#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCY8	114	genome.wustl.edu	37	8	131826440	131826440	+	Silent	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:131826440G>T	ENST00000286355.5	-	14	4880	c.2788C>A	c.(2788-2790)Cga>Aga	p.R930R	ADCY8_ENST00000377928.3_Silent_p.R799R	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	930					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.R930*(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCCTGTACTCGCCAAAGGAAG	0.512										HNSCC(32;0.087)																												dbGAP											1	Substitution - Nonsense(1)	prostate(1)											161.0	127.0	139.0					8																	131826440		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2788C>A	8.37:g.131826440G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R930	ENST00000286355.5	37	c.2788	CCDS6363.1	8																																																																																			ADCY8	-	NULL	ENSG00000155897		0.512	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	127	0.00	0	G			131826440	131826440	-1	no_errors	ENST00000286355	ensembl	human	known	69_37n	silent	256	18.21	57	SNP	1.000	T
AFF2	2334	genome.wustl.edu	37	X	148037136	148037136	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:148037136G>T	ENST00000370460.2	+	11	2040	c.1561G>T	c.(1561-1563)Gag>Tag	p.E521*	AFF2_ENST00000370457.5_Nonsense_Mutation_p.E488*|AFF2_ENST00000342251.3_Nonsense_Mutation_p.E488*|AFF2_ENST00000286437.5_Nonsense_Mutation_p.E162*	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	521					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TCTGCAGCCTGAGCCACCCTC	0.423																																						dbGAP											0													100.0	107.0	105.0					X																	148037136		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1561G>T	X.37:g.148037136G>T	ENSP00000359489:p.Glu521*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Nonsense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E521*	ENST00000370460.2	37	c.1561	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	41	9.042270	0.99046	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	.	.	.	5.01	5.01	0.66863	.	0.059358	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	17.5021	0.87734	0.0:0.0:1.0:0.0	.	.	.	.	X	521;488;488;162	.	ENSP00000286437:E162X	E	+	1	0	AFF2	147844836	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	8.879000	0.92398	2.058000	0.61347	0.513000	0.50165	GAG	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.423	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	58	0.00	0	G	NM_002025		148037136	148037136	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	nonsense	26	40.91	18	SNP	1.000	T
AFF3	3899	genome.wustl.edu	37	2	100210682	100210682	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:100210682G>T	ENST00000409236.2	-	13	1553	c.1441C>A	c.(1441-1443)Cct>Act	p.P481T	AFF3_ENST00000356421.2_Missense_Mutation_p.P506T|AFF3_ENST00000409579.1_Missense_Mutation_p.P506T|AFF3_ENST00000317233.4_Missense_Mutation_p.P481T			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	481					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						ATCAGAATAGGAGGCTTGTGG	0.488																																						dbGAP											0													158.0	181.0	173.0					2																	100210682		2196	4294	6490	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1441C>A	2.37:g.100210682G>T	ENSP00000387207:p.Pro481Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P506T	ENST00000409236.2	37	c.1516	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	G	6.773	0.511461	0.12944	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.87	4.99	0.66335	.	0.289577	0.29389	N	0.012283	T	0.61148	0.2324	L	0.41415	1.275	0.21675	N	0.999593	P;B;B	0.43938	0.822;0.008;0.449	B;B;B	0.43413	0.419;0.016;0.202	T	0.54636	-0.8264	10	0.32370	T	0.25	.	14.4243	0.67204	0.0:0.1473:0.8527:0.0	.	634;481;506	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	T	481;506;506;481;481;634;506	ENSP00000317421:P481T;ENSP00000348793:P506T;ENSP00000386834:P506T;ENSP00000387207:P481T	ENSP00000317421:P481T	P	-	1	0	AFF3	99577114	0.978000	0.34361	0.181000	0.23098	0.980000	0.70556	2.107000	0.41844	1.481000	0.48307	0.655000	0.94253	CCT	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.488	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	44	0.00	0	G	NM_002285		100210682	100210682	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	0.317	T
CARF	79800	genome.wustl.edu	37	2	203826061	203826061	+	Silent	SNP	T	T	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:203826061T>A	ENST00000402905.3	+	8	1065	c.744T>A	c.(742-744)cgT>cgA	p.R248R	CARF_ENST00000320443.8_Silent_p.R248R|CARF_ENST00000428585.1_Silent_p.R172R|CARF_ENST00000545253.1_Silent_p.R160R|CARF_ENST00000434998.1_Silent_p.R146R|CARF_ENST00000456821.2_Intron|CARF_ENST00000438828.2_Silent_p.R248R|WDR12_ENST00000477723.1_Intron|CARF_ENST00000414439.1_Silent_p.R146R|CARF_ENST00000471271.1_Intron|CARF_ENST00000545262.1_Silent_p.R172R|CARF_ENST00000444724.1_Silent_p.R248R	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	248					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GGGGGACCCGTCAGTCTCCAA	0.438																																						dbGAP											0													68.0	68.0	68.0					2																	203826061		1909	4115	6024	-	-	-	SO:0001819	synonymous_variant	0			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.744T>A	2.37:g.203826061T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Silent	SNP	NULL	p.R248	ENST00000402905.3	37	c.744	CCDS42801.1	2																																																																																			ALS2CR8	-	NULL	ENSG00000138380		0.438	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CR8	HGNC	protein_coding	OTTHUMT00000335768.5	184	0.00	0	T	NM_001104586		203826061	203826061	+1	no_errors	ENST00000320443	ensembl	human	known	69_37n	silent	114	28.30	45	SNP	1.000	A
AMBRA1	55626	genome.wustl.edu	37	11	46419206	46419206	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr11:46419206C>G	ENST00000458649.2	-	18	4109	c.3691G>C	c.(3691-3693)Gct>Cct	p.A1231P	AMBRA1_ENST00000533727.1_Missense_Mutation_p.A1112P|AMBRA1_ENST00000528950.1_Missense_Mutation_p.A1202P|AMBRA1_ENST00000298834.3_Missense_Mutation_p.A1171P|AMBRA1_ENST00000314845.3_Missense_Mutation_p.A1141P|AMBRA1_ENST00000534300.1_Missense_Mutation_p.A1171P|AMBRA1_ENST00000426438.1_Missense_Mutation_p.A1202P			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1231					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TCCCAGGAAGCTGTCCGGGGG	0.687																																						dbGAP											0													54.0	58.0	57.0					11																	46419206		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3691G>C	11.37:g.46419206C>G	ENSP00000415327:p.Ala1231Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1231P	ENST00000458649.2	37	c.3691		11	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242857	0.58995	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.73897	-0.62;-0.79;-0.38;-0.51;-0.38;-0.49;-0.51	5.35	3.49	0.39957	.	0.300793	0.29021	N	0.013385	T	0.59636	0.2208	N	0.14661	0.345	0.34311	D	0.68543	B;P;P;P;P;P	0.40875	0.38;0.514;0.514;0.514;0.731;0.729	B;B;B;B;P;B	0.44359	0.093;0.191;0.191;0.284;0.447;0.284	T	0.68368	-0.5427	10	0.87932	D	0	.	6.2056	0.20600	0.2033:0.6422:0.0:0.1544	.	1231;1202;1171;1112;1234;1141	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	P	1141;1112;1171;1202;1171;1231;189;1202	ENSP00000318313:A1141P;ENSP00000433372:A1112P;ENSP00000431926:A1171P;ENSP00000410899:A1202P;ENSP00000298834:A1171P;ENSP00000415327:A1231P;ENSP00000433945:A1202P	ENSP00000298834:A1171P	A	-	1	0	AMBRA1	46375782	0.998000	0.40836	1.000000	0.80357	0.978000	0.69477	0.421000	0.21280	0.833000	0.34828	0.561000	0.74099	GCT	AMBRA1	-	NULL	ENSG00000110497		0.687	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	105	0.00	0	C	NM_017749		46419206	46419206	-1	no_errors	ENST00000458649	ensembl	human	known	69_37n	missense	52	34.18	27	SNP	1.000	G
ANK2	287	genome.wustl.edu	37	4	114276056	114276056	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:114276056A>T	ENST00000357077.4	+	38	6335	c.6282A>T	c.(6280-6282)gaA>gaT	p.E2094D	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.E2061D|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2094					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAATACCTGAACCTGTTCAGT	0.473																																						dbGAP											0													68.0	71.0	70.0					4																	114276056		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6282A>T	4.37:g.114276056A>T	ENSP00000349588:p.Glu2094Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.E2094D	ENST00000357077.4	37	c.6282	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	A	6.414	0.444433	0.12164	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.69561	-0.4;-0.41	5.65	-6.38	0.01957	.	0.329163	0.25169	N	0.032616	T	0.60170	0.2248	M	0.62723	1.935	0.09310	N	1	B;P	0.48503	0.001;0.911	B;P	0.48873	0.001;0.593	T	0.59273	-0.7485	9	.	.	.	.	7.8646	0.29530	0.381:0.2135:0.4054:0.0	.	2061;2094	Q01484;Q01484-4	ANK2_HUMAN;.	D	2094;2061	ENSP00000349588:E2094D;ENSP00000264366:E2061D	.	E	+	3	2	ANK2	114495505	0.005000	0.15991	0.000000	0.03702	0.079000	0.17450	-0.130000	0.10498	-1.133000	0.02903	-0.461000	0.05368	GAA	ANK2	-	NULL	ENSG00000145362		0.473	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	102	0.00	0	A	NM_001148		114276056	114276056	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	111	27.92	43	SNP	0.000	T
ANKRD42	338699	genome.wustl.edu	37	11	82959055	82959055	+	3'UTR	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr11:82959055G>C	ENST00000393392.2	+	0	1344				ANKRD42_ENST00000533342.1_Missense_Mutation_p.D465H|ANKRD42_ENST00000531895.1_Missense_Mutation_p.D465H|ANKRD42_ENST00000260047.6_Missense_Mutation_p.D464H|ANKRD42_ENST00000528190.1_3'UTR	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42						positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						ATGTCAGCTTGATGAATATCG	0.358																																						dbGAP											0													76.0	75.0	75.0					11																	82959055		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.*12G>C	11.37:g.82959055G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A49	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D465H	ENST00000393392.2	37	c.1393	CCDS8265.1	11	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740196	0.49045	.	.	ENSG00000137494	ENST00000260047;ENST00000531895;ENST00000533342;ENST00000342658;ENST00000531815	T;T;T;D	0.82526	-0.98;-0.82;-0.88;-1.62	5.59	5.59	0.84812	.	.	.	.	.	D	0.91064	0.7188	.	.	.	0.41241	D	0.986643	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.90744	0.4652	7	.	.	.	-10.1138	17.4501	0.87589	0.0:0.0:1.0:0.0	.	465;729;556	E9PIL2;A1DRY3;A1XPJ0	.;.;.	H	464;465;465;205;89	ENSP00000260047:D464H;ENSP00000434666:D465H;ENSP00000435790:D465H;ENSP00000435197:D89H	.	D	+	1	0	ANKRD42	82636703	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	6.115000	0.71566	2.783000	0.95769	0.655000	0.94253	GAT	ANKRD42	-	NULL	ENSG00000137494		0.358	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	ANKRD42	HGNC	protein_coding	OTTHUMT00000392934.1	339	0.00	0	G	NM_182603		82959055	82959055	+1	no_errors	ENST00000533342	ensembl	human	putative	69_37n	missense	169	39.86	112	SNP	1.000	C
ARHGAP17	55114	genome.wustl.edu	37	16	24950727	24950727	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:24950727G>A	ENST00000289968.6	-	17	1751	c.1682C>T	c.(1681-1683)tCc>tTc	p.S561F	ARHGAP17_ENST00000303665.5_Intron|ARHGAP17_ENST00000441763.2_3'UTR	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	561	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		TATGCCCGCGGAAGAGGGGAC	0.687																																						dbGAP											0													19.0	24.0	22.0					16																	24950727		2194	4296	6490	-	-	-	SO:0001583	missense	0			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1682C>T	16.37:g.24950727G>A	ENSP00000289968:p.Ser561Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	pfam_BAR_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.S561F	ENST00000289968.6	37	c.1682	CCDS32409.1	16	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939710	0.52972	.	.	ENSG00000140750	ENST00000289968;ENST00000455311	T	0.24350	1.86	5.32	5.32	0.75619	.	0.161086	0.29638	N	0.011599	T	0.38957	0.1060	L	0.51422	1.61	0.80722	D	1	P;D	0.59767	0.924;0.986	B;P	0.57152	0.34;0.814	T	0.02852	-1.1102	10	0.45353	T	0.12	.	14.3713	0.66840	0.0:0.0:1.0:0.0	.	561;94	Q68EM7;Q68EM7-7	RHG17_HUMAN;.	F	561	ENSP00000289968:S561F	ENSP00000289968:S561F	S	-	2	0	ARHGAP17	24858228	1.000000	0.71417	0.998000	0.56505	0.471000	0.32888	2.040000	0.41203	2.767000	0.95098	0.655000	0.94253	TCC	ARHGAP17	-	NULL	ENSG00000140750		0.687	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP17	HGNC	protein_coding	OTTHUMT00000436548.3	103	0.96	1	G	NM_018054		24950727	24950727	-1	no_errors	ENST00000289968	ensembl	human	known	69_37n	missense	41	46.05	35	SNP	0.993	A
ARHGAP29	9411	genome.wustl.edu	37	1	94654845	94654845	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:94654845C>G	ENST00000260526.6	-	14	1685	c.1503G>C	c.(1501-1503)gaG>gaC	p.E501D	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	501					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		GTACAACATCCTCTAAAGAGT	0.368																																						dbGAP											0													87.0	87.0	87.0					1																	94654845		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1503G>C	1.37:g.94654845C>G	ENSP00000260526:p.Glu501Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.E501D	ENST00000260526.6	37	c.1503	CCDS748.1	1	.	.	.	.	.	.	.	.	.	.	C	9.817	1.184795	0.21870	.	.	ENSG00000137962	ENST00000260526	T	0.22743	1.94	5.76	-1.01	0.10169	.	0.000000	0.38897	N	0.001524	T	0.03434	0.0099	N	0.20881	0.62	0.80722	D	1	B;B	0.18013	0.025;0.01	B;B	0.20184	0.028;0.008	T	0.29088	-1.0023	10	0.18276	T	0.48	-23.9994	4.8932	0.13737	0.178:0.4175:0.0:0.4045	.	501;501	F8VWZ8;Q52LW3	.;RHG29_HUMAN	D	501	ENSP00000260526:E501D	ENSP00000260526:E501D	E	-	3	2	ARHGAP29	94427433	0.793000	0.28825	0.988000	0.46212	0.767000	0.43475	-0.374000	0.07484	0.053000	0.16036	-0.157000	0.13467	GAG	ARHGAP29	-	NULL	ENSG00000137962		0.368	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	282	0.35	1	C	NM_004815		94654845	94654845	-1	no_errors	ENST00000260526	ensembl	human	known	69_37n	missense	82	55.68	103	SNP	0.957	G
ARHGAP35	2909	genome.wustl.edu	37	19	47492817	47492817	+	Silent	SNP	G	G	T	rs181888641	byFrequency	TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:47492817G>T	ENST00000404338.3	+	4	3921	c.3921G>T	c.(3919-3921)ctG>ctT	p.L1307L		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1307	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										ACCTGGACCTGGCAGAGAAAG	0.532																																						dbGAP											0													81.0	83.0	83.0					19																	47492817		1973	4161	6134	-	-	-	SO:0001819	synonymous_variant	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3921G>T	19.37:g.47492817G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A4|Q14452|Q9C0E1	Silent	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L1307	ENST00000404338.3	37	c.3921	CCDS46127.1	19																																																																																			ARHGAP35	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000160007		0.532	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	72	0.00	0	G	NM_004491		47492817	47492817	+1	no_errors	ENST00000404338	ensembl	human	known	69_37n	silent	51	20.00	13	SNP	1.000	T
ASIC1	41	genome.wustl.edu	37	12	50472232	50472232	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr12:50472232C>T	ENST00000447966.2	+	6	1095	c.866C>T	c.(865-867)aCc>aTc	p.T289I	ASIC1_ENST00000228468.4_Missense_Mutation_p.T289I|ASIC1_ENST00000552438.1_Missense_Mutation_p.T323I	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	289					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	CCCTGGGGCACCTGCAAAGCT	0.597																																						dbGAP											0													117.0	124.0	122.0					12																	50472232		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.866C>T	12.37:g.50472232C>T	ENSP00000400228:p.Thr289Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KN86|E5KBL7|P78349|Q96CV2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.T289I	ENST00000447966.2	37	c.866	CCDS44876.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.96|15.96	2.987051|2.987051	0.53934|0.53934	.|.	.|.	ENSG00000110881|ENSG00000110881	ENST00000453327|ENST00000228468;ENST00000447966;ENST00000552438	.|T;T;T	.|0.64085	.|-0.08;-0.08;-0.08	4.07|4.07	4.07|4.07	0.47477|0.47477	.|.	.|0.464036	.|0.22226	.|N	.|0.062894	T|T	0.41282|0.41282	0.1152|0.1152	N|N	0.08118|0.08118	0|0	0.40486|0.40486	D|D	0.980493|0.980493	.|B;B	.|0.22146	.|0.009;0.065	.|B;B	.|0.25759	.|0.063;0.06	T|T	0.42832|0.42832	-0.9428|-0.9428	5|10	.|0.54805	.|T	.|0.06	-16.6297|-16.6297	10.1483|10.1483	0.42778|0.42778	0.3503:0.6497:0.0:0.0|0.3503:0.6497:0.0:0.0	.|.	.|289;289	.|P78348;P78348-1	.|ACCN2_HUMAN;.	S|I	157|289;289;323	.|ENSP00000228468:T289I;ENSP00000400228:T289I;ENSP00000450247:T323I	.|ENSP00000228468:T289I	P|T	+|+	1|2	0|0	ACCN2|ACCN2	48758499|48758499	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.403000|5.403000	0.66338|0.66338	2.265000|2.265000	0.75225|0.75225	0.462000|0.462000	0.41574|0.41574	CCT|ACC	ASIC1	-	pfam_Na+channel_ASC,prints_Na+channel_ASC	ENSG00000110881		0.597	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC1	HGNC	protein_coding	OTTHUMT00000406004.2	224	0.44	1	C	NM_020039		50472232	50472232	+1	no_errors	ENST00000228468	ensembl	human	known	69_37n	missense	122	38.69	77	SNP	1.000	T
ASPA	443	genome.wustl.edu	37	17	3386852	3386852	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:3386852T>A	ENST00000263080.2	+	3	650	c.492T>A	c.(490-492)taT>taA	p.Y164*	SPATA22_ENST00000541913.1_Intron|ASPA_ENST00000456349.2_Nonsense_Mutation_p.Y164*	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	164	Substrate binding.				aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	CCCTCAAATATGCGACCACTC	0.398																																						dbGAP											0													169.0	151.0	157.0					17																	3386852		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.492T>A	17.37:g.3386852T>A	ENSP00000263080:p.Tyr164*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Aste_AspA,pirsf_Aspartoacylase	p.Y164*	ENST00000263080.2	37	c.492	CCDS11028.1	17	.	.	.	.	.	.	.	.	.	.	t	35	5.475393	0.96291	.	.	ENSG00000108381	ENST00000456349;ENST00000263080	.	.	.	5.41	-2.14	0.07123	.	0.110264	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9303	12.4653	0.55755	0.0:0.3779:0.0:0.6221	.	.	.	.	X	164	.	ENSP00000263080:Y164X	Y	+	3	2	ASPA	3333602	1.000000	0.71417	0.912000	0.35992	0.877000	0.50540	0.433000	0.21477	-1.056000	0.03205	-1.139000	0.01908	TAT	ASPA	-	pfam_Aste_AspA,pirsf_Aspartoacylase	ENSG00000108381		0.398	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPA	HGNC	protein_coding	OTTHUMT00000207315.1	212	0.00	0	T	NM_000049		3386852	3386852	+1	no_errors	ENST00000263080	ensembl	human	known	69_37n	nonsense	16	86.55	103	SNP	0.994	A
ASTN1	460	genome.wustl.edu	37	1	177001903	177001903	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:177001903C>T	ENST00000367654.3	-	3	765	c.554G>A	c.(553-555)cGg>cAg	p.R185Q	ASTN1_ENST00000361833.2_Missense_Mutation_p.R185Q|ASTN1_ENST00000367657.3_Missense_Mutation_p.R185Q|ASTN1_ENST00000424564.2_Missense_Mutation_p.R185Q|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	185					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CTGCGGGACCCGGCGGCGTTT	0.617																																						dbGAP											0													38.0	39.0	39.0					1																	177001903		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.554G>A	1.37:g.177001903C>T	ENSP00000356626:p.Arg185Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.R185Q	ENST00000367654.3	37	c.554		1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861396	0.91433	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.24723	1.84;2.25;2.24;1.85	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.46190	0.1380	L	0.43152	1.355	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.77557	0.99;0.986;0.986	T	0.39210	-0.9625	10	0.87932	D	0	-12.585	19.0456	0.93018	0.0:1.0:0.0:0.0	.	185;185;185	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	Q	185	ENSP00000356629:R185Q;ENSP00000354536:R185Q;ENSP00000356626:R185Q;ENSP00000395041:R185Q	ENSP00000354536:R185Q	R	-	2	0	ASTN1	175268526	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	5.917000	0.69989	2.567000	0.86603	0.655000	0.94253	CGG	ASTN1	-	NULL	ENSG00000152092		0.617	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		35	0.00	0	C	NM_004319		177001903	177001903	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	27	44.90	22	SNP	1.000	T
ATG3	64422	genome.wustl.edu	37	3	112256689	112256689	+	Missense_Mutation	SNP	C	C	G	rs377401688		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:112256689C>G	ENST00000283290.5	-	9	993	c.559G>C	c.(559-561)Gat>Cat	p.D187H	ATG3_ENST00000495756.1_5'UTR|ATG3_ENST00000402314.2_Missense_Mutation_p.D187H	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	187					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						CCGCCAGCATCAGTTTTGGCT	0.348																																						dbGAP											0													97.0	92.0	94.0					3																	112256689		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.559G>C	3.37:g.112256689C>G	ENSP00000283290:p.Asp187His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PKC5|Q9H6L9	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_3_N,pfam_Autophagy-rel_prot_3,pfam_Autophagy-rel_prot_3_C	p.D187H	ENST00000283290.5	37	c.559	CCDS2966.1	3	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301254	0.81136	.	.	ENSG00000144848	ENST00000283290;ENST00000402314	.	.	.	5.82	5.82	0.92795	.	0.090297	0.85682	D	0.000000	T	0.53932	0.1827	N	0.08118	0	0.80722	D	1	P;P	0.47545	0.658;0.897	P;P	0.53450	0.726;0.712	T	0.58142	-0.7688	9	0.40728	T	0.16	-19.7995	20.1092	0.97906	0.0:1.0:0.0:0.0	.	187;187	Q9NT62;Q9NT62-2	ATG3_HUMAN;.	H	187	.	ENSP00000283290:D187H	D	-	1	0	ATG3	113739379	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.413000	0.80104	2.745000	0.94114	0.655000	0.94253	GAT	ATG3	-	NULL	ENSG00000144848		0.348	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG3	HGNC	protein_coding	OTTHUMT00000354147.1	341	0.00	0	C	NM_022488		112256689	112256689	-1	no_errors	ENST00000283290	ensembl	human	known	69_37n	missense	209	31.70	97	SNP	1.000	G
ATXN10	25814	genome.wustl.edu	37	22	46202962	46202962	+	Intron	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr22:46202962G>C	ENST00000252934.5	+	10	1502				ATXN10_ENST00000402380.3_Intron|ATXN10_ENST00000381061.4_Intron	NM_013236.3	NP_037368.1	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death (GO:0008219)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	10		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		AGCAAAACAAGTCCCTTGCCT	0.453																																						dbGAP											0													100.0	74.0	82.0					22																	46202962		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK095309	CCDS14070.1, CCDS54540.1	22q13	2013-02-15	2004-08-12	2004-08-12	ENSG00000130638	ENSG00000130638		"""Ataxins"""	10549	protein-coding gene	gene with protein product		611150	"""spinocerebellar ataxia 10"""	SCA10		9973298	Standard	NM_013236		Approved	E46L, FLJ37990	uc003bgm.2	Q9UBB4	OTTHUMG00000150451	ENST00000252934.5:c.1237+60G>C	22.37:g.46202962G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLC4|B4DG05|O14998|O15009|Q6I9X4	Missense_Mutation	SNP	pfam_Ataxin-10_domain	p.S132T	ENST00000252934.5	37	c.395	CCDS14070.1	22	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386689	0.25031	.	.	ENSG00000130638	ENST00000451241	.	.	.	3.19	0.939	0.19506	.	.	.	.	.	T	0.23886	0.0578	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23332	-1.0191	4	.	.	.	.	3.7057	0.08400	0.1348:0.0:0.6234:0.2418	.	.	.	.	T	132	.	.	S	+	2	0	ATXN10	44581626	0.000000	0.05858	0.000000	0.03702	0.210000	0.24377	0.255000	0.18333	0.301000	0.22738	0.655000	0.94253	AGT	ATXN10	-	NULL	ENSG00000130638		0.453	ATXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN10	HGNC	protein_coding	OTTHUMT00000318142.2	75	0.00	0	G	NM_013236		46202962	46202962	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451241	ensembl	human	putative	69_37n	missense	27	70.33	64	SNP	0.000	C
BCL2L12	83596	genome.wustl.edu	37	19	50169138	50169138	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:50169138G>T	ENST00000246785.3	+	1	316	c.58G>T	c.(58-60)Gag>Tag	p.E20*	IRF3_ENST00000596765.1_5'Flank|IRF3_ENST00000597198.1_5'Flank|IRF3_ENST00000442265.2_5'Flank|IRF3_ENST00000309877.7_5'Flank|IRF3_ENST00000599223.1_5'Flank|IRF3_ENST00000596822.1_5'Flank|IRF3_ENST00000600022.1_5'Flank|IRF3_ENST00000598808.1_5'Flank|IRF3_ENST00000601291.1_5'Flank|BCL2L12_ENST00000441864.2_Nonsense_Mutation_p.E20*|BCL2L12_ENST00000246784.3_Nonsense_Mutation_p.E20*|IRF3_ENST00000377135.4_5'Flank|IRF3_ENST00000600911.1_5'Flank|IRF3_ENST00000599144.1_5'Flank|IRF3_ENST00000377139.3_5'Flank|IRF3_ENST00000593922.1_5'Flank	NM_001040668.1|NM_138639.1	NP_001035758.1|NP_619580.1	Q9HB09	B2L12_HUMAN	BCL2-like 12 (proline rich)	20					inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	8		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)		TTTCCGGCCAGAGGCATGCTG	0.602																																						dbGAP											0													42.0	45.0	44.0					19																	50169138		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF289220	CCDS12776.1, CCDS46144.1, CCDS74424.1, CCDS74423.1	19q13.3	2014-03-07				ENSG00000126453			13787	protein-coding gene	gene with protein product		610837					Standard	NM_001040668		Approved		uc002ppa.3	Q9HB09		ENST00000246785.3:c.58G>T	19.37:g.50169138G>T	ENSP00000246785:p.Glu20*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY11|Q3SY13|Q96I96|Q9HB08	Nonsense_Mutation	SNP	NULL	p.E20*	ENST00000246785.3	37	c.58	CCDS12776.1	19	.	.	.	.	.	.	.	.	.	.	G	44	11.198826	0.99530	.	.	ENSG00000126453	ENST00000246785;ENST00000441864;ENST00000246784	.	.	.	3.62	-1.38	0.09027	.	1.959960	0.03422	U	0.206507	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	0.1412	1.6439	0.02758	0.3522:0.3407:0.1941:0.113	.	.	.	.	X	20	.	ENSP00000246784:E20X	E	+	1	0	BCL2L12	54860950	0.000000	0.05858	0.014000	0.15608	0.991000	0.79684	0.061000	0.14366	-0.108000	0.12066	0.467000	0.42956	GAG	BCL2L12	-	NULL	ENSG00000126453		0.602	BCL2L12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L12	HGNC	protein_coding	OTTHUMT00000465770.1	26	0.00	0	G	NM_052842		50169138	50169138	+1	no_errors	ENST00000246785	ensembl	human	known	69_37n	nonsense	25	19.35	6	SNP	0.013	T
BEST3	144453	genome.wustl.edu	37	12	70049341	70049341	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr12:70049341C>A	ENST00000330891.5	-	10	1579	c.1353G>T	c.(1351-1353)aaG>aaT	p.K451N	BEST3_ENST00000331471.4_Intron|BEST3_ENST00000553096.1_Missense_Mutation_p.K345N|BEST3_ENST00000488961.1_Missense_Mutation_p.K238N	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	451					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			AGCAGGATTTCTTCCAGGTGG	0.587																																						dbGAP											0													81.0	84.0	83.0					12																	70049341		1941	4142	6083	-	-	-	SO:0001583	missense	0			AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1353G>T	12.37:g.70049341C>A	ENSP00000332413:p.Lys451Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.K451N	ENST00000330891.5	37	c.1353	CCDS8992.2	12	.	.	.	.	.	.	.	.	.	.	C	6.636	0.485797	0.12641	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98437	-4.72;-4.93;-4.93	5.37	2.57	0.30868	.	0.283792	0.30142	N	0.010319	D	0.95943	0.8679	M	0.65975	2.015	0.34328	D	0.687381	B;B	0.14012	0.009;0.006	B;B	0.12156	0.006;0.007	D	0.92704	0.6177	10	0.37606	T	0.19	-8.4027	5.0495	0.14501	0.146:0.6212:0.0:0.2328	.	451;238	Q8N1M1;B5MDI8	BEST3_HUMAN;.	N	238;451;345	ENSP00000433213:K238N;ENSP00000332413:K451N;ENSP00000449548:K345N	ENSP00000332413:K451N	K	-	3	2	BEST3	68335608	0.985000	0.35326	0.021000	0.16686	0.062000	0.15995	1.139000	0.31504	0.254000	0.21573	0.467000	0.42956	AAG	BEST3	-	NULL	ENSG00000127325		0.587	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST3	HGNC	protein_coding	OTTHUMT00000313908.2	301	0.00	0	C	NM_152439		70049341	70049341	-1	no_errors	ENST00000330891	ensembl	human	known	69_37n	missense	10	90.27	102	SNP	0.568	A
C11orf30	56946	genome.wustl.edu	37	11	76207278	76207278	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr11:76207278C>G	ENST00000529032.1	+	8	1128	c.1128C>G	c.(1126-1128)atC>atG	p.I376M	C11orf30_ENST00000533248.1_Missense_Mutation_p.I390M|C11orf30_ENST00000524490.1_Intron|C11orf30_ENST00000525038.1_Missense_Mutation_p.I391M|C11orf30_ENST00000343878.3_Missense_Mutation_p.I376M|C11orf30_ENST00000525919.1_Missense_Mutation_p.I377M|C11orf30_ENST00000334736.3_Missense_Mutation_p.I376M|C11orf30_ENST00000524767.1_Missense_Mutation_p.I391M			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	376	Interaction with BRCA2.|Ser-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						CATCAGCAATCAAAATGGCAT	0.383																																						dbGAP											0													106.0	106.0	106.0					11																	76207278		2200	4292	6492	-	-	-	SO:0001583	missense	0			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1128C>G	11.37:g.76207278C>G	ENSP00000432327:p.Ile376Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	pfam_ENT_N,pfscan_ENT_N	p.I376M	ENST00000529032.1	37	c.1128	CCDS8244.1	11	.	.	.	.	.	.	.	.	.	.	C	13.56	2.273971	0.40194	.	.	ENSG00000158636	ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	.	.	.	5.82	4.82	0.62117	.	0.113907	0.64402	D	0.000010	T	0.41811	0.1175	N	0.19112	0.55	0.35783	D	0.821768	B;B;B;P;P;P;P	0.49090	0.435;0.435;0.435;0.773;0.919;0.664;0.664	B;B;B;B;P;B;B	0.51866	0.157;0.157;0.157;0.277;0.682;0.143;0.143	T	0.49041	-0.8980	9	0.44086	T	0.13	-6.6905	10.4644	0.44598	0.0:0.858:0.0:0.142	.	390;391;391;376;326;377;376	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;Q7Z589	.;.;.;.;.;.;EMSY_HUMAN	M	376;376;326;391;390;377;391;376	.	ENSP00000334130:I376M	I	+	3	3	C11orf30	75884926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.636000	0.37144	2.756000	0.94617	0.563000	0.77884	ATC	C11orf30	-	NULL	ENSG00000158636		0.383	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf30	HGNC	protein_coding	OTTHUMT00000383288.2	126	0.00	0	C	NM_020193		76207278	76207278	+1	no_errors	ENST00000334736	ensembl	human	known	69_37n	missense	49	51.49	52	SNP	1.000	G
C12orf40	283461	genome.wustl.edu	37	12	40114937	40114937	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr12:40114937G>A	ENST00000324616.5	+	13	1997	c.1843G>A	c.(1843-1845)Gat>Aat	p.D615N		NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	615										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						CATACAGTGTGATCTAATTTC	0.408																																						dbGAP											0													146.0	140.0	142.0					12																	40114937		1946	4136	6082	-	-	-	SO:0001583	missense	0			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1843G>A	12.37:g.40114937G>A	ENSP00000317671:p.Asp615Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	NULL	p.D615N	ENST00000324616.5	37	c.1843	CCDS41770.1	12	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730695	0.48939	.	.	ENSG00000180116	ENST00000324616	T	0.54866	0.55	4.79	1.57	0.23409	.	0.592597	0.14955	N	0.288662	T	0.33177	0.0854	N	0.19112	0.55	0.09310	N	1	B	0.12630	0.006	B	0.16289	0.015	T	0.17349	-1.0372	10	0.33141	T	0.24	.	7.4436	0.27198	0.2962:0.0:0.7038:0.0	.	615	Q86WS4	CL040_HUMAN	N	615	ENSP00000317671:D615N	ENSP00000317671:D615N	D	+	1	0	C12orf40	38401204	0.876000	0.30132	0.064000	0.19789	0.855000	0.48748	0.978000	0.29488	0.185000	0.20105	-0.459000	0.05422	GAT	C12orf40	-	NULL	ENSG00000180116		0.408	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	119	0.00	0	G	NM_173599		40114937	40114937	+1	no_errors	ENST00000324616	ensembl	human	known	69_37n	missense	46	43.90	36	SNP	0.084	A
C14orf105	55195	genome.wustl.edu	37	14	57960233	57960233	+	Silent	SNP	G	G	A	rs34296290		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr14:57960233G>A	ENST00000216445.3	-	1	337	c.201C>T	c.(199-201)aaC>aaT	p.N67N	C14orf105_ENST00000534126.1_Silent_p.N67N|C14orf105_ENST00000422976.2_Silent_p.N67N|C14orf105_ENST00000526336.1_Silent_p.N67N	NM_001283057.1|NM_018168.2	NP_001269986.1|NP_060638.2	Q9NVL8	CN105_HUMAN	chromosome 14 open reading frame 105	67										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						TTCCATACCAGTTTTCTTGTA	0.403																																						dbGAP											0													116.0	116.0	116.0					14																	57960233		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001512	CCDS9730.1, CCDS61458.1, CCDS61459.1	14q22.2	2012-09-25			ENSG00000100557	ENSG00000100557			20189	protein-coding gene	gene with protein product							Standard	XM_005267806		Approved	FLJ10650	uc001xcy.2	Q9NVL8	OTTHUMG00000140317	ENST00000216445.3:c.201C>T	14.37:g.57960233G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53G04	Silent	SNP	NULL	p.N67	ENST00000216445.3	37	c.201	CCDS9730.1	14																																																																																			C14orf105	-	NULL	ENSG00000100557		0.403	C14orf105-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C14orf105	HGNC	protein_coding	OTTHUMT00000276921.2	147	0.00	0	G	NM_018168		57960233	57960233	-1	no_errors	ENST00000216445	ensembl	human	known	69_37n	silent	55	47.12	49	SNP	0.155	A
C16orf62	57020	genome.wustl.edu	37	16	19580756	19580756	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:19580756C>G	ENST00000251143.5	+	3	140	c.128C>G	c.(127-129)tCa>tGa	p.S43*	C16orf62_ENST00000542263.1_Nonsense_Mutation_p.S132*|C16orf62_ENST00000438132.3_Nonsense_Mutation_p.S132*|C16orf62_ENST00000417362.2_Nonsense_Mutation_p.S43*|C16orf62_ENST00000538853.1_Nonsense_Mutation_p.S132*			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	43						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						GTCACAGAGTCAAAGACAAAG	0.527																																						dbGAP											0													49.0	50.0	50.0					16																	19580756		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.128C>G	16.37:g.19580756C>G	ENSP00000251143:p.Ser43*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Nonsense_Mutation	SNP	NULL	p.S132*	ENST00000251143.5	37	c.395		16	.	.	.	.	.	.	.	.	.	.	C	26.6	4.748952	0.89753	.	.	ENSG00000103544	ENST00000438132;ENST00000538853;ENST00000542263;ENST00000251143;ENST00000417362	.	.	.	5.17	5.17	0.71159	.	0.169048	0.39985	N	0.001220	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-9.6189	17.676	0.88230	0.0:1.0:0.0:0.0	.	.	.	.	X	132;132;132;43;43	.	ENSP00000251143:S43X	S	+	2	0	C16orf62	19488257	1.000000	0.71417	0.957000	0.39632	0.941000	0.58515	6.634000	0.74290	2.406000	0.81754	0.655000	0.94253	TCA	C16orf62	-	NULL	ENSG00000103544		0.527	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		36	0.00	0	C	NM_020314		19580756	19580756	+1	no_errors	ENST00000438132	ensembl	human	known	69_37n	nonsense	26	33.33	13	SNP	1.000	G
C16orf54	283897	genome.wustl.edu	37	16	29756060	29756060	+	Silent	SNP	G	G	A	rs578093410		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:29756060G>A	ENST00000329410.3	-	2	308	c.213C>T	c.(211-213)acC>acT	p.T71T	AC009133.17_ENST00000565600.1_RNA	NM_175900.3	NP_787096.2	Q6UWD8	CP054_HUMAN	chromosome 16 open reading frame 54	71						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|lung(2)|prostate(1)|urinary_tract(1)	6						GCCACACCAGGGTGGGTGCAC	0.677																																						dbGAP											0													17.0	17.0	17.0					16																	29756060		2165	4262	6427	-	-	-	SO:0001819	synonymous_variant	0			AK093000	CCDS10652.1	16p11.2	2012-10-10		2005-08-09	ENSG00000185905	ENSG00000185905			26649	protein-coding gene	gene with protein product						12975309	Standard	NM_175900		Approved	FLJ35681	uc002dtp.2	Q6UWD8	OTTHUMG00000132116	ENST00000329410.3:c.213C>T	16.37:g.29756060G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJR6|Q8NAB0	Silent	SNP	NULL	p.T71	ENST00000329410.3	37	c.213	CCDS10652.1	16																																																																																			C16orf54	-	NULL	ENSG00000185905		0.677	C16orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf54	HGNC	protein_coding	OTTHUMT00000255158.1	50	0.00	0	G	NM_175900		29756060	29756060	-1	no_errors	ENST00000329410	ensembl	human	known	69_37n	silent	28	41.67	20	SNP	0.977	A
