#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC2	1244	genome.wustl.edu	37	10	101611335	101611335	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:101611335T>C	ENST00000370449.4	+	32	4698	c.4585T>C	c.(4585-4587)Tac>Cac	p.Y1529H		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1529	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.Y1529H(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TGGACCCTTTTACTTTATGGC	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	113.0	113.0					10																	101611335		2203	4300	6503	-	-	-	SO:0001583	missense	0			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.4585T>C	10.37:g.101611335T>C	ENSP00000359478:p.Tyr1529His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.Y1529H	ENST00000370449.4	37	c.4585	CCDS7484.1	10	.	.	.	.	.	.	.	.	.	.	T	14.12	2.442063	0.43326	.	.	ENSG00000023839	ENST00000370449	T	0.66280	-0.2	4.68	3.54	0.40534	ABC transporter-like (1);	0.489180	0.23633	N	0.046116	T	0.52725	0.1752	N	0.11818	0.18	0.80722	D	1	D	0.56287	0.975	P	0.55545	0.778	T	0.55392	-0.8148	10	0.72032	D	0.01	-0.753	6.5854	0.22618	0.0:0.0833:0.1556:0.7612	.	1529	Q92887	MRP2_HUMAN	H	1529	ENSP00000359478:Y1529H	ENSP00000359478:Y1529H	Y	+	1	0	ABCC2	101601325	0.996000	0.38824	0.239000	0.24122	0.459000	0.32528	3.437000	0.52863	0.820000	0.34516	0.454000	0.30748	TAC	ABCC2	-	pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc	ENSG00000023839		0.413	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	HGNC	protein_coding	OTTHUMT00000049825.1	154	0.00	0	T	NM_000392		101611335	101611335	+1	no_errors	ENST00000370449	ensembl	human	known	69_37n	missense	96	23.20	29	SNP	0.856	C
ACSM2B	348158	genome.wustl.edu	37	16	20576155	20576155	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr16:20576155G>A	ENST00000329697.6	-	2	181	c.13C>T	c.(13-15)Cga>Tga	p.R5*	ACSM2B_ENST00000414188.2_Nonsense_Mutation_p.R5*|ACSM2B_ENST00000565322.1_Intron|ACSM2B_ENST00000567001.1_Nonsense_Mutation_p.R5*|ACSM2B_ENST00000565232.1_Nonsense_Mutation_p.R5*	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	5					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)	p.R5*(1)		breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						TGAACTTTTCGCAGCCAATGC	0.493																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											63.0	62.0	62.0					16																	20576155		2201	4300	6501	-	-	-	SO:0001587	stop_gained	0			AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.13C>T	16.37:g.20576155G>A	ENSP00000327453:p.Arg5*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YT1	Nonsense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.R5*	ENST00000329697.6	37	c.13	CCDS10586.1	16	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680203	0.88542	.	.	ENSG00000066813	ENST00000329697;ENST00000414188	.	.	.	3.27	-3.12	0.05282	.	2.661960	0.01665	N	0.025335	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	1.0797	3.5919	0.07991	0.5034:0.0:0.312:0.1846	.	.	.	.	X	5	.	ENSP00000327453:R5X	R	-	1	2	ACSM2B	20483656	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-3.025000	0.00640	-1.069000	0.03153	-0.362000	0.07510	CGA	ACSM2B	-	NULL	ENSG00000066813		0.493	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2B	HGNC	protein_coding	OTTHUMT00000254417.2	151	0.66	1	G	NM_182617		20576155	20576155	-1	no_errors	ENST00000329697	ensembl	human	known	69_37n	nonsense	105	22.79	31	SNP	0.000	A
