAP											0													111.0	104.0	107.0					1																	169702097		2203	4300	6503	-	-	-	SO:0001583	missense	0			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.80C>G	1.37:g.169702097G>C	ENSP00000331736:p.Ser27Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRD6|P16111	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,pfam_EGF-like_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_EGF-like,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.S27C	ENST00000333360.7	37	c.80	CCDS1283.1	1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772865	0.90108	.	.	ENSG00000007908	ENST00000367781;ENST00000367782;ENST00000367780;ENST00000367779;ENST00000333360;ENST00000367777;ENST00000367775;ENST00000367776;ENST00000367774	T;T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	5.58	5.58	0.84498	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.42294	D	0.000740	T	0.63438	0.2511	H	0.97732	4.065	0.50171	D	0.999854	D	0.89917	1.0	D	0.97110	1.0	T	0.77621	-0.2519	10	0.87932	D	0	-28.9607	18.1479	0.89663	0.0:0.0:1.0:0.0	.	27	P16581	LYAM2_HUMAN	C	27	ENSP00000356755:S27C;ENSP00000356756:S27C;ENSP00000356754:S27C;ENSP00000356753:S27C;ENSP00000331736:S27C;ENSP00000356751:S27C;ENSP00000356749:S27C;ENSP00000356750:S27C;ENSP00000356748:S27C	ENSP00000331736:S27C	S	-	2	0	SELE	167968721	1.000000	0.71417	0.072000	0.20136	0.701000	0.40568	6.121000	0.71602	2.604000	0.88044	0.655000	0.94253	TCC	SELE	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000007908		0.418	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELE	HGNC	protein_coding	OTTHUMT00000084333.1	129	0.00	0	G	NM_000450		169702097	169702097	-1	no_errors	ENST00000333360	ensembl	human	known	69_37n	missense	130	17.72	28	SNP	0.843	C
RGS1	5996	genome.wustl.edu	37	1	192548335	192548335	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:192548335T>G	ENST00000367459.3	+	5	579	c.513T>G	c.(511-513)ttT>ttG	p.F171L		NM_002922.3	NP_002913.3	Q08116	RGS1_HUMAN	regulator of G-protein signaling 1	171	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|immune response (GO:0006955)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			kidney(8)|large_intestine(1)|lung(13)	22		Breast(1374;0.188)				CCACGTGTTTTGATGAAGCAC	0.358																																						dbGAP											0													82.0	86.0	85.0					1																	192548335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF493925	CCDS1375.2	1q31	2008-02-05	2007-08-14		ENSG00000090104	ENSG00000090104		"""Regulators of G-protein signaling"""	9991	protein-coding gene	gene with protein product		600323	"""regulator of G-protein signalling 1"""	IER1		8241276, 8602223	Standard	NM_002922		Approved	1R20, IR20, BL34	uc001gsi.1	Q08116	OTTHUMG00000035598	ENST00000367459.3:c.513T>G	1.37:g.192548335T>G	ENSP00000356429:p.Phe171Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDM9|B4DZY0|Q07918|Q9H1W2	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,prints_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.F171L	ENST00000367459.3	37	c.513	CCDS1375.2	1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459718	0.63401	.	.	ENSG00000090104	ENST00000367459	T	0.58210	0.35	5.68	1.83	0.25207	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.70228	0.3200	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.67891	-0.5553	10	0.48119	T	0.1	.	9.0212	0.36202	0.0:0.2358:0.0:0.7642	.	171	Q08116	RGS1_HUMAN	L	171	ENSP00000356429:F171L	ENSP00000356429:F171L	F	+	3	2	RGS1	190814958	0.998000	0.40836	0.994000	0.49952	0.546000	0.35178	0.386000	0.20702	0.106000	0.17784	0.482000	0.46254	TTT	RGS1	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	ENSG00000090104		0.358	RGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS1	HGNC	protein_coding	OTTHUMT00000086391.1	368	0.00	0	T	NM_002922		192548335	192548335	+1	no_errors	ENST00000367459	ensembl	human	known	69_37n	missense	437	12.25	61	SNP	0.998	G