C1orf74	148304	genome.wustl.edu	37	1	209956185	209956185	+	Silent	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:209956185C>G	ENST00000294811.1	-	2	1051	c.795G>C	c.(793-795)ccG>ccC	p.P265P		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	265										endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GGGCCACAGCCGGCAGTGTGA	0.468																																						dbGAP											0													105.0	112.0	110.0					1																	209956185		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.795G>C	1.37:g.209956185C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.P265	ENST00000294811.1	37	c.795	CCDS1491.1	1																																																																																			C1orf74	-	NULL	ENSG00000162757		0.468	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf74	HGNC	protein_coding	OTTHUMT00000088745.1	156	0.00	0	C	NM_152485		209956185	209956185	-1	no_errors	ENST00000294811	ensembl	human	known	69_37n	silent	82	37.40	49	SNP	0.000	G
C8orf31	286122	genome.wustl.edu	37	8	144126093	144126093	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:144126093G>T	ENST00000395172.1	+	4	566	c.214G>T	c.(214-216)Gga>Tga	p.G72*	C8orf31_ENST00000517653.1_3'UTR	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	72										breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GGCACCCCAGGGACTCACTGC	0.617																																						dbGAP											0													73.0	63.0	67.0					8																	144126093		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.214G>T	8.37:g.144126093G>T	ENSP00000378601:p.Gly72*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GMU7	Nonsense_Mutation	SNP	NULL	p.G72*	ENST00000395172.1	37	c.214	CCDS6395.1	8	.	.	.	.	.	.	.	.	.	.	g	23.3	4.395640	0.83011	.	.	ENSG00000177335	ENST00000395172	.	.	.	1.77	0.872	0.19113	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.3056	0.10946	0.2084:0.0:0.7916:0.0	.	.	.	.	X	72	.	ENSP00000378601:G72X	G	+	1	0	C8orf31	144197468	0.904000	0.30761	0.026000	0.17262	0.003000	0.03518	0.785000	0.26830	0.337000	0.23665	-0.288000	0.09946	GGA	C8orf31	-	NULL	ENSG00000177335		0.617	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf31	HGNC	protein_coding	OTTHUMT00000380167.1	106	0.00	0	G	NM_173687		144126093	144126093	+1	no_errors	ENST00000395172	ensembl	human	known	69_37n	nonsense	141	23.66	44	SNP	0.343	T
CCAR1	55749	genome.wustl.edu	37	10	70507310	70507310	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr10:70507310G>T	ENST00000265872.6	+	8	932	c.813G>T	c.(811-813)caG>caT	p.Q271H	CCAR1_ENST00000535016.1_Missense_Mutation_p.Q256H|CCAR1_ENST00000543719.1_Missense_Mutation_p.Q256H	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	271					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TATTACAGCAGCCTCAGCAAA	0.413																																						dbGAP											0													119.0	118.0	118.0					10																	70507310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.813G>T	10.37:g.70507310G>T	ENSP00000265872:p.Gln271His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	pfam_SAP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.Q271H	ENST00000265872.6	37	c.813	CCDS7282.1	10	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906880	0.33628	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012;ENST00000540807	T;T;T;T;T;T	0.32272	1.46;1.86;1.86;1.88;1.89;1.91	5.06	-1.92	0.07618	.	0.000000	0.85682	D	0.000000	T	0.32734	0.0839	L	0.44542	1.39	0.41195	D	0.986337	D;D;D	0.60160	0.987;0.978;0.987	P;P;P	0.55303	0.693;0.496;0.773	T	0.06232	-1.0838	10	0.38643	T	0.18	-8.5357	10.3179	0.43747	0.5644:0.0:0.4356:0.0	.	256;271;245	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	H	271;256;256;256;245;76;76	ENSP00000265872:Q271H;ENSP00000441820:Q256H;ENSP00000445254:Q256H;ENSP00000439252:Q256H;ENSP00000438610:Q245H;ENSP00000439642:Q76H	ENSP00000265872:Q271H	Q	+	3	2	CCAR1	70177316	1.000000	0.71417	0.991000	0.47740	0.988000	0.76386	1.569000	0.36428	-0.324000	0.08589	-0.150000	0.13652	CAG	CCAR1	-	NULL	ENSG00000060339		0.413	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	108	0.00	0	G	NM_018237		70507310	70507310	+1	no_errors	ENST00000265872	ensembl	human	known	69_37n	missense	39	46.58	34	SNP	0.982	T
CCBL1	883	genome.wustl.edu	37	9	131600646	131600649	+	Splice_Site	DEL	CCTG	CCTG	-			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	CCTG	CCTG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr9:131600646_131600649delCCTG	ENST00000302586.3	-	4	364	c.202delCAGG	c.(202-204)cag>ag	p.Q68fs	CCBL1_ENST00000320665.6_Intron|CCBL1_ENST00000483599.1_Intron|CCBL1_ENST00000436267.2_Splice_Site_p.Q162fs	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	68					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	GGTGGGTAACCCTGCCAGGACAGC	0.598																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.202-1CAGG>-	9.37:g.131600646_131600649delCCTG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T275|Q8N191	Frame_Shift_Del	DEL	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	p.G162fs	ENST00000302586.3	37	c.484	CCDS43884.1	9																																																																																			CCBL1	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000171097		0.598	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCBL1	HGNC	protein_coding	OTTHUMT00000054521.2	36	0.00	0	CCTG		Frame_Shift_Del	131600646	131600649	-1	no_errors	ENST00000436267	ensembl	human	known	69_37n	frame_shift_del	18	14.29	3	DEL	1.000	-
CCNF	899	genome.wustl.edu	37	16	2495537	2495537	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:2495537G>T	ENST00000397066.4	+	10	1096	c.1008G>T	c.(1006-1008)gaG>gaT	p.E336D		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	336	Cyclin N-terminal.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				TGACCGTGGAGTGTGTGGACC	0.617																																						dbGAP											0													103.0	72.0	82.0					16																	2495537		2198	4300	6498	-	-	-	SO:0001583	missense	0			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1008G>T	16.37:g.2495537G>T	ENSP00000380256:p.Glu336Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H3|Q96EG9	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,pfam_F-box_dom_cyclin-like,superfamily_Cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Cyclin-like,pfscan_F-box_dom_cyclin-like	p.E336D	ENST00000397066.4	37	c.1008	CCDS10467.1	16	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269812	0.40095	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.11385	2.78	5.5	-0.396	0.12427	Cyclin, N-terminal (2);Cyclin-like (3);	0.194971	0.53938	D	0.000053	T	0.02533	0.0077	N	0.02120	-0.675	0.28433	N	0.917177	B	0.10296	0.003	B	0.12156	0.007	T	0.36578	-0.9742	10	0.18276	T	0.48	-34.6609	1.0856	0.01652	0.4043:0.1495:0.2923:0.1539	.	336	P41002	CCNF_HUMAN	D	336;251	ENSP00000380256:E336D	ENSP00000293968:E251D	E	+	3	2	CCNF	2435538	0.912000	0.30974	1.000000	0.80357	0.948000	0.59901	0.026000	0.13599	0.305000	0.22832	-0.259000	0.10710	GAG	CCNF	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000162063		0.617	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNF	HGNC	protein_coding	OTTHUMT00000250801.1	57	0.00	0	G	NM_001761		2495537	2495537	+1	no_errors	ENST00000397066	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	0.982	T
CD109	135228	genome.wustl.edu	37	6	74446225	74446225	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:74446225A>T	ENST00000287097.5	+	5	739	c.627A>T	c.(625-627)caA>caT	p.Q209H	CD109_ENST00000437994.2_Missense_Mutation_p.Q209H|CD109_ENST00000422508.2_Missense_Mutation_p.Q132H			Q6YHK3	CD109_HUMAN	CD109 molecule	209					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TTCAAGTTCAAGTGAATGTGA	0.363																																						dbGAP											0													128.0	138.0	135.0					6																	74446225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.627A>T	6.37:g.74446225A>T	ENSP00000287097:p.Gln209His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.Q209H	ENST00000287097.5	37	c.627	CCDS4982.1	6	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555959	0.65425	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.74106	-0.81;-0.81;-0.81	4.65	4.65	0.58169	Alpha-2-macroglobulin, N-terminal (1);	1.547870	0.04423	U	0.367959	T	0.63367	0.2505	L	0.28458	0.855	0.31191	N	0.700981	D;D;P;P	0.63880	0.993;0.985;0.814;0.848	P;B;P;P	0.53266	0.532;0.423;0.693;0.722	T	0.50783	-0.8787	10	0.59425	D	0.04	.	8.2056	0.31454	0.9082:0.0:0.0918:0.0	.	132;209;209;209	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	H	209;132;209	ENSP00000388062:Q209H;ENSP00000404475:Q132H;ENSP00000287097:Q209H	ENSP00000287097:Q209H	Q	+	3	2	CD109	74502946	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.354000	0.59417	2.064000	0.61679	0.482000	0.46254	CAA	CD109	-	pfam_A2M_N	ENSG00000156535		0.363	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	132	0.00	0	A	NM_133493		74446225	74446225	+1	no_errors	ENST00000287097	ensembl	human	known	69_37n	missense	7	87.27	48	SNP	1.000	T
CDH22	64405	genome.wustl.edu	37	20	44839113	44839113	+	Silent	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr20:44839113G>T	ENST00000372262.3	-	6	1519	c.1119C>A	c.(1117-1119)ggC>ggA	p.G373G	CDH22_ENST00000474438.1_5'UTR|CDH22_ENST00000537909.1_Silent_p.G373G	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	373	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CGCGGAACGTGCCCAGGTCGG	0.711																																						dbGAP											0													28.0	26.0	27.0					20																	44839113		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1119C>A	20.37:g.44839113G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGK7|O43205	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G373	ENST00000372262.3	37	c.1119	CCDS13395.1	20																																																																																			CDH22	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000149654		0.711	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	43	0.00	0	G	NM_021248		44839113	44839113	-1	no_errors	ENST00000372262	ensembl	human	known	69_37n	silent	41	41.43	29	SNP	0.935	T
CER1	9350	genome.wustl.edu	37	9	14722336	14722336	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr9:14722336A>G	ENST00000380911.3	-	1	379	c.335T>C	c.(334-336)cTc>cCc	p.L112P		NM_005454.2	NP_005445.1	O95813	CER1_HUMAN	cerberus 1, DAN family BMP antagonist	112					anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|bone mineralization (GO:0030282)|cell migration involved in gastrulation (GO:0042074)|cellular response to BMP stimulus (GO:0071773)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mesoderm development (GO:2000381)|nervous system development (GO:0007399)|sequestering of BMP in extracellular matrix (GO:0035582)|signal transduction involved in regulation of gene expression (GO:0023019)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(6)	11				GBM - Glioblastoma multiforme(50;3.16e-06)		CGGCTGGATGAGGGACTGGGT	0.498																																						dbGAP											0													63.0	67.0	66.0					9																	14722336		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090189	CCDS6476.1	9p23-p22	2013-02-26	2013-02-26		ENSG00000147869	ENSG00000147869			1862	protein-coding gene	gene with protein product		603777	"""cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)"", ""cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"""			10049596	Standard	NM_005454		Approved	DAND4	uc003zlj.3	O95813	OTTHUMG00000021022	ENST00000380911.3:c.335T>C	9.37:g.14722336A>G	ENSP00000370297:p.Leu112Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ISJ1|Q6ISJ6|Q6ISQ2|Q6ISS1	Missense_Mutation	SNP	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C,pirsf_Cerberus,pfscan_Cys_knot_C	p.L112P	ENST00000380911.3	37	c.335	CCDS6476.1	9	.	.	.	.	.	.	.	.	.	.	A	0.031	-1.337031	0.01287	.	.	ENSG00000147869	ENST00000380911	T	0.19394	2.15	4.29	-1.27	0.09347	.	1.348720	0.04988	N	0.466824	T	0.11024	0.0269	N	0.21448	0.665	0.20821	N	0.999843	B	0.02656	0.0	B	0.06405	0.002	T	0.27872	-1.0061	10	0.20519	T	0.43	-1.3229	0.0729	0.00024	0.3144:0.1667:0.1947:0.3241	.	112	O95813	CER1_HUMAN	P	112	ENSP00000370297:L112P	ENSP00000370297:L112P	L	-	2	0	CER1	14712336	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.099000	0.15210	-0.202000	0.10268	0.533000	0.62120	CTC	CER1	-	pirsf_Cerberus	ENSG00000147869		0.498	CER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CER1	HGNC	protein_coding	OTTHUMT00000055453.1	219	0.00	0	A	NM_005454		14722336	14722336	-1	no_errors	ENST00000380911	ensembl	human	known	69_37n	missense	90	39.60	59	SNP	0.000	G
CKAP5	9793	genome.wustl.edu	37	11	46766095	46766095	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr11:46766095G>C	ENST00000529230.1	-	43	5783	c.5737C>G	c.(5737-5739)Ccc>Gcc	p.P1913A	CKAP5_ENST00000312055.5_Missense_Mutation_p.P1853A|CKAP5_ENST00000354558.3_Missense_Mutation_p.P1853A|CKAP5_ENST00000415402.1_Missense_Mutation_p.P1920A			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1913					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GTGGGCGTGGGCACACATGTG	0.483																																					Ovarian(4;85 273 2202 4844 13323)	dbGAP											0													143.0	117.0	126.0					11																	46766095		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.5737C>G	11.37:g.46766095G>C	ENSP00000432768:p.Pro1913Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.P1920A	ENST00000529230.1	37	c.5758	CCDS31477.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.606|9.606	1.130058|1.130058	0.21041|0.21041	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000525896|ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	.|T;T;T;T	.|0.49139	.|0.84;0.87;0.79;0.79	5.38|5.38	3.51|3.51	0.40186|0.40186	.|.	.|0.444056	.|0.26439	.|N	.|0.024364	T|T	0.35393|0.35393	0.0930|0.0930	L|L	0.39898|0.39898	1.24|1.24	0.38169|0.38169	D|D	0.939288|0.939288	.|B;B;B	.|0.18741	.|0.03;0.03;0.018	.|B;B;B	.|0.21151	.|0.022;0.033;0.015	T|T	0.15549|0.15549	-1.0433|-1.0433	5|10	.|0.10377	.|T	.|0.69	-12.0389|-12.0389	11.6775|11.6775	0.51438|0.51438	0.1437:0.0:0.8563:0.0|0.1437:0.0:0.8563:0.0	.|.	.|1920;1853;1913	.|Q14008-3;Q14008-2;Q14008	.|.;.;CKAP5_HUMAN	G|A	151|1913;1920;1853;1853	.|ENSP00000432768:P1913A;ENSP00000395302:P1920A;ENSP00000310227:P1853A;ENSP00000346566:P1853A	.|ENSP00000310227:P1853A	A|P	-|-	2|1	0|0	CKAP5|CKAP5	46722671|46722671	1.000000|1.000000	0.71417|0.71417	0.054000|0.054000	0.19295|0.19295	0.246000|0.246000	0.25737|0.25737	3.046000|3.046000	0.49846|0.49846	0.656000|0.656000	0.30886|0.30886	0.655000|0.655000	0.94253|0.94253	GCC|CCC	CKAP5	-	NULL	ENSG00000175216		0.483	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1	142	0.00	0	G	NM_014756		46766095	46766095	-1	no_errors	ENST00000415402	ensembl	human	known	69_37n	missense	57	41.84	41	SNP	0.992	C
CLCN4	1183	genome.wustl.edu	37	X	10176333	10176333	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:10176333G>C	ENST00000380833.4	+	9	1483	c.1092G>C	c.(1090-1092)agG>agC	p.R364S	CLCN4_ENST00000421085.2_Missense_Mutation_p.R270S|CLCN4_ENST00000380829.1_Missense_Mutation_p.R333S	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	364					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AGACCACCAGGCTGGGGAAGT	0.602																																					Melanoma(74;1050 1296 1576 30544 38374)	dbGAP											0													111.0	106.0	108.0					X																	10176333		2203	4300	6503	-	-	-	SO:0001583	missense	0			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.1092G>C	X.37:g.10176333G>C	ENSP00000370213:p.Arg364Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U1|B7Z5Z4|Q9UBU1	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-4	p.R364S	ENST00000380833.4	37	c.1092	CCDS14137.1	X	.	.	.	.	.	.	.	.	.	.	g	12.88	2.069631	0.36470	.	.	ENSG00000073464	ENST00000380833;ENST00000380829;ENST00000421085	D;D;D	0.94330	-3.4;-3.38;-3.4	5.71	4.8	0.61643	Chloride channel, core (2);	0.645526	0.16742	N	0.201406	D	0.89167	0.6638	L	0.45228	1.405	0.39300	D	0.964884	B	0.06786	0.001	B	0.10450	0.005	D	0.85726	0.1328	10	0.48119	T	0.1	-15.8516	8.2899	0.31952	0.1302:0.1401:0.7297:0.0	.	364	P51793	CLCN4_HUMAN	S	364;333;270	ENSP00000370213:R364S;ENSP00000370209:R333S;ENSP00000405754:R270S	ENSP00000370209:R333S	R	+	3	2	CLCN4	10136333	0.968000	0.33430	1.000000	0.80357	0.997000	0.91878	1.019000	0.30014	2.436000	0.82500	0.592000	0.82586	AGG	CLCN4	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000073464		0.602	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN4	HGNC	protein_coding	OTTHUMT00000055730.1	114	0.00	0	G			10176333	10176333	+1	no_errors	ENST00000380833	ensembl	human	known	69_37n	missense	56	24.32	18	SNP	0.985	C
COL5A2	1290	genome.wustl.edu	37	2	189904261	189904261	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:189904261C>A	ENST00000374866.3	-	51	3936	c.3662G>T	c.(3661-3663)gGc>gTc	p.G1221V		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1221					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G1221A(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			ACCCGGAGGGCCAGGTGGGCC	0.478																																						dbGAP											1	Substitution - Missense(1)	lung(1)											23.0	25.0	24.0					2																	189904261		2202	4299	6501	-	-	-	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3662G>T	2.37:g.189904261C>A	ENSP00000364000:p.Gly1221Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G1221V	ENST00000374866.3	37	c.3662	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916361	0.73098	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99637	-6.29	5.28	5.28	0.74379	.	0.000000	0.49305	D	0.000147	D	0.99849	0.9930	H	0.99104	4.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96391	0.9289	10	0.87932	D	0	.	18.9001	0.92439	0.0:1.0:0.0:0.0	.	861;1221	Q5PR22;P05997	.;CO5A2_HUMAN	V	1221;861	ENSP00000364000:G1221V	ENSP00000364000:G1221V	G	-	2	0	COL5A2	189612506	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	7.814000	0.86154	2.451000	0.82905	0.655000	0.94253	GGC	COL5A2	-	pfam_Collagen	ENSG00000204262		0.478	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	40	0.00	0	C	NM_000393		189904261	189904261	-1	no_errors	ENST00000374866	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	A
COLQ	8292	genome.wustl.edu	37	3	15495408	15495408	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:15495408T>G	ENST00000383788.5	-	16	1351	c.1226A>C	c.(1225-1227)cAc>cCc	p.H409P	COLQ_ENST00000435459.2_Missense_Mutation_p.H399P|EAF1-AS1_ENST00000608408.1_RNA|COLQ_ENST00000383781.4_Missense_Mutation_p.H399P|COLQ_ENST00000603808.1_Missense_Mutation_p.H410P|COLQ_ENST00000383786.5_Missense_Mutation_p.H375P|COLQ_ENST00000383787.2_Missense_Mutation_p.H400P|COLQ_ENST00000383785.2_3'UTR	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	409					acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						CTCATGCCGGTGACCATCTCC	0.582																																						dbGAP											0													170.0	133.0	146.0					3																	15495408		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.1226A>C	3.37:g.15495408T>G	ENSP00000373298:p.His409Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	pfam_Collagen,tigrfam_Myxo_disulph_rpt	p.H409P	ENST00000383788.5	37	c.1226	CCDS33709.1	3	.	.	.	.	.	.	.	.	.	.	T	13.54	2.266252	0.40095	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786	D;D;D;D;D	0.90676	-2.56;-2.71;-2.67;-2.67;-2.7	5.03	2.49	0.30216	.	0.460728	0.25622	N	0.029412	D	0.85164	0.5634	L	0.40543	1.245	0.80722	D	1	P;B;P;D	0.56521	0.861;0.205;0.916;0.976	P;B;B;P	0.44921	0.461;0.08;0.356;0.464	T	0.82750	-0.0303	10	0.66056	D	0.02	-1.3848	6.4333	0.21809	0.1395:0.0771:0.0:0.7834	.	375;400;409;399	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	P	400;399;399;409;399;410;375	ENSP00000373297:H400P;ENSP00000373291:H399P;ENSP00000402511:H399P;ENSP00000373298:H409P;ENSP00000373296:H375P	ENSP00000373291:H399P	H	-	2	0	COLQ	15470412	1.000000	0.71417	0.957000	0.39632	0.993000	0.82548	4.685000	0.61693	0.774000	0.33427	0.379000	0.24179	CAC	COLQ	-	NULL	ENSG00000206561		0.582	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COLQ	HGNC	protein_coding	OTTHUMT00000343575.1	307	0.00	0	T	NM_005677		15495408	15495408	-1	no_errors	ENST00000383788	ensembl	human	known	69_37n	missense	155	24.88	52	SNP	1.000	G
CORIN	10699	genome.wustl.edu	37	4	47647207	47647207	+	Missense_Mutation	SNP	A	A	C	rs542013067	byFrequency	TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:47647207A>C	ENST00000273857.4	-	14	1847	c.1848T>G	c.(1846-1848)tgT>tgG	p.C616W	CORIN_ENST00000508498.1_Missense_Mutation_p.C477W|CORIN_ENST00000502252.1_Missense_Mutation_p.C549W|CORIN_ENST00000505909.1_Missense_Mutation_p.C579W|CORIN_ENST00000504584.1_Missense_Mutation_p.C579W	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	616	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						CTCTCTCTTTACAACCTAGAG	0.373																																						dbGAP											0													123.0	120.0	121.0					4																	47647207		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1848T>G	4.37:g.47647207A>C	ENSP00000273857:p.Cys616Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1_S6,pfam_LDrepeatLR_classA_rpt,pfam_Frizzled_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Frizzled_dom,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.C616W	ENST00000273857.4	37	c.1848	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	A	16.65	3.181597	0.57800	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	D;D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.73;-2.89	6.07	2.47	0.30058	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97365	0.9138	M	0.87180	2.865	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	D	0.96652	0.9482	10	0.87932	D	0	.	9.3675	0.38234	0.6838:0.0:0.3162:0.0	.	579;549;616	B4E2W9;B4E1Y7;Q9Y5Q5	.;.;CORIN_HUMAN	W	616;477;549;579;579	ENSP00000273857:C616W;ENSP00000425597:C477W;ENSP00000424212:C549W;ENSP00000425401:C579W;ENSP00000423216:C579W	ENSP00000273857:C616W	C	-	3	2	CORIN	47341964	0.493000	0.26035	1.000000	0.80357	0.827000	0.46813	0.546000	0.23284	0.556000	0.29098	0.533000	0.62120	TGT	CORIN	-	pirsf_Peptidase_S1A_corin,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000145244		0.373	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	HGNC	protein_coding	OTTHUMT00000216906.2	228	0.00	0	A			47647207	47647207	-1	no_errors	ENST00000273857	ensembl	human	known	69_37n	missense	198	28.16	78	SNP	0.975	C
CORO2A	7464	genome.wustl.edu	37	9	100895427	100895427	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr9:100895427C>G	ENST00000343933.5	-	5	798	c.541G>C	c.(541-543)Gat>Cat	p.D181H	CORO2A_ENST00000375077.4_Missense_Mutation_p.D181H	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	181					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AGGATCACATCTTGGTGACAG	0.542																																						dbGAP											0													288.0	216.0	240.0					9																	100895427		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.541G>C	9.37:g.100895427C>G	ENSP00000343746:p.Asp181His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D181H	ENST00000343933.5	37	c.541	CCDS6735.1	9	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554141	0.86231	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.60424	0.19;0.19	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.046667	0.85682	D	0.000000	T	0.77532	0.4144	M	0.80508	2.5	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.80845	-0.1200	10	0.87932	D	0	-19.2315	17.2336	0.86991	0.0:1.0:0.0:0.0	.	181	Q92828	COR2A_HUMAN	H	181	ENSP00000343746:D181H;ENSP00000364218:D181H	ENSP00000343746:D181H	D	-	1	0	CORO2A	99935248	1.000000	0.71417	0.926000	0.36857	0.887000	0.51463	7.568000	0.82369	2.602000	0.87976	0.655000	0.94253	GAT	CORO2A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000106789		0.542	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO2A	HGNC	protein_coding	OTTHUMT00000053357.1	106	0.00	0	C	NM_003389		100895427	100895427	-1	no_errors	ENST00000343933	ensembl	human	known	69_37n	missense	49	35.53	27	SNP	1.000	G
CSMD1	64478	genome.wustl.edu	37	8	3265726	3265726	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:3265726G>A	ENST00000520002.1	-	15	2324	c.1769C>T	c.(1768-1770)aCg>aTg	p.T590M	CSMD1_ENST00000542608.1_Missense_Mutation_p.T589M|CSMD1_ENST00000539096.1_Missense_Mutation_p.T589M|CSMD1_ENST00000602557.1_Missense_Mutation_p.T590M|CSMD1_ENST00000537824.1_Missense_Mutation_p.T589M|CSMD1_ENST00000602723.1_Missense_Mutation_p.T590M|CSMD1_ENST00000400186.3_Missense_Mutation_p.T590M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	590	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGATGATGCCGTAAAGTTGAA	0.383																																						dbGAP											0													22.0	19.0	20.0					8																	3265726		1860	4112	5972	-	-	-	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1769C>T	8.37:g.3265726G>A	ENSP00000430733:p.Thr590Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.T590M	ENST00000520002.1	37	c.1769		8	.	.	.	.	.	.	.	.	.	.	G	23.6	4.439404	0.83885	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.73164	0.3552	M	0.91090	3.175	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.80127	-0.1512	10	0.72032	D	0.01	.	18.7996	0.92010	0.0:0.0:1.0:0.0	.	590	E5RIG2	.	M	590;590;452;589;589;589	ENSP00000383047:T590M;ENSP00000430733:T590M;ENSP00000441462:T589M;ENSP00000446243:T589M;ENSP00000441675:T589M	ENSP00000320445:T452M	T	-	2	0	CSMD1	3253133	1.000000	0.71417	0.835000	0.33067	0.984000	0.73092	9.602000	0.98312	2.437000	0.82529	0.467000	0.42956	ACG	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.383	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	51	0.00	0	G	NM_033225		3265726	3265726	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	missense	22	50.00	22	SNP	1.000	A
CUL3	8452	genome.wustl.edu	37	2	225346622	225346622	+	Silent	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:225346622G>C	ENST00000264414.4	-	14	2354	c.2016C>G	c.(2014-2016)gtC>gtG	p.V672V	CUL3_ENST00000409096.1_Silent_p.V648V|CUL3_ENST00000344951.4_Silent_p.V606V|CUL3_ENST00000409777.1_Silent_p.V648V	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	672					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TTTGAATCTTGACTCTGTGTA	0.279																																						dbGAP											0													112.0	110.0	110.0					2																	225346622		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.2016C>G	2.37:g.225346622G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Silent	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.V672	ENST00000264414.4	37	c.2016	CCDS2462.1	2																																																																																			CUL3	-	superfamily_Cullin_homology	ENSG00000036257		0.279	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2	105	0.00	0	G			225346622	225346622	-1	no_errors	ENST00000264414	ensembl	human	known	69_37n	silent	56	48.15	52	SNP	1.000	C
CXorf22	170063	genome.wustl.edu	37	X	35974211	35974211	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:35974211delA	ENST00000297866.5	+	8	1374	c.1308delA	c.(1306-1308)atafs	p.I436fs		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	436										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AGTGCATCATAAAAAATCAAT	0.383																																						dbGAP											0													73.0	67.0	69.0					X																	35974211		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1308delA	X.37:g.35974211delA	ENSP00000297866:p.Ile436fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRM8|Q8N6X8	Frame_Shift_Del	DEL	superfamily_PapD-like	p.N438fs	ENST00000297866.5	37	c.1308	CCDS14237.2	X																																																																																			CXorf22	-	NULL	ENSG00000165164		0.383	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	130	0.00	0	A	NM_152632		35974211	35974211	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	frame_shift_del	78	36.00	45	DEL	0.000	-
CYTH3	9265	genome.wustl.edu	37	7	6210838	6210838	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:6210838G>T	ENST00000350796.3	-	7	693	c.557C>A	c.(556-558)tCc>tAc	p.S186Y	CYTH3_ENST00000396741.2_Missense_Mutation_p.S101Y|CYTH3_ENST00000488964.1_5'UTR	NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3	186	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				establishment of epithelial cell polarity (GO:0090162)|Golgi vesicle transport (GO:0048193)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19						CTGACCTGTGGACTGGAAGAC	0.647																																						dbGAP											0													85.0	90.0	89.0					7																	6210838		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256		"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3		9072969	Standard	NM_004227		Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.557C>A	7.37:g.6210838G>T	ENSP00000297044:p.Ser186Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2N8	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.S186Y	ENST00000350796.3	37	c.557	CCDS5346.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.264828	0.95399	.	.	ENSG00000008256	ENST00000350796;ENST00000396741	T;T	0.36157	1.27;1.27	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.74160	0.3680	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.79784	0.993;0.921	D	0.84102	0.0396	10	0.87932	D	0	.	18.8342	0.92155	0.0:0.0:1.0:0.0	.	101;186	B7Z2V9;O43739-2	.;.	Y	186;101	ENSP00000297044:S186Y;ENSP00000379967:S101Y	ENSP00000297044:S186Y	S	-	2	0	CYTH3	6177363	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.688000	0.84153	2.459000	0.83118	0.655000	0.94253	TCC	CYTH3	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000008256		0.647	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH3	HGNC	protein_coding	OTTHUMT00000207396.2	90	0.00	0	G	NM_004227		6210838	6210838	-1	no_errors	ENST00000350796	ensembl	human	known	69_37n	missense	55	29.49	23	SNP	1.000	T
DCX	1641	genome.wustl.edu	37	X	110644539	110644539	+	Silent	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:110644539G>A	ENST00000338081.3	-	3	798	c.627C>T	c.(625-627)tcC>tcT	p.S209S	DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Silent_p.S128S|DCX_ENST00000356220.3_Silent_p.S128S|DCX_ENST00000488120.1_Silent_p.S128S|DCX_ENST00000356915.2_Silent_p.S128S	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	209	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						AGTTGTCTGAGGAACAGACAT	0.388																																						dbGAP											0													85.0	81.0	83.0					X																	110644539		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.627C>T	X.37:g.110644539G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	p.P201L	ENST00000338081.3	37	c.602	CCDS14556.1	X	.	.	.	.	.	.	.	.	.	.	G	7.693	0.691534	0.15039	.	.	ENSG00000077279	ENST00000358070	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	T	0.49167	0.1541	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48536	-0.9027	4	.	.	.	.	4.7943	0.13265	0.0867:0.146:0.614:0.1534	.	.	.	.	L	201	.	.	P	-	2	0	DCX	110531195	0.986000	0.35501	1.000000	0.80357	0.973000	0.67179	0.140000	0.16056	2.283000	0.76528	0.600000	0.82982	CCT	DCX	-	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	ENSG00000077279		0.388	DCX-006	KNOWN	basic|CCDS	protein_coding	DCX	HGNC	protein_coding	OTTHUMT00000357058.1	114	0.00	0	G	NM_178153		110644539	110644539	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000358070	ensembl	human	novel	69_37n	missense	49	34.67	26	SNP	0.998	A
DEFB113	245927	genome.wustl.edu	37	6	49936517	49936517	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:49936517G>A	ENST00000398718.1	-	2	121	c.122C>T	c.(121-123)gCt>gTt	p.A41V		NM_001037729.1	NP_001032818.1	Q30KQ7	DB113_HUMAN	defensin, beta 113	41					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Lung NSC(77;0.042)					CGGCTTGCAAGCACCACGAAC	0.398																																						dbGAP											0													110.0	105.0	107.0					6																	49936517		1880	4109	5989	-	-	-	SO:0001583	missense	0			DQ012017	CCDS43472.1	6p12.3	2010-03-30			ENSG00000214642	ENSG00000214642		"""Defensins, beta"""	18094	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037729		Approved	DEFB-13	uc011dwq.2	Q30KQ7	OTTHUMG00000160210	ENST00000398718.1:c.122C>T	6.37:g.49936517G>A	ENSP00000381703:p.Ala41Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A41V	ENST00000398718.1	37	c.122	CCDS43472.1	6	.	.	.	.	.	.	.	.	.	.	G	7.649	0.682532	0.14907	.	.	ENSG00000214642	ENST00000398718	T	0.10763	2.84	4.15	-3.67	0.04476	.	.	.	.	.	T	0.01353	0.0044	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.47459	-0.9116	7	.	.	.	0.0427	5.5056	0.16852	0.5447:0.0:0.3115:0.1438	.	41	Q30KQ7	DB113_HUMAN	V	41	ENSP00000381703:A41V	.	A	-	2	0	DEFB113	50044476	0.001000	0.12720	0.001000	0.08648	0.007000	0.05969	-0.365000	0.07573	-1.071000	0.03145	-0.259000	0.10710	GCT	DEFB113	-	NULL	ENSG00000214642		0.398	DEFB113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB113	HGNC	protein_coding	OTTHUMT00000359666.1	135	0.00	0	G			49936517	49936517	-1	no_errors	ENST00000398718	ensembl	human	known	69_37n	missense	158	28.83	64	SNP	0.000	A
DFNA5	1687	genome.wustl.edu	37	7	24738784	24738784	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:24738784A>T	ENST00000342947.3	-	10	1777	c.1352T>A	c.(1351-1353)tTg>tAg	p.L451*	DFNA5_ENST00000419307.1_Nonsense_Mutation_p.L287*|DFNA5_ENST00000409775.3_Nonsense_Mutation_p.L451*|DFNA5_ENST00000545231.1_Nonsense_Mutation_p.L287*|DFNA5_ENST00000409970.1_Nonsense_Mutation_p.L287*	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	451					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TGAGGCAAACAAGCGCTGCAC	0.453																																					GBM(78;184 1250 20134 20900 23600)	dbGAP											0													92.0	83.0	86.0					7																	24738784		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.1352T>A	7.37:g.24738784A>T	ENSP00000339587:p.Leu451*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Nonsense_Mutation	SNP	pfam_Gasdermin	p.L451*	ENST00000342947.3	37	c.1352	CCDS5389.1	7	.	.	.	.	.	.	.	.	.	.	A	47	13.129158	0.99721	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775	.	.	.	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.9654	13.7343	0.62809	1.0:0.0:0.0:0.0	.	.	.	.	X	451;287;287;287;451	.	ENSP00000339587:L451X	L	-	2	0	DFNA5	24705309	0.998000	0.40836	0.697000	0.30258	0.942000	0.58702	5.293000	0.65680	2.068000	0.61886	0.528000	0.53228	TTG	DFNA5	-	pfam_Gasdermin	ENSG00000105928		0.453	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNA5	HGNC	protein_coding	OTTHUMT00000214060.2	76	0.00	0	A	NM_004403		24738784	24738784	-1	no_errors	ENST00000342947	ensembl	human	known	69_37n	nonsense	70	27.08	26	SNP	0.977	T
DGCR2	9993	genome.wustl.edu	37	22	19052399	19052399	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr22:19052399G>C	ENST00000263196.7	-	4	757	c.510C>G	c.(508-510)gaC>gaG	p.D170E	DGCR2_ENST00000537045.1_Missense_Mutation_p.D129E|DGCR2_ENST00000545799.1_Missense_Mutation_p.D167E|DGCR2_ENST00000473832.1_5'UTR	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	170	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					GCTCGGGCTGGTCCCATTCCT	0.612																																						dbGAP											0													56.0	51.0	53.0					22																	19052399		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.510C>G	22.37:g.19052399G>C	ENSP00000263196:p.Asp170Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_C-type_lectin_fold,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_C-type_lectin,smart_VWF_C,pfscan_LDrepeatLR_classA_rpt,pfscan_C-type_lectin	p.D170E	ENST00000263196.7	37	c.510	CCDS33598.1	22	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379578	0.42207	.	.	ENSG00000070413	ENST00000537045;ENST00000263196;ENST00000545799;ENST00000447928	T;D;D	0.97066	0.91;-4.23;-4.05	4.96	0.331	0.15933	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.089585	0.85682	N	0.000000	D	0.91150	0.7213	L	0.28192	0.835	0.47123	D	0.999328	B;B	0.28933	0.228;0.049	B;B	0.27262	0.078;0.04	T	0.82402	-0.0475	10	0.23302	T	0.38	.	6.8587	0.24054	0.2199:0.1249:0.6552:0.0	.	126;170	B7Z3T5;P98153	.;IDD_HUMAN	E	129;170;167;170	ENSP00000440062:D129E;ENSP00000263196:D170E;ENSP00000445069:D167E	ENSP00000263196:D170E	D	-	3	2	DGCR2	17432399	0.998000	0.40836	1.000000	0.80357	0.963000	0.63663	-0.232000	0.09055	0.143000	0.18926	0.467000	0.42956	GAC	DGCR2	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000070413		0.612	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DGCR2	HGNC	protein_coding	OTTHUMT00000316504.1	28	0.00	0	G	NM_005137		19052399	19052399	-1	no_errors	ENST00000263196	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.998	C