ADRBK2	157	genome.wustl.edu	37	22	26100079	26100079	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr22:26100079G>A	ENST00000324198.6	+	15	1423	c.1231G>A	c.(1231-1233)Gtg>Atg	p.V411M		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	411	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)	p.V411M(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	TCCCCAGAATGTGGAACTTCC	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	88.0	90.0					22																	26100079		2203	4300	6503	-	-	-	SO:0001583	missense	0			X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.1231G>A	22.37:g.26100079G>A	ENSP00000317578:p.Val411Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UGW9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom,prints_GPCR_kinase	p.V411M	ENST00000324198.6	37	c.1231	CCDS13832.1	22	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691396	0.88735	.	.	ENSG00000100077	ENST00000324198	T	0.56776	0.44	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69260	0.3091	L	0.58810	1.83	0.80722	D	1	D;P	0.57571	0.98;0.888	D;P	0.63488	0.915;0.631	T	0.68424	-0.5412	10	0.59425	D	0.04	-34.1263	18.957	0.92662	0.0:0.0:1.0:0.0	.	411;411	A8K869;P35626	.;ARBK2_HUMAN	M	411	ENSP00000317578:V411M	ENSP00000317578:V411M	V	+	1	0	ADRBK2	24430079	1.000000	0.71417	0.993000	0.49108	0.891000	0.51852	8.620000	0.90943	2.824000	0.97209	0.655000	0.94253	GTG	ADRBK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000100077		0.473	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRBK2	HGNC	protein_coding	OTTHUMT00000317296.4	137	0.00	0	G	NM_005160		26100079	26100079	+1	no_errors	ENST00000324198	ensembl	human	known	69_37n	missense	105	13.93	17	SNP	1.000	A
AFF1	4299	genome.wustl.edu	37	4	88029327	88029327	+	Missense_Mutation	SNP	C	C	T	rs553702861		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr4:88029327C>T	ENST00000307808.6	+	10	1792	c.1372C>T	c.(1372-1374)Cca>Tca	p.P458S	AFF1_ENST00000395146.4_Missense_Mutation_p.P465S|AFF1_ENST00000544085.1_Missense_Mutation_p.P96S	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	458					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P465S(1)		breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		ACAGTCCCTTCCAGAACCAGT	0.483																																						dbGAP											1	Substitution - Missense(1)	breast(1)											111.0	98.0	103.0					4																	88029327		2203	4300	6503	-	-	-	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1372C>T	4.37:g.88029327C>T	ENSP00000305689:p.Pro458Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P465S	ENST00000307808.6	37	c.1393	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	8.958	0.969835	0.18659	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000511722;ENST00000544085;ENST00000514970	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	5.5	4.61	0.57282	.	0.523213	0.20127	N	0.098667	T	0.59074	0.2167	L	0.48642	1.525	0.09310	N	0.999996	P;P;P	0.49559	0.925;0.925;0.925	P;P;P	0.48270	0.572;0.572;0.572	T	0.51028	-0.8757	10	0.21014	T	0.42	-4.637	12.0502	0.53503	0.1167:0.6734:0.21:0.0	.	465;458;458	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	S	465;458;96;96;149	ENSP00000378578:P465S;ENSP00000305689:P458S;ENSP00000424766:P96S;ENSP00000440843:P96S;ENSP00000424881:P149S	ENSP00000305689:P458S	P	+	1	0	AFF1	88248351	0.950000	0.32346	0.632000	0.29296	0.020000	0.10135	1.972000	0.40540	2.735000	0.93741	0.655000	0.94253	CCA	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.483	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	165	0.00	0	C	NM_005935		88029327	88029327	+1	no_errors	ENST00000395146	ensembl	human	known	69_37n	missense	94	16.07	18	SNP	0.169	T
AGAP5	729092	genome.wustl.edu	37	10	75435825	75435825	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:75435825G>T	ENST00000374094.4	-	8	633	c.593C>A	c.(592-594)aCc>aAc	p.T198N	RP11-464F9.21_ENST00000607450.1_RNA|AGAP5_ENST00000443782.2_Missense_Mutation_p.T175N|RP11-464F9.1_ENST00000399449.3_RNA	NM_001144000.1	NP_001137472.1	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 5	198					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.T175N(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(5)|skin(1)	12						AATGTGCACGGTGGAAACCTG	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											1.0	1.0	1.0					10																	75435825		118	220	338	-	-	-	SO:0001583	missense	0				CCDS44439.1	10q22.