SF1	7536	genome.wustl.edu	37	11	64536769	64536769	+	Missense_Mutation	SNP	G	G	C	rs188599860		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr11:64536769G>C	ENST00000377390.3	-	7	1042	c.705C>G	c.(703-705)gaC>gaG	p.D235E	SF1_ENST00000227503.9_Missense_Mutation_p.D235E|SF1_ENST00000377394.3_Missense_Mutation_p.D235E|SF1_ENST00000433274.2_Missense_Mutation_p.D209E|SF1_ENST00000489544.1_5'UTR|SF1_ENST00000422298.2_Missense_Mutation_p.D120E|SF1_ENST00000334944.5_Missense_Mutation_p.D235E|SF1_ENST00000377387.1_Missense_Mutation_p.D360E	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	235					Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GATCATTCTGGTCCTCTGGAG	0.478																																						dbGAP											0													105.0	100.0	102.0					11																	64536769		2201	4297	6498	-	-	-	SO:0001583	missense	0			D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.705C>G	11.37:g.64536769G>C	ENSP00000366607:p.Asp235Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_KH_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_KH_dom_type_1	p.D235E	ENST00000377390.3	37	c.705	CCDS31599.1	11	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053259	0.55218	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000422298;ENST00000433274	T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02	6.03	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.22513	0.0543	N	0.05351	-0.065	0.51482	D	0.999926	B;B;B;B;B;B	0.14438	0.004;0.004;0.01;0.006;0.01;0.01	B;B;B;B;B;B	0.13407	0.002;0.003;0.005;0.002;0.005;0.009	T	0.06197	-1.0840	10	0.59425	D	0.04	.	8.2595	0.31777	0.1623:0.0:0.8377:0.0	.	120;235;235;235;235;360	B4DX42;Q15637-6;Q15637-4;Q15637;Q15637-2;Q15637-5	.;.;.;SF01_HUMAN;.;.	E	360;235;235;235;235;120;209	ENSP00000366604:D360E;ENSP00000366607:D235E;ENSP00000227503:D235E;ENSP00000366611:D235E;ENSP00000334414:D235E;ENSP00000413084:D120E;ENSP00000396793:D209E	ENSP00000227503:D235E	D	-	3	2	SF1	64293345	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.449000	0.44935	2.868000	0.98415	0.557000	0.71058	GAC	SF1	-	NULL	ENSG00000168066		0.478	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SF1	HGNC	protein_coding	OTTHUMT00000143242.1	86	0.00	0	G	NM_004630		64536769	64536769	-1	no_errors	ENST00000377390	ensembl	human	known	69_37n	missense	72	28.00	28	SNP	1.000	C
SF3B4	10262	genome.wustl.edu	37	1	149895561	149895562	+	Frame_Shift_Ins	INS	-	-	G	rs387907187|rs387907186		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:149895561_149895562insG	ENST00000271628.8	-	6	1731_1732	c.1147_1148insC	c.(1147-1149)catfs	p.H383fs		NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	383					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.H383fs*>43(1)|p.H383fs*>42(1)		endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			AGTGTATCCATGGGGGGGCATC	0.624																																						dbGAP											2	Deletion - Frameshift(1)|Insertion - Frameshift(1)	large_intestine(2)								12,4250		0,12,2119						4.5	1.0			21	13,8231		0,13,4109	no	frameshift	SF3B4	NM_005850.4		0,25,6228	A1A1,A1R,RR		0.1577,0.2816,0.1999				25,12481				-	-	-	SO:0001589	frameshift_variant	0			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.1148dupC	