DGKZ	8525	genome.wustl.edu	37	11	46400752	46400753	+	Splice_Site	INS	-	-	CC	rs3832759		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr11:46400752_46400753insCC	ENST00000454345.1	+	30	3228_3229		c.e30-1		MDK_ENST00000407067.1_5'Flank|MDK_ENST00000405308.2_5'Flank|MDK_ENST00000395565.1_5'Flank|DGKZ_ENST00000318201.8_Splice_Site|MIR4688_ENST00000577966.1_RNA|DGKZ_ENST00000532868.2_Splice_Site|MDK_ENST00000395566.4_5'Flank|MDK_ENST00000395569.4_5'Flank|DGKZ_ENST00000421244.2_Splice_Site|DGKZ_ENST00000395574.3_Splice_Site|DGKZ_ENST00000528615.1_Splice_Site|MDK_ENST00000359803.3_5'Flank|DGKZ_ENST00000543978.1_Splice_Site|DGKZ_ENST00000456247.2_Splice_Site|DGKZ_ENST00000527911.1_Splice_Site|DGKZ_ENST00000343674.6_Splice_Site	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta						blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CCCTTCTCCAGCCCCCCCAGAG	0.649																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.3104-1->CC	11.37:g.46400757_46400758dupCC		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Frame_Shift_Ins	INS	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1038fs	ENST00000454345.1	37	c.3105_3104	CCDS41640.1	11																																																																																			DGKZ	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000149091		0.649	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKZ	HGNC	protein_coding	OTTHUMT00000389772.1	13	0.00	0	-	NM_001105540	Intron	46400752	46400753	+1	no_errors	ENST00000454345	ensembl	human	known	69_37n	frame_shift_ins	5	37.50	3	INS	0.999:0.958	CC
DIP2C	22982	genome.wustl.edu	37	10	461709	461711	+	Splice_Site	DEL	CTT	CTT	-			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr10:461709_461711delCTT	ENST00000280886.6	-	7	944_946	c.857_859delAAG	c.(856-861)gaagtt>gtt	p.E286del	DIP2C_ENST00000381496.3_Splice_Site_p.E179del	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	286						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GTTCTCTCACCTTCTAATAATTC	0.404																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.859+1AAG>-	10.37:g.461709_461711delCTT		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPI5|Q5SS78	In_Frame_Del	DEL	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.E286in_frame_del	ENST00000280886.6	37	c.859_857	CCDS7054.1	10																																																																																			DIP2C	-	NULL	ENSG00000151240		0.404	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	155	0.00	0	CTT	NM_014974	In_Frame_Del	461709	461711	-1	no_errors	ENST00000280886	ensembl	human	known	69_37n	in_frame_del	74	12.94	11	DEL	1.000:1.000:1.000	-
DISP1	84976	genome.wustl.edu	37	1	223178036	223178036	+	Silent	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:223178036C>G	ENST00000284476.6	+	8	3461	c.3297C>G	c.(3295-3297)ccC>ccG	p.P1099P		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1099					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TGATGATGCCCTCCACAGTTC	0.567																																						dbGAP											0													66.0	62.0	63.0					1																	223178036		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.3297C>G	1.37:g.223178036C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.P1099	ENST00000284476.6	37	c.3297	CCDS1536.1	1																																																																																			DISP1	-	pfam_Patched,pfam_MMPL-typ	ENSG00000154309		0.567	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DISP1	HGNC	protein_coding	OTTHUMT00000092512.1	48	0.00	0	C	NM_032890		223178036	223178036	+1	no_errors	ENST00000284476	ensembl	human	known	69_37n	silent	44	36.23	25	SNP	0.993	G
DNAH7	56171	genome.wustl.edu	37	2	196709889	196709889	+	Splice_Site	SNP	T	T	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:196709889T>A	ENST00000312428.6	-	47	8882	c.8782A>T	c.(8782-8784)Aat>Tat	p.N2928Y		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2928					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTAGTTTGATTCTTTAGAACA	0.378																																						dbGAP											0													102.0	92.0	95.0					2																	196709889		1837	4092	5929	-	-	-	SO:0001630	splice_region_variant	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8782-1A>T	2.37:g.196709889T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.N2928Y	ENST00000312428.6	37	c.8782	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362826	0.41902	.	.	ENSG00000118997	ENST00000312428	T	0.74947	-0.89	5.65	0.428	0.16499	Dynein heavy chain, coiled coil stalk (1);	1.026360	0.07699	N	0.940045	T	0.64011	0.2560	N	0.24115	0.695	0.36512	D	0.869657	B	0.21071	0.051	B	0.35073	0.195	T	0.57596	-0.7784	10	0.48119	T	0.1	.	6.1954	0.20548	0.0:0.1359:0.2524:0.6117	.	2928	Q8WXX0	DYH7_HUMAN	Y	2928	ENSP00000311273:N2928Y	ENSP00000311273:N2928Y	N	-	1	0	DNAH7	196418134	0.975000	0.34042	0.970000	0.41538	0.921000	0.55340	0.714000	0.25808	0.055000	0.16094	0.528000	0.53228	AAT	DNAH7	-	NULL	ENSG00000118997		0.378	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	157	0.00	0	T	NM_018897	Missense_Mutation	196709889	196709889	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	147	15.52	27	SNP	0.581	A
DNTT	1791	genome.wustl.edu	37	10	98064440	98064440	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr10:98064440G>T	ENST00000371174.2	+	1	288	c.186G>T	c.(184-186)agG>agT	p.R62S	RP11-35J23.1_ENST00000454484.2_RNA|DNTT_ENST00000419175.1_Missense_Mutation_p.R62S			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	62	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		AAGGGTTCAGGGTTGAAAATG	0.468																																						dbGAP											0													36.0	43.0	40.0					10																	98064440		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.186G>T	10.37:g.98064440G>T	ENSP00000360216:p.Arg62Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	pfam_DNA_pol_lambd_fingers_domain,pfam_BRCT_dom,pfam_Nucleotidyltransferase,superfamily_DNA-dir_DNA_pol_X_beta-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_DNA-dir_DNA_pol_X,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	p.R62S	ENST00000371174.2	37	c.186	CCDS7447.1	10	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001808	0.74932	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.78246	-1.16;-1.16	5.9	5.9	0.94986	BRCT (4);	0.301012	0.39687	N	0.001286	D	0.86310	0.5902	M	0.80746	2.51	0.42632	D	0.99338	D;D	0.64830	0.992;0.994	P;D	0.63703	0.864;0.917	D	0.87132	0.2197	10	0.59425	D	0.04	3.7379	11.0816	0.48064	0.0835:0.0:0.9165:0.0	.	62;62	P04053-2;P04053	.;TDT_HUMAN	S	62	ENSP00000401169:R62S;ENSP00000360216:R62S	ENSP00000360216:R62S	R	+	3	2	DNTT	98054430	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.395000	0.44459	2.802000	0.96397	0.650000	0.86243	AGG	DNTT	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase	ENSG00000107447		0.468	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNTT	HGNC	protein_coding	OTTHUMT00000049607.1	134	0.74	1	G	NM_004088		98064440	98064440	+1	no_errors	ENST00000371174	ensembl	human	known	69_37n	missense	58	40.21	39	SNP	1.000	T
EBP	10682	genome.wustl.edu	37	X	48382367	48382367	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:48382367G>T	ENST00000495186.1	+	2	1031	c.208G>T	c.(208-210)Gca>Tca	p.A70S	EBP_ENST00000276096.6_3'UTR	NM_006579.2	NP_006570.1	Q15125	EBP_HUMAN	emopamil binding protein (sterol isomerase)	70					cholesterol biosynthetic process (GO:0006695)|cholesterol metabolic process (GO:0008203)|drug transmembrane transport (GO:0006855)|hemopoiesis (GO:0030097)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	C-8 sterol isomerase activity (GO:0000247)|cholestenol delta-isomerase activity (GO:0047750)|drug transmembrane transporter activity (GO:0015238)|steroid delta-isomerase activity (GO:0004769)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|stomach(1)	11					Tamoxifen(DB00675)	GTGCTGGTTTGCAGTGTGTGG	0.552																																					Ovarian(41;550 1000 33077 33474 52335)	dbGAP											0													190.0	162.0	172.0					X																	48382367		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z37986	CCDS14300.1	Xp11.23-p11.22	2013-05-22	2001-11-28		ENSG00000147155	ENSG00000147155			3133	protein-coding gene	gene with protein product	"""3-beta-hydroxysteroid-delta-8,delta-7-isomerase"", ""Chondrodysplasia punctata-2, X-linked dominant (Happle syndrome)"", ""sterol 8-isomerase"""	300205	"""emopamil-binding protein (sterol isomerase)"""	CDPX2		7706302, 8938429	Standard	NM_006579		Approved	CPX, CPXD, CHO2	uc004djx.4	Q15125	OTTHUMG00000034482	ENST00000495186.1:c.208G>T	X.37:g.48382367G>T	ENSP00000417052:p.Ala70Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FGL3|Q6IBI9	Missense_Mutation	SNP	pfam_EBP	p.A70S	ENST00000495186.1	37	c.208	CCDS14300.1	X	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763157	0.69763	.	.	ENSG00000147155	ENST00000495186;ENST00000446158;ENST00000414061	D;D;D	0.98192	-4.78;-4.78;-4.78	5.72	4.86	0.63082	.	0.186471	0.47093	N	0.000257	D	0.98096	0.9372	M	0.89715	3.055	0.38112	D	0.937587	P	0.43578	0.811	P	0.45660	0.489	D	0.98452	1.0592	10	0.59425	D	0.04	-6.3589	9.6624	0.39962	0.0973:0.0:0.9027:0.0	.	70	Q15125	EBP_HUMAN	S	70	ENSP00000417052:A70S;ENSP00000390031:A70S;ENSP00000405832:A70S	ENSP00000405832:A70S	A	+	1	0	EBP	48267311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.937000	0.48979	1.195000	0.43115	0.536000	0.68110	GCA	EBP	-	pfam_EBP	ENSG00000147155		0.552	EBP-004	KNOWN	basic|appris_principal|CCDS	protein_coding	EBP	HGNC	protein_coding	OTTHUMT00000083372.1	423	0.24	1	G	NM_006579		48382367	48382367	+1	no_errors	ENST00000495186	ensembl	human	known	69_37n	missense	200	41.79	145	SNP	1.000	T
ENOSF1	55556	genome.wustl.edu	37	18	694282	694282	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr18:694282G>A	ENST00000251101.7	-	4	450	c.362C>T	c.(361-363)gCg>gTg	p.A121V	ENOSF1_ENST00000539164.1_Missense_Mutation_p.A121V|ENOSF1_ENST00000580982.1_Silent_p.R82R|ENOSF1_ENST00000340116.7_Missense_Mutation_p.A142V|ENOSF1_ENST00000383578.3_Missense_Mutation_p.A39V	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	121					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						GTCCCACACCGCGTTTAGGAC	0.537																																						dbGAP											0													55.0	47.0	50.0					18																	694282		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.362C>T	18.37:g.694282G>A	ENSP00000251101:p.Ala121Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Missense_Mutation	SNP	pfam_Mandelate_racemase_C,pfam_Mandelate_racemase_N,smart_Mandelate_racemase_C	p.A142V	ENST00000251101.7	37	c.425	CCDS11822.1	18	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866254	0.71949	.	.	ENSG00000132199	ENST00000383578;ENST00000251101;ENST00000340116;ENST00000539164	T;T;T;T	0.77229	-0.29;-1.08;-1.08;-1.08	5.62	5.62	0.85841	Mandelate racemase/muconate lactonizing enzyme, N-terminal (1);	0.101163	0.64402	D	0.000002	D	0.93684	0.7982	H	0.99286	4.5	0.51482	D	0.999922	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	D	0.96158	0.9113	10	0.87932	D	0	.	18.4199	0.90587	0.0:0.0:1.0:0.0	.	142;166;121;39	A6NMP3;Q6ZS08;Q7L5Y1;Q7L5Y1-2	.;.;ENOF1_HUMAN;.	V	39;121;142;121	ENSP00000373072:A39V;ENSP00000251101:A121V;ENSP00000345974:A142V;ENSP00000446321:A121V	ENSP00000251101:A121V	A	-	2	0	ENOSF1	684282	1.000000	0.71417	0.513000	0.27749	0.062000	0.15995	7.529000	0.81952	2.635000	0.89317	0.655000	0.94253	GCG	ENOSF1	-	pfam_Mandelate_racemase_N	ENSG00000132199		0.537	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	HGNC	protein_coding	OTTHUMT00000254312.2	43	0.00	0	G	NM_017512		694282	694282	-1	no_errors	ENST00000340116	ensembl	human	known	69_37n	missense	27	34.15	14	SNP	1.000	A
EPHA5	2044	genome.wustl.edu	37	4	66468004	66468004	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:66468004C>T	ENST00000273854.3	-	3	865	c.265G>A	c.(265-267)Gtg>Atg	p.V89M	EPHA5_ENST00000511294.1_Missense_Mutation_p.V89M|EPHA5_ENST00000354839.4_Missense_Mutation_p.V89M|EPHA5_ENST00000432638.2_Missense_Mutation_p.V89M	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	89	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TTTTCATCCACTTCACCAATC	0.318										TSP Lung(17;0.13)																												dbGAP											0													116.0	122.0	120.0					4																	66468004		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.265G>A	4.37:g.66468004C>T	ENSP00000273854:p.Val89Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V89M	ENST00000273854.3	37	c.265	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	C	6.747	0.506585	0.12883	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.09630	2.96;2.96;2.96;2.96	5.68	5.68	0.88126	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.56097	D	0.000038	T	0.23410	0.0566	L	0.37897	1.145	0.45995	D	0.998808	D;B;D;B	0.89917	1.0;0.132;0.999;0.228	D;B;D;B	0.97110	1.0;0.101;1.0;0.114	T	0.03296	-1.1051	10	0.09843	T	0.71	.	19.7821	0.96420	0.0:1.0:0.0:0.0	.	89;89;89;89	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	M	89	ENSP00000273854:V89M;ENSP00000389208:V89M;ENSP00000346899:V89M;ENSP00000427638:V89M	ENSP00000273854:V89M	V	-	1	0	EPHA5	66150599	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.920000	0.70017	2.682000	0.91365	0.655000	0.94253	GTG	EPHA5	-	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom,pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000145242		0.318	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	119	0.00	0	C	NM_004439		66468004	66468004	-1	no_errors	ENST00000273854	ensembl	human	known	69_37n	missense	50	45.65	42	SNP	1.000	T
FAAH2	158584	genome.wustl.edu	37	X	57337119	57337119	+	Silent	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:57337119C>T	ENST00000374900.4	+	3	489	c.369C>T	c.(367-369)ttC>ttT	p.F123F		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	123						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						AATGGCCCTTCCTTGGGGTTC	0.418										HNSCC(52;0.14)																												dbGAP											0													78.0	69.0	72.0					X																	57337119		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.369C>T	X.37:g.57337119C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VT2|Q96N98	Silent	SNP	pfam_Amidase,superfamily_Amidase_dom	p.F123	ENST00000374900.4	37	c.369	CCDS14375.1	X																																																																																			FAAH2	-	pfam_Amidase,superfamily_Amidase_dom	ENSG00000165591		0.418	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	213	0.00	0	C	NM_174912		57337119	57337119	+1	no_errors	ENST00000374900	ensembl	human	known	69_37n	silent	86	47.88	79	SNP	1.000	T
FAM102B	284611	genome.wustl.edu	37	1	109171386	109171386	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:109171386A>G	ENST00000370035.3	+	9	1270	c.930A>G	c.(928-930)atA>atG	p.I310M	FAM102B_ENST00000405454.1_Missense_Mutation_p.I310M	NM_001010883.2	NP_001010883.2	Q5T8I3	F102B_HUMAN	family with sequence similarity 102, member B	310										autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		TAGAGAAAATATTACAAAGTC	0.408																																						dbGAP											0													89.0	80.0	83.0					1																	109171386		2203	4300	6503	-	-	-	SO:0001583	missense	0			CR749397	CCDS30786.2	1p13.3	2012-11-05			ENSG00000162636	ENSG00000162636			27637	protein-coding gene	gene with protein product	"""sym-3 homolog B (C. elegans)"""						Standard	NM_001010883		Approved	DKFZp779B126, SYM-3B	uc010ouy.2	Q5T8I3	OTTHUMG00000010967	ENST00000370035.3:c.930A>G	1.37:g.109171386A>G	ENSP00000359052:p.Ile310Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L1A1|B0QZ46|B0QZ47|Q68DH7	Missense_Mutation	SNP	pfam_NT-C2	p.I310M	ENST00000370035.3	37	c.930	CCDS30786.2	1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.138198	0.56936	.	.	ENSG00000162636	ENST00000370035;ENST00000405454;ENST00000437902	T;T	0.61158	0.13;0.13	5.85	3.45	0.39498	.	0.000000	0.85682	D	0.000000	T	0.68924	0.3054	M	0.83953	2.67	0.51233	D	0.99991	D	0.76494	0.999	D	0.87578	0.998	T	0.73603	-0.3930	10	0.62326	D	0.03	-21.8579	12.6201	0.56597	0.5811:0.4189:0.0:0.0	.	310	Q5T8I3	F102B_HUMAN	M	310	ENSP00000359052:I310M;ENSP00000386084:I310M	ENSP00000359052:I310M	I	+	3	3	FAM102B	108972909	0.916000	0.31088	0.986000	0.45419	0.994000	0.84299	1.743000	0.38258	0.434000	0.26340	0.533000	0.62120	ATA	FAM102B	-	NULL	ENSG00000162636		0.408	FAM102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM102B	HGNC	protein_coding	OTTHUMT00000030188.3	80	0.00	0	A	NM_001010883		109171386	109171386	+1	no_errors	ENST00000370035	ensembl	human	known	69_37n	missense	51	38.55	32	SNP	1.000	G
DENND6A	201627	genome.wustl.edu	37	3	57619004	57619004	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:57619004G>C	ENST00000311128.5	-	15	1411	c.1341C>G	c.(1339-1341)ttC>ttG	p.F447L	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	447					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										ATGGAATGATGAAACTTTGTG	0.323																																						dbGAP											0													67.0	70.0	69.0					3																	57619004		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1341C>G	3.37:g.57619004G>C	ENSP00000311401:p.Phe447Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5T4|Q8N235|Q8TEG8	Missense_Mutation	SNP	pfam_Afi1_N,pfam_Secretory_pathway_prot_Avl9,pfam_DENN_dom	p.F447L	ENST00000311128.5	37	c.1341	CCDS33773.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.326428|4.326428	0.81690|0.81690	.|.	.|.	ENSG00000174839|ENSG00000174839	ENST00000311128|ENST00000471531	.|.	.|.	.|.	5.49|5.49	3.68|3.68	0.42216|0.42216	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75221|0.75221	0.3820|0.3820	M|M	0.87827|0.87827	2.91|2.91	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	D|.	0.79784|.	0.993|.	T|T	0.77278|0.77278	-0.2647|-0.2647	9|5	0.49607|.	T|.	0.09|.	-11.429|-11.429	9.0033|9.0033	0.36094|0.36094	0.2224:0.0:0.7776:0.0|0.2224:0.0:0.7776:0.0	.|.	447|.	Q8IWF6|.	F116A_HUMAN|.	L|D	447|19	.|.	ENSP00000311401:F447L|.	F|H	-|-	3|1	2|0	FAM116A|FAM116A	57594044|57594044	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.366000|5.366000	0.66122|0.66122	1.446000|1.446000	0.47643|0.47643	0.557000|0.557000	0.71058|0.71058	TTC|CAT	FAM116A	-	pfam_Afi1_N	ENSG00000174839		0.323	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM116A	HGNC	protein_coding	OTTHUMT00000351594.1	86	0.00	0	G	NM_152678		57619004	57619004	-1	no_errors	ENST00000311128	ensembl	human	known	69_37n	missense	1	96.43	27	SNP	1.000	C
FAM49A	81553	genome.wustl.edu	37	2	16742265	16742265	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:16742265C>A	ENST00000381323.3	-	9	923	c.703G>T	c.(703-705)Gaa>Taa	p.E235*	FAM49A_ENST00000406434.1_Nonsense_Mutation_p.E235*|FAM49A_ENST00000355549.2_Nonsense_Mutation_p.E235*	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	235						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			TACGGAGTTTCCAGCATGACT	0.403																																						dbGAP											0													206.0	184.0	191.0					2																	16742265		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.703G>T	2.37:g.16742265C>A	ENSP00000370724:p.Glu235*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNZ1|Q53QW2	Nonsense_Mutation	SNP	pfam_DUF1394	p.E235*	ENST00000381323.3	37	c.703	CCDS1688.1	2	.	.	.	.	.	.	.	.	.	.	C	40	7.968313	0.98588	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-17.3764	18.5102	0.90913	0.0:1.0:0.0:0.0	.	.	.	.	X	235	.	ENSP00000347744:E235X	E	-	1	0	FAM49A	16605746	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.697000	0.92050	0.655000	0.94253	GAA	FAM49A	-	pfam_DUF1394	ENSG00000197872		0.403	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49A	HGNC	protein_coding	OTTHUMT00000207203.2	191	0.00	0	C	NM_030797		16742265	16742265	-1	no_errors	ENST00000355549	ensembl	human	known	69_37n	nonsense	14	85.42	82	SNP	1.000	A
FAR2	55711	genome.wustl.edu	37	12	29464069	29464069	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr12:29464069G>T	ENST00000536681.3	+	7	1123	c.877G>T	c.(877-879)Gca>Tca	p.A293S	RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000547116.1_Missense_Mutation_p.A196S|FAR2_ENST00000182377.4_Missense_Mutation_p.A293S	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	293					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						ATGGTATACTGCAGTTCACAG	0.443																																						dbGAP											0													155.0	147.0	150.0					12																	29464069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.877G>T	12.37:g.29464069G>T	ENSP00000443291:p.Ala293Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	pfam_Male_sterile_NAD-bd,pfam_Malesterile,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_Polysac_CapD-like	p.A293S	ENST00000536681.3	37	c.877	CCDS8717.1	12	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555503	0.65425	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	T;T;T	0.34275	1.81;1.81;1.37	4.48	4.48	0.54585	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.56280	1.765	0.58432	D	0.999996	P	0.45986	0.87	B	0.43194	0.411	T	0.13548	-1.0505	10	0.39692	T	0.17	-21.6539	12.8649	0.57934	0.0:0.0:1.0:0.0	.	293	Q96K12	FACR2_HUMAN	S	293;293;196	ENSP00000443291:A293S;ENSP00000182377:A293S;ENSP00000449349:A196S	ENSP00000182377:A293S	A	+	1	0	FAR2	29355336	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.128000	0.94424	2.482000	0.83794	0.655000	0.94253	GCA	FAR2	-	NULL	ENSG00000064763		0.443	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAR2	HGNC	protein_coding	OTTHUMT00000403479.2	147	0.00	0	G	NM_018099		29464069	29464069	+1	no_errors	ENST00000182377	ensembl	human	known	69_37n	missense	10	84.13	53	SNP	1.000	T
FBXL18	80028	genome.wustl.edu	37	7	5540818	5540818	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:5540818G>A	ENST00000382368.3	-	3	1205	c.1082C>T	c.(1081-1083)tCg>tTg	p.S361L	FBXL18_ENST00000453700.3_Missense_Mutation_p.S361L	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	361									FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GCGGAGCAGCGAGTCTGGGGA	0.667																																						dbGAP											0													20.0	27.0	25.0					7																	5540818		2121	4241	6362	-	-	-	SO:0001583	missense	0			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1082C>T	7.37:g.5540818G>A	ENSP00000371805:p.Ser361Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.S361L	ENST00000382368.3	37	c.1082	CCDS43546.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.740|9.740	1.164740|1.164740	0.21538|0.21538	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000458142|ENST00000382368;ENST00000312577;ENST00000453700	.|T;T	.|0.50813	.|0.77;0.73	5.13|5.13	4.24|4.24	0.50183|0.50183	.|.	.|0.452551	.|0.26092	.|N	.|0.026381	T|T	0.26085|0.26085	0.0636|0.0636	N|N	0.14661|0.14661	0.345|0.345	0.18873|0.18873	N|N	0.999989|0.999989	.|B;B	.|0.18013	.|0.025;0.003	.|B;B	.|0.14578	.|0.011;0.003	T|T	0.16364|0.16364	-1.0405|-1.0405	5|10	.|0.12430	.|T	.|0.62	.|.	8.7141|8.7141	0.34401|0.34401	0.08:0.1532:0.7668:0.0|0.08:0.1532:0.7668:0.0	.|.	.|361;361	.|F5H4Z4;Q96ME1-4	.|.;.	C|L	245|361	.|ENSP00000371805:S361L;ENSP00000444797:S361L	.|ENSP00000311990:S361L	R|S	-|-	1|2	0|0	FBXL18|FBXL18	5507344|5507344	0.994000|0.994000	0.37717|0.37717	0.107000|0.107000	0.21349|0.21349	0.809000|0.809000	0.45718|0.45718	3.283000|3.283000	0.51701|0.51701	1.279000|1.279000	0.44446|0.44446	0.650000|0.650000	0.86243|0.86243	CGC|TCG	FBXL18	-	NULL	ENSG00000155034		0.667	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL18	HGNC	protein_coding	OTTHUMT00000324093.1	38	0.00	0	G	NM_024963		5540818	5540818	-1	no_errors	ENST00000453700	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.167	A
FCRL5	83416	genome.wustl.edu	37	1	157514745	157514745	+	Silent	SNP	A	A	C	rs373496324		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:157514745A>C	ENST00000361835.3	-	4	592	c.435T>G	c.(433-435)ctT>ctG	p.L145L	FCRL5_ENST00000356953.4_Silent_p.L145L|FCRL5_ENST00000368191.3_Silent_p.L60L|FCRL5_ENST00000368189.3_Silent_p.L145L|FCRL5_ENST00000368190.3_Silent_p.L145L	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	145					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TTCTTTTATTAAGGAATGCCA	0.418																																						dbGAP											0													139.0	132.0	134.0					1																	157514745		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.435T>G	1.37:g.157514745A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L145	ENST00000361835.3	37	c.435	CCDS1165.1	1																																																																																			FCRL5	-	smart_Ig_sub,smart_Ig_sub2	ENSG00000143297		0.418	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	91	0.00	0	A	NM_031281		157514745	157514745	-1	no_errors	ENST00000356953	ensembl	human	known	69_37n	silent	89	27.05	33	SNP	0.000	C
FGFR2	2263	genome.wustl.edu	37	10	123258034	123258034	+	Missense_Mutation	SNP	A	A	C	rs121913476		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr10:123258034A>C	ENST00000358487.5	-	12	1919	c.1647T>G	c.(1645-1647)aaT>aaG	p.N549K	FGFR2_ENST00000356226.4_Missense_Mutation_p.N432K|FGFR2_ENST00000369061.4_Missense_Mutation_p.N437K|FGFR2_ENST00000369059.1_Missense_Mutation_p.N435K|FGFR2_ENST00000351936.6_Missense_Mutation_p.N547K|FGFR2_ENST00000478859.1_Missense_Mutation_p.N321K|FGFR2_ENST00000346997.2_Missense_Mutation_p.N547K|FGFR2_ENST00000360144.3_Missense_Mutation_p.N461K|FGFR2_ENST00000369060.4_Missense_Mutation_p.N433K|FGFR2_ENST00000357555.5_Missense_Mutation_p.N460K|FGFR2_ENST00000369056.1_Missense_Mutation_p.N550K|FGFR2_ENST00000457416.2_Missense_Mutation_p.N550K	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	549	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> H (in CS; constitutive kinase activity). {ECO:0000269|PubMed:11781872}.		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.N549K(21)|p.N547K(4)|p.N460K(4)|p.N550K(4)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CTCCAAGAAGATTTATGATAT	0.423	N549K(AN3CA_ENDOMETRIUM)|N549K(MFE296_ENDOMETRIUM)	5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																													dbGAP		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	33	Substitution - Missense(33)	endometrium(33)											169.0	151.0	157.0					10																	123258034		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1647T>G	10.37:g.123258034A>C	ENSP00000351276:p.Asn549Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.N550K	ENST00000358487.5	37	c.1650	CCDS31298.1	10	.	.	.	.	.	.	.	.	.	.	A	18.35	3.605558	0.66445	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000369061;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000429361;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.02	2.67	0.31697	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87382	0.6163	N	0.04880	-0.145	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.997;0.999;1.0;1.0;1.0;0.999;1.0;1.0	D	0.85769	0.1354	10	0.87932	D	0	.	7.515	0.27596	0.7605:0.0:0.2395:0.0	.	566;548;460;432;549;461;550;452	D3DRD5;P21802-18;P21802-21;P21802-20;P21802;P21802-22;P21802-17;D3DRD3	.;.;.;.;FGFR2_HUMAN;.;.;.	K	460;550;437;549;432;433;435;141;547;550;547;461;550;550;458	ENSP00000350166:N460K;ENSP00000358057:N437K;ENSP00000351276:N549K;ENSP00000348559:N432K;ENSP00000358056:N433K;ENSP00000358055:N435K;ENSP00000404219:N141K;ENSP00000263451:N547K;ENSP00000410294:N550K;ENSP00000309878:N547K;ENSP00000353262:N461K;ENSP00000358052:N550K;ENSP00000358054:N550K;ENSP00000337665:N458K	ENSP00000337665:N458K	N	-	3	2	FGFR2	123248024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.247000	0.32815	0.269000	0.21961	0.482000	0.46254	AAT	FGFR2	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000066468		0.423	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	HGNC	protein_coding	OTTHUMT00000050715.1	114	0.00	0	A	NM_022976, NM_000141		123258034	123258034	-1	no_errors	ENST00000457416	ensembl	human	known	69_37n	missense	48	64.75	90	SNP	1.000	C
FGFR3	2261	genome.wustl.edu	37	4	1806180	1806181	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:1806180_1806181insC	ENST00000260795.2	+	8	1301_1302	c.1199_1200insC	c.(1198-1203)agccccfs	p.SP400fs	FGFR3_ENST00000340107.4_Frame_Shift_Ins_p.SP402fs|FGFR3_ENST00000440486.2_Frame_Shift_Ins_p.SP400fs|FGFR3_ENST00000412135.2_Intron|FGFR3_ENST00000352904.1_Intron|FGFR3_ENST00000481110.2_Frame_Shift_Ins_p.SP400fs			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	400					alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CGCCTGCGCAGCCCCCCCAAGA	0.629		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																													dbGAP		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1206dupC	4.37:g.1806187_1806187dupC	ENSP00000260795:p.Ser400fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Frame_Shift_Ins	INS	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.K405fs	ENST00000260795.2	37	c.1205_1206	CCDS3353.1	4																																																																																			FGFR3	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt	ENSG00000068078		0.629	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FGFR3	HGNC	protein_coding	OTTHUMT00000241632.2	35	0.00	0	-	NM_000142		1806180	1806181	+1	no_errors	ENST00000340107	ensembl	human	known	69_37n	frame_shift_ins	23	11.54	3	INS	0.996:0.987	C
FKBP10	60681	genome.wustl.edu	37	17	39969300	39969301	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:39969300_39969301insC	ENST00000321562.4	+	1	118_119	c.14_15insC	c.(13-18)ggccccfs	p.GP5fs	LEPREL4_ENST00000393928.1_5'Flank|LEPREL4_ENST00000355468.3_5'Flank	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	5					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		TTCCCCGCGGGCCCCCCCAGCC	0.748																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.21dupC	17.37:g.39969307_39969307dupC	ENSP00000317232:p.Gly5fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Frame_Shift_Ins	INS	pfam_PPIase_FKBP_dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.S8fs	ENST00000321562.4	37	c.14_15	CCDS11409.1	17																																																																																			FKBP10	-	NULL	ENSG00000141756		0.748	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	HGNC	protein_coding	OTTHUMT00000257410.2	11	0.00	0	-	NM_021939		39969300	39969301	+1	no_errors	ENST00000321562	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.001:0.000	C
FOCAD	54914	genome.wustl.edu	37	9	20789501	20789501	+	Missense_Mutation	SNP	C	C	T	rs537746068	byFrequency	TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr9:20789501C>T	ENST00000380249.1	+	13	1713	c.1349C>T	c.(1348-1350)gCg>gTg	p.A450V	SNORA30_ENST00000365319.1_RNA|FOCAD_ENST00000338382.6_Missense_Mutation_p.A450V	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	450						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											GTGATCCCTGCGCCTGCCTTT	0.473													c|||	2	0.000399361	0.0	0.0	5008	,	,		16945	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													156.0	139.0	145.0					9																	20789501		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.1349C>T	9.37:g.20789501C>T	ENSP00000369599:p.Ala450Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.A450V	ENST00000380249.1	37	c.1349	CCDS34993.1	9	.	.	.	.	.	.	.	.	.	.	c	4.366	0.067459	0.08388	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.06371	3.31;3.31	5.71	-5.68	0.02436	.	2.012480	0.01958	N	0.043173	T	0.03695	0.0105	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36504	-0.9745	10	0.28530	T	0.3	-34.6616	11.5935	0.50959	0.0:0.551:0.1096:0.3395	.	450	Q5VW36	K1797_HUMAN	V	450	ENSP00000369599:A450V;ENSP00000344307:A450V	ENSP00000344307:A450V	A	+	2	0	KIAA1797	20779501	0.000000	0.05858	0.001000	0.08648	0.095000	0.18619	-1.344000	0.02639	-1.509000	0.01798	-0.285000	0.09966	GCG	FOCAD	-	NULL	ENSG00000188352		0.473	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	196	0.00	0	C	NM_017794		20789501	20789501	+1	no_errors	ENST00000338382	ensembl	human	known	69_37n	missense	72	47.45	65	SNP	0.005	T
FOCAD	54914	genome.wustl.edu	37	9	20990248	20990248	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr9:20990248delC	ENST00000380249.1	+	44	5495	c.5131delC	c.(5131-5133)ccafs	p.P1711fs	FOCAD_ENST00000605086.1_Frame_Shift_Del_p.P1147fs|FOCAD_ENST00000338382.6_Frame_Shift_Del_p.P1711fs	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1711						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CCCGGCTGGGCCAGTACCAAG	0.592																																						dbGAP											0													52.0	49.0	50.0					9																	20990248		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.5131delC	9.37:g.20990248delC	ENSP00000369599:p.Pro1711fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Frame_Shift_Del	DEL	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.P1711fs	ENST00000380249.1	37	c.5131	CCDS34993.1	9																																																																																			FOCAD	-	pfam_DUF3028	ENSG00000188352		0.592	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	40	0.00	0	C	NM_017794		20990248	20990248	+1	no_errors	ENST00000338382	ensembl	human	known	69_37n	frame_shift_del	26	18.75	6	DEL	0.001	-
FRMD3	257019	genome.wustl.edu	37	9	85950510	85950510	+	Missense_Mutation	SNP	T	T	C	rs111374752	byFrequency	TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr9:85950510T>C	ENST00000304195.3	-	6	723	c.517A>G	c.(517-519)Atc>Gtc	p.I173V	FRMD3_ENST00000376438.1_Missense_Mutation_p.I173V	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	173	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						AACTCACTGATGTAATTCTCA	0.353																																						dbGAP											0													111.0	98.0	102.0					9																	85950510		1850	4092	5942	-	-	-	SO:0001583	missense	0			AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.517A>G	9.37:g.85950510T>C	ENSP00000303508:p.Ile173Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.I173V	ENST00000304195.3	37	c.517	CCDS43840.1	9	.	.	.	.	.	.	.	.	.	.	T	2.913	-0.224868	0.06022	.	.	ENSG00000172159	ENST00000376438;ENST00000304195;ENST00000376422	T;T	0.71461	-0.57;-0.57	5.46	3.11	0.35812	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.188182	0.56097	N	0.000029	T	0.41604	0.1166	N	0.04275	-0.24	0.54753	D	0.999986	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.003	T	0.17684	-1.0361	10	0.07175	T	0.84	.	8.619	0.33849	0.0:0.2201:0.0:0.7799	.	173;173	A2A2Y4;A2A2Y4-2	FRMD3_HUMAN;.	V	173;173;69	ENSP00000365621:I173V;ENSP00000303508:I173V	ENSP00000303508:I173V	I	-	1	0	FRMD3	85140330	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.568000	0.23623	0.382000	0.24878	0.482000	0.46254	ATC	FRMD3	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000172159		0.353	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	HGNC	protein_coding	OTTHUMT00000157355.1	221	0.00	0	T	NM_174938		85950510	85950510	-1	no_errors	ENST00000304195	ensembl	human	known	69_37n	missense	94	49.73	93	SNP	1.000	C
FRMPD4	9758	genome.wustl.edu	37	X	12736124	12736124	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:12736124A>G	ENST00000380682.1	+	16	3685	c.3179A>G	c.(3178-3180)gAg>gGg	p.E1060G		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1060					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						ATGGAGGAGGAGGCCAGTGGT	0.507																																						dbGAP											0													103.0	85.0	91.0					X																	12736124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3179A>G	X.37:g.12736124A>G	ENSP00000370057:p.Glu1060Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X9|O15032	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.E1060G	ENST00000380682.1	37	c.3179	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	A	2.103	-0.405550	0.04832	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.06449	3.3	5.49	4.33	0.51752	.	0.356906	0.31145	N	0.008168	T	0.04998	0.0134	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34104	-0.9842	10	0.59425	D	0.04	-2.16	8.2045	0.31446	0.9094:0.0:0.0906:0.0	.	1052;1060	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	G	1060;1051;1049	ENSP00000370057:E1060G	ENSP00000304583:E1049G	E	+	2	0	FRMPD4	12646045	0.996000	0.38824	0.401000	0.26359	0.112000	0.19704	3.660000	0.54496	0.742000	0.32697	0.486000	0.48141	GAG	FRMPD4	-	NULL	ENSG00000169933		0.507	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	143	0.00	0	A	XM_045712		12736124	12736124	+1	no_errors	ENST00000380682	ensembl	human	known	69_37n	missense	59	44.34	47	SNP	0.003	G
G2E3	55632	genome.wustl.edu	37	14	31077124	31077124	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr14:31077124G>T	ENST00000206595.6	+	12	1503	c.1349G>T	c.(1348-1350)gGc>gTc	p.G450V	G2E3_ENST00000553504.1_Missense_Mutation_p.G480V|G2E3_ENST00000438909.2_Missense_Mutation_p.G404V|G2E3_ENST00000544007.1_3'UTR	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	450	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						TATGAAGCTGGCAAAATGCTT	0.323																																						dbGAP											0													62.0	58.0	60.0					14																	31077124		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1349G>T	14.37:g.31077124G>T	ENSP00000206595:p.Gly450Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_HECT,pfscan_HECT	p.G450V	ENST00000206595.6	37	c.1349	CCDS9638.1	14	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901716	0.92035	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504	D;D;D	0.91124	-2.79;-2.79;-2.79	5.57	5.57	0.84162	HECT (2);	0.000000	0.85682	D	0.000000	D	0.95370	0.8497	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95490	0.8568	10	0.87932	D	0	-8.2423	19.5583	0.95363	0.0:0.0:1.0:0.0	.	450	Q7L622	G2E3_HUMAN	V	450;404;480	ENSP00000206595:G450V;ENSP00000391068:G404V;ENSP00000451653:G480V	ENSP00000206595:G450V	G	+	2	0	G2E3	30146875	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.872000	0.92352	2.602000	0.87976	0.591000	0.81541	GGC	G2E3	-	pfam_HECT,superfamily_HECT,smart_HECT	ENSG00000092140		0.323	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G2E3	HGNC	protein_coding	OTTHUMT00000276613.2	137	0.00	0	G	NM_017769		31077124	31077124	+1	no_errors	ENST00000206595	ensembl	human	known	69_37n	missense	83	40.71	57	SNP	1.000	T