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000172650	ENSG00000172650		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23467	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 2"""	CTGLF2			Standard	NM_001144000		Approved	Em:AC073389.1	uc009xri.3	A6NIR3	OTTHUMG00000018473	ENST00000374094.4:c.593C>A	10.37:g.75435825G>T	ENSP00000363207:p.Thr198Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSN5	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.T198N	ENST00000374094.4	37	c.593	CCDS44439.1	10	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722769	0.30503	.	.	ENSG00000172650	ENST00000374094;ENST00000443782	T;T	0.54866	0.55;0.55	.	.	.	.	0.286877	0.33534	N	0.004820	T	0.49864	0.1582	N	0.25647	0.755	0.19775	N	0.999959	D	0.57899	0.981	D	0.67231	0.95	T	0.36601	-0.9741	9	0.37606	T	0.19	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	198	A6NIR3	AGAP5_HUMAN	N	198;175	ENSP00000363207:T198N;ENSP00000402792:T175N	ENSP00000363207:T198N	T	-	2	0	AGAP5	75105831	0.012000	0.17670	0.060000	0.19600	0.059000	0.15707	1.723000	0.38053	0.064000	0.16427	0.064000	0.15345	ACC	AGAP5	-	NULL	ENSG00000172650		0.458	AGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGAP5	HGNC	protein_coding		171	0.00	0	G	XM_001132585		75435825	75435825	-1	no_errors	ENST00000374094	ensembl	human	known	69_37n	missense	194	14.16	32	SNP	0.996	T
AHI1	54806	genome.wustl.edu	37	6	135776985	135776985	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:135776985T>C	ENST00000367800.4	-	8	1447	c.1231A>G	c.(1231-1233)Aaa>Gaa	p.K411E	AHI1_ENST00000457866.2_Missense_Mutation_p.K411E|AHI1_ENST00000327035.6_Missense_Mutation_p.K411E	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	411	Interaction with HAP1.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)		p.K411E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TTTAACTGTTTAAAATCATAT	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	35.0	36.0					6																	135776985		1807	4063	5870	-	-	-	SO:0001583	missense	0			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.1231A>G	6.37:g.135776985T>C	ENSP00000356774:p.Lys411Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SH3_domain,pfam_SH3_2,superfamily_WD40_repeat_dom,superfamily_SH3_domain,smart_WD40_repeat,smart_SH3_domain,pfscan_SH3_domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_SH3_domain	p.K411E	ENST00000367800.4	37	c.1231	CCDS47483.1	6	.	.	.	.	.	.	.	.	.	.	T	26.8	4.775124	0.90108	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801	T;T;T;T	0.61040	0.18;0.18;0.18;0.14	5.7	5.7	0.88788	.	0.049293	0.85682	D	0.000000	T	0.66336	0.2779	L	0.60455	1.87	0.80722	D	1	D;D	0.69078	0.997;0.996	D;P	0.68353	0.957;0.907	T	0.71126	-0.4683	10	0.87932	D	0	-25.2438	15.9608	0.79928	0.0:0.0:0.0:1.0	.	411;411	Q8N157-2;Q8N157	.;AHI1_HUMAN	E	411	ENSP00000356774:K411E;ENSP00000388650:K411E;ENSP00000265602:K411E;ENSP00000322478:K411E	ENSP00000265602:K411E	K	-	1	0	AHI1	135818678	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.999000	0.70665	2.174000	0.68829	0.383000	0.25322	AAA	AHI1	-	NULL	ENSG00000135541		0.343	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	AHI1	HGNC	protein_coding	OTTHUMT00000391948.1	89	0.00	0	T	NM_017651		135776985	135776985	-1	no_errors	ENST00000265602	ensembl	human	known	69_37n	missense	117	14.60	20	SNP	1.000	C
ANKRD27	84079	genome.wustl.edu	37	19	33090934	33090934	+	Silent	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:33090934T>C	ENST00000306065.4	-	27	2948	c.2790A>G	c.(2788-2790)ctA>ctG	p.L930L		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	930					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.L930L(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					GCTCATCTGGTAGATCATACA	0.338																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											86.0	77.0	80.0					19																	33090934		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2790A>G	19.37:g.33090934T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Silent	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.L930	ENST00000306065.4	37	c.2790	CCDS32986.1	19																																																																																			ANKRD27	-	NULL	ENSG00000105186		0.338	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	139	0.00	0	T	NM_032139		33090934	33090934	-1	no_errors	ENST00000306065	ensembl	human	known	69_37n	silent	87	24.35	28	SNP	0.179	C