1.37:g.149895568_149895568dupG	ENSP00000271628:p.His383fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZ63	Frame_Shift_Ins	INS	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H383fs	ENST00000271628.8	37	c.1148_1147	CCDS941.1	1																																																																																			SF3B4	-	NULL	ENSG00000143368		0.624	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B4	HGNC	protein_coding	OTTHUMT00000033753.1	16	0.00	0	-	NM_005850		149895561	149895562	-1	no_errors	ENST00000271628	ensembl	human	known	69_37n	frame_shift_ins	8	27.27	3	INS	1.000:1.000	G
SLIT3	6586	genome.wustl.edu	37	5	168112908	168112909	+	Frame_Shift_Ins	INS	-	-	G	rs146512576	byFrequency	TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr5:168112908_168112909insG	ENST00000519560.1	-	31	3757_3758	c.3338_3339insC	c.(3337-3339)ccafs	p.P1113fs	SLIT3_ENST00000332966.8_Frame_Shift_Ins_p.P1120fs|SLIT3_ENST00000404867.3_Frame_Shift_Ins_p.P1113fs	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1113					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGACCATGGGTGGGGGGTGTTC	0.604																																					Ovarian(29;311 847 10864 17279 24903)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.3339dupC	5.37:g.168112914_168112914dupG	ENSP00000430333:p.Pro1113fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U9|J3KNP3|O95804|Q9UFH5	Frame_Shift_Ins	INS	pfam_EGF-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.P1114fs	ENST00000519560.1	37	c.3339_3338	CCDS4369.1	5																																																																																			SLIT3	-	NULL	ENSG00000184347		0.604	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	36	0.00	0	-	NM_003062		168112908	168112909	-1	no_errors	ENST00000519560	ensembl	human	known	69_37n	frame_shift_ins	20	13.04	3	INS	0.135:0.999	G
ZBTB37	84614	genome.wustl.edu	37	1	173834509	173834509	+	5'Flank	SNP	C	C	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:173834509C>G	ENST00000427304.1	+	0	0				GAS5_ENST00000364822.2_RNA|GAS5_ENST00000363840.1_RNA|GAS5_ENST00000385578.2_RNA|ZBTB37_ENST00000367704.1_5'Flank|ZBTB37_ENST00000432989.1_5'Flank|GAS5_ENST00000363859.1_RNA|GAS5_ENST00000365524.1_RNA|GAS5-AS1_ENST00000602767.1_RNA|GAS5_ENST00000364084.1_RNA|GAS5_ENST00000363146.1_RNA|SNORD78_ENST00000385582.1_RNA	NM_001122770.1	NP_001116242.1	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						TAAGATTAATCTCCATTTTCT	0.318																																						dbGAP											0													25.0	23.0	24.0					1																	173834509		874	1988	2862	-	-	-	SO:0001631	upstream_gene_variant	0			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274		1.37:g.173834509C>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TC80|Q96M87|Q9BQ88	RNA	SNP	-	NULL	ENST00000427304.1	37	NULL	CCDS44278.1	1																																																																																			SNORD79	-	-	ENSG00000200729		0.318	ZBTB37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD79	HGNC	protein_coding		42	0.00	0	C	NM_032522		173834509	173834509	-1	no_errors	ENST00000363859	ensembl	human	known	69_37n	rna	20	28.57	8	SNP	0.022	G