GGN	199720	genome.wustl.edu	37	19	38877092	38877093	+	Frame_Shift_Ins	INS	-	-	C	rs569448235		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:38877092_38877093insC	ENST00000334928.6	-	3	941_942	c.809_810insG	c.(808-810)ggcfs	p.G270fs	AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank|GGN_ENST00000591809.1_Intron	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	270	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CGCCTCCGCCGCCCCCCAGCGA	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.810dupG	19.37:g.38877098_38877098dupC	ENSP00000334940:p.Gly270fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTU6|Q86UU4|Q8NAA1	Frame_Shift_Ins	INS	NULL	p.G271fs	ENST00000334928.6	37	c.810_809	CCDS12516.1	19																																																																																			GGN	-	NULL	ENSG00000179168		0.653	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGN	HGNC	protein_coding	OTTHUMT00000459205.1	13	0.00	0	-	NM_152657		38877092	38877093	-1	no_errors	ENST00000334928	ensembl	human	known	69_37n	frame_shift_ins	13	18.75	3	INS	0.648:0.644	C
GNAT3	346562	genome.wustl.edu	37	7	80108225	80108225	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:80108225C>T	ENST00000398291.3	-	4	486	c.393G>A	c.(391-393)tgG>tgA	p.W131*	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	131					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						CTGGATCTCTCCACAGCCGTT	0.453																																						dbGAP											0													151.0	143.0	146.0					7																	80108225		1882	4125	6007	-	-	-	SO:0001587	stop_gained	0				CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.393G>A	7.37:g.80108225C>T	ENSP00000381339:p.Trp131*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1B2|A4D1B3|B9EJG5	Nonsense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.W131*	ENST00000398291.3	37	c.393	CCDS47625.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.383415	0.97524	.	.	ENSG00000214415	ENST00000398291	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5918	0.91215	0.0:1.0:0.0:0.0	.	.	.	.	X	131	.	.	W	-	3	0	GNAT3	79946161	1.000000	0.71417	0.935000	0.37517	0.936000	0.57629	7.593000	0.82686	2.490000	0.84030	0.650000	0.86243	TGG	GNAT3	-	pfam_Gprotein_alpha_su,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000214415		0.453	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAT3	HGNC	protein_coding	OTTHUMT00000339909.3	241	0.00	0	C	XM_294370		80108225	80108225	-1	no_errors	ENST00000398291	ensembl	human	known	69_37n	nonsense	141	28.43	56	SNP	1.000	T
GPC5	2262	genome.wustl.edu	37	13	92345621	92345621	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr13:92345621G>A	ENST00000377067.3	+	3	878	c.506G>A	c.(505-507)aGt>aAt	p.S169N		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	169					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTTTTTGACAGTCTTTTTCCT	0.468																																						dbGAP											0													145.0	147.0	146.0					13																	92345621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.506G>A	13.37:g.92345621G>A	ENSP00000366267:p.Ser169Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.S169N	ENST00000377067.3	37	c.506	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	G	9.739	1.164363	0.21538	.	.	ENSG00000179399	ENST00000377067	T	0.50813	0.73	5.24	3.46	0.39613	.	0.272209	0.42420	N	0.000719	T	0.37972	0.1023	L	0.45581	1.43	0.28255	N	0.925079	B	0.17465	0.022	B	0.25405	0.06	T	0.37753	-0.9692	10	0.66056	D	0.02	.	5.0187	0.14350	0.0906:0.2225:0.5673:0.1195	.	169	P78333	GPC5_HUMAN	N	169	ENSP00000366267:S169N	ENSP00000366267:S169N	S	+	2	0	GPC5	91143622	0.991000	0.36638	1.000000	0.80357	0.429000	0.31625	1.372000	0.34261	1.201000	0.43203	0.591000	0.81541	AGT	GPC5	-	pfam_Glypican	ENSG00000179399		0.468	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	134	0.00	0	G	NM_004466		92345621	92345621	+1	no_errors	ENST00000377067	ensembl	human	known	69_37n	missense	55	39.56	36	SNP	0.991	A
GPR132	29933	genome.wustl.edu	37	14	105517621	105517621	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr14:105517621T>C	ENST00000329797.3	-	4	1764	c.853A>G	c.(853-855)Agg>Ggg	p.R285G	GPR132_ENST00000546679.1_5'Flank|GPR132_ENST00000392585.2_Missense_Mutation_p.R276G|GPR132_ENST00000539291.2_Missense_Mutation_p.R285G	NM_001278694.1|NM_001278696.1|NM_013345.2	NP_001265623.1|NP_001265625.1|NP_037477.1	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	285					G1/S transition of mitotic cell cycle (GO:0000082)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	18		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		GTGTACAGCCTTTCCTCCAAG	0.587																																						dbGAP											0													88.0	78.0	82.0					14																	105517621		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF083955	CCDS9997.1, CCDS61567.1	14q32.3	2012-08-21			ENSG00000183484	ENSG00000183484		"""GPCR / Class A : Orphans"""	17482	protein-coding gene	gene with protein product	"""G2 accumulation"""	606167				12086852	Standard	NM_013345		Approved	G2A	uc001yqd.3	Q9UNW8	OTTHUMG00000140173	ENST00000329797.3:c.853A>G	14.37:g.105517621T>C	ENSP00000328818:p.Arg285Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7X7|B4E144|Q9BSU2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_G2A_lysphc_rcpt,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.R285G	ENST00000329797.3	37	c.853	CCDS9997.1	14	.	.	.	.	.	.	.	.	.	.	T	3.956	-0.011266	0.07727	.	.	ENSG00000183484	ENST00000329797;ENST00000392585;ENST00000539291	T;T;T	0.72051	-0.62;-0.62;-0.62	4.98	-2.82	0.05787	GPCR, rhodopsin-like superfamily (1);	0.875003	0.10126	N	0.712699	T	0.56337	0.1978	L	0.31664	0.95	0.09310	N	1	B;B	0.31351	0.32;0.32	B;B	0.31390	0.129;0.129	T	0.35076	-0.9803	10	0.15066	T	0.55	.	15.942	0.79763	0.0:0.0:0.6513:0.3487	.	276;285	B4E144;Q9UNW8	.;GP132_HUMAN	G	285;276;285	ENSP00000328818:R285G;ENSP00000376364:R276G;ENSP00000438094:R285G	ENSP00000328818:R285G	R	-	1	2	GPR132	104588666	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.356000	0.07661	-0.835000	0.04234	0.460000	0.39030	AGG	GPR132	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183484		0.587	GPR132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR132	HGNC	protein_coding	OTTHUMT00000409278.1	69	0.00	0	T	NM_013345		105517621	105517621	-1	no_errors	ENST00000329797	ensembl	human	known	69_37n	missense	42	30.65	19	SNP	0.000	C
GPR179	440435	genome.wustl.edu	37	17	36489841	36489841	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:36489841G>A	ENST00000342292.4	-	9	1885	c.1865C>T	c.(1864-1866)aCg>aTg	p.T622M		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	622					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CAGAGCCAGCGTGGTGGTGAC	0.647											OREG0024354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													80.0	97.0	91.0					17																	36489841		2175	4273	6448	-	-	-	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.1865C>T	17.37:g.36489841G>A	ENSP00000345060:p.Thr622Met	Somatic	863	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.T622M	ENST00000342292.4	37	c.1865	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	G	17.68	3.450014	0.63290	.	.	ENSG00000188888	ENST00000342292	D	0.88586	-2.4	5.02	5.02	0.67125	GPCR, family 3, C-terminal (2);	0.000000	0.64402	D	0.000002	D	0.93736	0.7998	M	0.69248	2.105	0.51012	D	0.999907	D	0.89917	1.0	D	0.97110	1.0	D	0.93974	0.7252	10	0.72032	D	0.01	-16.6544	17.6135	0.88061	0.0:0.0:1.0:0.0	.	622	Q6PRD1	GP179_HUMAN	M	622	ENSP00000345060:T622M	ENSP00000345060:T622M	T	-	2	0	GPR179	33743367	1.000000	0.71417	0.963000	0.40424	0.088000	0.18126	8.862000	0.92283	2.769000	0.95229	0.563000	0.77884	ACG	GPR179	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000188888		0.647	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	167	0.00	0	G			36489841	36489841	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	missense	9	89.53	77	SNP	0.999	A
HELQ	113510	genome.wustl.edu	37	4	84350883	84350883	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:84350883T>G	ENST00000295488.3	-	12	2474	c.2312A>C	c.(2311-2313)gAt>gCt	p.D771A	HELQ_ENST00000510985.1_Missense_Mutation_p.D704A	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	771					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						ATAGATGTCATCAAGATTCGT	0.318								Other identified genes with known or suspected DNA repair function																														dbGAP											0													39.0	35.0	36.0					4																	84350883		2200	4298	6498	-	-	-	SO:0001583	missense	0			AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.2312A>C	4.37:g.84350883T>G	ENSP00000295488:p.Asp771Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D771A	ENST00000295488.3	37	c.2312	CCDS3603.1	4	.	.	.	.	.	.	.	.	.	.	T	1.802	-0.476906	0.04414	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.45276	0.9;0.9	5.22	-2.28	0.06826	.	0.440664	0.25394	N	0.030999	T	0.23249	0.0562	N	0.17082	0.46	0.09310	N	0.999999	B;B	0.24533	0.105;0.001	B;B	0.24394	0.053;0.003	T	0.14924	-1.0455	10	0.31617	T	0.26	-16.2877	12.0929	0.53737	0.0:0.183:0.0:0.817	.	704;771	E3W980;Q8TDG4	.;HELQ_HUMAN	A	771;704	ENSP00000295488:D771A;ENSP00000424539:D704A	ENSP00000295488:D771A	D	-	2	0	HELQ	84569907	0.003000	0.15002	0.105000	0.21289	0.385000	0.30292	-0.010000	0.12743	-0.437000	0.07243	-0.456000	0.05471	GAT	HELQ	-	NULL	ENSG00000163312		0.318	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELQ	HGNC	protein_coding	OTTHUMT00000252810.1	53	0.00	0	T	NM_133636		84350883	84350883	-1	no_errors	ENST00000295488	ensembl	human	known	69_37n	missense	38	42.42	28	SNP	0.186	G
HERC2P4	100289574	genome.wustl.edu	37	16	32190861	32190861	+	IGR	SNP	G	G	T	rs137994127	byFrequency	TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:32190861G>T								HERC2P4 (7973 upstream) : RP11-17M15.1 (8792 downstream)																							TCTCACTGGGGCTCAGAGGGC	0.438													g|||	229	0.0457268	0.0038	0.0663	5008	,	,		31005	0.002		0.1561	False		,,,				2504	0.0194					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.32190861G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		16	131	0.059981684981684984	3	0.006097560975609756	22	0.06077348066298342	0	0.0	106	0.13984168865435356	.	0.891	-0.725409	0.03158	.	.	ENSG00000230267	ENST00000433784	.	.	.	2.36	-1.16	0.09678	.	.	.	.	.	T	0.00384	0.0012	.	.	.	.	.	.	.	.	.	.	.	.	T	0.20840	-1.0263	4	0.72032	D	0.01	.	5.8775	0.18836	0.6036:0.0:0.3964:0.0	.	.	.	.	R	107	.	ENSP00000402538:S107R	S	-	3	2	AC133485.1	32098362	1.000000	0.71417	0.997000	0.53966	0.057000	0.15508	1.668000	0.37481	-0.083000	0.12618	0.194000	0.17425	AGC	HERC2P4	-	-	ENSG00000230267	0	0.438					HERC2P4	HGNC			35	0.00	0	G			32190861	32190861	-1	no_errors	ENST00000566591	ensembl	human	known	69_37n	rna	65	12.16	9	SNP	1.000	T
HLA-B	3106	genome.wustl.edu	37	6	31322985	31322985	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:31322985G>C	ENST00000412585.2	-	5	939	c.911C>G	c.(910-912)tCc>tGc	p.S304C		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	304	Connecting peptide.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GGGGACGGTGGACTGGGAAGA	0.592									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																													dbGAP											0													70.0	70.0	70.0					6																	31322985		1511	2709	4220	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.911C>G	6.37:g.31322985G>C	ENSP00000399168:p.Ser304Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q29764	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.S304C	ENST00000412585.2	37	c.911	CCDS34394.1	6	.	.	.	.	.	.	.	.	.	.	N	9.710	1.156836	0.21454	.	.	ENSG00000234745	ENST00000412585;ENST00000428231	T	0.00675	5.88	3.69	0.739	0.18324	Immunoglobulin-like fold (1);	0.888381	0.09201	U	0.834670	T	0.02230	0.0069	H	0.98027	4.13	0.09310	N	1	D	0.58970	0.984	P	0.56788	0.806	T	0.15521	-1.0434	10	0.87932	D	0	.	6.0502	0.19781	0.1099:0.3675:0.5226:0.0	.	304	P01889	1B07_HUMAN	C	304;183	ENSP00000399168:S304C	ENSP00000399168:S304C	S	-	2	0	HLA-B	31430964	0.002000	0.14202	0.000000	0.03702	0.055000	0.15305	1.064000	0.30579	-0.094000	0.12374	0.442000	0.29010	TCC	HLA-B	-	NULL	ENSG00000234745		0.592	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	21	0.00	0	G	NM_005514		31322985	31322985	-1	no_errors	ENST00000412585	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.002	C
HSPA14	51182	genome.wustl.edu	37	10	14913531	14913531	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr10:14913531G>A	ENST00000378372.3	+	14	1695	c.1456G>A	c.(1456-1458)Gga>Aga	p.G486R		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	486					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						GTTTAGGGATGGATCTTTACA	0.323																																						dbGAP											0													72.0	73.0	72.0					10																	14913531		2203	4291	6494	-	-	-	SO:0001583	missense	0			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.1456G>A	10.37:g.14913531G>A	ENSP00000367623:p.Gly486Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.G486R	ENST00000378372.3	37	c.1456	CCDS7103.1	10	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703329	0.88924	.	.	ENSG00000187522	ENST00000378372	T	0.05925	3.37	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.42268	0.1195	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60979	-0.7155	10	0.87932	D	0	-21.7785	19.8113	0.96547	0.0:0.0:1.0:0.0	.	486	Q0VDF9	HSP7E_HUMAN	R	486	ENSP00000367623:G486R	ENSP00000367623:G486R	G	+	1	0	HSPA14	14953537	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.918000	0.87506	2.690000	0.91761	0.655000	0.94253	GGA	HSPA14	-	pfam_Hsp_70_fam	ENSG00000187522		0.323	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA14	HGNC	protein_coding	OTTHUMT00000046910.1	92	0.00	0	G	NM_016299		14913531	14913531	+1	no_errors	ENST00000378372	ensembl	human	known	69_37n	missense	43	36.76	25	SNP	1.000	A
ID2	3398	genome.wustl.edu	37	2	8822605	8822605	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:8822605delA	ENST00000234091.4	+	3	1170	c.310delA	c.(310-312)accfs	p.T105fs	ID2_ENST00000331129.3_Frame_Shift_Del_p.T105fs|ID2_ENST00000396290.1_Frame_Shift_Del_p.T105fs|AC011747.7_ENST00000455965.1_RNA			Q02363	ID2_HUMAN	inhibitor of DNA binding 2, dominant negative helix-loop-helix protein	105					adipose tissue development (GO:0060612)|bundle of His development (GO:0003166)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|embryonic digestive tract morphogenesis (GO:0048557)|endodermal digestive tract morphogenesis (GO:0061031)|entrainment of circadian clock by photoperiod (GO:0043153)|enucleate erythrocyte differentiation (GO:0043353)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|locomotor rhythm (GO:0045475)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|membranous septum morphogenesis (GO:0003149)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|natural killer cell differentiation (GO:0001779)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of DNA binding (GO:0043392)|negative regulation of gene expression (GO:0010629)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate commitment (GO:0048663)|olfactory bulb development (GO:0021772)|oligodendrocyte development (GO:0014003)|Peyer's patch development (GO:0048541)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of lipid metabolic process (GO:0019216)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|protein complex (GO:0043234)	ion channel binding (GO:0044325)			breast(1)|large_intestine(1)|lung(1)|prostate(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GACGCCGCTGACCACCCTCAA	0.647																																						dbGAP											0													48.0	55.0	53.0					2																	8822605		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS1659.1	2p25	2013-05-21			ENSG00000115738	ENSG00000115738		"""Basic helix-loop-helix proteins"""	5361	protein-coding gene	gene with protein product	"""cell growth-inhibiting gene 8"""	600386				8294468	Standard	NM_002166		Approved	GIG8, bHLHb26	uc002qza.3	Q02363	OTTHUMG00000112454	ENST00000234091.4:c.310delA	2.37:g.8822605delA	ENSP00000234091:p.Thr105fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.T104fs	ENST00000234091.4	37	c.310	CCDS1659.1	2																																																																																			ID2	-	superfamily_HLH_DNA-bd	ENSG00000115738		0.647	ID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID2	HGNC	protein_coding	OTTHUMT00000231925.2	34	0.00	0	A	NM_002166		8822605	8822605	+1	no_errors	ENST00000234091	ensembl	human	known	69_37n	frame_shift_del	9	52.63	10	DEL	1.000	-
ITGA10	8515	genome.wustl.edu	37	1	145535834	145535834	+	Silent	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:145535834C>G	ENST00000369304.3	+	16	2197	c.2022C>G	c.(2020-2022)gtC>gtG	p.V674V	ITGA10_ENST00000539363.1_Silent_p.V531V|ITGA10_ENST00000538811.1_Silent_p.V543V	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	674					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAGAGGCAGTCTGTCTGACTG	0.572																																						dbGAP											0													100.0	91.0	94.0					1																	145535834		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.2022C>G	1.37:g.145535834C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.V674	ENST00000369304.3	37	c.2022	CCDS918.1	1																																																																																			ITGA10	-	pfam_Integrin_alpha-2	ENSG00000143127		0.572	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	133	0.00	0	C	NM_003637		145535834	145535834	+1	no_errors	ENST00000369304	ensembl	human	known	69_37n	silent	68	26.88	25	SNP	1.000	G
INTS7	25896	genome.wustl.edu	37	1	212126020	212126020	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:212126020C>T	ENST00000366994.3	-	17	2311	c.2207G>A	c.(2206-2208)gGa>gAa	p.G736E	INTS7_ENST00000366992.3_Missense_Mutation_p.G736E|INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000440600.2_Missense_Mutation_p.G687E|INTS7_ENST00000366993.3_Missense_Mutation_p.G736E	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	736					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		ATGGGCTGTTCCAGTAGATCC	0.363																																						dbGAP											0													102.0	97.0	99.0					1																	212126020		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.2207G>A	1.37:g.212126020C>T	ENSP00000355961:p.Gly736Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G736E	ENST00000366994.3	37	c.2207	CCDS1501.1	1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290797	0.23564	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.42131	1.02;0.98;1.04;1.03	5.58	4.66	0.58398	.	0.046419	0.85682	D	0.000000	T	0.59197	0.2176	L	0.54323	1.7	0.80722	D	1	P;P;D;D	0.89917	0.933;0.933;1.0;1.0	P;P;D;D	0.91635	0.624;0.624;0.999;0.999	T	0.56117	-0.8032	10	0.28530	T	0.3	-19.5345	16.4681	0.84090	0.0:0.8686:0.1314:0.0	.	687;736;736;736	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	E	736;736;736;687	ENSP00000355961:G736E;ENSP00000355960:G736E;ENSP00000355959:G736E;ENSP00000388908:G687E	ENSP00000355959:G736E	G	-	2	0	INTS7	210192643	1.000000	0.71417	0.078000	0.20375	0.861000	0.49209	5.454000	0.66651	1.353000	0.45828	-0.310000	0.09108	GGA	INTS7	-	NULL	ENSG00000143493		0.363	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	HGNC	protein_coding	OTTHUMT00000090142.1	74	0.00	0	C	NM_015434		212126020	212126020	-1	no_errors	ENST00000366994	ensembl	human	known	69_37n	missense	86	40.41	59	SNP	0.997	T
KCND2	3751	genome.wustl.edu	37	7	120387849	120387849	+	Silent	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:120387849A>G	ENST00000331113.4	+	6	2795	c.1830A>G	c.(1828-1830)ggA>ggG	p.G610G	RP4-797C5.2_ENST00000450480.1_RNA	NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	610					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CACCAGAAGGAGACGATAGGC	0.423																																						dbGAP											0													83.0	73.0	76.0					7																	120387849		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1830A>G	7.37:g.120387849A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.G610	ENST00000331113.4	37	c.1830	CCDS5776.1	7																																																																																			KCND2	-	NULL	ENSG00000184408		0.423	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	115	0.00	0	A	NM_012281		120387849	120387849	+1	no_errors	ENST00000331113	ensembl	human	known	69_37n	silent	60	36.17	34	SNP	1.000	G
KDM5A	5927	genome.wustl.edu	37	12	427354	427354	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr12:427354C>G	ENST00000399788.2	-	19	3177	c.2815G>C	c.(2815-2817)Gag>Cag	p.E939Q	KDM5A_ENST00000382815.4_Missense_Mutation_p.E939Q	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	939					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						ATTGCTTTCTCCACAGCATGG	0.488			T	NUP98	AML																																	dbGAP		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0													145.0	138.0	140.0					12																	427354		1915	4136	6051	-	-	-	SO:0001583	missense	0				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.2815G>C	12.37:g.427354C>G	ENSP00000382688:p.Glu939Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.E939Q	ENST00000399788.2	37	c.2815	CCDS41736.1	12	.	.	.	.	.	.	.	.	.	.	C	24.9	4.583649	0.86748	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760	T;T;T	0.47869	0.83;0.83;0.83	4.72	4.72	0.59763	Lysine-specific demethylase-like domain (1);	0.056199	0.64402	D	0.000001	T	0.66973	0.2844	M	0.75615	2.305	0.58432	D	0.999999	P;B;D	0.62365	0.824;0.182;0.991	P;B;P	0.61658	0.607;0.217;0.892	T	0.72040	-0.4410	10	0.72032	D	0.01	-6.4687	17.8679	0.88801	0.0:1.0:0.0:0.0	.	939;939;939	F5H1F7;P29375;P29375-2	.;KDM5A_HUMAN;.	Q	558;898;939;939;558	ENSP00000382688:E939Q;ENSP00000372265:E939Q;ENSP00000440622:E558Q	ENSP00000261253:E558Q	E	-	1	0	KDM5A	297615	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.243000	0.78219	2.459000	0.83118	0.591000	0.81541	GAG	KDM5A	-	pfam_Lys_sp_deMease_like_dom	ENSG00000073614		0.488	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1	125	0.00	0	C	NM_005056		427354	427354	-1	no_errors	ENST00000399788	ensembl	human	known	69_37n	missense	12	69.05	29	SNP	1.000	G
KIAA0232	9778	genome.wustl.edu	37	4	6865760	6865760	+	Silent	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:6865760A>G	ENST00000307659.5	+	7	4106	c.3651A>G	c.(3649-3651)gaA>gaG	p.E1217E	KIAA0232_ENST00000425103.1_Silent_p.E1217E	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	1217							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						GCATGAATGAATCCCTGGAAA	0.383																																						dbGAP											0													61.0	58.0	59.0					4																	6865760		1820	4081	5901	-	-	-	SO:0001819	synonymous_variant	0			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.3651A>G	4.37:g.6865760A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D2	Silent	SNP	NULL	p.E1217	ENST00000307659.5	37	c.3651	CCDS43209.1	4																																																																																			KIAA0232	-	NULL	ENSG00000170871		0.383	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	HGNC	protein_coding	OTTHUMT00000359102.2	118	0.00	0	A	NM_014743		6865760	6865760	+1	no_errors	ENST00000307659	ensembl	human	known	69_37n	silent	38	49.33	37	SNP	0.003	G
KIAA1210	57481	genome.wustl.edu	37	X	118220634	118220634	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:118220634C>A	ENST00000402510.2	-	11	4558	c.4559G>T	c.(4558-4560)aGc>aTc	p.S1520I		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1520										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CTGGGAAGTGCTTCTGATTTT	0.493																																						dbGAP											0													76.0	70.0	72.0					X																	118220634		1890	4112	6002	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4559G>T	X.37:g.118220634C>A	ENSP00000384670:p.Ser1520Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.S1520I	ENST00000402510.2	37	c.4559	CCDS48156.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.08|13.08	2.129143|2.129143	0.37533|0.37533	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.12774	.|2.65	4.17|4.17	2.29|2.29	0.28610|0.28610	.|.	.|.	.|.	.|.	.|.	T|T	0.17874|0.17874	0.0429|0.0429	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	.|D	.|0.54047	.|0.964	.|P	.|0.49047	.|0.599	T|T	0.11012|0.11012	-1.0605|-1.0605	5|9	.|0.35671	.|T	.|0.21	.|.	6.1656|6.1656	0.20388|0.20388	0.1935:0.5743:0.2322:0.0|0.1935:0.5743:0.2322:0.0	.|.	.|1520	.|Q9ULL0	.|K1210_HUMAN	N|I	926|1520	.|ENSP00000384670:S1520I	.|ENSP00000384670:S1520I	K|S	-|-	3|2	2|0	KIAA1210|RP13-347D8.6	118104662|118104662	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.058000|0.058000	0.15608|0.15608	0.143000|0.143000	0.16115|0.16115	0.296000|0.296000	0.22592|0.22592	0.513000|0.513000	0.50165|0.50165	AAG|AGC	KIAA1210	-	NULL	ENSG00000250423		0.493	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	188	0.00	0	C	NM_020721		118220634	118220634	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	73	37.07	43	SNP	0.006	A
KIF5C	3800	genome.wustl.edu	37	2	149868090	149868090	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:149868090C>A	ENST00000435030.1	+	25	3142	c.2774C>A	c.(2773-2775)cCc>cAc	p.P925H	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000397413.1_Missense_Mutation_p.P693H|KIF5C_ENST00000414838.2_Missense_Mutation_p.P830H			O60282	KIF5C_HUMAN	kinesin family member 5C	925	Globular.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		ACAGCCAAGCCCATCCGCCCC	0.498																																						dbGAP											0													52.0	53.0	53.0					2																	149868090		1873	4112	5985	-	-	-	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2774C>A	2.37:g.149868090C>A	ENSP00000393379:p.Pro925His	Somatic		WXS	Illumina GAIIx	Phase_IV	O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P925H	ENST00000435030.1	37	c.2774		2	.	.	.	.	.	.	.	.	.	.	C	31	5.082933	0.94050	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	T;T;T	0.80994	-1.1;-1.44;-1.42	6.07	6.07	0.98685	.	0.061291	0.64402	D	0.000003	D	0.90239	0.6948	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.73380	0.98;0.884	D	0.88846	0.3316	8	.	.	.	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	925;233	O60282;Q59GB8	KIF5C_HUMAN;.	H	925;830;828;693	ENSP00000393379:P925H;ENSP00000410115:P830H;ENSP00000380560:P693H	.	P	+	2	0	KIF5C	149576336	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.625000	0.83145	2.884000	0.98904	0.655000	0.94253	CCC	KIF5C	-	NULL	ENSG00000168280		0.498	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	80	0.00	0	C	NM_004522		149868090	149868090	+1	no_errors	ENST00000435030	ensembl	human	known	69_37n	missense	60	33.33	30	SNP	1.000	A
LGSN	51557	genome.wustl.edu	37	6	63990398	63990398	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:63990398G>A	ENST00000370657.4	-	4	1091	c.1058C>T	c.(1057-1059)gCt>gTt	p.A353V	LGSN_ENST00000370658.5_3'UTR			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	353					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GCTGAGCGCAGCAGAGTGCTT	0.502																																						dbGAP											0													114.0	114.0	114.0					6																	63990398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.1058C>T	6.37:g.63990398G>A	ENSP00000359691:p.Ala353Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.A353V	ENST00000370657.4	37	c.1058	CCDS4964.1	6	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286742	0.59867	.	.	ENSG00000146166	ENST00000370657	D	0.86230	-2.09	5.77	5.77	0.91146	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90590	0.7050	M	0.75447	2.3	0.80722	D	1	P	0.52316	0.952	P	0.58266	0.836	D	0.87940	0.2716	10	0.30078	T	0.28	-20.5815	18.9741	0.92728	0.0:0.0:1.0:0.0	.	353	Q5TDP6	LGSN_HUMAN	V	353	ENSP00000359691:A353V	ENSP00000359691:A353V	A	-	2	0	LGSN	64048357	1.000000	0.71417	0.950000	0.38849	0.008000	0.06430	7.603000	0.82811	2.729000	0.93468	0.655000	0.94253	GCT	LGSN	-	pfam_Gln_synth_cat_dom	ENSG00000146166		0.502	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGSN	HGNC	protein_coding	OTTHUMT00000041076.2	51	0.00	0	G	NM_016571		63990398	63990398	-1	no_errors	ENST00000370657	ensembl	human	known	69_37n	missense	30	37.50	18	SNP	1.000	A
LIG3	3980	genome.wustl.edu	37	17	33318105	33318105	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:33318105C>G	ENST00000378526.4	+	5	1146	c.1013C>G	c.(1012-1014)cCa>cGa	p.P338R	LIG3_ENST00000262327.5_Missense_Mutation_p.P338R	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	338					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	AACTGCAACCCAGATGATATG	0.507								Other BER factors																														dbGAP											0													95.0	86.0	89.0					17																	33318105		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1013C>G	17.37:g.33318105C>G	ENSP00000367787:p.Pro338Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold-like,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.P338R	ENST00000378526.4	37	c.1013	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	C	12.53	1.966731	0.34659	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.16196	2.36;2.36	5.65	4.63	0.57726	DNA ligase, ATP-dependent, N-terminal (3);	0.228542	0.46145	D	0.000312	T	0.10637	0.0260	N	0.14661	0.345	0.38092	D	0.937005	B;B;B	0.16802	0.019;0.019;0.019	B;B;B	0.29440	0.102;0.102;0.102	T	0.21075	-1.0256	10	0.15066	T	0.55	-0.5124	11.5051	0.50461	0.2969:0.7031:0.0:0.0	.	338;338;338	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	R	338	ENSP00000367787:P338R;ENSP00000262327:P338R	ENSP00000262327:P338R	P	+	2	0	LIG3	30342218	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.119000	0.57891	2.941000	0.99782	0.655000	0.94253	CCA	LIG3	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep	ENSG00000005156		0.507	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	HGNC	protein_coding	OTTHUMT00000250330.3	37	0.00	0	C	NM_013975		33318105	33318105	+1	no_errors	ENST00000378526	ensembl	human	known	69_37n	missense	5	68.75	11	SNP	1.000	G
LMOD1	25802	genome.wustl.edu	37	1	201869213	201869213	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:201869213C>G	ENST00000367288.4	-	2	1174	c.928G>C	c.(928-930)Gag>Cag	p.E310Q	RP11-307B6.3_ENST00000414927.1_RNA|RP11-307B6.3_ENST00000458139.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	310					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GCCTCCTCCTCCACCTTGGCC	0.537																																						dbGAP											0													64.0	64.0	64.0					1																	201869213		2040	4188	6228	-	-	-	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.928G>C	1.37:g.201869213C>G	ENSP00000356257:p.Glu310Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.E310Q	ENST00000367288.4	37	c.928	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497705	0.44455	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	D	0.91792	-2.91	5.22	5.22	0.72569	.	0.178386	0.26612	N	0.023412	D	0.88738	0.6518	L	0.49126	1.545	0.50813	D	0.99989	P;P	0.42827	0.791;0.791	B;B	0.34722	0.143;0.188	D	0.89878	0.4028	10	0.54805	T	0.06	-18.5761	16.2706	0.82616	0.0:1.0:0.0:0.0	.	259;310	B4E3S9;P29536	.;LMOD1_HUMAN	Q	310;310;259	ENSP00000356257:E310Q	ENSP00000356257:E310Q	E	-	1	0	LMOD1	200135836	1.000000	0.71417	0.932000	0.37286	0.118000	0.20060	7.096000	0.76960	2.437000	0.82529	0.603000	0.83216	GAG	LMOD1	-	NULL	ENSG00000163431		0.537	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2	173	0.57	1	C			201869213	201869213	-1	no_errors	ENST00000367288	ensembl	human	known	69_37n	missense	252	26.74	92	SNP	0.998	G
LPAR1	1902	genome.wustl.edu	37	9	113637769	113637769	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr9:113637769G>A	ENST00000374431.3	-	5	1410	c.1027C>T	c.(1027-1029)Cgc>Tgc	p.R343C	LPAR1_ENST00000538760.1_Missense_Mutation_p.R344C|LPAR1_ENST00000358883.4_Missense_Mutation_p.R343C|LPAR1_ENST00000541779.1_Missense_Mutation_p.R344C|LPAR1_ENST00000374430.2_Missense_Mutation_p.R343C	NM_057159.2	NP_476500.1	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	343					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|bleb assembly (GO:0032060)|cellular response to oxygen levels (GO:0071453)|G-protein coupled receptor signaling pathway (GO:0007186)|myelination (GO:0042552)|negative regulation of neuron projection development (GO:0010977)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell chemotaxis (GO:0071673)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(6)|skin(1)	21						GAAGCCGAGCGGTCTGAGCCT	0.562																																					NSCLC(115;661 2323 9836 34256)	dbGAP											0													139.0	131.0	134.0					9																	113637769		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80811	CCDS6777.1	9q	2012-08-08	2008-04-11	2008-04-11	ENSG00000198121	ENSG00000198121		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3166	protein-coding gene	gene with protein product		602282	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2"""	EDG2		8922387, 9070858	Standard	NM_001401		Approved	edg-2, rec.1.3, vzg-1, Gpcr26, Mrec1.3, LPA1, GPR26	uc004bfc.3	Q92633	OTTHUMG00000020486	ENST00000374431.3:c.1027C>T	9.37:g.113637769G>A	ENSP00000363553:p.Arg343Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK36|O00656|O00722|P78351	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LPA_rcpt_EDG2,prints_LPA_rcpt,prints_7TM_GPCR_Rhodpsn	p.R344C	ENST00000374431.3	37	c.1030	CCDS6777.1	9	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547849	0.86022	.	.	ENSG00000198121	ENST00000374431;ENST00000541779;ENST00000374430;ENST00000358883;ENST00000449490;ENST00000538760	T;T;T;T;T	0.79845	-1.31;-1.21;-1.31;-1.31;-1.31	6.06	6.06	0.98353	.	0.242433	0.42548	D	0.000689	T	0.80549	0.4644	N	0.19112	0.55	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.56163	0.793;0.793;0.793	T	0.79598	-0.1737	10	0.38643	T	0.18	.	19.609	0.95594	0.0:0.0:1.0:0.0	.	344;344;343	B4DQ18;B4DK36;Q92633	.;.;LPAR1_HUMAN	C	343;344;343;343;325;344	ENSP00000363553:R343C;ENSP00000445697:R344C;ENSP00000363552:R343C;ENSP00000351755:R343C;ENSP00000440201:R344C	ENSP00000351755:R343C	R	-	1	0	LPAR1	112677590	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.787000	0.85759	2.882000	0.98803	0.655000	0.94253	CGC	LPAR1	-	prints_LPA_rcpt_EDG2	ENSG00000198121		0.562	LPAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR1	HGNC	protein_coding	OTTHUMT00000053631.1	435	0.00	0	G	NM_057159		113637769	113637769	-1	no_errors	ENST00000538760	ensembl	human	known	69_37n	missense	182	47.40	164	SNP	1.000	A
LSG1	55341	genome.wustl.edu	37	3	194371715	194371715	+	Silent	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:194371715A>G	ENST00000265245.5	-	10	1628	c.1314T>C	c.(1312-1314)tgT>tgC	p.C438C	AC046143.2_ENST00000582474.1_RNA	NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	438	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		CCAAGCCAGGACAGTCACACA	0.478																																						dbGAP											0													91.0	94.0	93.0					3																	194371715		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.1314T>C	3.37:g.194371715A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	pfam_GTP_binding_domain,prints_GTP_binding_domain	p.V172A	ENST00000265245.5	37	c.515	CCDS33922.1	3	.	.	.	.	.	.	.	.	.	.	A	1.516	-0.548203	0.04024	.	.	ENSG00000041802	ENST00000437613	.	.	.	5.85	2.93	0.34026	.	.	.	.	.	T	0.56292	0.1975	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51004	-0.8760	4	.	.	.	.	7.9611	0.30072	0.1874:0.0:0.6926:0.1199	.	.	.	.	A	172	.	.	V	-	2	0	LSG1	195853004	1.000000	0.71417	1.000000	0.80357	0.066000	0.16364	2.005000	0.40864	0.911000	0.36747	-0.177000	0.13119	GTC	LSG1	-	pfam_GTP_binding_domain,prints_GTP_binding_domain	ENSG00000041802		0.478	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSG1	HGNC	protein_coding	OTTHUMT00000342740.1	163	0.00	0	A	NM_018385		194371715	194371715	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000437613	ensembl	human	novel	69_37n	missense	137	23.46	42	SNP	1.000	G