ARHGAP35	2909	genome.wustl.edu	37	19	47422145	47422145	+	Silent	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:47422145C>T	ENST00000404338.3	+	1	213	c.213C>T	c.(211-213)gaC>gaT	p.D71D		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	71					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.D71D(2)									TCAATAATGACCACTTTCTCT	0.507																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											87.0	91.0	90.0					19																	47422145		1947	4130	6077	-	-	-	SO:0001819	synonymous_variant	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.213C>T	19.37:g.47422145C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A4|Q14452|Q9C0E1	Silent	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.D71	ENST00000404338.3	37	c.213	CCDS46127.1	19																																																																																			ARHGAP35	-	NULL	ENSG00000160007		0.507	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	102	0.00	0	C	NM_004491		47422145	47422145	+1	no_errors	ENST00000404338	ensembl	human	known	69_37n	silent	56	29.11	23	SNP	1.000	T
ARHGEF28	64283	genome.wustl.edu	37	5	73153573	73153573	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr5:73153573A>G	ENST00000426542.2	+	14	1903	c.1883A>G	c.(1882-1884)aAt>aGt	p.N628S	ARHGEF28_ENST00000437974.1_Missense_Mutation_p.N628S|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.N628S|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.N315S|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.N628S|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.N628S|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.N628S			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	628					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.N628S(2)									TTCCTCATGAATAGGATGACT	0.308																																						dbGAP											2	Substitution - Missense(2)	breast(2)											62.0	59.0	60.0					5																	73153573		1818	4080	5898	-	-	-	SO:0001583	missense	0				CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.1883A>G	5.37:g.73153573A>G	ENSP00000412175:p.Asn628Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.N628S	ENST00000426542.2	37	c.1883	CCDS54870.1	5	.	.	.	.	.	.	.	.	.	.	A	14.98	2.698754	0.48307	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.09630	3.19;3.17;3.18;2.96;3.17;3.18;3.03	5.51	5.51	0.81932	.	.	.	.	.	T	0.08537	0.0212	N	0.12746	0.255	0.33216	D	0.554021	P;P;B;P	0.49559	0.925;0.925;0.434;0.569	B;B;B;B	0.42738	0.396;0.396;0.178;0.332	T	0.14671	-1.0464	9	0.45353	T	0.12	.	15.2795	0.73770	1.0:0.0:0.0:0.0	.	315;628;628;628	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	S	628;628;628;628;628;628;315	ENSP00000296794:N628S;ENSP00000441913:N628S;ENSP00000441436:N628S;ENSP00000287898:N628S;ENSP00000411459:N628S;ENSP00000412175:N628S;ENSP00000296799:N315S	ENSP00000287898:N628S	N	+	2	0	RP11-428C6.1	73189329	1.000000	0.71417	0.985000	0.45067	0.983000	0.72400	4.337000	0.59310	2.114000	0.64651	0.528000	0.53228	AAT	ARHGEF28	-	NULL	ENSG00000214944		0.308	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF28	HGNC	protein_coding	OTTHUMT00000368975.1	99	0.00	0	A			73153573	73153573	+1	no_errors	ENST00000545377	ensembl	human	known	69_37n	missense	88	20.00	22	SNP	1.000	G