SNX32	254122	genome.wustl.edu	37	11	65617722	65617722	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr11:65617722G>C	ENST00000308342.6	+	4	779	c.354G>C	c.(352-354)aaG>aaC	p.K118N		NM_152760.2	NP_689973.2	Q86XE0	SNX32_HUMAN	sorting nexin 32	118	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				READ - Rectum adenocarcinoma(159;0.171)		AGTTTGCCAAGATGAAGCAGG	0.577																																						dbGAP											0													70.0	72.0	71.0					11																	65617722		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK055496	CCDS8113.2	11q13.1	2008-03-11	2008-03-11	2008-03-11	ENSG00000172803	ENSG00000172803		"""Sorting nexins"""	26423	protein-coding gene	gene with protein product			"""sorting nexin 6B"""	SNX6B		16782399	Standard	XM_005273871		Approved	FLJ30934	uc001ofr.3	Q86XE0	OTTHUMG00000128491	ENST00000308342.6:c.354G>C	11.37:g.65617722G>C	ENSP00000310620:p.Lys118Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW53|Q96NG4	Missense_Mutation	SNP	pfam_Vps5_C,pfam_Phox,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	p.K118N	ENST00000308342.6	37	c.354	CCDS8113.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.35|14.35	2.508485|2.508485	0.44660|0.44660	.|.	.|.	ENSG00000172803|ENSG00000172803	ENST00000536740|ENST00000308342	.|T	.|0.37058	.|1.22	4.56|4.56	0.685|0.685	0.18009|0.18009	.|Phox homologous domain (4);	.|1.297390	.|0.05193	.|N	.|0.503498	T|T	0.45935|0.45935	0.1367|0.1367	M|M	0.83312|0.83312	2.635|2.635	0.35776|0.35776	D|D	0.821253|0.821253	.|B	.|0.29909	.|0.261	.|B	.|0.35039	.|0.194	T|T	0.46803|0.46803	-0.9165|-0.9165	6|10	0.59425|0.87932	D|D	0.04|0	-11.0431|-11.0431	6.9608|6.9608	0.24595|0.24595	0.5913:0.0:0.4087:0.0|0.5913:0.0:0.4087:0.0	.|.	.|118	.|Q86XE0	.|SNX32_HUMAN	H|N	97|118	.|ENSP00000310620:K118N	ENSP00000440891:D97H|ENSP00000310620:K118N	D|K	+|+	1|3	0|2	SNX32|SNX32	65374298|65374298	1.000000|1.000000	0.71417|0.71417	0.918000|0.918000	0.36340|0.36340	0.990000|0.990000	0.78478|0.78478	0.745000|0.745000	0.26259|0.26259	-0.048000|-0.048000	0.13401|0.13401	-0.367000|-0.367000	0.07326|0.07326	GAT|AAG	SNX32	-	pfam_Phox,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	ENSG00000172803		0.577	SNX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX32	HGNC	protein_coding	OTTHUMT00000250295.3	105	0.00	0	G	NM_152760		65617722	65617722	+1	no_errors	ENST00000308342	ensembl	human	known	69_37n	missense	36	57.65	49	SNP	0.998	C
TCHH	7062	genome.wustl.edu	37	1	152084837	152084837	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:152084837G>T	ENST00000368804.1	-	2	855	c.856C>A	c.(856-858)Ctg>Atg	p.L286M		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	286					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCTCCTCAGCTCTTGCCGC	0.622																																						dbGAP											0													73.0	83.0	80.0					1																	152084837		2131	4252	6383	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.856C>A	1.37:g.152084837G>T	ENSP00000357794:p.Leu286Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.L286M	ENST00000368804.1	37	c.856	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	G	9.514	1.106596	0.20714	.	.	ENSG00000159450	ENST00000368804	T	0.05025	3.51	4.27	2.23	0.28157	.	.	.	.	.	T	0.02494	0.0076	N	0.08118	0	0.09310	N	1	D	0.61080	0.989	P	0.53809	0.735	T	0.51196	-0.8736	9	0.35671	T	0.21	.	12.122	0.53897	0.0:0.3293:0.6706:0.0	.	286	Q07283	TRHY_HUMAN	M	286	ENSP00000357794:L286M	ENSP00000357794:L286M	L	-	1	2	TCHH	150351461	0.021000	0.18746	0.001000	0.08648	0.093000	0.18481	0.627000	0.24506	0.976000	0.38417	-0.533000	0.04299	CTG	TCHH	-	NULL	ENSG00000159450		0.622	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	115	0.00	0	G	NM_007113		152084837	152084837	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	47	46.59	41	SNP	0.011	T
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	125	0.00	0	C	NM_000546		7578406	7578406	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	35	61.11	55	SNP	1.000	T