LSR	51599	genome.wustl.edu	37	19	35758359	35758359	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:35758359T>G	ENST00000361790.3	+	9	1795	c.1636T>G	c.(1636-1638)Tcc>Gcc	p.S546A	LSR_ENST00000354900.3_Missense_Mutation_p.S527A|LSR_ENST00000347609.4_Missense_Mutation_p.S488A|USF2_ENST00000594064.1_5'Flank|LSR_ENST00000602122.1_Missense_Mutation_p.S526A|USF2_ENST00000222305.3_5'Flank|LSR_ENST00000360798.3_Missense_Mutation_p.S478A|AD000684.2_ENST00000602262.1_RNA|USF2_ENST00000595068.1_5'Flank|LSR_ENST00000427250.1_Missense_Mutation_p.S390A|USF2_ENST00000343550.5_5'Flank|USF2_ENST00000379134.3_5'Flank	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	546					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTTCCCACGCTCCCGGGACCC	0.687																																						dbGAP											0													17.0	22.0	21.0					19																	35758359		2187	4277	6464	-	-	-	SO:0001583	missense	0			AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.1636T>G	19.37:g.35758359T>G	ENSP00000354575:p.Ser546Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub,pfscan_Ig-like	p.S546A	ENST00000361790.3	37	c.1636	CCDS12450.1	19	.	.	.	.	.	.	.	.	.	.	T	6.901	0.535724	0.13188	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609;ENST00000427250	T;T;T;T;T	0.64438	0.48;0.65;0.32;0.31;-0.1	4.72	0.188	0.15114	.	0.779066	0.12151	N	0.494912	T	0.40272	0.1110	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;B	0.18461	0.005;0.0;0.0;0.028;0.0;0.0	B;B;B;B;B;B	0.11329	0.003;0.001;0.002;0.006;0.001;0.005	T	0.18272	-1.0342	10	0.32370	T	0.25	-13.7994	4.8353	0.13462	0.0:0.2546:0.1527:0.5927	.	485;488;526;478;527;546	Q9BT33;Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;.;LSR_HUMAN	A	546;527;478;488;390	ENSP00000354575:S546A;ENSP00000346976:S527A;ENSP00000354034:S478A;ENSP00000262627:S488A;ENSP00000394479:S390A	ENSP00000262627:S488A	S	+	1	0	LSR	40450199	0.000000	0.05858	0.019000	0.16419	0.157000	0.22087	-0.107000	0.10873	-0.084000	0.12595	0.397000	0.26171	TCC	LSR	-	NULL	ENSG00000105699		0.687	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LSR	HGNC	protein_coding	OTTHUMT00000465513.2	27	0.00	0	T	NM_015925		35758359	35758359	+1	no_errors	ENST00000361790	ensembl	human	known	69_37n	missense	8	50.00	8	SNP	0.001	G
MATN1	4146	genome.wustl.edu	37	1	31188155	31188155	+	Splice_Site	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:31188155G>A	ENST00000373765.4	-	6	1244	c.1209C>T	c.(1207-1209)ggC>ggT	p.G403G	MATN1_ENST00000477320.1_5'Flank	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	403	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		ACATCTTAAAGCCTGCCAGGA	0.562																																						dbGAP											0													104.0	93.0	96.0					1																	31188155		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.1208-1C>T	1.37:g.31188155G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7E3|Q5TBB9	Silent	SNP	pfam_VWF_A,pfam_Matrilin_coiled-coil_trimer,pfam_EGF-like_Ca-bd,smart_VWF_A,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_VWF_A	p.G403	ENST00000373765.4	37	c.1209	CCDS336.1	1																																																																																			MATN1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000162510		0.562	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1	HGNC	protein_coding	OTTHUMT00000010458.1	72	0.00	0	G	NM_002379	Silent	31188155	31188155	-1	no_errors	ENST00000373765	ensembl	human	known	69_37n	silent	6	86.05	37	SNP	0.162	A
MAGI3	260425	genome.wustl.edu	37	1	114225698	114225698	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:114225698A>C	ENST00000307546.9	+	21	3583	c.3508A>C	c.(3508-3510)Aag>Cag	p.K1170Q	MAGI3_ENST00000369615.1_3'UTR	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	1195					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTGCCTGAAAAGAAAAGCAC	0.403																																						dbGAP											0													86.0	79.0	81.0					1																	114225698		1568	3582	5150	-	-	-	SO:0001583	missense	0			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.3508A>C	1.37:g.114225698A>C	ENSP00000304604:p.Lys1170Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.K1170Q	ENST00000307546.9	37	c.3508	CCDS44196.1	1	.	.	.	.	.	.	.	.	.	.	a	14.18	2.458165	0.43634	.	.	ENSG00000081026	ENST00000307546;ENST00000546156	T	0.54866	0.55	5.54	4.41	0.53225	.	0.194315	0.36268	N	0.002698	T	0.32615	0.0835	L	0.27053	0.805	0.80722	D	1	D	0.53462	0.96	P	0.48795	0.59	T	0.16276	-1.0408	10	0.46703	T	0.11	.	11.8397	0.52346	0.9313:0.0:0.0687:0.0	.	1170	Q5TCQ9-4	.	Q	1170;210	ENSP00000304604:K1170Q	ENSP00000304604:K1170Q	K	+	1	0	MAGI3	114027221	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.726000	0.61986	1.039000	0.40074	-0.377000	0.06932	AAG	MAGI3	-	NULL	ENSG00000081026		0.403	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	HGNC	protein_coding	OTTHUMT00000032429.1	74	0.00	0	A	NM_152900		114225698	114225698	+1	no_errors	ENST00000307546	ensembl	human	novel	69_37n	missense	42	51.72	45	SNP	1.000	C
FSTL4	23105	genome.wustl.edu	37	5	132763340	132763340	+	Intron	SNP	C	C	T	rs567603326		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr5:132763340C>T	ENST00000265342.7	-	4	410				MIR1289-2_ENST00000408360.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4							extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			cacccagtgactctgttcagt	0.522																																						dbGAP											0													83.0	90.0	88.0					5																	132763340		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.161-26662G>A	5.37:g.132763340C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBU0|Q9UPU1	RNA	SNP	-	NULL	ENST00000265342.7	37	NULL	CCDS34238.1	5																																																																																			MIR1289-2	-	-	ENSG00000221287		0.522	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1289-2	HGNC	protein_coding	OTTHUMT00000370212.1	274	0.00	0	C	XM_048786		132763340	132763340	-1	no_errors	ENST00000408360	ensembl	human	known	69_37n	rna	16	88.06	118	SNP	0.000	T
MMP11	4320	genome.wustl.edu	37	22	24124660	24124660	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr22:24124660G>C	ENST00000215743.3	+	7	1375	c.1323G>C	c.(1321-1323)caG>caC	p.Q441H	AP000349.1_ENST00000598975.1_Missense_Mutation_p.L187V	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	441					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	CTGCCTTCCAGGATGCTGATG	0.672																																						dbGAP											0													27.0	20.0	22.0					22																	24124660		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.1323G>C	22.37:g.24124660G>C	ENSP00000215743:p.Gln441His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.Q441H	ENST00000215743.3	37	c.1323	CCDS13816.1	22	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235592	0.22626	.	.	ENSG00000099953	ENST00000215743	T	0.02709	4.19	4.93	3.92	0.45320	Hemopexin/matrixin (2);	0.284415	0.19019	U	0.124865	T	0.09598	0.0236	L	0.55103	1.725	0.58432	D	0.999999	D	0.64830	0.994	D	0.67900	0.954	T	0.26189	-1.0110	10	0.24483	T	0.36	.	13.3677	0.60694	0.0805:0.0:0.9195:0.0	.	441	P24347	MMP11_HUMAN	H	441	ENSP00000215743:Q441H	ENSP00000215743:Q441H	Q	+	3	2	MMP11	22454660	1.000000	0.71417	1.000000	0.80357	0.077000	0.17291	2.776000	0.47709	2.761000	0.94854	0.585000	0.79938	CAG	MMP11	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000099953		0.672	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP11	HGNC	protein_coding	OTTHUMT00000319891.2	14	0.00	0	G	NM_005940		24124660	24124660	+1	no_errors	ENST00000215743	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	1.000	C
MOB4	25843	genome.wustl.edu	37	2	198405102	198405102	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:198405102C>G	ENST00000323303.4	+	5	550	c.295C>G	c.(295-297)Caa>Gaa	p.Q99E	MOB4_ENST00000409360.1_Missense_Mutation_p.Q67E|HSPE1-MOB4_ENST00000604458.1_Missense_Mutation_p.Q135E|MOB4_ENST00000497443.1_3'UTR|MOB4_ENST00000233892.4_Missense_Mutation_p.Q67E|MOB4_ENST00000448447.2_Missense_Mutation_p.Q78E|MOB4_ENST00000409916.1_5'UTR	NM_001202485.1|NM_015387.4	NP_001189414.1|NP_056202.2	Q9Y3A3	PHOCN_HUMAN	MOB family member 4, phocein	99					transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	metal ion binding (GO:0046872)										TACTTGCACTCAAATGACAGC	0.264																																						dbGAP											0													35.0	35.0	35.0					2																	198405102		2203	4292	6495	-	-	-	SO:0001583	missense	0			AF151853	CCDS2321.1, CCDS2322.1, CCDS46480.1	2q33.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000115540	ENSG00000115540		"""MOB kinase activators"""	17261	protein-coding gene	gene with protein product	"""phocein"", ""phocein, Mob-like protein"""	609361	"""preimplantation protein 3"", ""MOB1, Mps One Binder kinase activator-like 3 (yeast)"""	PREI3, MOBKL3		17853115, 10810093, 11230166, 11319234	Standard	NM_199482		Approved	MOB3, DKFZP564M112, CGI-95, 2C4D, PHOCN		Q9Y3A3	OTTHUMG00000132748	ENST00000323303.4:c.295C>G	2.37:g.198405102C>G	ENSP00000315702:p.Gln99Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DML0|Q53SE0|Q7Z4Y6|Q9H2P3|Q9H5J1|Q9Y4T8	Missense_Mutation	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.Q99E	ENST00000323303.4	37	c.295	CCDS2321.1	2	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439015	0.63067	.	.	ENSG00000115540	ENST00000233892;ENST00000323303;ENST00000448447;ENST00000409360	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.62441	0.2428	L	0.42686	1.345	0.80722	D	1	D;D	0.60160	0.984;0.987	P;P	0.58130	0.743;0.833	T	0.55579	-0.8119	9	0.02654	T	1	.	19.6689	0.95903	0.0:1.0:0.0:0.0	.	78;99	Q9Y3A3-3;Q9Y3A3	.;PHOCN_HUMAN	E	67;99;78;67	.	ENSP00000233892:Q67E	Q	+	1	0	PHOCN	198113347	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.743000	0.85020	2.642000	0.89623	0.655000	0.94253	CAA	MOB4	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000115540		0.264	MOB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB4	HGNC	protein_coding	OTTHUMT00000256110.4	32	0.00	0	C	NM_015387		198405102	198405102	+1	no_errors	ENST00000323303	ensembl	human	known	69_37n	missense	41	26.79	15	SNP	1.000	G
MPP1	4354	genome.wustl.edu	37	X	154009963	154009963	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:154009963T>C	ENST00000369534.3	-	10	1208	c.1061A>G	c.(1060-1062)tAc>tGc	p.Y354C	MPP1_ENST00000393531.1_Missense_Mutation_p.Y334C|MPP1_ENST00000462825.1_5'Flank|MPP1_ENST00000413259.3_Missense_Mutation_p.Y324C	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	354	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.|Interaction with MPP5.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GTTGCCTTGGTAGCTGCCAAA	0.483																																						dbGAP											0													366.0	258.0	294.0					X																	154009963		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.1061A>G	X.37:g.154009963T>C	ENSP00000358547:p.Tyr354Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.Y354C	ENST00000369534.3	37	c.1061	CCDS14762.1	X	.	.	.	.	.	.	.	.	.	.	T	16.02	3.005648	0.54254	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531	T;T;T	0.52295	0.67;0.67;0.67	5.39	5.39	0.77823	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.112791	0.64402	D	0.000008	T	0.71091	0.3299	M	0.94063	3.49	0.53688	D	0.999979	D;D;D;D	0.71674	0.998;0.99;0.987;0.99	P;P;P;P	0.61533	0.89;0.878;0.806;0.878	T	0.77691	-0.2493	10	0.87932	D	0	.	8.8124	0.34976	0.1701:0.0:0.0:0.8299	.	337;324;334;354	B4E325;B4DZV5;G3XAI1;Q00013	.;.;.;EM55_HUMAN	C	354;324;334	ENSP00000358547:Y354C;ENSP00000400155:Y324C;ENSP00000377165:Y334C	ENSP00000358547:Y354C	Y	-	2	0	MPP1	153663157	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	3.901000	0.56303	1.803000	0.52742	0.481000	0.45027	TAC	MPP1	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin	ENSG00000130830		0.483	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP1	HGNC	protein_coding	OTTHUMT00000061191.3	403	0.00	0	T	NM_002436		154009963	154009963	-1	no_errors	ENST00000369534	ensembl	human	known	69_37n	missense	188	39.94	125	SNP	1.000	C
MRPL13	28998	genome.wustl.edu	37	8	121432115	121432115	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:121432115T>C	ENST00000306185.3	-	5	661	c.370A>G	c.(370-372)Agg>Ggg	p.R124G		NM_014078.5	NP_054797.2	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13	124					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	6	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			AGATGCAACCTTTCCATCATT	0.313																																						dbGAP											0													94.0	88.0	90.0					8																	121432115		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB049640	CCDS6332.1	8q22.1-q22.3	2012-09-13			ENSG00000172172	ENSG00000172172		"""Mitochondrial ribosomal proteins / large subunits"""	14278	protein-coding gene	gene with protein product		610200				11543634	Standard	NM_014078		Approved	L13, RPL13, L13mt, RPML13, L13A	uc003ypa.3	Q9BYD1	OTTHUMG00000165039	ENST00000306185.3:c.370A>G	8.37:g.121432115T>C	ENSP00000306548:p.Arg124Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4R8|Q9UI04	Missense_Mutation	SNP	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,pirsf_Ribosomal_L13,tigrfam_Ribosomal_L13_bac-type	p.R124G	ENST00000306185.3	37	c.370	CCDS6332.1	8	.	.	.	.	.	.	.	.	.	.	T	18.98	3.738568	0.69304	.	.	ENSG00000172172	ENST00000306185;ENST00000518918	.	.	.	5.39	4.24	0.50183	Ribosomal protein L13, conserved site (1);Ribosomal protein L13 domain (2);	0.000000	0.85682	D	0.000000	D	0.86016	0.5832	H	0.96239	3.79	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.88403	0.3016	9	0.87932	D	0	-4.6969	11.142	0.48408	0.0:0.0:0.3197:0.6803	.	124	Q9BYD1	RM13_HUMAN	G	124;100	.	ENSP00000306548:R124G	R	-	1	2	MRPL13	121501296	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	2.652000	0.46682	0.971000	0.38288	0.482000	0.46254	AGG	MRPL13	-	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,pirsf_Ribosomal_L13,tigrfam_Ribosomal_L13_bac-type	ENSG00000172172		0.313	MRPL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL13	HGNC	protein_coding	OTTHUMT00000381523.1	100	0.00	0	T	NM_014078		121432115	121432115	-1	no_errors	ENST00000306185	ensembl	human	known	69_37n	missense	146	19.23	35	SNP	1.000	C
MRPL40	64976	genome.wustl.edu	37	22	19423260	19423260	+	Missense_Mutation	SNP	G	G	C	rs11557716		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr22:19423260G>C	ENST00000333130.3	+	4	1049	c.396G>C	c.(394-396)gaG>gaC	p.E132D	HIRA_ENST00000541063.1_Intron|MRPL40_ENST00000443660.1_3'UTR|HIRA_ENST00000546308.1_Intron	NM_003776.2	NP_003767.2	Q9NQ50	RM40_HUMAN	mitochondrial ribosomal protein L40	132					anatomical structure morphogenesis (GO:0009653)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					GTAAGATGGAGAGGGACACCA	0.562																																						dbGAP											0													142.0	143.0	143.0					22																	19423260		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051624	CCDS13760.1	22q11.2	2012-09-13	2002-11-13		ENSG00000185608	ENSG00000185608		"""Mitochondrial ribosomal proteins / large subunits"""	14491	protein-coding gene	gene with protein product		605089	"""nuclear localization signal deleted in velocardiofacial syndrome"""	NLVCF		9790763, 11543634	Standard	NM_003776		Approved	MRP-L22	uc002zpg.3	Q9NQ50	OTTHUMG00000150136	ENST00000333130.3:c.396G>C	22.37:g.19423260G>C	ENSP00000333401:p.Glu132Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVZ7|O95134	Missense_Mutation	SNP	pfam_Ribosomal_L28/L40_mit	p.E132D	ENST00000333130.3	37	c.396	CCDS13760.1	22	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577642	0.28180	.	.	ENSG00000185608	ENST00000333130	T	0.44482	0.92	5.22	2.05	0.26809	.	0.000000	0.85682	D	0.000000	T	0.46073	0.1374	L	0.42245	1.32	0.58432	D	0.99999	P	0.49447	0.924	P	0.56823	0.807	T	0.26018	-1.0115	10	0.44086	T	0.13	-31.0617	8.8151	0.34991	0.3638:0.0:0.6361:0.0	.	132	Q9NQ50	RM40_HUMAN	D	132	ENSP00000333401:E132D	ENSP00000333401:E132D	E	+	3	2	MRPL40	17803260	1.000000	0.71417	0.864000	0.33941	0.256000	0.26092	2.301000	0.43628	0.362000	0.24319	-0.251000	0.11542	GAG	MRPL40	-	pfam_Ribosomal_L28/L40_mit	ENSG00000185608		0.562	MRPL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL40	HGNC	protein_coding	OTTHUMT00000316491.2	93	0.00	0	G	NM_003776		19423260	19423260	+1	no_errors	ENST00000333130	ensembl	human	known	69_37n	missense	46	55.34	57	SNP	0.768	C
MUC17	140453	genome.wustl.edu	37	7	100686047	100686047	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:100686047T>A	ENST00000306151.4	+	3	11414	c.11350T>A	c.(11350-11352)Tct>Act	p.S3784T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3784	Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACCAGCATGTCTATGACCAC	0.473																																						dbGAP											0													138.0	131.0	134.0					7																	100686047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11350T>A	7.37:g.100686047T>A	ENSP00000302716:p.Ser3784Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S3784T	ENST00000306151.4	37	c.11350	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	t	7.744	0.701976	0.15172	.	.	ENSG00000169876	ENST00000306151	T	0.01998	4.51	1.96	-3.91	0.04168	.	.	.	.	.	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	P	0.43885	0.82	P	0.46026	0.501	T	0.30268	-0.9984	9	0.11794	T	0.64	.	0.0156	0.00002	0.2843:0.1888:0.2213:0.3056	.	3784	Q685J3	MUC17_HUMAN	T	3784	ENSP00000302716:S3784T	ENSP00000302716:S3784T	S	+	1	0	MUC17	100472767	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.136000	0.01305	-1.077000	0.03121	0.158000	0.16466	TCT	MUC17	-	NULL	ENSG00000169876		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	40	0.00	0	T	NM_001040105		100686047	100686047	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	18	70.00	42	SNP	0.000	A
NAMPTL	646309	genome.wustl.edu	37	10	36811783	36811784	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr10:36811783_36811784insT	ENST00000543053.1	-	1	539_540	c.323_324insA	c.(322-324)aatfs	p.N108fs						nicotinamide phosphoribosyltransferase-like											biliary_tract(1)|breast(3)|lung(9)|stomach(1)	14						TCAGCTGTGCATTTTTTCTTAT	0.416																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0					10p11.21	2013-03-27	2008-11-06	2008-11-06	ENSG00000229644	ENSG00000229644			17633	other	unknown			"""pre-B-cell colony enhancing factor 2"""	PBEF2		8289818	Standard	NG_005593		Approved	bA92J19.4			OTTHUMG00000017964	ENST00000543053.1:c.324dupA	10.37:g.36811789_36811789dupT	ENSP00000439553:p.Asn108fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C	p.N108fs	ENST00000543053.1	37	c.324_323		10																																																																																			NAMPTL	-	superfamily_Quinolinate_PRibosylTrfase_C	ENSG00000229644		0.416	NAMPTL-201	KNOWN	basic|appris_principal	protein_coding	NAMPTL	HGNC	protein_coding		191	0.00	0	-	NG_005593		36811783	36811784	-1	no_errors	ENST00000543053	ensembl	human	known	69_37n	frame_shift_ins	85	39.72	56	INS	0.997:0.998	T
NAMPTL	646309	genome.wustl.edu	37	10	36811790	36811790	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr10:36811790C>G	ENST00000543053.1	-	1	533	c.317G>C	c.(316-318)aGa>aCa	p.R106T						nicotinamide phosphoribosyltransferase-like											biliary_tract(1)|breast(3)|lung(9)|stomach(1)	14						TGCATTTTTTCTTATTTCATC	0.413																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					10p11.21	2013-03-27	2008-11-06	2008-11-06	ENSG00000229644	ENSG00000229644			17633	other	unknown			"""pre-B-cell colony enhancing factor 2"""	PBEF2		8289818	Standard	NG_005593		Approved	bA92J19.4			OTTHUMG00000017964	ENST00000543053.1:c.317G>C	10.37:g.36811790C>G	ENSP00000439553:p.Arg106Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C	p.R106T	ENST00000543053.1	37	c.317		10	.	.	.	.	.	.	.	.	.	.	c	10.09	1.254145	0.22965	.	.	ENSG00000229644	ENST00000440465;ENST00000543053	.	.	.	1.76	-0.334	0.12666	.	0.040741	0.85682	D	0.000000	T	0.53206	0.1782	.	.	.	0.35524	D	0.801683	.	.	.	.	.	.	T	0.59847	-0.7377	6	0.87932	D	0	-1.4901	5.7731	0.18263	0.0:0.6552:0.0:0.3448	.	.	.	.	T	458;106	.	ENSP00000407952:R458T	R	-	2	0	NAMPTL	36851796	1.000000	0.71417	0.853000	0.33588	0.398000	0.30690	2.754000	0.47532	0.125000	0.18397	0.433000	0.28618	AGA	NAMPTL	-	superfamily_Quinolinate_PRibosylTrfase_C	ENSG00000229644		0.413	NAMPTL-201	KNOWN	basic|appris_principal	protein_coding	NAMPTL	HGNC	protein_coding		190	0.00	0	C	NG_005593		36811790	36811790	-1	no_errors	ENST00000543053	ensembl	human	known	69_37n	missense	77	43.97	62	SNP	0.986	G
NAT9	26151	genome.wustl.edu	37	17	72768136	72768136	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:72768136G>A	ENST00000357814.3	-	6	525	c.452C>T	c.(451-453)cCa>cTa	p.P151L	NAT9_ENST00000583476.1_Intron|NAT9_ENST00000583757.1_Intron|NAT9_ENST00000580216.1_5'Flank|NAT9_ENST00000578822.1_Missense_Mutation_p.P156L|NAT9_ENST00000582524.1_Intron|NAT9_ENST00000580632.1_Missense_Mutation_p.P151L|NAT9_ENST00000580301.1_Missense_Mutation_p.P150L|NAT9_ENST00000582870.1_Missense_Mutation_p.P155L|NAT9_ENST00000581136.1_Missense_Mutation_p.P146L	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	151	N-acetyltransferase.					protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						CCGGATGCTTGGTTCATTTCC	0.547																																						dbGAP											0													172.0	167.0	169.0					17																	72768136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.452C>T	17.37:g.72768136G>A	ENSP00000350467:p.Pro151Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7F0|Q9BTD0|Q9Y3T3	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.P151L	ENST00000357814.3	37	c.452	CCDS11706.1	17	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122188	0.37436	.	.	ENSG00000109065	ENST00000357814	T	0.48836	0.8	5.09	5.09	0.68999	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.367731	0.31102	N	0.008248	T	0.57184	0.2036	M	0.86651	2.83	0.80722	D	1	B;P	0.35527	0.066;0.507	B;B	0.36766	0.048;0.232	T	0.60546	-0.7242	10	0.27082	T	0.32	-8.27	18.8609	0.92271	0.0:0.0:1.0:0.0	.	150;151	Q9BTE0-2;Q9BTE0	.;NAT9_HUMAN	L	151	ENSP00000350467:P151L	ENSP00000350467:P151L	P	-	2	0	NAT9	70279731	0.999000	0.42202	0.990000	0.47175	0.978000	0.69477	4.931000	0.63469	2.541000	0.85698	0.561000	0.74099	CCA	NAT9	-	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	ENSG00000109065		0.547	NAT9-001	KNOWN	basic|CCDS	protein_coding	NAT9	HGNC	protein_coding	OTTHUMT00000443700.1	93	0.00	0	G	NM_015654		72768136	72768136	-1	no_errors	ENST00000357814	ensembl	human	known	69_37n	missense	69	33.01	34	SNP	0.981	A
NAV2	89797	genome.wustl.edu	37	11	20122549	20122549	+	Missense_Mutation	SNP	G	G	C	rs544861895		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr11:20122549G>C	ENST00000396087.3	+	35	6524	c.6425G>C	c.(6424-6426)cGc>cCc	p.R2142P	NAV2_ENST00000360655.4_Missense_Mutation_p.R2019P|NAV2_ENST00000540292.1_Missense_Mutation_p.R2073P|NAV2_ENST00000311043.8_Missense_Mutation_p.R1147P|NAV2_ENST00000396085.1_Missense_Mutation_p.R2086P|NAV2_ENST00000533917.1_Missense_Mutation_p.R1147P|NAV2_ENST00000349880.4_Missense_Mutation_p.R2083P|NAV2_ENST00000527559.2_Missense_Mutation_p.R2071P	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	2142					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						ATCCTGCAGCGCTACGTCTCC	0.552																																						dbGAP											0													168.0	141.0	150.0					11																	20122549		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.6425G>C	11.37:g.20122549G>C	ENSP00000379396:p.Arg2142Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.R2142P	ENST00000396087.3	37	c.6425	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.245173	0.95272	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000311043	D;D;D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000002	D	0.95023	0.8389	M	0.82823	2.61	0.80722	D	1	D;D;D;D	0.89917	1.0;0.963;1.0;1.0	D;P;D;D	0.97110	0.999;0.81;1.0;0.999	D	0.94522	0.7728	9	.	.	.	.	19.4498	0.94862	0.0:0.0:1.0:0.0	.	2086;1147;2083;2019	A7E2D6;Q8IVL1-5;Q8IVL1-3;Q8IVL1-4	.;.;.;.	P	2019;2086;2083;2142;2071;2073;1147;1147	ENSP00000353871:R2019P;ENSP00000379394:R2086P;ENSP00000309577:R2083P;ENSP00000379396:R2142P;ENSP00000435395:R2071P;ENSP00000443489:R2073P;ENSP00000437316:R1147P;ENSP00000312169:R1147P	.	R	+	2	0	NAV2	20079125	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.859000	0.99545	2.702000	0.92279	0.549000	0.68633	CGC	NAV2	-	NULL	ENSG00000166833		0.552	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	133	0.00	0	G	NM_145117		20122549	20122549	+1	no_errors	ENST00000396087	ensembl	human	known	69_37n	missense	65	45.38	54	SNP	1.000	C
NCKAP1L	3071	genome.wustl.edu	37	12	54891635	54891635	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr12:54891635G>A	ENST00000293373.6	+	1	141	c.62G>A	c.(61-63)cGc>cAc	p.R21H	RP11-753H16.3_ENST00000550474.1_RNA|NCKAP1L_ENST00000545638.2_5'Flank	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	21					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						CTGAATGATCGCGGTCAGGGG	0.453																																						dbGAP											0													115.0	97.0	103.0					12																	54891635		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.62G>A	12.37:g.54891635G>A	ENSP00000293373:p.Arg21His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUT5|Q52LW0	Missense_Mutation	SNP	pfam_Nck-associated_protein-1,superfamily_Nucl_hormone_rcpt_ligand-bd	p.R21H	ENST00000293373.6	37	c.62	CCDS31813.1	12	.	.	.	.	.	.	.	.	.	.	G	31	5.104764	0.94245	.	.	ENSG00000123338	ENST00000293373	T	0.50548	0.74	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68118	0.2966	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.62927	-0.6750	10	0.30854	T	0.27	-7.2219	17.7923	0.88558	0.0:0.0:1.0:0.0	.	21	P55160	NCKPL_HUMAN	H	21	ENSP00000293373:R21H	ENSP00000293373:R21H	R	+	2	0	NCKAP1L	53177902	1.000000	0.71417	0.980000	0.43619	0.804000	0.45430	7.019000	0.76412	2.793000	0.96121	0.655000	0.94253	CGC	NCKAP1L	-	pfam_Nck-associated_protein-1	ENSG00000123338		0.453	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	HGNC	protein_coding	OTTHUMT00000406195.1	100	0.00	0	G	NM_005337		54891635	54891635	+1	no_errors	ENST00000293373	ensembl	human	known	69_37n	missense	66	11.84	9	SNP	0.997	A
NDC80	10403	genome.wustl.edu	37	18	2585112	2585112	+	Splice_Site	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr18:2585112A>G	ENST00000261597.4	+	7	762	c.580A>G	c.(580-582)Ata>Gta	p.I194V		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	194	Interaction with RB1.|Interaction with the N-terminus of CDCA1.|Nuclear localization.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						TACTAATTAGATACATACTGC	0.343																																						dbGAP											0													85.0	83.0	84.0					18																	2585112		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.580-1A>G	18.37:g.2585112A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.I194V	ENST00000261597.4	37	c.580	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	A	11.94	1.787609	0.31593	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	T	0.59906	0.23	5.44	2.79	0.32731	.	0.257041	0.39544	N	0.001322	T	0.36991	0.0987	L	0.29908	0.895	0.35798	D	0.82289	B	0.02656	0.0	B	0.10450	0.005	T	0.24012	-1.0172	9	.	.	.	-8.0491	3.5277	0.07765	0.3412:0.2269:0.0:0.4319	.	194	O14777	NDC80_HUMAN	V	194	ENSP00000261597:I194V	.	I	+	1	0	NDC80	2575112	0.962000	0.33011	0.976000	0.42696	0.984000	0.73092	0.016000	0.13377	1.003000	0.39130	0.528000	0.53228	ATA	NDC80	-	pfam_Kinetochore_Ndc80	ENSG00000080986		0.343	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	74	0.00	0	A	NM_006101	Missense_Mutation	2585112	2585112	+1	no_errors	ENST00000261597	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	0.982	G
NEK5	341676	genome.wustl.edu	37	13	52693482	52693482	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr13:52693482T>C	ENST00000355568.4	-	4	326	c.187A>G	c.(187-189)Att>Gtt	p.I63V		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	63	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		AAGGCTACAATGTTGGGATGT	0.299																																						dbGAP											0													94.0	98.0	96.0					13																	52693482		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.187A>G	13.37:g.52693482T>C	ENSP00000347767:p.Ile63Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I63V	ENST00000355568.4	37	c.187	CCDS31979.1	13	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760074	0.69763	.	.	ENSG00000197168	ENST00000355568	T	0.31769	1.48	5.3	4.09	0.47781	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.44074	0.1276	L	0.36672	1.1	0.40488	D	0.980519	D	0.71674	0.998	D	0.87578	0.998	T	0.36237	-0.9756	10	0.56958	D	0.05	.	12.3401	0.55089	0.0:0.0:0.1414:0.8586	.	63	Q6P3R8	NEK5_HUMAN	V	63	ENSP00000347767:I63V	ENSP00000347767:I63V	I	-	1	0	NEK5	51591483	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	4.291000	0.59025	0.826000	0.34661	-0.316000	0.08728	ATT	NEK5	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000197168		0.299	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK5	HGNC	protein_coding	OTTHUMT00000045045.3	126	0.00	0	T	NM_199289		52693482	52693482	-1	no_errors	ENST00000355568	ensembl	human	known	69_37n	missense	62	50.00	63	SNP	1.000	C
NOD1	10392	genome.wustl.edu	37	7	30469058	30469058	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:30469058C>A	ENST00000222823.4	-	13	3246	c.2721G>T	c.(2719-2721)caG>caT	p.Q907H		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	907					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						TAGCTGTGATCTGATTCTGGA	0.433																																						dbGAP											0													215.0	211.0	213.0					7																	30469058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.2721G>T	7.37:g.30469058C>A	ENSP00000222823:p.Gln907His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.Q907H	ENST00000222823.4	37	c.2721	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	C	7.287	0.610276	0.14066	.	.	ENSG00000106100	ENST00000222823	T	0.54866	0.55	5.93	3.15	0.36227	.	0.372197	0.31177	N	0.008111	T	0.42177	0.1191	L	0.56340	1.77	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.23797	-1.0178	10	0.37606	T	0.19	.	4.7843	0.13217	0.1548:0.6156:0.1492:0.0804	.	907	Q9Y239	NOD1_HUMAN	H	907	ENSP00000222823:Q907H	ENSP00000222823:Q907H	Q	-	3	2	NOD1	30435583	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	0.819000	0.27308	0.412000	0.25729	-0.136000	0.14681	CAG	NOD1	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000106100		0.433	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	70	0.00	0	C			30469058	30469058	-1	no_errors	ENST00000222823	ensembl	human	known	69_37n	missense	23	58.18	32	SNP	1.000	A
NPIPB15	440348	genome.wustl.edu	37	16	74425915	74425915	+	Silent	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:74425915G>A	ENST00000429990.1	+	7	1365	c.1269G>A	c.(1267-1269)ccG>ccA	p.P423P				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	423						extracellular region (GO:0005576)											gaataaatccgtgggtcgaaa	0.373																																						dbGAP											0													2.0	3.0	3.0					16																	74425915		1297	2830	4127	-	-	-	SO:0001819	synonymous_variant	0			BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.1269G>A	16.37:g.74425915G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J9U8	Silent	SNP	pfam_NPIP	p.P423	ENST00000429990.1	37	c.1269		16																																																																																			NPIPL2	-	NULL	ENSG00000196436		0.373	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPL2	HGNC	protein_coding	OTTHUMT00000346597.2	94	0.00	0	G	NM_001018059		74425915	74425915	+1	no_errors	ENST00000429990	ensembl	human	known	69_37n	silent	56	18.84	13	SNP	0.994	A
NR2F6	2063	genome.wustl.edu	37	19	17355841	17355841	+	Silent	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:17355841C>G	ENST00000291442.3	-	1	908	c.189G>C	c.(187-189)tcG>tcC	p.S63S	AC010646.3_ENST00000594059.1_Intron	NM_005234.3	NP_005225.2	P10588	NR2F6_HUMAN	nuclear receptor subfamily 2, group F, member 6	63					detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|entrainment of circadian clock by photoperiod (GO:0043153)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						GCTTGCCGCTCGACTTGTCCC	0.692																																						dbGAP											0													27.0	23.0	24.0					19																	17355841		2196	4295	6491	-	-	-	SO:0001819	synonymous_variant	0			X12794	CCDS12352.1	19p13.11	2013-09-20			ENSG00000160113	ENSG00000160113		"""Nuclear hormone receptors"""	7977	protein-coding gene	gene with protein product		132880		ERBAL2		2905047	Standard	NM_005234		Approved	EAR-2	uc002nfq.3	P10588	OTTHUMG00000182728	ENST00000291442.3:c.189G>C	19.37:g.17355841C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC68|Q5XGA0|Q6P586|Q9BUE8	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_COUP_TF,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S63	ENST00000291442.3	37	c.189	CCDS12352.1	19																																																																																			NR2F6	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	ENSG00000160113		0.692	NR2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2F6	HGNC	protein_coding	OTTHUMT00000463325.1	29	0.00	0	C			17355841	17355841	-1	no_errors	ENST00000291442	ensembl	human	known	69_37n	silent	8	33.33	4	SNP	1.000	G
OGG1	4968	genome.wustl.edu	37	3	9798825	9798825	+	Silent	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:9798825G>A	ENST00000344629.7	+	7	1372	c.1029G>A	c.(1027-1029)ccG>ccA	p.P343P	OGG1_ENST00000349503.5_Intron|OGG1_ENST00000302003.7_Missense_Mutation_p.R349Q|OGG1_ENST00000449570.2_Intron|OGG1_ENST00000302036.7_Intron|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302008.8_Intron|OGG1_ENST00000339511.5_3'UTR			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	343					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					CCAAAGGGCCGGAAGGCTAGA	0.602								Base excision repair (BER), DNA glycosylases																														dbGAP											0													90.0	97.0	95.0					3																	9798825		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.1029G>A	3.37:g.9798825G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	pfam_OGG_N,pfam_HhH-GPD_domain,superfamily_DNA_glycosylase,smart_HhH-GPD_domain,tigrfam_Ogg	p.R349Q	ENST00000344629.7	37	c.1046	CCDS2581.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.702|3.702	-0.061381|-0.061381	0.07317|0.07317	.|.	.|.	ENSG00000114026|ENSG00000114026	ENST00000416333|ENST00000302003;ENST00000339542	.|T	.|0.60171	.|0.21	4.81|4.81	-9.63|-9.63	0.00544|0.00544	.|.	.|.	.|.	.|.	.|.	T|T	0.33990|0.33990	0.0882|0.0882	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999998|0.999998	.|B;B;B;B	.|0.09022	.|0.001;0.001;0.002;0.001	.|B;B;B;B	.|0.04013	.|0.001;0.001;0.0;0.0	T|T	0.15263|0.15263	-1.0443|-1.0443	4|8	.|0.38643	.|T	.|0.18	.|.	3.8146|3.8146	0.08811|0.08811	0.107:0.1744:0.4407:0.2779|0.107:0.1744:0.4407:0.2779	.|.	.|136;120;349;349	.|F8WA07;Q9HCR8;O15527-3;E5KPN0	.|.;.;.;.	R|Q	116|349;136	.|ENSP00000305584:R349Q	.|ENSP00000305584:R349Q	G|R	+|+	1|2	0|0	OGG1|OGG1	9773825|9773825	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-2.212000|-2.212000	0.01225|0.01225	-3.330000|-3.330000	0.00186|0.00186	-1.069000|-1.069000	0.02264|0.02264	GGA|CGG	OGG1	-	NULL	ENSG00000114026		0.602	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OGG1	HGNC	protein_coding	OTTHUMT00000214223.2	160	0.00	0	G	NM_016821		9798825	9798825	+1	no_errors	ENST00000302003	ensembl	human	known	69_37n	missense	13	93.56	189	SNP	0.000	A
ONECUT1	3175	genome.wustl.edu	37	15	53081468	53081469	+	Frame_Shift_Ins	INS	-	-	C	rs201253071		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr15:53081468_53081469insC	ENST00000305901.5	-	1	740_741	c.613_614insG	c.(613-615)gccfs	p.A205fs	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	205					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		GGGCATGGCGGCCCCCGGGTGG	0.713																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.614dupG	15.37:g.53081473_53081473dupC	ENSP00000302630:p.Ala205fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV4|Q99744|Q9UMR6	Frame_Shift_Ins	INS	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.A205fs	ENST00000305901.5	37	c.614_613	CCDS10150.1	15																																																																																			ONECUT1	-	NULL	ENSG00000169856		0.713	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT1	HGNC	protein_coding	OTTHUMT00000254849.2	64	0.00	0	-			53081468	53081469	-1	no_errors	ENST00000305901	ensembl	human	known	69_37n	frame_shift_ins	17	15.00	3	INS	1.000:0.998	C
OR10S1	219873	genome.wustl.edu	37	11	123848324	123848324	+	Silent	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr11:123848324G>A	ENST00000531945.1	-	1	164	c.75C>T	c.(73-75)ttC>ttT	p.F25F		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CCTCCAGGAAGAAGTGGCTCA	0.502																																						dbGAP											0													67.0	68.0	68.0					11																	123848324		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.75C>T	11.37:g.123848324G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH43|Q6IEV3|Q96R78	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F25	ENST00000531945.1	37	c.75	CCDS31701.1	11																																																																																			OR10S1	-	NULL	ENSG00000196248		0.502	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	HGNC	protein_coding	OTTHUMT00000387265.2	61	0.00	0	G	NM_001004474		123848324	123848324	-1	no_errors	ENST00000531945	ensembl	human	known	69_37n	silent	47	31.88	22	SNP	0.936	A