ARL8B	55207	genome.wustl.edu	37	3	5220352	5220352	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:5220352T>G	ENST00000256496.3	+	7	761	c.515T>G	c.(514-516)aTc>aGc	p.I172S	ARL8B_ENST00000468010.1_3'UTR|AC026202.3_ENST00000439325.1_RNA|ARL8B_ENST00000419534.2_Missense_Mutation_p.S126A	NM_018184.2	NP_060654.1	Q9NVJ2	ARL8B_HUMAN	ADP-ribosylation factor-like 8B	172					cell cycle (GO:0007049)|cell division (GO:0051301)|chromosome segregation (GO:0007059)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|membrane (GO:0016020)|midbody (GO:0030496)|spindle midzone (GO:0051233)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.I172S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0717)|Epithelial(13;0.0777)		TCTTTAGATATCACACTTCAG	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	142.0	144.0					3																	5220352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001564	CCDS2566.1	3p26.1	2014-05-09	2005-11-03	2005-11-03	ENSG00000134108	ENSG00000134108		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25564	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10C"""	ARL10C		12477932	Standard	NM_018184		Approved	FLJ10702, Gie1	uc003bqg.3	Q9NVJ2	OTTHUMG00000090463	ENST00000256496.3:c.515T>G	3.37:g.5220352T>G	ENSP00000256496:p.Ile172Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI85	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.I172S	ENST00000256496.3	37	c.515	CCDS2566.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.03|12.03	1.814906|1.814906	0.32053|0.32053	.|.	.|.	ENSG00000134108|ENSG00000134108	ENST00000256496;ENST00000438743|ENST00000419534	T|T	0.61627|0.59638	0.09|0.25	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.48519|0.48519	0.1504|0.1504	N|N	0.20610|0.20610	0.595|0.595	0.30726|0.30726	N|N	0.747736|0.747736	B;B|B	0.19583|0.25719	0.004;0.037|0.132	B;B|B	0.22753|0.31245	0.01;0.041|0.126	T|T	0.56896|0.56896	-0.7903|-0.7903	10|9	0.59425|0.87932	D|D	0.04|0	-11.5043|-11.5043	15.3479|15.3479	0.74355|0.74355	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	163;172|126	B4DQT8;Q9NVJ2|B4DI85	.;ARL8B_HUMAN|.	S|A	172;224|126	ENSP00000256496:I172S|ENSP00000402996:S126A	ENSP00000256496:I172S|ENSP00000402996:S126A	I|S	+|+	2|1	0|0	ARL8B|ARL8B	5195352|5195352	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.745000|7.745000	0.85046|0.85046	2.025000|2.025000	0.59659|0.59659	0.528000|0.528000	0.53228|0.53228	ATC|TCA	ARL8B	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type	ENSG00000134108		0.353	ARL8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL8B	HGNC	protein_coding	OTTHUMT00000206910.2	325	0.00	0	T	NM_018184		5220352	5220352	+1	no_errors	ENST00000256496	ensembl	human	known	69_37n	missense	390	13.30	60	SNP	1.000	G
ARMC12	221481	genome.wustl.edu	37	6	35704942	35704942	+	Silent	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:35704942C>T	ENST00000373866.3	+	1	79	c.57C>T	c.(55-57)gtC>gtT	p.V19V	ARMC12_ENST00000288065.2_Silent_p.V19V|RP3-510O8.4_ENST00000452048.1_RNA|ARMC12_ENST00000373869.3_Silent_p.V19V			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	19						nucleus (GO:0005634)		p.V19V(1)									AAAGCGTAGTCAGCCTGGCCA	0.587											OREG0017379	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											88.0	83.0	85.0					6																	35704942		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	ENST00000373866.3:c.57C>T	6.37:g.35704942C>T		Somatic	857	WXS	Illumina GAIIx	Phase_IV	Q8NEB2|Q96LL8	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.V19	ENST00000373866.3	37	c.57		6																																																																																			ARMC12	-	NULL	ENSG00000157343		0.587	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	ARMC12	HGNC	protein_coding	OTTHUMT00000040311.2	83	0.00	0	C	NM_145028		35704942	35704942	+1	no_errors	ENST00000288065	ensembl	human	known	69_37n	silent	66	17.50	14	SNP	0.943	T