TROAP	10024	genome.wustl.edu	37	12	49717812	49717812	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr12:49717812C>T	ENST00000257909.3	+	3	405	c.329C>T	c.(328-330)gCc>gTc	p.A110V	TROAP_ENST00000551245.1_Missense_Mutation_p.A110V|TROAP_ENST00000548311.1_Missense_Mutation_p.A110V|TROAP_ENST00000549275.1_Intron|TROAP_ENST00000550709.1_Missense_Mutation_p.A110V|TROAP_ENST00000547923.1_5'Flank|TROAP_ENST00000549534.1_3'UTR|RP11-161H23.9_ENST00000553259.1_RNA|TROAP_ENST00000380327.5_Missense_Mutation_p.A110V	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	110					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						GGGCCCCCTGCCCAGACAGGT	0.577																																						dbGAP											0													61.0	63.0	62.0					12																	49717812		2203	4300	6503	-	-	-	SO:0001583	missense	0			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.329C>T	12.37:g.49717812C>T	ENSP00000257909:p.Ala110Val	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	NULL	p.A110V	ENST00000257909.3	37	c.329	CCDS8784.1	12	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177866	0.57692	.	.	ENSG00000135451	ENST00000551245;ENST00000380327;ENST00000548311;ENST00000550709;ENST00000257909;ENST00000547807;ENST00000551567	T;T;T	0.25414	1.8;1.8;1.8	5.77	1.81	0.25067	.	0.613992	0.15240	N	0.272906	T	0.15046	0.0363	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.22480	0.07;0.029;0.07;0.029	B;B;B;B	0.21151	0.033;0.023;0.033;0.023	T	0.21109	-1.0255	10	0.62326	D	0.03	0.014	4.8499	0.13531	0.0:0.581:0.1534:0.2656	.	110;110;110;110	F8W130;Q12815;Q6PJU7;F8VSF9	.;TROAP_HUMAN;.;.	V	110	ENSP00000447509:A110V;ENSP00000257909:A110V;ENSP00000446646:A110V	ENSP00000257909:A110V	A	+	2	0	TROAP	48004079	0.000000	0.05858	0.691000	0.30163	0.832000	0.47134	0.232000	0.17891	0.058000	0.16222	-0.176000	0.13171	GCC	TROAP	-	NULL	ENSG00000135451		0.577	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROAP	HGNC	protein_coding	OTTHUMT00000404300.1	148	0.00	0	C	NM_005480		49717812	49717812	+1	no_errors	ENST00000257909	ensembl	human	known	69_37n	missense	34	65.31	64	SNP	0.007	T
TSR1	55720	genome.wustl.edu	37	17	2239717	2239717	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:2239717G>T	ENST00000301364.5	-	1	1084	c.5C>A	c.(4-6)gCg>gAg	p.A2E	SGSM2_ENST00000574563.1_5'Flank|TSR1_ENST00000576112.2_Missense_Mutation_p.A2E|SGSM2_ENST00000426855.2_5'Flank|SGSM2_ENST00000268989.3_5'Flank	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	2					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						GCGGTGGGCCGCCATGCCGCA	0.692																																						dbGAP											0													52.0	57.0	55.0					17																	2239717		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.5C>A	17.37:g.2239717G>T	ENSP00000301364:p.Ala2Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	pfam_BMS1_TSR1_C,pfam_AARP2CN,superfamily_Transl_elong_init/rib_B-barrel,smart_AARP2CN	p.A2E	ENST00000301364.5	37	c.5	CCDS32525.1	17	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113980	0.56398	.	.	ENSG00000167721	ENST00000301364	T	0.44881	0.91	5.32	5.32	0.75619	.	0.123204	0.56097	D	0.000039	T	0.58708	0.2141	L	0.55743	1.74	0.53005	D	0.99996	D	0.71674	0.998	D	0.65874	0.939	T	0.56805	-0.7918	10	0.51188	T	0.08	-11.1985	16.5466	0.84448	0.0:0.0:1.0:0.0	.	2	Q2NL82	TSR1_HUMAN	E	2	ENSP00000301364:A2E	ENSP00000301364:A2E	A	-	2	0	TSR1	2186467	1.000000	0.71417	0.993000	0.49108	0.029000	0.11900	3.228000	0.51270	2.773000	0.95371	0.655000	0.94253	GCG	TSR1	-	NULL	ENSG00000167721		0.692	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR1	HGNC	protein_coding	OTTHUMT00000438180.2	12	0.00	0	G	NM_018128		2239717	2239717	-1	no_errors	ENST00000301364	ensembl	human	known	69_37n	missense	0	100.00	7	SNP	0.998	T