OR6K2	81448	genome.wustl.edu	37	1	158669708	158669708	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:158669708G>T	ENST00000359610.2	-	1	778	c.735C>A	c.(733-735)caC>caA	p.H245Q		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					AGACAATGAAGTGAGAGACAC	0.478																																						dbGAP											0													121.0	111.0	114.0					1																	158669708		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.735C>A	1.37:g.158669708G>T	ENSP00000352626:p.His245Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH33|Q6IFR6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H245Q	ENST00000359610.2	37	c.735	CCDS30902.1	1	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792266	0.31685	.	.	ENSG00000196171	ENST00000359610	T	0.00307	8.17	4.94	2.94	0.34122	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43747	D	0.000525	T	0.00524	0.0017	H	0.97682	4.055	0.31977	N	0.606374	D	0.76494	0.999	D	0.81914	0.995	T	0.03202	-1.1061	10	0.87932	D	0	-9.1155	9.7313	0.40363	0.1875:0.0:0.8125:0.0	.	245	Q8NGY2	OR6K2_HUMAN	Q	245	ENSP00000352626:H245Q	ENSP00000352626:H245Q	H	-	3	2	OR6K2	156936332	0.129000	0.22400	0.997000	0.53966	0.100000	0.18952	0.163000	0.16520	1.201000	0.43203	0.655000	0.94253	CAC	OR6K2	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196171		0.478	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K2	HGNC	protein_coding	OTTHUMT00000059061.1	339	0.00	0	G	NM_001005279		158669708	158669708	-1	no_errors	ENST00000359610	ensembl	human	known	69_37n	missense	271	34.30	142	SNP	0.998	T
OR11L1	391189	genome.wustl.edu	37	1	248005072	248005072	+	Missense_Mutation	SNP	C	C	A	rs567908878		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:248005072C>A	ENST00000355784.2	-	1	182	c.127G>T	c.(127-129)Gtt>Ttt	p.V43F		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	43						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATGATGACAACATTCCCTATA	0.507																																						dbGAP											0													74.0	65.0	68.0					1																	248005072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.127G>T	1.37:g.248005072C>A	ENSP00000348033:p.Val43Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V43F	ENST00000355784.2	37	c.127	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	C	2.202	-0.382800	0.04966	.	.	ENSG00000197591	ENST00000355784	T	0.00441	7.41	4.2	-4.2	0.03823	GPCR, rhodopsin-like superfamily (1);	0.892392	0.09187	U	0.836649	T	0.00241	0.0007	N	0.21508	0.67	0.09310	N	1	B	0.19935	0.04	B	0.18561	0.022	T	0.21621	-1.0240	10	0.42905	T	0.14	.	6.9955	0.24780	0.0:0.228:0.2145:0.5575	.	43	Q8NGX0	O11L1_HUMAN	F	43	ENSP00000348033:V43F	ENSP00000348033:V43F	V	-	1	0	OR11L1	246071695	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-2.717000	0.00813	-0.694000	0.05113	0.543000	0.68304	GTT	OR11L1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000197591		0.507	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	113	0.00	0	C	NM_001001959		248005072	248005072	-1	no_errors	ENST00000355784	ensembl	human	known	69_37n	missense	132	25.42	45	SNP	0.000	A
OSBPL3	26031	genome.wustl.edu	37	7	24911625	24911625	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:24911625G>A	ENST00000313367.2	-	3	611	c.160C>T	c.(160-162)Cag>Tag	p.Q54*	OSBPL3_ENST00000396431.1_Nonsense_Mutation_p.Q54*|OSBPL3_ENST00000431825.2_Nonsense_Mutation_p.Q54*|OSBPL3_ENST00000353930.1_Nonsense_Mutation_p.Q54*|OSBPL3_ENST00000352860.1_Nonsense_Mutation_p.Q54*|OSBPL3_ENST00000409069.1_Nonsense_Mutation_p.Q54*|OSBPL3_ENST00000396429.1_Nonsense_Mutation_p.Q54*	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	54	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						AATCCTTTCTGAACTGGTGGC	0.478																																						dbGAP											0													106.0	95.0	99.0					7																	24911625		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.160C>T	7.37:g.24911625G>A	ENSP00000315410:p.Gln54*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Nonsense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q54*	ENST00000313367.2	37	c.160	CCDS5390.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.452125	0.96223	.	.	ENSG00000070882	ENST00000313367;ENST00000352860;ENST00000353930;ENST00000431825;ENST00000396431;ENST00000396429;ENST00000409069;ENST00000415162;ENST00000441059;ENST00000415952	.	.	.	6.02	6.02	0.97574	.	0.172174	0.52532	D	0.000068	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-25.3521	20.5407	0.99260	0.0:0.0:1.0:0.0	.	.	.	.	X	54	.	ENSP00000315410:Q54X	Q	-	1	0	OSBPL3	24878150	1.000000	0.71417	0.970000	0.41538	0.991000	0.79684	9.337000	0.96545	2.865000	0.98341	0.655000	0.94253	CAG	OSBPL3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000070882		0.478	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	HGNC	protein_coding	OTTHUMT00000214085.2	179	0.00	0	G			24911625	24911625	-1	no_errors	ENST00000313367	ensembl	human	known	69_37n	nonsense	86	63.56	150	SNP	1.000	A
PACSIN1	29993	genome.wustl.edu	37	6	34499505	34499505	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:34499505G>A	ENST00000538621.1	+	9	1411	c.1166G>A	c.(1165-1167)cGc>cAc	p.R389H	PACSIN1_ENST00000374043.2_Missense_Mutation_p.R347H|PACSIN1_ENST00000244458.2_Missense_Mutation_p.R389H	NM_001199583.2	NP_001186512.1	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in neurons 1	389	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|establishment of protein localization to plasma membrane (GO:0090002)|membrane tubulation (GO:0097320)|neuron projection morphogenesis (GO:0048812)|positive regulation of dendrite development (GO:1900006)|protein localization to membrane (GO:0072657)|synaptic vesicle endocytosis (GO:0048488)	axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	13						AAGGGAGTGCGCGTGCGGGCA	0.652																																						dbGAP											0													90.0	97.0	95.0					6																	34499505		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037800	CCDS4793.1	6p21.3	2008-02-05			ENSG00000124507	ENSG00000124507			8570	protein-coding gene	gene with protein product	"""syndapin I"""	606512				11179684	Standard	NM_020804		Approved	SDPI	uc003ojp.4	Q9BY11	OTTHUMG00000014547	ENST00000538621.1:c.1166G>A	6.37:g.34499505G>A	ENSP00000439639:p.Arg389His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2G8	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,prints_SH3_domain	p.R389H	ENST00000538621.1	37	c.1166	CCDS4793.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.572747	0.96553	.	.	ENSG00000124507	ENST00000244458;ENST00000374043;ENST00000436831;ENST00000538621	T;T;T	0.31247	1.5;1.5;1.5	4.94	4.08	0.47627	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.36880	0.0983	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.15263	-1.0443	10	0.44086	T	0.13	-9.2108	13.1453	0.59459	0.0779:0.0:0.9221:0.0	.	389	Q9BY11	PACN1_HUMAN	H	389;347;389;389	ENSP00000244458:R389H;ENSP00000363155:R347H;ENSP00000439639:R389H	ENSP00000244458:R389H	R	+	2	0	PACSIN1	34607483	1.000000	0.71417	0.952000	0.39060	0.997000	0.91878	9.255000	0.95524	1.324000	0.45282	0.561000	0.74099	CGC	PACSIN1	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	ENSG00000124507		0.652	PACSIN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN1	HGNC	protein_coding	OTTHUMT00000040236.1	76	0.00	0	G			34499505	34499505	+1	no_errors	ENST00000244458	ensembl	human	known	69_37n	missense	17	71.67	43	SNP	1.000	A
PCDH11X	27328	genome.wustl.edu	37	X	91133182	91133182	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:91133182G>T	ENST00000373094.1	+	2	2788	c.1943G>T	c.(1942-1944)gGt>gTt	p.G648V	PCDH11X_ENST00000504220.2_Missense_Mutation_p.G648V|PCDH11X_ENST00000373097.1_Missense_Mutation_p.G648V|PCDH11X_ENST00000361655.2_Missense_Mutation_p.G648V|PCDH11X_ENST00000298274.8_Missense_Mutation_p.G648V|PCDH11X_ENST00000361724.1_Missense_Mutation_p.G648V|PCDH11X_ENST00000406881.1_Missense_Mutation_p.G648V|PCDH11X_ENST00000395337.2_Missense_Mutation_p.G648V|PCDH11X_ENST00000373088.1_Missense_Mutation_p.G648V	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	648	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GCTGAGGATGGTGGTAGAGTA	0.383																																					NSCLC(38;925 1092 2571 38200 45895)	dbGAP											0													57.0	50.0	53.0					X																	91133182		2201	4280	6481	-	-	-	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1943G>T	X.37:g.91133182G>T	ENSP00000362186:p.Gly648Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G648V	ENST00000373094.1	37	c.1943	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	G	13.58	2.279808	0.40294	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64;0.64	5.35	3.45	0.39498	Cadherin (4);Cadherin-like (1);	0.170451	0.52532	D	0.000064	T	0.62865	0.2463	M	0.80847	2.515	0.54753	D	0.999983	P;P;P;P;P;P;P;P	0.46512	0.854;0.833;0.854;0.854;0.854;0.879;0.854;0.854	P;P;P;P;P;P;P;P	0.58873	0.662;0.847;0.662;0.662;0.662;0.772;0.662;0.662	T	0.64740	-0.6336	10	0.87932	D	0	.	7.6904	0.28565	0.0859:0.3085:0.6056:0.0	.	648;648;648;648;648;648;648;648	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	V	648	ENSP00000378746:G648V;ENSP00000362186:G648V;ENSP00000362189:G648V;ENSP00000355040:G648V;ENSP00000362180:G648V;ENSP00000423762:G648V;ENSP00000355105:G648V;ENSP00000384758:G648V;ENSP00000298274:G648V	ENSP00000298274:G648V	G	+	2	0	PCDH11X	91019838	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.491000	0.60326	1.009000	0.39289	0.415000	0.27848	GGT	PCDH11X	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000102290		0.383	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	63	0.00	0	G	NM_032969		91133182	91133182	+1	no_errors	ENST00000373094	ensembl	human	known	69_37n	missense	32	50.00	32	SNP	1.000	T
PCDH19	57526	genome.wustl.edu	37	X	99662857	99662857	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:99662857C>G	ENST00000373034.4	-	1	2414	c.739G>C	c.(739-741)Gtg>Ctg	p.V247L	PCDH19_ENST00000420881.2_Missense_Mutation_p.V247L|PCDH19_ENST00000255531.7_Missense_Mutation_p.V247L	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	247	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TTTTCTGGCACGCTCACCGCG	0.612																																						dbGAP											0													136.0	139.0	138.0					X																	99662857		2180	4266	6446	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.739G>C	X.37:g.99662857C>G	ENSP00000362125:p.Val247Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V247L	ENST00000373034.4	37	c.739	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	C	2.802	-0.248923	0.05867	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.55234	0.53;0.53;0.53	5.95	5.04	0.67666	Cadherin (4);Cadherin-like (1);	0.056538	0.64402	D	0.000001	T	0.29028	0.0721	N	0.04116	-0.275	0.80722	D	1	B;B;B	0.20887	0.049;0.006;0.007	B;B;B	0.26770	0.073;0.014;0.025	T	0.19160	-1.0314	10	0.02654	T	1	.	15.5569	0.76203	0.0:0.8658:0.1342:0.0	.	247;247;247	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	L	247	ENSP00000400327:V247L;ENSP00000362125:V247L;ENSP00000255531:V247L	ENSP00000255531:V247L	V	-	1	0	PCDH19	99549513	0.995000	0.38212	0.953000	0.39169	0.882000	0.50991	3.266000	0.51569	2.498000	0.84270	0.513000	0.50165	GTG	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000165194		0.612	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	72	0.00	0	C	NM_020766		99662857	99662857	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	43	41.89	31	SNP	0.995	G
PCDHA1	56147	genome.wustl.edu	37	5	140168170	140168170	+	Silent	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr5:140168170C>G	ENST00000504120.2	+	1	2295	c.2295C>G	c.(2293-2295)ccC>ccG	p.P765P	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Silent_p.P765P	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	765	5 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGCCCACCCAAGACCGACC	0.562																																						dbGAP											0													47.0	44.0	45.0					5																	140168170		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2295C>G	5.37:g.140168170C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O75288|Q9NRT7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P765	ENST00000504120.2	37	c.2295	CCDS54913.1	5																																																																																			PCDHA1	-	NULL	ENSG00000204970		0.562	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	69	0.00	0	C	NM_018900		140168170	140168170	+1	no_errors	ENST00000504120	ensembl	human	known	69_37n	silent	9	82.00	41	SNP	0.659	G
PCDHB5	26167	genome.wustl.edu	37	5	140516039	140516039	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr5:140516039C>A	ENST00000231134.5	+	1	1240	c.1023C>A	c.(1021-1023)gaC>gaA	p.D341E		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	341	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGTGAATGACAACGCCCCTG	0.502																																						dbGAP											0													114.0	122.0	119.0					5																	140516039		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1023C>A	5.37:g.140516039C>A	ENSP00000231134:p.Asp341Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q549F4|Q9UFU9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D341E	ENST00000231134.5	37	c.1023	CCDS4247.1	5	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114287	0.37339	.	.	ENSG00000113209	ENST00000231134;ENST00000537936	T	0.62788	0.0	5.3	3.49	0.39957	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.80374	0.4611	M	0.88906	2.99	0.29969	N	0.818742	D	0.89917	1.0	D	0.85130	0.997	T	0.76269	-0.3021	9	0.87932	D	0	.	10.0208	0.42041	0.0:0.7815:0.0:0.2185	.	341	Q9Y5E4	PCDB5_HUMAN	E	341;125	ENSP00000231134:D341E	ENSP00000231134:D341E	D	+	3	2	PCDHB5	140496223	0.836000	0.29430	1.000000	0.80357	0.318000	0.28184	0.027000	0.13621	1.380000	0.46344	0.505000	0.49811	GAC	PCDHB5	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000113209		0.502	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB5	HGNC	protein_coding	OTTHUMT00000251811.1	136	0.00	0	C	NM_015669		140516039	140516039	+1	no_errors	ENST00000231134	ensembl	human	known	69_37n	missense	6	90.77	59	SNP	1.000	A
PENK	5179	genome.wustl.edu	37	8	57358417	57358417	+	Silent	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:57358417C>T	ENST00000314922.3	-	1	172	c.96G>A	c.(94-96)acG>acA	p.T32T	PENK_ENST00000523274.1_5'Flank|PENK_ENST00000523051.1_Silent_p.T32T|PENK_ENST00000518770.1_Silent_p.T32T|RP11-17A4.2_ENST00000518662.1_RNA|PENK_ENST00000451791.2_Silent_p.T32T	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	32					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			GGTAGCTGCACGTCGCGCAAT	0.642																																						dbGAP											0													53.0	52.0	53.0					8																	57358417		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.96G>A	8.37:g.57358417C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC23|Q6FHC6|Q6FHE6	Silent	SNP	pfam_Opioid_neupept,prints_Proenkphlin_A,prints_Opioid_neupept	p.T32	ENST00000314922.3	37	c.96	CCDS6168.1	8																																																																																			PENK	-	pfam_Opioid_neupept,prints_Opioid_neupept	ENSG00000181195		0.642	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	HGNC	protein_coding	OTTHUMT00000378645.1	29	0.00	0	C			57358417	57358417	-1	no_errors	ENST00000314922	ensembl	human	known	69_37n	silent	11	26.67	4	SNP	0.007	T
PI4KAP1	728233	genome.wustl.edu	37	22	20388567	20388567	+	RNA	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr22:20388567G>T	ENST00000430523.3	-	0	1046					NR_003563.1		Q8N8J0	PI4P1_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 1						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)												CGACCAGCTGGAAGATGTTCT	0.622																																						dbGAP											0																																										-	-	-			0					22q11.21	2007-08-14	2007-08-14			ENSG00000274602			33576	pseudogene	pseudogene							Standard	NR_003563		Approved		uc010gsg.2	Q8N8J0			22.37:g.20388567G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430523.3	37	NULL		22																																																																																			PI4KAP1	-	-	ENSG00000215513		0.622	PI4KAP1-005	KNOWN	basic	processed_transcript	PI4KAP1	HGNC	pseudogene	OTTHUMT00000319534.5	15	0.00	0	G			20388567	20388567	-1	no_errors	ENST00000416922	ensembl	human	known	69_37n	rna	3	57.14	4	SNP	1.000	T
PI4KAP2	375133	genome.wustl.edu	37	22	21832346	21832346	+	RNA	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr22:21832346G>T	ENST00000450651.1	-	0	1403							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						CGACCAGCTGGAAGATGTTCT	0.617																																						dbGAP											0													5.0	4.0	4.0					22																	21832346		651	1431	2082	-	-	-			0					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21832346G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICJ0|Q6ZT68|Q8WUK7	RNA	SNP	-	NULL	ENST00000450651.1	37	NULL		22																																																																																			PI4KAP2	-	-	ENSG00000183506		0.617	PI4KAP2-005	KNOWN	basic	processed_transcript	PI4KAP2	HGNC	pseudogene	OTTHUMT00000334908.1	15	0.00	0	G			21832346	21832346	-1	no_errors	ENST00000450651	ensembl	human	known	69_37n	rna	1	66.67	2	SNP	1.000	T
PIAS3	10401	genome.wustl.edu	37	1	145585532	145585533	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:145585532_145585533insG	ENST00000393045.2	+	14	1887_1888	c.1797_1798insG	c.(1798-1800)gggfs	p.G600fs	PIAS3_ENST00000369298.1_Frame_Shift_Ins_p.G565fs|NUDT17_ENST00000444015.2_5'Flank	NM_006099.3	NP_006090.2	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	600					positive regulation of gene expression (GO:0010628)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein sumoylation (GO:0033235)|protein sumoylation (GO:0016925)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)|synapse (GO:0045202)	enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)	28	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTGTGGCCCCTGGGGGGGCCTT	0.663																																						dbGAP											0										11,4249		0,11,2119						4.1	1.0			46	12,8224		0,12,4106	no	frameshift	PIAS3	NM_006099.3		0,23,6225	A1A1,A1R,RR		0.1457,0.2582,0.1841				23,12473				-	-	-	SO:0001589	frameshift_variant	0			AB021868	CCDS72866.1	1q21	2011-10-11			ENSG00000131788	ENSG00000131788		"""Zinc fingers, MIZ-type"""	16861	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 5"""	605987				10319586	Standard	NM_006099		Approved	FLJ14651, ZMIZ5	uc001eoc.1	Q9Y6X2	OTTHUMG00000013750	ENST00000393045.2:c.1804dupG	1.37:g.145585539_145585539dupG	ENSP00000376765:p.Gly600fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UFI3	Frame_Shift_Ins	INS	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.A601fs	ENST00000393045.2	37	c.1797_1798	CCDS920.2	1																																																																																			PIAS3	-	NULL	ENSG00000131788		0.663	PIAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS3	HGNC	protein_coding	OTTHUMT00000038533.4	65	0.00	0	-	NM_006099		145585532	145585533	+1	no_errors	ENST00000393045	ensembl	human	known	69_37n	frame_shift_ins	33	10.81	4	INS	1.000:1.000	G
PJA1	64219	genome.wustl.edu	37	X	68381469	68381469	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:68381469A>G	ENST00000361478.1	-	2	1990	c.1613T>C	c.(1612-1614)aTg>aCg	p.M538T	PJA1_ENST00000477231.1_5'Flank|PJA1_ENST00000374571.4_Missense_Mutation_p.M483T|PJA1_ENST00000374583.1_Missense_Mutation_p.M538T|PJA1_ENST00000374584.3_Missense_Mutation_p.M350T	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	538					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						TTCAAGTGCCATGTAGGTGAG	0.532																																						dbGAP											0													102.0	84.0	91.0					X																	68381469		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.1613T>C	X.37:g.68381469A>G	ENSP00000355014:p.Met538Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.M538T	ENST00000361478.1	37	c.1613	CCDS14393.1	X	.	.	.	.	.	.	.	.	.	.	a	8.386	0.838711	0.16891	.	.	ENSG00000181191	ENST00000396010;ENST00000374584;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T;T	0.06933	3.24;3.24;3.24;3.24	3.24	2.06	0.26882	.	0.000000	0.64402	U	0.000007	T	0.11836	0.0288	L	0.29908	0.895	0.37664	D	0.922894	P;P	0.50156	0.932;0.814	P;P	0.58391	0.838;0.838	T	0.11036	-1.0604	10	0.62326	D	0.03	-9.1684	6.3751	0.21503	0.8705:0.0:0.1295:0.0	.	538;350	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	T	453;350;538;538;483	ENSP00000363712:M350T;ENSP00000363711:M538T;ENSP00000355014:M538T;ENSP00000363699:M483T	ENSP00000355014:M538T	M	-	2	0	PJA1	68298194	1.000000	0.71417	0.455000	0.27031	0.017000	0.09413	5.072000	0.64389	0.487000	0.27698	-0.588000	0.04126	ATG	PJA1	-	NULL	ENSG00000181191		0.532	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PJA1	HGNC	protein_coding	OTTHUMT00000057031.2	48	0.00	0	A	NM_145119		68381469	68381469	-1	no_errors	ENST00000361478	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	0.999	G
PLA2G7	7941	genome.wustl.edu	37	6	46684756	46684756	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:46684756A>T	ENST00000274793.7	-	3	383	c.187T>A	c.(187-189)Tat>Aat	p.Y63N	PLA2G7_ENST00000537365.1_Missense_Mutation_p.Y63N|PLA2G7_ENST00000538237.1_Missense_Mutation_p.Y18N|PLA2G7_ENST00000541026.1_Intron	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	63					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			CCAACGGAATAAGGCCCATTT	0.383																																						dbGAP											0													129.0	122.0	124.0					6																	46684756		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.187T>A	6.37:g.46684756A>T	ENSP00000274793:p.Tyr63Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5HTT5|Q15692|Q5VTT1|Q8IVA2	Missense_Mutation	SNP	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	p.Y63N	ENST00000274793.7	37	c.187	CCDS4917.1	6	.	.	.	.	.	.	.	.	.	.	A	10.89	1.478297	0.26511	.	.	ENSG00000146070	ENST00000274793;ENST00000537365;ENST00000538237	T;T;T	0.56103	0.48;0.48;0.48	6.03	6.03	0.97812	.	0.233077	0.41823	D	0.000809	T	0.63570	0.2522	M	0.85462	2.755	0.80722	D	1	D;P;P	0.63880	0.993;0.844;0.844	P;B;B	0.56127	0.792;0.36;0.36	T	0.71034	-0.4709	10	0.62326	D	0.03	.	14.0956	0.65019	1.0:0.0:0.0:0.0	.	18;63;63	F5GYY6;A8K2W6;Q13093	.;.;PAFA_HUMAN	N	63;63;18	ENSP00000274793:Y63N;ENSP00000445666:Y63N;ENSP00000441416:Y18N	ENSP00000274793:Y63N	Y	-	1	0	PLA2G7	46792715	0.998000	0.40836	0.267000	0.24556	0.400000	0.30750	3.223000	0.51231	2.313000	0.78055	0.455000	0.32223	TAT	PLA2G7	-	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	ENSG00000146070		0.383	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G7	HGNC	protein_coding	OTTHUMT00000040802.1	227	0.00	0	A			46684756	46684756	-1	no_errors	ENST00000274793	ensembl	human	known	69_37n	missense	238	28.91	98	SNP	0.979	T
PLP2	5355	genome.wustl.edu	37	X	49028371	49028371	+	Silent	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:49028371G>A	ENST00000376327.5	+	1	99	c.24G>A	c.(22-24)tcG>tcA	p.S8S	PLP2_ENST00000376322.3_Silent_p.S8S	NM_002668.2	NP_002659.1	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic epithelium-enriched)	8					chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine binding (GO:0019956)|ion transmembrane transporter activity (GO:0015075)			endometrium(3)|large_intestine(1)|lung(6)|urinary_tract(3)	13						AGCGCCTCTCGGCTCCTGGCT	0.632																																						dbGAP											0													36.0	29.0	31.0					X																	49028371		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			L09604	CCDS14319.1	Xp11.23	2008-08-01			ENSG00000102007	ENSG00000102007			9087	protein-coding gene	gene with protein product	"""A4 differentiation-dependent protein"""	300112				8470895, 7622043	Standard	NM_002668		Approved	A4, A4-LSB, MGC126187	uc004dmx.3	Q04941	OTTHUMG00000021513	ENST00000376327.5:c.24G>A	X.37:g.49028371G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDT7|Q32MM8	Silent	SNP	pfam_MARVEL-like_dom	p.S8	ENST00000376327.5	37	c.24	CCDS14319.1	X																																																																																			PLP2	-	NULL	ENSG00000102007		0.632	PLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLP2	HGNC	protein_coding	OTTHUMT00000056540.1	88	0.00	0	G	NM_002668		49028371	49028371	+1	no_errors	ENST00000376327	ensembl	human	known	69_37n	silent	20	58.00	29	SNP	0.001	A
PLXNA1	5361	genome.wustl.edu	37	3	126707789	126707789	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:126707789T>A	ENST00000393409.2	+	1	353	c.353T>A	c.(352-354)cTg>cAg	p.L118Q	PLXNA1_ENST00000251772.4_Missense_Mutation_p.L95Q	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	118	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		AACAAGCTGCTGCTGCTGGAC	0.642																																						dbGAP											0													48.0	45.0	46.0					3																	126707789		2203	4300	6503	-	-	-	SO:0001583	missense	0			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.353T>A	3.37:g.126707789T>A	ENSP00000377061:p.Leu118Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.L118Q	ENST00000393409.2	37	c.353	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	T	15.68	2.905131	0.52333	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.21734	1.99;1.99	3.56	3.56	0.40772	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.56097	D	0.000036	T	0.54565	0.1866	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67154	-0.5742	10	0.87932	D	0	.	12.2967	0.54852	0.0:0.0:0.0:1.0	.	118	Q9UIW2	PLXA1_HUMAN	Q	118;95	ENSP00000377061:L118Q;ENSP00000251772:L95Q	ENSP00000251772:L95Q	L	+	2	0	PLXNA1	128190479	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	7.771000	0.85420	1.497000	0.48584	0.260000	0.18958	CTG	PLXNA1	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000114554		0.642	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	15	0.00	0	T	NM_032242		126707789	126707789	+1	no_errors	ENST00000393409	ensembl	human	known	69_37n	missense	1	90.91	10	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	131883300	131883300	+	Silent	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr7:131883300G>C	ENST00000359827.3	-	13	3644	c.2682C>G	c.(2680-2682)gtC>gtG	p.V894V	PLXNA4_ENST00000321063.4_Silent_p.V894V			Q9HCM2	PLXA4_HUMAN	plexin A4	894	IPT/TIG 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CAGCAACCTTGACATGGGAGG	0.582																																						dbGAP											0													73.0	75.0	74.0					7																	131883300		1993	4179	6172	-	-	-	SO:0001819	synonymous_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2682C>G	7.37:g.131883300G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.V894	ENST00000359827.3	37	c.2682	CCDS43646.1	7																																																																																			PLXNA4	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000221866		0.582	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	146	0.00	0	G	NM_181775		131883300	131883300	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	silent	96	28.36	38	SNP	0.998	C
PNPLA1	285848	genome.wustl.edu	37	6	36275467	36275467	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:36275467delA	ENST00000394571.2	+	8	1573	c.1573delA	c.(1573-1575)aaafs	p.K526fs	PNPLA1_ENST00000312917.5_Frame_Shift_Del_p.K440fs|PNPLA1_ENST00000388715.3_Frame_Shift_Del_p.K431fs	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	526					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						TTCGGGATCCAAAAAACCAAG	0.468																																						dbGAP											0													90.0	82.0	84.0					6																	36275467		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.1573delA	6.37:g.36275467delA	ENSP00000378072:p.Lys526fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Frame_Shift_Del	DEL	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.K527fs	ENST00000394571.2	37	c.1576	CCDS54997.1	6																																																																																			PNPLA1	-	NULL	ENSG00000180316		0.468	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA1	HGNC	protein_coding		123	0.00	0	A	NM_173676		36275467	36275467	+1	no_errors	ENST00000457797	ensembl	human	known	69_37n	frame_shift_del	101	29.45	43	DEL	0.000	-
PNPLA1	285848	genome.wustl.edu	37	6	36275473	36275473	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:36275473C>G	ENST00000394571.2	+	8	1579	c.1579C>G	c.(1579-1581)Cca>Gca	p.P527A	PNPLA1_ENST00000312917.5_Missense_Mutation_p.P441A|PNPLA1_ENST00000388715.3_Missense_Mutation_p.P432A	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	527					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)	p.P432A(1)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						ATCCAAAAAACCAAGCAGCAA	0.458																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											93.0	84.0	87.0					6																	36275473		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.1579C>G	6.37:g.36275473C>G	ENSP00000378072:p.Pro527Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.P528A	ENST00000394571.2	37	c.1582	CCDS54997.1	6	.	.	.	.	.	.	.	.	.	.	C	9.843	1.191460	0.21954	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.32988	1.66;1.65;1.43;1.43	5.3	-6.63	0.01807	.	1.592360	0.03811	N	0.265996	T	0.04182	0.0116	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.001;0.004	T	0.22382	-1.0218	10	0.25106	T	0.35	-0.1565	3.5788	0.07945	0.5109:0.2045:0.2004:0.0842	.	527;441	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	A	432;441;528;527	ENSP00000373367:P432A;ENSP00000321116:P441A;ENSP00000391868:P528A;ENSP00000378072:P527A	ENSP00000321116:P441A	P	+	1	0	PNPLA1	36383451	0.000000	0.05858	0.000000	0.03702	0.262000	0.26303	-1.795000	0.01752	-0.782000	0.04541	0.655000	0.94253	CCA	PNPLA1	-	NULL	ENSG00000180316		0.458	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA1	HGNC	protein_coding		124	0.00	0	C	NM_173676		36275473	36275473	+1	no_errors	ENST00000457797	ensembl	human	known	69_37n	missense	96	31.91	45	SNP	0.000	G
PROM1	8842	genome.wustl.edu	37	4	15991372	15991372	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:15991372G>C	ENST00000510224.1	-	19	2307	c.2059C>G	c.(2059-2061)Cct>Gct	p.P687A	PROM1_ENST00000539194.1_Missense_Mutation_p.P687A|PROM1_ENST00000447510.2_Missense_Mutation_p.P687A|PROM1_ENST00000540805.1_Missense_Mutation_p.P687A|PROM1_ENST00000508167.1_Missense_Mutation_p.P678A|PROM1_ENST00000505450.1_Missense_Mutation_p.P678A|PROM1_ENST00000543373.1_Missense_Mutation_p.P678A			O43490	PROM1_HUMAN	prominin 1	687					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						TGTTCTATAGGAAGGACTCGT	0.398																																						dbGAP											0													136.0	130.0	132.0					4																	15991372		1881	4120	6001	-	-	-	SO:0001583	missense	0			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.2059C>G	4.37:g.15991372G>C	ENSP00000426809:p.Pro687Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	pfam_Prominin	p.P687A	ENST00000510224.1	37	c.2059	CCDS47029.1	4	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468858	0.43839	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.03	4.18	0.49190	.	0.096544	0.64402	D	0.000001	T	0.65186	0.2667	M	0.78637	2.42	0.33275	D	0.561555	D;D;D;D;D;D	0.89917	0.998;0.998;0.994;0.998;0.99;1.0	D;D;P;D;P;D	0.74674	0.955;0.955;0.903;0.955;0.864;0.984	T	0.75291	-0.3369	10	0.62326	D	0.03	-8.5908	8.9072	0.35530	0.0995:0.0:0.9005:0.0	.	678;687;678;687;678;687	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	A	687;687;687;678;678;687;678	ENSP00000415481:P687A;ENSP00000438045:P687A;ENSP00000443620:P687A;ENSP00000426090:P678A;ENSP00000427346:P678A;ENSP00000426809:P687A;ENSP00000445526:P678A	ENSP00000415481:P687A	P	-	1	0	PROM1	15600470	0.978000	0.34361	0.037000	0.18230	0.008000	0.06430	2.915000	0.48805	1.348000	0.45733	0.655000	0.94253	CCT	PROM1	-	pfam_Prominin	ENSG00000007062		0.398	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	HGNC	protein_coding	OTTHUMT00000359595.2	222	0.00	0	G	NM_006017		15991372	15991372	-1	no_errors	ENST00000447510	ensembl	human	known	69_37n	missense	107	50.00	107	SNP	0.474	C
PROX1	5629	genome.wustl.edu	37	1	214171443	214171443	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:214171443C>T	ENST00000366958.4	+	2	2173	c.1565C>T	c.(1564-1566)aCg>aTg	p.T522M	PROX1_ENST00000435016.1_Missense_Mutation_p.T522M|PROX1_ENST00000261454.4_Missense_Mutation_p.T522M|PROX1_ENST00000498508.2_Missense_Mutation_p.T522M	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	522					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.T522R(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGGGATACCACGAGTCTGAGG	0.552																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											97.0	100.0	99.0					1																	214171443		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1565C>T	1.37:g.214171443C>T	ENSP00000355925:p.Thr522Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	pfam_Prox1,superfamily_Homeodomain-like	p.T522M	ENST00000366958.4	37	c.1565	CCDS31021.1	1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469258	0.63625	.	.	ENSG00000117707	ENST00000541470;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.47528	0.85;0.84;0.85;0.85	5.71	5.71	0.89125	.	0.045241	0.85682	D	0.000000	T	0.60983	0.2311	M	0.61703	1.905	0.80722	D	1	P	0.52061	0.95	P	0.52957	0.714	T	0.59789	-0.7388	10	0.48119	T	0.1	-3.8498	19.8546	0.96752	0.0:1.0:0.0:0.0	.	522	Q92786	PROX1_HUMAN	M	94;522;522;522;522	ENSP00000420283:T522M;ENSP00000355925:T522M;ENSP00000400694:T522M;ENSP00000261454:T522M	ENSP00000261454:T522M	T	+	2	0	PROX1	212238066	1.000000	0.71417	0.986000	0.45419	0.985000	0.73830	6.070000	0.71220	2.697000	0.92050	0.655000	0.94253	ACG	PROX1	-	pfam_Prox1	ENSG00000117707		0.552	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	HGNC	protein_coding	OTTHUMT00000089727.6	168	0.59	1	C	NM_002763		214171443	214171443	+1	no_errors	ENST00000261454	ensembl	human	known	69_37n	missense	141	27.69	54	SNP	1.000	T
PXDNL	137902	genome.wustl.edu	37	8	52366148	52366148	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:52366148C>A	ENST00000356297.4	-	10	1280	c.1180G>T	c.(1180-1182)Ggt>Tgt	p.G394C	PXDNL_ENST00000543296.1_Missense_Mutation_p.G394C	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	394	Ig-like C2-type 2.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTAAATCGACCATGATCCCGT	0.473																																						dbGAP											0													142.0	142.0	142.0					8																	52366148		2101	4216	6317	-	-	-	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1180G>T	8.37:g.52366148C>A	ENSP00000348645:p.Gly394Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.G394C	ENST00000356297.4	37	c.1180	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	C	10.14	1.268654	0.23136	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.60797	0.16;0.16	4.08	1.19	0.21007	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.82056	0.4954	H	0.98351	4.21	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.68432	-0.5410	9	0.87932	D	0	.	6.026	0.19656	0.0:0.6607:0.0:0.3393	.	394	A1KZ92	PXDNL_HUMAN	C	394	ENSP00000348645:G394C;ENSP00000444865:G394C	ENSP00000348645:G394C	G	-	1	0	PXDNL	52528701	0.658000	0.27402	0.000000	0.03702	0.003000	0.03518	1.783000	0.38664	0.185000	0.20105	0.650000	0.86243	GGT	PXDNL	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000147485		0.473	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	102	0.00	0	C	NM_144651		52366148	52366148	-1	no_errors	ENST00000356297	ensembl	human	known	69_37n	missense	51	46.88	45	SNP	0.190	A
RANBP3L	202151	genome.wustl.edu	37	5	36262047	36262047	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr5:36262047G>C	ENST00000296604.3	-	7	1063	c.578C>G	c.(577-579)tCa>tGa	p.S193*	RANBP3L_ENST00000502994.1_Nonsense_Mutation_p.S218*|RANBP3L_ENST00000515759.1_Nonsense_Mutation_p.S193*	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	193					intracellular transport (GO:0046907)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			TTACCCTACTGATGTTGCACC	0.343																																						dbGAP											0													126.0	137.0	133.0					5																	36262047		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.578C>G	5.37:g.36262047G>C	ENSP00000296604:p.Ser193*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z866|E9PGP9|Q96LK2	Nonsense_Mutation	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.S193*	ENST00000296604.3	37	c.578	CCDS3918.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.659263	0.98415	.	.	ENSG00000164188	ENST00000296604;ENST00000502994;ENST00000515759	.	.	.	5.29	3.24	0.37175	.	0.864998	0.09955	N	0.734234	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-0.1438	6.9468	0.24522	0.2497:0.0:0.7503:0.0	.	.	.	.	X	193;218;193	.	ENSP00000296604:S193X	S	-	2	0	RANBP3L	36297804	0.987000	0.35691	0.245000	0.24217	0.995000	0.86356	1.995000	0.40767	0.536000	0.28733	0.655000	0.94253	TCA	RANBP3L	-	NULL	ENSG00000164188		0.343	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RANBP3L	HGNC	protein_coding	OTTHUMT00000253773.2	135	0.00	0	G	NM_145000		36262047	36262047	-1	no_errors	ENST00000296604	ensembl	human	known	69_37n	nonsense	75	39.02	48	SNP	0.387	C