ASTN1	460	genome.wustl.edu	37	1	176857332	176857332	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:176857332C>A	ENST00000367654.3	-	18	3184	c.2973G>T	c.(2971-2973)caG>caT	p.Q991H	ASTN1_ENST00000367657.3_Missense_Mutation_p.Q983H|ASTN1_ENST00000424564.2_Missense_Mutation_p.Q983H|ASTN1_ENST00000361833.2_Missense_Mutation_p.Q983H	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	991					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.Q983H(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TGGTAGCCTCCTGCAAGAGCT	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	76.0	79.0					1																	176857332		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2973G>T	1.37:g.176857332C>A	ENSP00000356626:p.Gln991His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.Q991H	ENST00000367654.3	37	c.2973		1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747309	0.69533	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.82	1.82	0.25136	.	0.052923	0.85682	D	0.000000	T	0.30103	0.0754	L	0.46157	1.445	0.58432	D	0.999999	P;P	0.41848	0.763;0.763	B;B	0.44224	0.444;0.444	T	0.06899	-1.0801	10	0.72032	D	0.01	-13.5922	10.2326	0.43264	0.0:0.6646:0.0:0.3354	.	983;983	O14525-2;B1AJS1	.;.	H	983;983;991;983;983	ENSP00000356629:Q983H;ENSP00000354536:Q983H;ENSP00000356626:Q991H;ENSP00000395041:Q983H	ENSP00000354536:Q983H	Q	-	3	2	ASTN1	175123955	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	0.825000	0.27393	0.368000	0.24481	0.585000	0.79938	CAG	ASTN1	-	smart_MACPF	ENSG00000152092		0.532	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		77	0.00	0	C	NM_004319		176857332	176857332	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	1.000	A
ATP8B4	79895	genome.wustl.edu	37	15	50226338	50226338	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr15:50226338A>T	ENST00000284509.6	-	15	1470	c.1329T>A	c.(1327-1329)gaT>gaA	p.D443E	ATP8B4_ENST00000559829.1_Missense_Mutation_p.D443E	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	443						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.D443E(1)		breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GAAATTCTCTATCCGCTTGAG	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	105.0	105.0					15																	50226338		2196	4295	6491	-	-	-	SO:0001583	missense	0			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1329T>A	15.37:g.50226338A>T	ENSP00000284509:p.Asp443Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H727	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.D443E	ENST00000284509.6	37	c.1329	CCDS32238.1	15	.	.	.	.	.	.	.	.	.	.	A	9.203	1.028951	0.19512	.	.	ENSG00000104043	ENST00000284509	T	0.61392	0.11	5.81	-5.75	0.02384	ATPase, cation-transporting, domain N (1);HAD-like domain (1);	0.380247	0.28236	N	0.016084	T	0.32194	0.0821	L	0.27053	0.805	0.09310	N	0.999997	B	0.21381	0.055	B	0.33620	0.167	T	0.33163	-0.9879	10	0.15952	T	0.53	.	1.2654	0.02010	0.2755:0.2705:0.2959:0.158	.	443	Q8TF62	AT8B4_HUMAN	E	443	ENSP00000284509:D443E	ENSP00000284509:D443E	D	-	3	2	ATP8B4	48013630	0.006000	0.16342	0.000000	0.03702	0.110000	0.19582	-0.106000	0.10890	-1.157000	0.02815	0.482000	0.46254	GAT	ATP8B4	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000104043		0.378	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B4	HGNC	protein_coding	OTTHUMT00000418100.1	147	0.68	1	A	NM_024837		50226338	50226338	-1	no_errors	ENST00000284509	ensembl	human	known	69_37n	missense	101	26.81	37	SNP	0.006	T
CCDC7	79741	genome.wustl.edu	37	10	32977992	32977992	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:32977992G>T	ENST00000375030.2	+	8	808	c.190G>T	c.(190-192)Gaa>Taa	p.E64*	C10orf68_ENST00000375028.3_Nonsense_Mutation_p.E70*|C10orf68_ENST00000375025.4_Nonsense_Mutation_p.E56*			Q9H943	CJ068_HUMAN		56								p.E56*(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TCCTGATAAAGAACCAAATGA	0.328																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											57.0	59.0	58.0					10																	32977992		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0																														ENST00000375030.2:c.190G>T	10.37:g.32977992G>T	ENSP00000364170:p.Glu64*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ71|Q08AN7|Q8N7T7	Nonsense_Mutation	SNP	NULL	p.E56*	ENST00000375030.2	37	c.166		10	.	