TRPV2	51393	genome.wustl.edu	37	17	16326990	16326990	+	Missense_Mutation	SNP	C	C	A	rs536622113		TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:16326990C>A	ENST00000338560.7	+	5	1232	c.833C>A	c.(832-834)gCc>gAc	p.A278D	TRPV2_ENST00000577397.1_Intron	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	278	Required for interaction with SLC50A1. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CAAGCTGGGGCCCGCCTCTGC	0.602																																						dbGAP											0													70.0	67.0	68.0					17																	16326990		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.833C>A	17.37:g.16326990C>A	ENSP00000342222:p.Ala278Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	p.A278D	ENST00000338560.7	37	c.833	CCDS32576.1	17	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884354	0.33255	.	.	ENSG00000187688	ENST00000338560	T	0.78126	-1.15	6.17	3.11	0.35812	Ankyrin repeat-containing domain (3);	0.301298	0.41097	D	0.000952	T	0.79667	0.4485	M	0.91663	3.23	0.21020	N	0.999802	B	0.28324	0.207	B	0.31337	0.128	T	0.72414	-0.4301	10	0.51188	T	0.08	0.0	6.2726	0.20963	0.0:0.6074:0.1253:0.2673	.	278	Q9Y5S1	TRPV2_HUMAN	D	278	ENSP00000342222:A278D	ENSP00000342222:A278D	A	+	2	0	TRPV2	16267715	0.033000	0.19621	0.005000	0.12908	0.004000	0.04260	0.451000	0.21779	0.478000	0.27488	0.655000	0.94253	GCC	TRPV2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	ENSG00000187688		0.602	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	HGNC	protein_coding	OTTHUMT00000130464.2	89	0.00	0	C	NM_016113		16326990	16326990	+1	no_errors	ENST00000338560	ensembl	human	known	69_37n	missense	12	55.56	15	SNP	0.025	A
TTN	7273	genome.wustl.edu	37	2	179640141	179640141	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr2:179640141C>A	ENST00000591111.1	-	28	6674	c.6450G>T	c.(6448-6450)atG>atT	p.M2150I	TTN_ENST00000342992.6_Missense_Mutation_p.M2150I|TTN_ENST00000360870.5_Missense_Mutation_p.M2150I|TTN-AS1_ENST00000584485.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.M2150I|TTN_ENST00000342175.6_Missense_Mutation_p.M2104I|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.M2104I|TTN_ENST00000460472.2_Missense_Mutation_p.M2104I|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12479	Ig-like 10.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCTTTTACCATGATGCTGG	0.443																																						dbGAP											0													105.0	98.0	101.0					2																	179640141		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6450G>T	2.37:g.179640141C>A	ENSP00000465570:p.Met2150Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.M2150I	ENST00000591111.1	37	c.6450		2	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014416	0.35511	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.27	5.27	0.74061	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69762	0.3147	N	0.25144	0.715	0.46260	D	0.998956	D;D;D;D;D	0.71674	0.985;0.985;0.985;0.985;0.998	D;D;D;D;D	0.78314	0.977;0.977;0.977;0.977;0.991	T	0.74518	-0.3639	9	0.87932	D	0	.	18.8847	0.92372	0.0:1.0:0.0:0.0	.	2104;2104;2104;2150;2150	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	I	2150;2104;2104;2104;2104;2150	ENSP00000343764:M2150I;ENSP00000434586:M2104I;ENSP00000340554:M2104I;ENSP00000352154:M2104I;ENSP00000354117:M2150I	ENSP00000340554:M2104I	M	-	3	0	TTN	179348386	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.792000	0.85828	2.468000	0.83385	0.655000	0.94253	ATG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like	ENSG00000155657		0.443	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	221	0.45	1	C	NM_133378		179640141	179640141	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	258	22.69	76	SNP	1.000	A