RBL1	5933	genome.wustl.edu	37	20	35696493	35696493	+	Silent	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr20:35696493A>G	ENST00000373664.3	-	3	453	c.387T>C	c.(385-387)ttT>ttC	p.F129F	RBL1_ENST00000344359.3_Silent_p.F129F	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	129					chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				TAGACACCTCAAAATTTCTCT	0.313																																						dbGAP											0													46.0	48.0	47.0					20																	35696493		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.387T>C	20.37:g.35696493A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Silent	SNP	pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,pfam_Rb_C,superfamily_Cyclin-like,smart_Cyclin-like	p.F129	ENST00000373664.3	37	c.387	CCDS13289.1	20																																																																																			RBL1	-	pfam_DUF3452_retinoblatoma-assoc	ENSG00000080839		0.313	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL1	HGNC	protein_coding	OTTHUMT00000079067.2	63	0.00	0	A	NM_002895		35696493	35696493	-1	no_errors	ENST00000373664	ensembl	human	known	69_37n	silent	6	90.62	58	SNP	1.000	G
RBM26	64062	genome.wustl.edu	37	13	79928636	79928636	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr13:79928636G>C	ENST00000438737.2	-	13	2364	c.1924C>G	c.(1924-1926)Cca>Gca	p.P642A	RBM26_ENST00000267229.7_Missense_Mutation_p.P639A|RBM26_ENST00000438724.1_Missense_Mutation_p.P642A			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	642					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		GAAGGTACTGGACCCAGCCGC	0.463																																						dbGAP											0													73.0	72.0	72.0					13																	79928636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.1924C>G	13.37:g.79928636G>C	ENSP00000387531:p.Pro642Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	pfam_PWI,superfamily_PWI,smart_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.P642A	ENST00000438737.2	37	c.1924		13	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599759	0.87055	.	.	ENSG00000139746	ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	D;D	0.93488	-3.23;-3.23	5.62	5.62	0.85841	.	0.051956	0.85682	D	0.000000	D	0.95714	0.8606	L	0.50333	1.59	0.80722	D	1	D;D;P;D	0.89917	1.0;0.967;0.905;0.967	D;P;P;P	0.83275	0.996;0.836;0.543;0.836	D	0.94455	0.7671	9	.	.	.	-12.7265	20.0333	0.97547	0.0:0.0:1.0:0.0	.	23;642;642;639	B4DZH7;Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;.;RBM26_HUMAN;.	A	639;643;642;642	ENSP00000267229:P639A;ENSP00000390222:P642A	.	P	-	1	0	RBM26	78826637	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.187000	0.77730	2.810000	0.96702	0.585000	0.79938	CCA	RBM26	-	NULL	ENSG00000139746		0.463	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	HGNC	protein_coding	OTTHUMT00000045373.4	248	0.00	0	G	NM_022118		79928636	79928636	-1	no_errors	ENST00000327303	ensembl	human	known	69_37n	missense	73	42.06	53	SNP	1.000	C
RGL2	5863	genome.wustl.edu	37	6	33263964	33263965	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:33263964_33263965insC	ENST00000497454.1	-	6	1103_1104	c.608_609insG	c.(607-609)ggcfs	p.G203fs	RGL2_ENST00000437840.2_5'UTR|PFDN6_ENST00000463584.1_Intron|RGL2_ENST00000444031.2_Frame_Shift_Ins_p.G121fs	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	203	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						GGTCAGCGCTGCCCCCCCCAAC	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.609dupG	6.37:g.33263972_33263972dupC	ENSP00000420211:p.Gly203fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG72|Q5STK0|Q9Y3F3	Frame_Shift_Ins	INS	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S204fs	ENST00000497454.1	37	c.609_608	CCDS4774.1	6																																																																																			RGL2	-	superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000237441		0.653	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL2	HGNC	protein_coding	OTTHUMT00000076098.2	40	0.00	0	-			33263964	33263965	-1	no_errors	ENST00000497454	ensembl	human	known	69_37n	frame_shift_ins	33	10.81	4	INS	1.000:1.000	C
RGS11	8786	genome.wustl.edu	37	16	324238	324238	+	Silent	SNP	T	T	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:324238T>G	ENST00000397770.3	-	5	363	c.346A>C	c.(346-348)Agg>Cgg	p.R116R	RGS11_ENST00000359740.5_Intron|RGS11_ENST00000316163.5_Silent_p.R95R|RGS11_ENST00000397768.3_Silent_p.R116R			O94810	RGS11_HUMAN	regulator of G-protein signaling 11	116					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)	8		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GCAGCCGGCCTCAGGGTACTT	0.657																																						dbGAP											0													46.0	37.0	40.0					16																	324238		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AF035153	CCDS10403.1, CCDS42088.1, CCDS66884.1	16p13.3	2008-07-28	2007-08-14		ENSG00000076344	ENSG00000076344		"""Regulators of G-protein signaling"""	9993	protein-coding gene	gene with protein product		603895	"""regulator of G-protein signalling 11"""			9789084	Standard	NM_001286486		Approved		uc002cgj.1	O94810	OTTHUMG00000064893	ENST00000397770.3:c.346A>C	16.37:g.324238T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O75883|Q4TT71|Q4TT72	Missense_Mutation	SNP	pfam_DEP_dom,pfscan_DEP_dom	p.E59A	ENST00000397770.3	37	c.176	CCDS42088.1	16																																																																																			RGS11	-	NULL	ENSG00000076344		0.657	RGS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS11	HGNC	protein_coding	OTTHUMT00000139325.2	22	0.00	0	T			324238	324238	-1	no_errors	ENST00000168869	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.994	G
RIMBP2	23504	genome.wustl.edu	37	12	130884319	130884319	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr12:130884319A>C	ENST00000261655.4	-	18	3200	c.3037T>G	c.(3037-3039)Ttc>Gtc	p.F1013V		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	1013	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCTTCCAAGAAGTTTGAGGGC	0.463																																						dbGAP											0													114.0	103.0	106.0					12																	130884319		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.3037T>G	12.37:g.130884319A>C	ENSP00000261655:p.Phe1013Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.F1013V	ENST00000261655.4	37	c.3037	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	A	27.1	4.800618	0.90538	.	.	ENSG00000060709	ENST00000261655;ENST00000536632	T;T	0.53857	0.6;0.6	5.32	5.32	0.75619	Src homology-3 domain (4);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.73961	0.3654	M	0.79693	2.465	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	T	0.78489	-0.2184	10	0.87932	D	0	-33.4778	15.3201	0.74115	1.0:0.0:0.0:0.0	.	1013	O15034	RIMB2_HUMAN	V	1013;150	ENSP00000261655:F1013V;ENSP00000439030:F150V	ENSP00000261655:F1013V	F	-	1	0	RIMBP2	129450272	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.898000	0.92538	2.028000	0.59812	0.392000	0.25879	TTC	RIMBP2	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	ENSG00000060709		0.463	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	149	0.00	0	A	NM_015347		130884319	130884319	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	1.000	C
RIMS1	22999	genome.wustl.edu	37	6	72596812	72596812	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:72596812C>G	ENST00000521978.1	+	1	86	c.86C>G	c.(85-87)aCc>aGc	p.T29S	RIMS1_ENST00000518273.1_Missense_Mutation_p.T29S|RIMS1_ENST00000264839.7_Missense_Mutation_p.T29S|RIMS1_ENST00000348717.5_Missense_Mutation_p.T29S|RIMS1_ENST00000517960.1_Missense_Mutation_p.T29S|RIMS1_ENST00000520567.1_Missense_Mutation_p.T29S|RIMS1_ENST00000491071.2_Missense_Mutation_p.T29S|RIMS1_ENST00000522291.1_Missense_Mutation_p.T29S	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	29	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGCCACCTGACCGAAGAGGAG	0.637																																						dbGAP											0													35.0	44.0	41.0					6																	72596812		2076	4199	6275	-	-	-	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.86C>G	6.37:g.72596812C>G	ENSP00000428417:p.Thr29Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.T29S	ENST00000521978.1	37	c.86	CCDS47449.1	6	.	.	.	.	.	.	.	.	.	.	c	15.92	2.975603	0.53720	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	4.96	3.12	0.35913	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.301945	0.20785	N	0.085725	T	0.78175	0.4242	L	0.55017	1.72	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	T	0.78996	-0.1983	10	0.87932	D	0	-0.3353	9.5392	0.39242	0.0:0.7787:0.1425:0.0788	.	29	Q86UR5	RIMS1_HUMAN	S	29	ENSP00000430101:T29S;ENSP00000275037:T29S;ENSP00000264839:T29S;ENSP00000429959:T29S;ENSP00000430408:T29S;ENSP00000430502:T29S;ENSP00000430932:T29S;ENSP00000428417:T29S	ENSP00000264839:T29S	T	+	2	0	RIMS1	72653533	1.000000	0.71417	0.998000	0.56505	0.621000	0.37620	5.670000	0.68088	0.470000	0.27294	-0.226000	0.12346	ACC	RIMS1	-	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	ENSG00000079841		0.637	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	63	0.00	0	C			72596812	72596812	+1	no_errors	ENST00000521978	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	G
ROCK2	9475	genome.wustl.edu	37	2	11334430	11334430	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:11334430C>T	ENST00000315872.6	-	29	4008	c.3560G>A	c.(3559-3561)aGt>aAt	p.S1187N	ROCK2_ENST00000401753.1_Missense_Mutation_p.S944N	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	1187	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		ATCTTGTTCACTGTCATAGAA	0.264																																						dbGAP											0													89.0	87.0	87.0					2																	11334430		1795	4041	5836	-	-	-	SO:0001583	missense	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.3560G>A	2.37:g.11334430C>T	ENSP00000317985:p.Ser1187Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.S1187N	ENST00000315872.6	37	c.3560	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	C	14.88	2.668512	0.47677	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.18502	2.21;2.21	5.81	5.81	0.92471	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.082643	0.85682	D	0.000000	T	0.17023	0.0409	N	0.24115	0.695	0.36838	D	0.887221	B	0.20052	0.041	B	0.28991	0.097	T	0.11179	-1.0598	10	0.34782	T	0.22	.	20.0755	0.97742	0.0:1.0:0.0:0.0	.	1187	O75116	ROCK2_HUMAN	N	1187;944;545	ENSP00000317985:S1187N;ENSP00000385509:S944N	ENSP00000317985:S1187N	S	-	2	0	ROCK2	11251881	0.938000	0.31826	1.000000	0.80357	0.996000	0.88848	2.007000	0.40883	2.749000	0.94314	0.460000	0.39030	AGT	ROCK2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology	ENSG00000134318		0.264	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	128	0.00	0	C			11334430	11334430	-1	no_errors	ENST00000315872	ensembl	human	known	69_37n	missense	21	73.75	59	SNP	1.000	T
RRN3	54700	genome.wustl.edu	37	16	15173953	15173953	+	Splice_Site	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr16:15173953C>G	ENST00000198767.6	-	9	750	c.667G>C	c.(667-669)Gaa>Caa	p.E223Q	RRN3_ENST00000429751.2_Splice_Site_p.E193Q|RRN3_ENST00000564131.1_Splice_Site_p.E223Q|RRN3_ENST00000563559.1_Splice_Site_p.E223Q|RRN3_ENST00000540462.1_Intron|RRN3_ENST00000327307.7_Splice_Site_p.E190Q|PDXDC1_ENST00000535621.2_Intron	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	223					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						ACGTAACATTCCTAAAGGAGA	0.299																																						dbGAP											0													24.0	24.0	24.0					16																	15173953		2192	4283	6475	-	-	-	SO:0001630	splice_region_variant	0			AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.667-1G>C	16.37:g.15173953C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	p.E223Q	ENST00000198767.6	37	c.667	CCDS10559.1	16	.	.	.	.	.	.	.	.	.	.	.	14.39	2.521074	0.44866	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307	T;T;T	0.42513	0.97;0.97;0.97	4.91	4.91	0.64330	.	0.064436	0.64402	U	0.000014	T	0.45955	0.1368	M	0.75264	2.295	0.80722	D	1	B;B;B	0.28178	0.047;0.202;0.093	B;B;B	0.32465	0.03;0.109;0.146	T	0.41893	-0.9483	10	0.12430	T	0.62	.	17.0375	0.86480	0.0:1.0:0.0:0.0	.	193;223;223	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	Q	223;193;190	ENSP00000198767:E223Q;ENSP00000402027:E193Q;ENSP00000318484:E190Q	ENSP00000198767:E223Q	E	-	1	0	RRN3	15081454	1.000000	0.71417	1.000000	0.80357	0.601000	0.36947	5.053000	0.64269	2.413000	0.81919	0.313000	0.20887	GAA	RRN3	-	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	ENSG00000085721		0.299	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRN3	HGNC	protein_coding	OTTHUMT00000252087.2	45	0.00	0	C	NM_018427	Missense_Mutation	15173953	15173953	-1	no_errors	ENST00000198767	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	G
SCG3	29106	genome.wustl.edu	37	15	51975544	51975544	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr15:51975544A>G	ENST00000220478.3	+	4	713	c.310A>G	c.(310-312)Aat>Gat	p.N104D	SCG3_ENST00000542355.2_5'UTR	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	104					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		TAATAAGTTGAATGTGGAAGA	0.323																																						dbGAP											0													133.0	141.0	139.0					15																	51975544		2195	4293	6488	-	-	-	SO:0001583	missense	0			AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.310A>G	15.37:g.51975544A>G	ENSP00000220478:p.Asn104Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	NULL	p.N104D	ENST00000220478.3	37	c.310	CCDS10142.1	15	.	.	.	.	.	.	.	.	.	.	A	14.47	2.543645	0.45280	.	.	ENSG00000104112	ENST00000220478	T	0.22336	1.96	5.93	4.81	0.61882	.	0.404992	0.29537	N	0.011868	T	0.10981	0.0268	N	0.14661	0.345	0.80722	D	1	P	0.37276	0.589	B	0.35971	0.215	T	0.12372	-1.0550	10	0.30854	T	0.27	-22.1831	7.1972	0.25860	0.8402:0.0:0.1598:0.0	.	104	Q8WXD2	SCG3_HUMAN	D	104	ENSP00000220478:N104D	ENSP00000220478:N104D	N	+	1	0	SCG3	49762836	1.000000	0.71417	0.984000	0.44739	0.969000	0.65631	4.129000	0.57957	2.263000	0.75096	0.533000	0.62120	AAT	SCG3	-	NULL	ENSG00000104112		0.323	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG3	HGNC	protein_coding	OTTHUMT00000254670.2	136	0.73	1	A	NM_013243		51975544	51975544	+1	no_errors	ENST00000220478	ensembl	human	known	69_37n	missense	12	81.82	54	SNP	0.695	G
SCN9A	6335	genome.wustl.edu	37	2	167060936	167060936	+	Silent	SNP	C	C	T	rs267598972		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:167060936C>T	ENST00000409435.1	-	24	4436	c.4437G>A	c.(4435-4437)aaG>aaA	p.K1479K	SCN9A_ENST00000303354.6_Silent_p.K1480K|SCN9A_ENST00000375387.4_Silent_p.K1480K|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Silent_p.K1468K			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1479					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TATAGTATTTCTTCTGTTCTT	0.323																																						dbGAP											0													80.0	86.0	84.0					2																	167060936		2187	4290	6477	-	-	-	SO:0001819	synonymous_variant	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4437G>A	2.37:g.167060936C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.K1480	ENST00000409435.1	37	c.4440	CCDS46441.1	2																																																																																			SCN9A	-	NULL	ENSG00000169432		0.323	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	209	0.00	0	C	NM_002977		167060936	167060936	-1	no_errors	ENST00000303354	ensembl	human	known	69_37n	silent	188	32.62	91	SNP	1.000	T
SEC31A	22872	genome.wustl.edu	37	4	83802025	83802025	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:83802025C>G	ENST00000395310.2	-	3	312	c.130G>C	c.(130-132)Gag>Cag	p.E44Q	SEC31A_ENST00000326950.5_Missense_Mutation_p.E44Q|SEC31A_ENST00000355196.2_Missense_Mutation_p.E44Q|SEC31A_ENST00000505472.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000508479.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000448323.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000500777.2_Missense_Mutation_p.E44Q|SEC31A_ENST00000311785.7_Missense_Mutation_p.E44Q|SEC31A_ENST00000508502.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000513858.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000505984.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000443462.2_Missense_Mutation_p.E39Q|SEC31A_ENST00000348405.4_Missense_Mutation_p.E44Q|SEC31A_ENST00000432794.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000509142.1_Missense_Mutation_p.E44Q|SEC31A_ENST00000436790.2_5'UTR	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	44					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				TCAAATATCTCAAGGGAAGCA	0.353																																						dbGAP											0													127.0	130.0	129.0					4																	83802025		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.130G>C	4.37:g.83802025C>G	ENSP00000378721:p.Glu44Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E44Q	ENST00000395310.2	37	c.130	CCDS3596.1	4	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725426	0.89298	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000505984;ENST00000508479;ENST00000514326;ENST00000513323;ENST00000503210;ENST00000505434	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.55760	0.91;0.81;1.79;1.63;0.7;1.63;1.79;0.91;0.7;0.5;0.81;1.83;1.79;1.92;1.84;1.27;1.28	4.41	4.41	0.53225	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74711	0.3752	M	0.82433	2.59	0.80722	D	1	D;D;D;D;D;P;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;0.918;0.985;0.999;0.999	D;D;D;D;D;P;P;D;D	0.91635	0.999;0.998;0.994;0.998;0.998;0.835;0.891;0.997;0.964	T	0.78858	-0.2038	10	0.54805	T	0.06	-17.7166	17.2009	0.86906	0.0:1.0:0.0:0.0	.	39;44;44;44;44;44;44;44;44	B4DIW6;B7ZL00;O94979-5;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979	.;.;.;.;.;.;.;.;SC31A_HUMAN	Q	44;44;44;39;44;44;44;44;44;44;44;44;44;44;44;44;44;44;44	ENSP00000337602:E44Q;ENSP00000426886:E44Q;ENSP00000378721:E44Q;ENSP00000408027:E39Q;ENSP00000426569:E44Q;ENSP00000407944:E44Q;ENSP00000400926:E44Q;ENSP00000325087:E44Q;ENSP00000309070:E44Q;ENSP00000421633:E44Q;ENSP00000421464:E44Q;ENSP00000424635:E44Q;ENSP00000347329:E44Q;ENSP00000424451:E44Q;ENSP00000425999:E44Q;ENSP00000425555:E44Q;ENSP00000426950:E44Q	ENSP00000309070:E44Q	E	-	1	0	SEC31A	84021049	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.576000	0.82467	2.298000	0.77334	0.460000	0.39030	GAG	SEC31A	-	superfamily_WD40_repeat_dom	ENSG00000138674		0.353	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	145	0.00	0	C	NM_016211		83802025	83802025	-1	no_errors	ENST00000432794	ensembl	human	known	69_37n	missense	67	42.74	50	SNP	1.000	G
SEC63	11231	genome.wustl.edu	37	6	108246121	108246121	+	Silent	SNP	A	A	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:108246121A>C	ENST00000369002.4	-	3	419	c.240T>G	c.(238-240)ctT>ctG	p.L80L		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	80					liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CCCATCCTGCAAGCAGAACTA	0.348																																						dbGAP											0													121.0	119.0	120.0					6																	108246121		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.240T>G	6.37:g.108246121A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Silent	SNP	pfam_Sec63-dom,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_ARM-type_fold,smart_DnaJ_N,smart_Sec63-dom,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.L80	ENST00000369002.4	37	c.240	CCDS5061.1	6																																																																																			SEC63	-	NULL	ENSG00000025796		0.348	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC63	HGNC	protein_coding	OTTHUMT00000041705.4	133	0.00	0	A	NM_007214		108246121	108246121	-1	no_errors	ENST00000369002	ensembl	human	known	69_37n	silent	64	43.36	49	SNP	1.000	C
SEC63	11231	genome.wustl.edu	37	6	108250658	108250658	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:108250658C>T	ENST00000369002.4	-	2	364	c.185G>A	c.(184-186)cGg>cAg	p.R62Q	RNU6-437P_ENST00000459408.1_RNA	NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	62					liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TTTTAATAACCGTAAACGATA	0.299																																						dbGAP											0													159.0	159.0	159.0					6																	108250658		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.185G>A	6.37:g.108250658C>T	ENSP00000357998:p.Arg62Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_ARM-type_fold,smart_DnaJ_N,smart_Sec63-dom,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.R62Q	ENST00000369002.4	37	c.185	CCDS5061.1	6	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530902	0.64972	.	.	ENSG00000025796	ENST00000369002;ENST00000429168	T;T	0.75050	-0.9;-0.08	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.40119	0.1104	N	0.17474	0.49	0.53688	D	0.999977	B	0.21821	0.061	B	0.13407	0.009	T	0.37267	-0.9713	10	0.13108	T	0.6	-14.1314	12.6629	0.56824	0.0:0.9242:0.0:0.0757	.	62	Q9UGP8	SEC63_HUMAN	Q	62;6	ENSP00000357998:R62Q;ENSP00000403144:R6Q	ENSP00000357998:R62Q	R	-	2	0	SEC63	108357351	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	5.655000	0.67981	2.576000	0.86940	0.557000	0.71058	CGG	SEC63	-	NULL	ENSG00000025796		0.299	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC63	HGNC	protein_coding	OTTHUMT00000041705.4	173	0.00	0	C	NM_007214		108250658	108250658	-1	no_errors	ENST00000369002	ensembl	human	known	69_37n	missense	140	38.86	89	SNP	1.000	T
SEPSECS	51091	genome.wustl.edu	37	4	25160722	25160722	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:25160722C>A	ENST00000382103.2	-	2	194	c.122G>T	c.(121-123)tGt>tTt	p.C41F	PI4K2B_ENST00000512921.1_5'Flank|SEPSECS_ENST00000302922.3_Intron	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	41	Tetramerization.				selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				ATTCTCTGGACACTTGCCCtt	0.328																																						dbGAP											0													130.0	109.0	116.0					4																	25160722		692	1591	2283	-	-	-	SO:0001583	missense	0			AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.122G>T	4.37:g.25160722C>A	ENSP00000371535:p.Cys41Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Missense_Mutation	SNP	pfam_SLA/LP_auto_ag,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Sec-tRNA_Se_transferase	p.C41F	ENST00000382103.2	37	c.122	CCDS3432.2	4	.	.	.	.	.	.	.	.	.	.	C	9.063	0.994934	0.19043	.	.	ENSG00000109618	ENST00000382103;ENST00000513285	T;T	0.81330	-1.48;-1.48	5.71	5.71	0.89125	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.88273	0.6392	M	0.68952	2.095	0.80722	D	1	D;P	0.63880	0.993;0.914	P;B	0.62740	0.906;0.236	D	0.86897	0.2052	9	.	.	.	-0.434	19.8461	0.96707	0.0:1.0:0.0:0.0	.	40;41	Q9HD40-3;Q9HD40	.;SPCS_HUMAN	F	41;126	ENSP00000371535:C41F;ENSP00000423361:C126F	.	C	-	2	0	SEPSECS	24769820	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.648000	0.67930	2.682000	0.91365	0.650000	0.86243	TGT	SEPSECS	-	superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Sec-tRNA_Se_transferase	ENSG00000109618		0.328	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPSECS	HGNC	protein_coding	OTTHUMT00000250414.2	181	0.00	0	C	NM_016955		25160722	25160722	-1	no_errors	ENST00000382103	ensembl	human	known	69_37n	missense	64	48.80	61	SNP	1.000	A
SIN3A	25942	genome.wustl.edu	37	15	75676645	75676645	+	Missense_Mutation	SNP	C	C	G	rs149212643		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr15:75676645C>G	ENST00000394947.3	-	17	3469	c.3155G>C	c.(3154-3156)cGg>cCg	p.R1052P	SIN3A_ENST00000394949.4_Missense_Mutation_p.R1052P|SIN3A_ENST00000360439.4_Missense_Mutation_p.R1052P	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						CTCAGCTTTCCGCTGATACGT	0.488																																						dbGAP											0													134.0	139.0	137.0					15																	75676645		2197	4294	6491	-	-	-	SO:0001583	missense	0			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3155G>C	15.37:g.75676645C>G	ENSP00000378402:p.Arg1052Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.R1052P	ENST00000394947.3	37	c.3155	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630295	0.87660	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.50001	0.76;0.76;0.76	6.0	6.0	0.97389	.	0.000000	0.85682	D	0.000000	T	0.69922	0.3165	M	0.79123	2.44	0.80722	D	1	D	0.71674	0.998	D	0.65443	0.935	T	0.68078	-0.5504	10	0.45353	T	0.12	-23.4555	19.5479	0.95307	0.0:1.0:0.0:0.0	.	1052	Q96ST3	SIN3A_HUMAN	P	1052	ENSP00000378402:R1052P;ENSP00000378403:R1052P;ENSP00000353622:R1052P	ENSP00000353622:R1052P	R	-	2	0	SIN3A	73463698	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.074000	0.71253	2.868000	0.98415	0.556000	0.70494	CGG	SIN3A	-	NULL	ENSG00000169375		0.488	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1	47	0.00	0	C	NM_015477		75676645	75676645	-1	no_errors	ENST00000360439	ensembl	human	known	69_37n	missense	4	73.33	11	SNP	1.000	G
SIPA1L2	57568	genome.wustl.edu	37	1	232561450	232561450	+	Silent	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr1:232561450C>G	ENST00000366630.1	-	17	4873	c.4515G>C	c.(4513-4515)cgG>cgC	p.R1505R	SIPA1L2_ENST00000262861.4_Silent_p.R1505R|SIPA1L2_ENST00000308942.4_Silent_p.R579R			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1505					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCACGGAACTCCGGGAACTGC	0.632																																						dbGAP											0													59.0	75.0	69.0					1																	232561450		2191	4294	6485	-	-	-	SO:0001819	synonymous_variant	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.4515G>C	1.37:g.232561450C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.R1505	ENST00000366630.1	37	c.4515	CCDS41474.1	1																																																																																			SIPA1L2	-	pfam_DUF3401	ENSG00000116991		0.632	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	176	0.56	1	C	XM_045839		232561450	232561450	-1	no_errors	ENST00000262861	ensembl	human	known	69_37n	silent	166	29.66	70	SNP	0.040	G
SLC16A13	201232	genome.wustl.edu	37	17	6942180	6942181	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:6942180_6942181insG	ENST00000308027.6	+	3	1361_1362	c.1053_1054insG	c.(1054-1056)gggfs	p.G352fs		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	352						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						TAGAGAGCATCGGGGGGCTGCT	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.1059dupG	17.37:g.6942186_6942186dupG	ENSP00000309751:p.Gly352fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMG3|A5PKU5|Q2VP92	Frame_Shift_Ins	INS	pfam_MFS,pfam_Atg22-like,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L353fs	ENST00000308027.6	37	c.1053_1054	CCDS11085.1	17																																																																																			SLC16A13	-	pfam_MFS,pfam_Atg22-like,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000174327		0.574	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A13	HGNC	protein_coding	OTTHUMT00000219923.2	32	0.00	0	-			6942180	6942181	+1	no_errors	ENST00000308027	ensembl	human	known	69_37n	frame_shift_ins	17	10.53	2	INS	0.987:1.000	G
SLC22A2	6582	genome.wustl.edu	37	6	160670398	160670398	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:160670398C>T	ENST00000366953.3	-	4	950	c.692G>A	c.(691-693)cGg>cAg	p.R231Q	SLC22A2_ENST00000366952.1_Missense_Mutation_p.R210Q|SLC22A2_ENST00000491092.1_5'UTR	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	231					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	CCGATATCTCCGCCCAACAAA	0.458																																						dbGAP											0													125.0	115.0	119.0					6																	160670398		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.692G>A	6.37:g.160670398C>T	ENSP00000355920:p.Arg231Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.R231Q	ENST00000366953.3	37	c.692	CCDS5276.1	6	.	.	.	.	.	.	.	.	.	.	C	11.49	1.654894	0.29425	.	.	ENSG00000112499	ENST00000366953;ENST00000366952	T;T	0.73897	-0.79;-0.79	5.31	-3.26	0.05064	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.658250	0.14825	N	0.296235	T	0.31857	0.0810	N	0.14661	0.345	0.09310	N	1	P;P	0.37997	0.527;0.614	B;B	0.36922	0.19;0.236	T	0.31530	-0.9940	10	0.54805	T	0.06	.	6.8172	0.23837	0.485:0.2115:0.3035:0.0	.	231;231	O15244;O15244-2	S22A2_HUMAN;.	Q	231;210	ENSP00000355920:R231Q;ENSP00000355919:R210Q	ENSP00000355919:R210Q	R	-	2	0	SLC22A2	160590388	0.081000	0.21417	0.535000	0.28026	0.446000	0.32137	1.711000	0.37930	-0.708000	0.05015	-1.720000	0.00707	CGG	SLC22A2	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000112499		0.458	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A2	HGNC	protein_coding	OTTHUMT00000042943.1	161	0.00	0	C	NM_003058		160670398	160670398	-1	no_errors	ENST00000366953	ensembl	human	known	69_37n	missense	97	40.24	66	SNP	0.109	T
SPATA18	132671	genome.wustl.edu	37	4	52943137	52943137	+	Silent	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:52943137G>A	ENST00000295213.4	+	7	1325	c.951G>A	c.(949-951)gcG>gcA	p.A317A	SPATA18_ENST00000419395.2_Silent_p.A285A	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	317					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			GCCTGGACGCGCAGTGCCTGC	0.642																																						dbGAP											0													41.0	31.0	34.0					4																	52943137		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.951G>A	4.37:g.52943137G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Silent	SNP	NULL	p.A317	ENST00000295213.4	37	c.951	CCDS3489.1	4																																																																																			SPATA18	-	NULL	ENSG00000163071		0.642	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA18	HGNC	protein_coding	OTTHUMT00000250597.2	94	0.00	0	G	NM_145263		52943137	52943137	+1	no_errors	ENST00000295213	ensembl	human	known	69_37n	silent	38	44.29	31	SNP	0.784	A
SRP72	6731	genome.wustl.edu	37	4	57333819	57333820	+	Frame_Shift_Ins	INS	-	-	G	rs17524437	byFrequency	TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:57333819_57333820insG	ENST00000342756.5	+	1	739_740	c.18_19insG	c.(19-21)gggfs	p.G7fs	SRP72_ENST00000504757.1_Frame_Shift_Ins_p.G7fs|SRP72_ENST00000510663.1_Frame_Shift_Ins_p.G7fs	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	7					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					GCGGCGGCAGCGGGGGGGTGTC	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.25dupG	4.37:g.57333826_57333826dupG	ENSP00000342181:p.Gly7fs	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9Z8|Q7Z3C0	Frame_Shift_Ins	INS	pfam_Signal_recog_part_SRP72_RNA-bd,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V8fs	ENST00000342756.5	37	c.18_19	CCDS3506.1	4																																																																																			SRP72	-	NULL	ENSG00000174780		0.639	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP72	HGNC	protein_coding	OTTHUMT00000250782.7	25	0.00	0	-			57333819	57333820	+1	no_errors	ENST00000342756	ensembl	human	known	69_37n	frame_shift_ins	26	10.34	3	INS	0.414:0.920	G
SPP1	6696	genome.wustl.edu	37	4	88902730	88902730	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:88902730A>C	ENST00000395080.3	+	6	447	c.320A>C	c.(319-321)gAc>gCc	p.D107A	SPP1_ENST00000237623.7_Missense_Mutation_p.D93A|SPP1_ENST00000509659.1_3'UTR|SPP1_ENST00000360804.4_Missense_Mutation_p.D80A	NM_001040058.1|NM_001251830.1	NP_001035147.1|NP_001238759.1	P10451	OSTP_HUMAN	secreted phosphoprotein 1	107					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|negative regulation of collateral sprouting of intact axon in response to injury (GO:0048685)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell-substrate adhesion (GO:0010811)|response to steroid hormone (GO:0048545)|response to vitamin D (GO:0033280)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix binding (GO:0050840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		GACTCGAACGACTCTGATGAT	0.458																																						dbGAP											0													316.0	291.0	299.0					4																	88902730		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3626.1, CCDS34027.1, CCDS43250.1	4q22.1	2014-01-30	2008-07-31		ENSG00000118785	ENSG00000118785		"""Endogenous ligands"""	11255	protein-coding gene	gene with protein product	"""early T-lymphocyte activation 1"""	166490	"""osteopontin"", ""bone sialoprotein I"""	BNSP, OPN		1575754	Standard	NM_001251829		Approved	BSPI, ETA-1	uc003hra.3	P10451	OTTHUMG00000130599	ENST00000395080.3:c.320A>C	4.37:g.88902730A>C	ENSP00000378517:p.Asp107Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA1|Q15681|Q15682|Q15683|Q4W597|Q567T5|Q8NBK2|Q96IZ1	Missense_Mutation	SNP	pfam_Osteopontin,smart_Osteopontin,prints_Osteopontin	p.D107A	ENST00000395080.3	37	c.320	CCDS43250.1	4	.	.	.	.	.	.	.	.	.	.	A	16.07	3.017693	0.54576	.	.	ENSG00000118785	ENST00000535912;ENST00000237623;ENST00000395080;ENST00000360804;ENST00000508233	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	4.51	4.51	0.55191	.	0.193276	0.35436	N	0.003209	T	0.48660	0.1512	L	0.55990	1.75	0.09310	N	1	D;D;D;D;D	0.58620	0.983;0.983;0.983;0.983;0.983	P;P;P;P;P	0.58266	0.836;0.836;0.836;0.836;0.836	T	0.40175	-0.9577	10	0.72032	D	0.01	-2.1445	12.185	0.54234	1.0:0.0:0.0:0.0	.	120;66;93;80;107	B7Z351;Q3LGB0;B2RDA1;Q567T5;P10451	.;.;.;.;OSTP_HUMAN	A	66;93;107;80;66	ENSP00000237623:D93A;ENSP00000378517:D107A;ENSP00000354042:D80A;ENSP00000422973:D66A	ENSP00000237623:D93A	D	+	2	0	SPP1	89121754	0.006000	0.16342	0.032000	0.17829	0.056000	0.15407	1.579000	0.36536	2.252000	0.74401	0.519000	0.50382	GAC	SPP1	-	pfam_Osteopontin,smart_Osteopontin	ENSG00000118785		0.458	SPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPP1	HGNC	protein_coding	OTTHUMT00000253048.3	114	0.00	0	A			88902730	88902730	+1	no_errors	ENST00000395080	ensembl	human	known	69_37n	missense	44	53.68	51	SNP	0.133	C
STARD8	9754	genome.wustl.edu	37	X	67943519	67943520	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:67943519_67943520insC	ENST00000252336.6	+	12	2983_2984	c.2611_2612insC	c.(2611-2613)gccfs	p.A871fs	STARD8_ENST00000374599.3_Frame_Shift_Ins_p.A951fs|STARD8_ENST00000374597.3_Frame_Shift_Ins_p.A871fs	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	871	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.A874fs*16(2)|p.A954fs*16(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AGAGGTGGCAGCCCCCCCAGCT	0.678																																						dbGAP											3	Insertion - Frameshift(3)	large_intestine(3)							,,	19,3628		1,14,3,1555,504					,,	3.6	0.0			14	27,6388		0,14,13,2327,1720	no	frameshift,frameshift,frameshift	STARD8	NM_014725.4,NM_001142504.2,NM_001142503.2	,,	1,28,16,3882,2224	A1A1,A1R,A1,RR,R		0.4209,0.521,0.4572	,,	,,		46,10016				-	-	-	SO:0001589	frameshift_variant	0			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.2618dupC	X.37:g.67943526_67943526dupC	ENSP00000252336:p.Ala871fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Frame_Shift_Ins	INS	pfam_START_lipid-bd,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.A954fs	ENST00000252336.6	37	c.2851_2852	CCDS14390.1	X																																																																																			STARD8	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	ENSG00000130052		0.678	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	34	0.00	0	-	NM_014725		67943519	67943520	+1	no_errors	ENST00000374599	ensembl	human	known	69_37n	frame_shift_ins	12	14.29	2	INS	0.850:0.851	C
STK4	6789	genome.wustl.edu	37	20	43703761	43703761	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr20:43703761C>T	ENST00000372806.3	+	11	1503	c.1408C>T	c.(1408-1410)Cgg>Tgg	p.R470W	STK4_ENST00000499879.2_Missense_Mutation_p.R415W|STK4_ENST00000372801.1_3'UTR	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	470	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				CCAGTCCAAGCGGCAGCCCAT	0.572																																					GBM(187;1039 2137 11798 21916 33213)	dbGAP											0													49.0	48.0	48.0					20																	43703761		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.1408C>T	20.37:g.43703761C>T	ENSP00000361892:p.Arg470Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_SARAH,pfscan_Prot_kinase_cat_dom	p.R470W	ENST00000372806.3	37	c.1408	CCDS13341.1	20	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133550	0.77662	.	.	ENSG00000101109	ENST00000372806;ENST00000499879	T;T	0.80123	-1.34;-0.49	5.99	4.02	0.46733	SARAH domain (1);SARAH (1);	0.063202	0.64402	D	0.000008	D	0.89653	0.6777	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90703	0.4622	10	0.87932	D	0	.	15.3402	0.74290	0.2676:0.7324:0.0:0.0	.	415;470	F5H5B4;Q13043	.;STK4_HUMAN	W	470;415	ENSP00000361892:R470W;ENSP00000443514:R415W	ENSP00000361892:R470W	R	+	1	2	STK4	43137175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.162000	0.42367	0.819000	0.34492	0.655000	0.94253	CGG	STK4	-	pfam_SARAH_domain,pfscan_SARAH	ENSG00000101109		0.572	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK4	HGNC	protein_coding	OTTHUMT00000080401.4	92	0.00	0	C	NM_006282		43703761	43703761	+1	no_errors	ENST00000372806	ensembl	human	known	69_37n	missense	90	31.82	42	SNP	1.000	T