USP1	7398	genome.wustl.edu	37	1	62910521	62910521	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr1:62910521A>G	ENST00000339950.4	+	6	1485	c.670A>G	c.(670-672)Aaa>Gaa	p.K224E	USP1_ENST00000371146.1_Missense_Mutation_p.K224E	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	224	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		AGAAGAAGTAAAAAATGTGGC	0.353																																					Ovarian(122;1846 2315 3982 19504)	dbGAP											0													71.0	77.0	75.0					1																	62910521		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.670A>G	1.37:g.62910521A>G	ENSP00000343526:p.Lys224Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.K224E	ENST00000339950.4	37	c.670	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	A	8.613	0.889522	0.17540	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.18016	2.24;2.24	5.5	4.37	0.52481	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.546194	0.19974	N	0.101918	T	0.11793	0.0287	L	0.29908	0.895	0.25482	N	0.98773	B	0.22146	0.065	B	0.21151	0.033	T	0.29088	-1.0023	10	0.10902	T	0.67	-10.0637	11.4861	0.50354	0.9301:0.0:0.0699:0.0	.	224	O94782	UBP1_HUMAN	E	224	ENSP00000360188:K224E;ENSP00000343526:K224E	ENSP00000343526:K224E	K	+	1	0	USP1	62683109	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.899000	0.56288	1.092000	0.41356	0.528000	0.53228	AAA	USP1	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000162607		0.353	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	98	0.00	0	A	NM_001017415		62910521	62910521	+1	no_errors	ENST00000339950	ensembl	human	known	69_37n	missense	83	31.40	38	SNP	0.954	G
WSCD1	23302	genome.wustl.edu	37	17	6023829	6023829	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr17:6023829G>C	ENST00000574946.1	+	9	1966	c.1576G>C	c.(1576-1578)Ggc>Cgc	p.G526R	WSCD1_ENST00000574232.1_Missense_Mutation_p.G526R|WSCD1_ENST00000317744.5_Missense_Mutation_p.G526R|WSCD1_ENST00000573634.1_Missense_Mutation_p.G410R|WSCD1_ENST00000539421.1_Missense_Mutation_p.G526R			Q658N2	WSCD1_HUMAN	WSC domain containing 1	526						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CAACAAGGAGGGCAGCTTCCG	0.652																																						dbGAP											0													64.0	64.0	64.0					17																	6023829		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1576G>C	17.37:g.6023829G>C	ENSP00000460825:p.Gly526Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	pfam_WSC_carb-bd,pfam_Sulfotransferase_dom,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.G526R	ENST00000574946.1	37	c.1576	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	G	29.2	4.987321	0.93106	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.34667	1.35;1.35	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67277	-0.5711	10	0.54805	T	0.06	-41.8131	16.9738	0.86308	0.0:0.0:1.0:0.0	.	526	Q658N2	WSCD1_HUMAN	R	526	ENSP00000323087:G526R;ENSP00000446032:G526R	ENSP00000323087:G526R	G	+	1	0	WSCD1	5964553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.438000	0.97539	2.606000	0.88127	0.655000	0.94253	GGC	WSCD1	-	NULL	ENSG00000179314		0.652	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	HGNC	protein_coding	OTTHUMT00000438965.4	63	0.00	0	G	NM_015253		6023829	6023829	+1	no_errors	ENST00000317744	ensembl	human	known	69_37n	missense	6	68.42	13	SNP	1.000	C
XPOT	11260	genome.wustl.edu	37	12	64815088	64815088	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr12:64815088G>C	ENST00000332707.5	+	9	1446	c.917G>C	c.(916-918)tGg>tCg	p.W306S		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	306	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		ATAGTTAGTTGGAGTAAATTA	0.373																																						dbGAP											0													120.0	123.0	122.0					12																	64815088		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.917G>C	12.37:g.64815088G>C	ENSP00000327821:p.Trp306Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.W306S	ENST00000332707.5	37	c.917	CCDS31852.1	12	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533123	0.27387	.	.	ENSG00000184575	ENST00000332707	T	0.23754	1.89	4.92	4.92	0.64577	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	L	0.60455	1.87	0.80722	D	1	P	0.52842	0.956	B	0.44315	0.446	T	0.07654	-1.0761	9	.	.	.	.	19.0104	0.92871	0.0:0.0:1.0:0.0	.	306	O43592	XPOT_HUMAN	S	306	ENSP00000327821:W306S	.	W	+	2	0	XPOT	63101355	1.000000	0.71417	1.000000	0.80357	0.131000	0.20780	7.598000	0.82745	2.664000	0.90586	0.655000	0.94253	TGG	XPOT	-	superfamily_ARM-type_fold	ENSG00000184575		0.373	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPOT	HGNC	protein_coding	OTTHUMT00000401122.1	171	0.00	0	G	NM_007235		64815088	64815088	+1	no_errors	ENST00000332707	ensembl	human	known	69_37n	missense	63	57.14	84	SNP	1.000	C
ZNF224	7767	genome.wustl.edu	37	19	44611903	44611903	+	Silent	SNP	C	C	T			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr19:44611903C>T	ENST00000336976.6	+	6	1844	c.1590C>T	c.(1588-1590)caC>caT	p.H530H	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	530					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				TTGATATGCACCAGAAGGTCC	0.438																																						dbGAP											0													100.0	97.0	98.0					19																	44611903		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.1590C>T	19.37:g.44611903C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H530	ENST00000336976.6	37	c.1590	CCDS33046.1	19																																																																																			ZNF224	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267680		0.438	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF224	HGNC	protein_coding	OTTHUMT00000460477.1	370	0.00	0	C	NM_013398		44611903	44611903	+1	no_errors	ENST00000336976	ensembl	human	known	69_37n	silent	254	32.98	125	SNP	0.125	T
ZNF718	255403	genome.wustl.edu	37	4	155760	155760	+	lincRNA	SNP	G	G	A			TCGA-AN-A0AL-01A-11W-A019-09	TCGA-AN-A0AL-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	47849ee3-b59e-4ccf-a261-65f7e252b885	2f79e4ef-5112-4d70-8320-ca2148b47621	g.chr4:155760G>A	ENST00000510175.1	+	0	1195							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		TAAACAATGTGGCAAAGCCTT	0.348																																						dbGAP											0													31.0	35.0	34.0					4																	155760		2105	4261	6366	-	-	-			0			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155760G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXZ4|Q3SXZ5	RNA	SNP	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			ZNF718	-	-	ENSG00000250312		0.348	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	HGNC	lincRNA	OTTHUMT00000357865.3	139	0.00	0	G	NM_001039127		155760	155760	+1	no_errors	ENST00000400172	ensembl	human	known	69_37n	rna	29	69.47	66	SNP	1.000	A