SYNPO2	171024	genome.wustl.edu	37	4	119810233	119810233	+	Silent	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr4:119810233G>T	ENST00000429713.2	+	1	224	c.42G>T	c.(40-42)ggG>ggT	p.G14G	SYNPO2_ENST00000307142.4_Silent_p.G14G|SYNPO2_ENST00000448416.2_Silent_p.G14G|SYNPO2_ENST00000434046.2_Silent_p.G14G	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	14	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGACTGGAGGGGCGCCCTGGG	0.537																																						dbGAP											0													98.0	99.0	99.0					4																	119810233		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.42G>T	4.37:g.119810233G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G14	ENST00000429713.2	37	c.42	CCDS47129.1	4																																																																																			SYNPO2	-	pfam_PDZ,superfamily_PDZ,pfscan_PDZ	ENSG00000172403		0.537	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	HGNC	protein_coding	OTTHUMT00000364020.1	227	0.00	0	G			119810233	119810233	+1	no_errors	ENST00000307142	ensembl	human	known	69_37n	silent	6	96.11	173	SNP	1.000	T
TBP	6908	genome.wustl.edu	37	6	170878735	170878735	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:170878735C>A	ENST00000392092.2	+	6	992	c.713C>A	c.(712-714)gCt>gAt	p.A238D	TBP_ENST00000230354.6_Missense_Mutation_p.A238D|TBP_ENST00000540980.1_Missense_Mutation_p.A218D	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	238					cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		AGAAAATATGCTAGAGTTGTA	0.383																																						dbGAP											0													94.0	94.0	94.0					6																	170878735		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.713C>A	6.37:g.170878735C>A	ENSP00000375942:p.Ala238Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Nonsense_Mutation	SNP	pfam_TBP,prints_TBP	p.C12*	ENST00000392092.2	37	c.36	CCDS5315.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.9|23.9	4.474160|4.474160	0.84640|0.84640	.|.	.|.	ENSG00000112592|ENSG00000112592	ENST00000392092;ENST00000540980;ENST00000230354;ENST00000392091|ENST00000446829	T;T;T|.	0.49432|.	0.78;0.78;0.78|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);Beta2-adaptin/TATA-box binding, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.87861|.	0.6284|.	H|H	0.96015|0.96015	3.755|3.755	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.91635|.	0.999|.	D|.	0.90041|.	0.4142|.	10|.	0.87932|.	D|.	0|.	-11.8617|-11.8617	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	238|.	P20226|.	TBP_HUMAN|.	D|X	238;218;238;215|12	ENSP00000375942:A238D;ENSP00000442132:A218D;ENSP00000230354:A238D|.	ENSP00000230354:A238D|.	A|C	+|+	2|3	0|2	TBP|TBP	170720660|170720660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	7.341000|7.341000	0.79300|0.79300	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCT|TGC	TBP	-	NULL	ENSG00000112592		0.383	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	269	0.00	0	C	NM_003194		170878735	170878735	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000446829	ensembl	human	known	69_37n	nonsense	116	55.56	145	SNP	1.000	A
TG	7038	genome.wustl.edu	37	8	133898735	133898735	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:133898735C>T	ENST00000220616.4	+	9	1158	c.1118C>T	c.(1117-1119)tCc>tTc	p.S373F	TG_ENST00000377869.1_Missense_Mutation_p.S373F	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	373					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAGGCCTTGTCCAGACTCTAC	0.502																																						dbGAP											0													116.0	118.0	117.0					8																	133898735		2203	4300	6503	-	-	-	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1118C>T	8.37:g.133898735C>T	ENSP00000220616:p.Ser373Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.S373F	ENST00000220616.4	37	c.1118	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199192	0.79015	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.70986	-0.53;-0.5	5.81	5.81	0.92471	.	1.293190	0.05116	N	0.489728	D	0.84835	0.5560	M	0.64404	1.975	0.43852	D	0.996442	D	0.76494	0.999	D	0.62955	0.909	T	0.74648	-0.3595	10	0.87932	D	0	.	19.051	0.93046	0.0:1.0:0.0:0.0	.	373	P01266	THYG_HUMAN	F	373	ENSP00000367100:S373F;ENSP00000220616:S373F	ENSP00000220616:S373F	S	+	2	0	TG	133967917	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	6.492000	0.73654	2.745000	0.94114	0.655000	0.94253	TCC	TG	-	pirsf_Thyroglobulin	ENSG00000042832		0.502	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	76	0.00	0	C	NM_003235		133898735	133898735	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	missense	149	13.87	24	SNP	1.000	T
TMC2	117532	genome.wustl.edu	37	20	2552868	2552868	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr20:2552868A>G	ENST00000358864.1	+	5	613	c.598A>G	c.(598-600)Aag>Gag	p.K200E		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	200	Arg/Asp/Glu/Lys-rich (highly charged).				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGCCTTGGGAAAGGGGAAAGG	0.483																																						dbGAP											0													124.0	117.0	120.0					20																	2552868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.598A>G	20.37:g.2552868A>G	ENSP00000351732:p.Lys200Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	pfam_TMC	p.K200E	ENST00000358864.1	37	c.598	CCDS13029.2	20	.	.	.	.	.	.	.	.	.	.	A	19.58	3.853604	0.71719	.	.	ENSG00000149488	ENST00000358864	T	0.50001	0.76	5.16	4.05	0.47172	.	0.000000	0.85682	D	0.000000	T	0.66346	0.2780	M	0.79123	2.44	0.50813	D	0.999897	D;D;D;D	0.69078	0.989;0.983;0.997;0.995	P;P;D;D	0.72982	0.818;0.524;0.979;0.972	T	0.68629	-0.5358	10	0.72032	D	0.01	-22.9223	10.705	0.45950	0.8396:0.1604:0.0:0.0	.	31;32;200;200	B4DFB3;B7ZAE6;Q8TDI7-3;Q8TDI7	.;.;.;TMC2_HUMAN	E	200	ENSP00000351732:K200E	ENSP00000351732:K200E	K	+	1	0	TMC2	2500868	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.998000	0.76277	0.903000	0.36546	0.533000	0.62120	AAG	TMC2	-	NULL	ENSG00000149488		0.483	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	341	0.00	0	A			2552868	2552868	+1	no_errors	ENST00000358864	ensembl	human	known	69_37n	missense	170	46.75	151	SNP	1.000	G
TMC3	342125	genome.wustl.edu	37	15	81633785	81633785	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr15:81633785C>T	ENST00000359440.5	-	16	1925	c.1790G>A	c.(1789-1791)aGc>aAc	p.S597N	RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000559277.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.S598N|RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						CACAGCCCAGCTTCTCAGGTA	0.483																																						dbGAP											0													49.0	50.0	49.0					15																	81633785		1981	4170	6151	-	-	-	SO:0001583	missense	0			AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.1790G>A	15.37:g.81633785C>T	ENSP00000352413:p.Ser597Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TMC	p.S597N	ENST00000359440.5	37	c.1790	CCDS45324.1	15	.	.	.	.	.	.	.	.	.	.	C	31	5.093848	0.94149	.	.	ENSG00000188869	ENST00000359440	T	0.63744	-0.06	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.73087	0.3542	L	0.45581	1.43	0.58432	D	0.999995	D;D	0.89917	1.0;0.967	D;P	0.75484	0.986;0.884	T	0.66452	-0.5920	10	0.17369	T	0.5	-26.8733	19.1207	0.93362	0.0:1.0:0.0:0.0	.	597;597	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	N	597	ENSP00000352413:S597N	ENSP00000352413:S597N	S	-	2	0	TMC3	79420840	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.456000	0.80751	2.508000	0.84585	0.585000	0.79938	AGC	TMC3	-	pfam_TMC	ENSG00000188869		0.483	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMC3	HGNC	protein_coding	OTTHUMT00000417795.3	111	0.00	0	C	NM_181841		81633785	81633785	-1	no_errors	ENST00000359440	ensembl	human	known	69_37n	missense	45	39.19	29	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577610	7577610	+	Splice_Site	SNP	T	T	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:7577610T>C	ENST00000269305.4	-	7	862		c.e7-2		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(43)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAGCCAACCTAGGAGATAAC	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Unknown(43)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	lung(16)|liver(7)|upper_aerodigestive_tract(5)|biliary_tract(5)|ovary(5)|breast(4)|bone(4)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|urinary_tract(1)|oesophagus(1)											88.0	74.0	79.0					17																	7577610		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.673-2A>G	17.37:g.7577610T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e6-2	ENST00000269305.4	37	c.673-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.76	3.468043	0.63625	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	3.35	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3302	0.43818	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518335	1.000000	0.71417	0.324000	0.25361	0.557000	0.35523	7.634000	0.83273	1.750000	0.51863	0.379000	0.24179	.	TP53	-	-	ENSG00000141510		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	195	0.00	0	T	NM_000546	Intron	7577610	7577610	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	18	80.65	75	SNP	0.999	C
TRIM65	201292	genome.wustl.edu	37	17	73888871	73888871	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr17:73888871G>C	ENST00000269383.3	-	2	540	c.475C>G	c.(475-477)Cta>Gta	p.L159V		NM_001256124.1|NM_173547.3	NP_001243053.1|NP_775818.2	Q6PJ69	TRI65_HUMAN	tripartite motif containing 65	159						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGCTCTAGTAGCTGGCCTTCG	0.667																																						dbGAP											0													49.0	44.0	46.0					17																	73888871		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006138	CCDS11732.1	17q25.1	2013-01-09	2011-01-25		ENSG00000141569	ENSG00000141569		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	27316	protein-coding gene	gene with protein product			"""tripartite motif-containing 65"""			12477932	Standard	NM_173547		Approved		uc002jpx.4	Q6PJ69	OTTHUMG00000132127	ENST00000269383.3:c.475C>G	17.37:g.73888871G>C	ENSP00000269383:p.Leu159Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0F0|Q6DKJ6|Q9BRP6	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L159V	ENST00000269383.3	37	c.475	CCDS11732.1	17	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	g|g|g	13.69|13.69|13.69	2.311439|2.311439|2.311439	0.40895|0.40895|0.40895	.|.|.	.|.|.	ENSG00000141569|ENSG00000141569|ENSG00000141569	ENST00000540128|ENST00000269383|ENST00000543309	.|T|.	.|0.58358|.	.|0.34|.	4.74|4.74|4.74	4.74|4.74|4.74	0.60224|0.60224|0.60224	.|.|.	.|0.000000|.	.|0.39146|.	.|N|.	.|0.001444|.	T|T|T	0.27594|0.27594|0.27594	0.0678|0.0678|0.0678	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.29364|0.29364|0.29364	N|N|N	0.864477|0.864477|0.864477	.|B|.	.|0.29988|.	.|0.264|.	.|B|.	.|0.31547|.	.|0.132|.	T|T|T	0.14811|0.14811|0.14811	-1.0459|-1.0459|-1.0459	5|10|5	.|0.12103|.	.|T|.	.|0.63|.	.|.|.	13.6113|13.6113|13.6113	0.62080|0.62080|0.62080	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|159|.	.|Q6PJ69|.	.|TRI65_HUMAN|.	G|V|R	150|159|32	.|ENSP00000269383:L159V|.	.|ENSP00000269383:L159V|.	A|L|S	-|-|-	2|1|3	0|2|2	TRIM65|TRIM65|TRIM65	71400466|71400466|71400466	0.973000|0.973000|0.973000	0.33851|0.33851|0.33851	0.946000|0.946000|0.946000	0.38457|0.38457|0.38457	0.015000|0.015000|0.015000	0.08874|0.08874|0.08874	2.297000|2.297000|2.297000	0.43593|0.43593|0.43593	2.358000|2.358000|2.358000	0.79984|0.79984|0.79984	0.556000|0.556000|0.556000	0.70494|0.70494|0.70494	GCT|CTA|AGC	TRIM65	-	NULL	ENSG00000141569		0.667	TRIM65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM65	HGNC	protein_coding	OTTHUMT00000255170.2	73	0.00	0	G	NM_173547		73888871	73888871	-1	no_errors	ENST00000269383	ensembl	human	known	69_37n	missense	88	14.56	15	SNP	0.955	C
TTC21A	199223	genome.wustl.edu	37	3	39167781	39167781	+	Silent	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:39167781A>G	ENST00000431162.2	+	12	1580	c.1446A>G	c.(1444-1446)ccA>ccG	p.P482P	TTC21A_ENST00000301819.6_Silent_p.P482P|TTC21A_ENST00000440121.1_Silent_p.P433P			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	482										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TCGTGTCTCCACTTCTTAAAC	0.527																																						dbGAP											0													128.0	134.0	132.0					3																	39167781		1980	4174	6154	-	-	-	SO:0001819	synonymous_variant	0			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.1446A>G	3.37:g.39167781A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Silent	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P482	ENST00000431162.2	37	c.1446	CCDS46800.1	3																																																																																			TTC21A	-	NULL	ENSG00000168026		0.527	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC21A	HGNC	protein_coding	OTTHUMT00000377829.1	186	0.53	1	A	NM_145755		39167781	39167781	+1	no_errors	ENST00000301819	ensembl	human	known	69_37n	silent	14	84.44	76	SNP	0.849	G
TTN	7273	genome.wustl.edu	37	2	179400248	179400248	+	Silent	SNP	A	A	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:179400248A>G	ENST00000591111.1	-	308	96395	c.96171T>C	c.(96169-96171)gtT>gtC	p.V32057V	TTN_ENST00000342175.6_Silent_p.V24825V|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000359218.5_Silent_p.V24758V|TTN_ENST00000460472.2_Silent_p.V24633V|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN_ENST00000589042.1_Silent_p.V33698V|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000342992.6_Silent_p.V31130V			Q8WZ42	TITIN_HUMAN	titin	32057	Fibronectin type-III 132. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGACATCACTAACTTTGACTC	0.433																																						dbGAP											0													88.0	94.0	92.0					2																	179400248		2055	4204	6259	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96171T>C	2.37:g.179400248A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V31130	ENST00000591111.1	37	c.93390		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	98	0.00	0	A	NM_133378		179400248	179400248	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	27	71.28	67	SNP	0.886	G
TTN	7273	genome.wustl.edu	37	2	179499339	179499339	+	Missense_Mutation	SNP	C	C	A	rs376192503		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:179499339C>A	ENST00000591111.1	-	180	37470	c.37246G>T	c.(37246-37248)Gct>Tct	p.A12416S	TTN_ENST00000342175.6_Missense_Mutation_p.A5184S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A5117S|TTN_ENST00000460472.2_Missense_Mutation_p.A4992S|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A14057S|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A11489S			Q8WZ42	TITIN_HUMAN	titin	12416					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGGGCACAGCAAAGTCAAGT	0.448																																						dbGAP											0													110.0	112.0	112.0					2																	179499339		1913	4128	6041	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37246G>T	2.37:g.179499339C>A	ENSP00000465570:p.Ala12416Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A11489S	ENST00000591111.1	37	c.34465		2	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120602	0.56613	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	6.16	6.16	0.99307	Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42131	0.1189	N	0.20445	0.575	0.43377	D	0.995475	P;P;P;P	0.49559	0.925;0.925;0.925;0.925	P;P;P;P	0.48270	0.572;0.572;0.572;0.572	T	0.35301	-0.9794	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	4992;5117;5184;12416	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	11489;4992;5184;5117;4992	ENSP00000343764:A11489S;ENSP00000434586:A4992S;ENSP00000340554:A5184S;ENSP00000352154:A5117S	ENSP00000340554:A5184S	A	-	1	0	TTN	179207584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.673000	0.61604	2.937000	0.99478	0.650000	0.86243	GCT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.448	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	39	0.00	0	C	NM_133378		179499339	179499339	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179647781	179647781	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:179647781T>A	ENST00000591111.1	-	18	3076	c.2852A>T	c.(2851-2853)aAt>aTt	p.N951I	TTN_ENST00000342175.6_Missense_Mutation_p.N905I|TTN_ENST00000359218.5_Missense_Mutation_p.N905I|TTN_ENST00000460472.2_Missense_Mutation_p.N905I|TTN_ENST00000360870.5_Missense_Mutation_p.N951I|TTN_ENST00000589042.1_Missense_Mutation_p.N951I|TTN_ENST00000342992.6_Missense_Mutation_p.N951I			Q8WZ42	TITIN_HUMAN	titin	33653	Ig-like 3.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACAGTCACATTTTTTAAGCC	0.393																																						dbGAP											0													50.0	52.0	51.0					2																	179647781		2201	4300	6501	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2852A>T	2.37:g.179647781T>A	ENSP00000465570:p.Asn951Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.N951I	ENST00000591111.1	37	c.2852		2	.	.	.	.	.	.	.	.	.	.	T	15.54	2.862433	0.51482	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84488	0.5483	M	0.78916	2.43	0.35713	D	0.816567	D;D;D;D;D	0.89917	0.991;0.991;0.991;0.991;1.0	D;D;D;D;D	0.74348	0.93;0.93;0.93;0.93;0.983	D	0.89318	0.3638	9	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	905;905;905;951;951	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	I	951;905;905;905;905;951	ENSP00000343764:N951I;ENSP00000434586:N905I;ENSP00000340554:N905I;ENSP00000352154:N905I;ENSP00000354117:N951I	ENSP00000340554:N905I	N	-	2	0	TTN	179356026	1.000000	0.71417	0.999000	0.59377	0.939000	0.58152	8.013000	0.88655	2.371000	0.80710	0.533000	0.62120	AAT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	26	0.00	0	T	NM_133378		179647781	179647781	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	1.000	A
UGT1A3	54659	genome.wustl.edu	37	2	234638190	234638190	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr2:234638190C>A	ENST00000482026.1	+	1	437	c.418C>A	c.(418-420)Cac>Aac	p.H140N	UGT1A1_ENST00000373450.4_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609767.1_Missense_Mutation_p.H140N|UGT1A6_ENST00000480628.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000406651.1_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	140					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)			breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	CCTGATCAGGCACCTGAATGC	0.428																																						dbGAP											0													194.0	199.0	197.0					2																	234638190		2203	4300	6503	-	-	-	SO:0001583	missense	0			M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.418C>A	2.37:g.234638190C>A	ENSP00000418532:p.His140Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B8K287	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.H140N	ENST00000482026.1	37	c.418	CCDS2509.1	2	.	.	.	.	.	.	.	.	.	.	c	7.683	0.689491	0.14973	.	.	ENSG00000243135	ENST00000482026	T	0.58940	0.3	4.35	-0.827	0.10802	.	.	.	.	.	T	0.29458	0.0734	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.16217	-1.0410	9	0.52906	T	0.07	.	0.4505	0.00500	0.3128:0.1374:0.1579:0.3919	.	140;140	Q5DT01;P35503	.;UD13_HUMAN	N	140	ENSP00000418532:H140N	ENSP00000418532:H140N	H	+	1	0	UGT1A3	234302929	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-0.474000	0.06607	-0.467000	0.06932	0.585000	0.79938	CAC	UGT1A3	-	pfam_UDP_glucos_trans	ENSG00000243135		0.428	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A3	HGNC	protein_coding	OTTHUMT00000130983.1	313	0.00	0	C	NM_019093		234638190	234638190	+1	no_errors	ENST00000482026	ensembl	human	known	69_37n	missense	16	94.27	263	SNP	0.000	A
VSTM2B	342865	genome.wustl.edu	37	19	30054804	30054804	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:30054804C>T	ENST00000335523.7	+	5	906	c.821C>T	c.(820-822)gCt>gTt	p.A274V		NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	274						integral component of membrane (GO:0016021)		p.A274D(1)		breast(2)	2						CTCCTGTTAGCTCTGCATAAG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											199.0	160.0	172.0					19																	30054804		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.821C>T	19.37:g.30054804C>T	ENSP00000335038:p.Ala274Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.A274V	ENST00000335523.7	37	c.821	CCDS46034.1	19	.	.	.	.	.	.	.	.	.	.	C	0.072	-1.200005	0.01581	.	.	ENSG00000187135	ENST00000335523	T	0.08193	3.12	5.69	4.66	0.58398	.	.	.	.	.	T	0.04092	0.0114	N	0.14661	0.345	0.28485	N	0.914781	B	0.26363	0.147	B	0.18263	0.021	T	0.34875	-0.9811	9	0.07030	T	0.85	.	7.358	0.26729	0.0:0.7437:0.0:0.2563	.	274	A6NLU5	VTM2B_HUMAN	V	274	ENSP00000335038:A274V	ENSP00000335038:A274V	A	+	2	0	VSTM2B	34746644	0.971000	0.33674	0.661000	0.29709	0.052000	0.14988	2.055000	0.41345	1.415000	0.47037	0.462000	0.41574	GCT	VSTM2B	-	NULL	ENSG00000187135		0.582	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2B	HGNC	protein_coding	OTTHUMT00000458601.1	63	0.00	0	C	NM_001146339		30054804	30054804	+1	no_errors	ENST00000335523	ensembl	human	known	69_37n	missense	31	44.64	25	SNP	0.982	T
XIAP	331	genome.wustl.edu	37	X	123040998	123040998	+	Silent	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chrX:123040998C>G	ENST00000371199.3	+	7	1760	c.1461C>G	c.(1459-1461)gtC>gtG	p.V487V	XIAP_ENST00000468691.1_3'UTR|XIAP_ENST00000355640.3_Silent_p.V487V|XIAP_ENST00000434753.3_Silent_p.V487V	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	487					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GCTACACAGTCATTACTTTCA	0.353									X-linked Lymphoproliferative syndrome																													dbGAP											0													99.0	85.0	90.0					X																	123040998		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.1461C>G	X.37:g.123040998C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTF2|Q9NQ14	Silent	SNP	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.V487	ENST00000371199.3	37	c.1461	CCDS14606.1	X																																																																																			XIAP	-	NULL	ENSG00000101966		0.353	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XIAP	HGNC	protein_coding	OTTHUMT00000058165.5	134	0.00	0	C	NM_001167		123040998	123040998	+1	no_errors	ENST00000355640	ensembl	human	known	69_37n	silent	74	41.73	53	SNP	0.279	G
XPO5	57510	genome.wustl.edu	37	6	43535089	43535089	+	Silent	SNP	C	C	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:43535089C>T	ENST00000265351.7	-	7	861	c.651G>A	c.(649-651)gcG>gcA	p.A217A		NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	217					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AGTTTGCTTGCGCCTACCAGA	0.418																																						dbGAP											0													55.0	51.0	53.0					6																	43535089		1890	4130	6020	-	-	-	SO:0001819	synonymous_variant	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.651G>A	6.37:g.43535089C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Silent	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.A217	ENST00000265351.7	37	c.651	CCDS47430.1	6																																																																																			XPO5	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	ENSG00000124571		0.418	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	53	0.00	0	C	NM_020750		43535089	43535089	-1	no_errors	ENST00000265351	ensembl	human	known	69_37n	silent	34	42.62	26	SNP	0.998	T
YEATS2	55689	genome.wustl.edu	37	3	183479305	183479305	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:183479305C>G	ENST00000305135.5	+	14	1862	c.1667C>G	c.(1666-1668)tCt>tGt	p.S556C		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	556					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CAGGAGGATTCTTTGTTTGCA	0.393																																						dbGAP											0													148.0	143.0	145.0					3																	183479305		1871	4084	5955	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1667C>G	3.37:g.183479305C>G	ENSP00000306983:p.Ser556Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.S556C	ENST00000305135.5	37	c.1667	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	C	17.29	3.353271	0.61293	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.31769	1.48	6.03	5.16	0.70880	.	0.335510	0.29668	N	0.011509	T	0.36991	0.0987	L	0.27053	0.805	0.44899	D	0.997917	D	0.69078	0.997	P	0.55667	0.781	T	0.27262	-1.0079	10	0.87932	D	0	-22.1482	15.3849	0.74691	0.0:0.9336:0.0:0.0664	.	556	Q9ULM3	YETS2_HUMAN	C	556	ENSP00000306983:S556C	ENSP00000306983:S556C	S	+	2	0	YEATS2	184961999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.647000	0.67923	1.561000	0.49584	0.655000	0.94253	TCT	YEATS2	-	NULL	ENSG00000163872		0.393	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	125	0.00	0	C	NM_018023		183479305	183479305	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	86	54.74	104	SNP	1.000	G
ZBTB24	9841	genome.wustl.edu	37	6	109787658	109787658	+	Nonsense_Mutation	SNP	A	A	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:109787658A>C	ENST00000230122.3	-	7	1657	c.1490T>G	c.(1489-1491)tTa>tGa	p.L497*	MICAL1_ENST00000368952.4_5'Flank	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	497					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		AGCAAACTGTAAGTTACACTC	0.458																																						dbGAP											0													97.0	97.0	97.0					6																	109787658		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1490T>G	6.37:g.109787658A>C	ENSP00000230122:p.Leu497*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RC6|Q5TED5|Q8N455	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L497*	ENST00000230122.3	37	c.1490	CCDS34509.1	6	.	.	.	.	.	.	.	.	.	.	A	38	6.952050	0.97960	.	.	ENSG00000112365	ENST00000230122	.	.	.	6.06	4.88	0.63580	.	0.076480	0.48286	D	0.000183	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-11.4105	13.4862	0.61366	0.8694:0.1306:0.0:0.0	.	.	.	.	X	497	.	ENSP00000230122:L497X	L	-	2	0	ZBTB24	109894351	0.987000	0.35691	0.290000	0.24890	0.981000	0.71138	5.868000	0.69605	1.094000	0.41399	0.533000	0.62120	TTA	ZBTB24	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000112365		0.458	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB24	HGNC	protein_coding	OTTHUMT00000041758.1	122	0.00	0	A	NM_014797		109787658	109787658	-1	no_errors	ENST00000230122	ensembl	human	known	69_37n	nonsense	46	47.13	41	SNP	0.035	C
ZFHX4	79776	genome.wustl.edu	37	8	77617914	77617914	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:77617914G>A	ENST00000521891.2	+	2	2039	c.1591G>A	c.(1591-1593)Gat>Aat	p.D531N	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D531N|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D531N|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D531N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GACTGTTTCTGATGACACAGA	0.448										HNSCC(33;0.089)																												dbGAP											0													40.0	41.0	41.0					8																	77617914		1978	4170	6148	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1591G>A	8.37:g.77617914G>A	ENSP00000430497:p.Asp531Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D531N	ENST00000521891.2	37	c.1591	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	9.978	1.227391	0.22542	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50548	0.74;0.78;0.74;0.74	5.65	5.65	0.86999	.	0.300602	0.23245	U	0.050305	T	0.42810	0.1219	L	0.40543	1.245	0.54753	D	0.999987	B;B;B;B	0.10296	0.001;0.003;0.003;0.002	B;B;B;B	0.11329	0.002;0.005;0.005;0.006	T	0.19614	-1.0300	10	0.19147	T	0.46	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	531;531;531;531	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	N	531	ENSP00000430497:D531N;ENSP00000399605:D531N;ENSP00000050961:D531N;ENSP00000430848:D531N	ENSP00000050961:D531N	D	+	1	0	ZFHX4	77780469	1.000000	0.71417	0.176000	0.23000	0.980000	0.70556	6.139000	0.71728	2.941000	0.99782	0.655000	0.94253	GAT	ZFHX4	-	NULL	ENSG00000091656		0.448	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	53	0.00	0	G	NM_024721		77617914	77617914	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	39	29.09	16	SNP	0.998	A
ZFPM2	23414	genome.wustl.edu	37	8	106815139	106815139	+	Silent	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr8:106815139G>A	ENST00000407775.2	+	8	3079	c.2829G>A	c.(2827-2829)aaG>aaA	p.K943K	RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000378472.4_Silent_p.K674K|ZFPM2_ENST00000520492.1_Silent_p.K811K|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000517361.1_Silent_p.K811K	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	943					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AAGGCTTGAAGGTCTTTAGTG	0.398																																						dbGAP											0													31.0	30.0	30.0					8																	106815139		1863	4095	5958	-	-	-	SO:0001819	synonymous_variant	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2829G>A	8.37:g.106815139G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K943	ENST00000407775.2	37	c.2829	CCDS47908.1	8																																																																																			ZFPM2	-	NULL	ENSG00000169946		0.398	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	26	0.00	0	G			106815139	106815139	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	silent	35	31.37	16	SNP	0.994	A
ZKSCAN7	55888	genome.wustl.edu	37	3	44607075	44607075	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr3:44607075G>T	ENST00000273320.3	+	3	949	c.520G>T	c.(520-522)Ggc>Tgc	p.G174C	RP11-944L7.5_ENST00000419137.1_Missense_Mutation_p.G9C|ZKSCAN7_ENST00000431636.1_Missense_Mutation_p.G174C|ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.G174C|ZKSCAN7_ENST00000341840.3_Missense_Mutation_p.G174C|RP11-944L7.4_ENST00000457331.1_RNA	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	174					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCTCAGTGGGGGCTCAGCCCC	0.562																																						dbGAP											0													96.0	96.0	96.0					3																	44607075		2203	4300	6503	-	-	-	SO:0001583	missense	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.520G>T	3.37:g.44607075G>T	ENSP00000273320:p.Gly174Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.G174C	ENST00000273320.3	37	c.520	CCDS2715.1	3	.	.	.	.	.	.	.	.	.	.	.	8.548	0.874816	0.17395	.	.	ENSG00000196345	ENST00000431636;ENST00000426540;ENST00000341840;ENST00000273320;ENST00000447279;ENST00000419137	T;T;T;T;T;T	0.48201	4.45;3.36;4.45;3.36;3.42;0.82	3.89	2.02	0.26589	.	0.250837	0.20980	N	0.082236	T	0.20659	0.0497	N	0.08118	0	0.09310	N	1	P;B;B	0.37663	0.604;0.142;0.185	B;B;B	0.29716	0.102;0.042;0.106	T	0.09143	-1.0688	10	0.40728	T	0.16	-0.0105	6.7896	0.23692	0.0:0.1955:0.6025:0.2021	.	45;174;174	A7MAY2;Q9P0L1;Q9P0L1-2	.;ZN167_HUMAN;.	C	174;174;174;174;24;9	ENSP00000416681:G174C;ENSP00000395524:G174C;ENSP00000345404:G174C;ENSP00000273320:G174C;ENSP00000405034:G24C;ENSP00000389243:G9C	ENSP00000273320:G174C	G	+	1	0	ZNF167	44582079	0.001000	0.12720	0.029000	0.17559	0.181000	0.23173	-0.099000	0.11007	0.565000	0.29255	0.650000	0.86243	GGC	ZNF167	-	NULL	ENSG00000196345		0.562	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF167	HGNC	protein_coding	OTTHUMT00000256752.4	183	0.00	0	G	NM_018651		44607075	44607075	+1	no_errors	ENST00000273320	ensembl	human	known	69_37n	missense	7	89.55	60	SNP	0.151	T
ZNF536	9745	genome.wustl.edu	37	19	30935520	30935520	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:30935520G>A	ENST00000355537.3	+	2	1198	c.1051G>A	c.(1051-1053)Ggt>Agt	p.G351S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	351					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CGAGGTGTGCGGTCAGGTGTT	0.652																																						dbGAP											0													101.0	110.0	107.0					19																	30935520		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1051G>A	19.37:g.30935520G>A	ENSP00000347730:p.Gly351Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G351S	ENST00000355537.3	37	c.1051	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104669	0.77096	.	.	ENSG00000198597	ENST00000355537	T	0.58358	0.34	5.59	5.59	0.84812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	L	0.45581	1.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70063	-0.4975	10	0.72032	D	0.01	-27.6561	19.5661	0.95393	0.0:0.0:1.0:0.0	.	351;351	A7E228;O15090	.;ZN536_HUMAN	S	351	ENSP00000347730:G351S	ENSP00000347730:G351S	G	+	1	0	ZNF536	35627360	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.965000	0.87945	2.631000	0.89168	0.491000	0.48974	GGT	ZNF536	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198597		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	49	0.00	0	G	NM_014717		30935520	30935520	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	missense	18	47.06	16	SNP	1.000	A
ZNF544	27300	genome.wustl.edu	37	19	58773330	58773330	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr19:58773330T>C	ENST00000596652.1	+	6	1592	c.1358T>C	c.(1357-1359)gTa>gCa	p.V453A	ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000600044.1_Missense_Mutation_p.V425A|ZNF544_ENST00000599953.1_Missense_Mutation_p.V311A|ZNF544_ENST00000269829.4_Missense_Mutation_p.V453A|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000415203.2_Missense_Mutation_p.V425A|ZNF544_ENST00000596825.1_3'UTR|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000600220.1_Missense_Mutation_p.V425A|ZNF544_ENST00000599227.1_3'UTR			Q6NX49	ZN544_HUMAN	zinc finger protein 544	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		AACCTCATTGTACATCAGAGA	0.403																																						dbGAP											0													84.0	85.0	85.0					19																	58773330		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.1358T>C	19.37:g.58773330T>C	ENSP00000469635:p.Val453Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J1|Q9UEX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V453A	ENST00000596652.1	37	c.1358	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	T	5.480	0.273576	0.10403	.	.	ENSG00000198131	ENST00000269829;ENST00000415203;ENST00000441758	T;T	0.17213	2.29;2.29	2.64	-4.56	0.03431	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05364	0.0142	N	0.05534	-0.03	0.09310	N	0.999999	P;B;B	0.38280	0.625;0.22;0.082	B;B;B	0.34652	0.187;0.103;0.028	T	0.35076	-0.9803	9	0.08599	T	0.76	.	5.8279	0.18564	0.1535:0.0:0.4658:0.3807	.	425;425;453	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	A	453;425;117	ENSP00000269829:V453A;ENSP00000394341:V425A	ENSP00000269829:V453A	V	+	2	0	ZNF544	63465142	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.907000	0.00700	-0.700000	0.05070	-0.466000	0.05196	GTA	ZNF544	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198131		0.403	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	50	0.00	0	T	NM_014480		58773330	58773330	+1	no_errors	ENST00000269829	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	0.000	C
ZUFSP	221302	genome.wustl.edu	37	6	116973262	116973262	+	Missense_Mutation	SNP	G	G	C	rs375114528		TCGA-AN-A0FL-01A-11W-A050-09	TCGA-AN-A0FL-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	18ee29ae-fe36-49a3-9843-e0757c69a7dd	023ceb74-14a9-4316-8e15-cad12165baa0	g.chr6:116973262G>C	ENST00000368576.3	-	6	1298	c.1055C>G	c.(1054-1056)tCt>tGt	p.S352C	ZUFSP_ENST00000471919.1_5'UTR|ZUFSP_ENST00000368573.1_3'UTR	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	352							metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		GTCGCCTAAAGATGAATGAAA	0.383																																						dbGAP											0													132.0	130.0	130.0					6																	116973262		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.1055C>G	6.37:g.116973262G>C	ENSP00000357565:p.Ser352Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TD92|Q6PJH7|Q96NV6	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S352C	ENST00000368576.3	37	c.1055	CCDS5110.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071543	0.76301	.	.	ENSG00000153975	ENST00000368576	T	0.35048	1.33	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.38453	0.1041	M	0.80847	2.515	0.80722	D	1	P	0.45011	0.848	P	0.44422	0.449	T	0.42413	-0.9453	10	0.59425	D	0.04	-1.0135	16.1284	0.81410	0.0:0.1336:0.8664:0.0	.	352	Q96AP4	ZUFSP_HUMAN	C	352	ENSP00000357565:S352C	ENSP00000357565:S352C	S	-	2	0	ZUFSP	117079955	1.000000	0.71417	0.996000	0.52242	0.897000	0.52465	6.927000	0.75840	2.771000	0.95319	0.655000	0.94253	TCT	ZUFSP	-	pfam_Peptidase_C78_UfSP1/2	ENSG00000153975		0.383	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZUFSP	HGNC	protein_coding	OTTHUMT00000041961.1	255	0.00	0	G	NM_145062		116973262	116973262	-1	no_errors	ENST00000368576	ensembl	human	known	69_37n	missense	113	40.93	79	SNP	1.000	C