.	.	.	.	.	.	.	.	.	.	19.58	3.854513	0.71719	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	.	.	.	3.42	2.49	0.30216	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	7.9717	0.30132	0.0:0.0:0.7556:0.2444	.	.	.	.	X	56;64;70;56;42	.	ENSP00000303710:E56X	E	+	1	0	C10orf68	33017998	0.009000	0.17119	0.001000	0.08648	0.208000	0.24298	2.679000	0.46909	0.965000	0.38133	0.484000	0.47621	GAA	C10orf68	-	NULL	ENSG00000150076		0.328	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	109	0.91	1	G			32977992	32977992	+1	no_errors	ENST00000375025	ensembl	human	known	69_37n	nonsense	158	16.75	32	SNP	0.001	T
ACSM6	142827	genome.wustl.edu	37	10	96967145	96967145	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:96967145G>T	ENST00000394005.3	+	3	593	c.584G>T	c.(583-585)gGg>gTg	p.G195V	C10orf129_ENST00000430183.1_Missense_Mutation_p.G40V|C10orf129_ENST00000341686.3_Missense_Mutation_p.G195V			Q6P461	ACSM6_HUMAN		195					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.G40V(1)|p.G195V(1)		breast(1)|kidney(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		AGCTATGATGGGTGGTTGGAT	0.418																																						dbGAP											2	Substitution - Missense(2)	breast(2)											85.0	78.0	80.0					10																	96967145		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000394005.3:c.584G>T	10.37:g.96967145G>T	ENSP00000377573:p.Gly195Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU95|A4IF38|Q5VZX2|Q6ZTX1	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.G195V	ENST00000394005.3	37	c.584	CCDS7440.2	10	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085077	0.55861	.	.	ENSG00000173124	ENST00000539707;ENST00000341686;ENST00000430183;ENST00000394005	T;T;T	0.41400	2.71;1.0;2.71	1.2	1.2	0.21068	AMP-dependent synthetase/ligase (1);	.	.	.	.	T	0.56587	0.1995	M	0.71871	2.18	0.45415	D	0.998394	D	0.55800	0.973	D	0.65874	0.939	T	0.59762	-0.7393	9	0.87932	D	0	.	8.4827	0.33052	0.0:0.0:1.0:0.0	.	195	Q6P461	ACSM6_HUMAN	V	221;195;40;195	ENSP00000340296:G195V;ENSP00000400368:G40V;ENSP00000377573:G195V	ENSP00000340296:G195V	G	+	2	0	C10orf129	96957135	1.000000	0.71417	0.025000	0.17156	0.516000	0.34256	4.656000	0.61483	1.047000	0.40274	0.579000	0.79373	GGG	C10orf129	-	pfam_AMP-dep_Synth/Lig	ENSG00000173124		0.418	C10orf129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf129	HGNC	protein_coding	OTTHUMT00000049506.2	78	0.00	0	G			96967145	96967145	+1	no_errors	ENST00000341686	ensembl	human	known	69_37n	missense	73	31.78	34	SNP	0.921	T
C12orf50	160419	genome.wustl.edu	37	12	88380088	88380088	+	Splice_Site	SNP	C	C	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr12:88380088C>G	ENST00000298699.2	-	10	1103		c.e10+1		C12orf50_ENST00000550553.1_Splice_Site	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50									p.?(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						AGACACCTTACCTCTCTGCAT	0.318																																						dbGAP											1	Unknown(1)	breast(1)											86.0	87.0	86.0					12																	88380088		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.922+1G>C	12.37:g.88380088C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P674	Splice_Site	SNP	-	e9+1	ENST00000298699.2	37	c.922+1	CCDS9031.1	12	.	.	.	.	.	.	.	.	.	.	C	9.940	1.217096	0.22373	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944	.	.	.	6.01	6.01	0.97437	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4379	0.87557	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C12orf50	86904219	1.000000	0.71417	1.000000	0.80357	0.096000	0.18686	4.200000	0.58433	2.861000	0.98227	0.650000	0.86243	.	C12orf50	-	-	ENSG00000165805		0.318	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf50	HGNC	protein_coding	OTTHUMT00000406328.1	229	0.00	0	C	NM_152589	Intron	88380088	88380088	-1	no_errors	ENST00000298699	ensembl	human	known	69_37n	splice_site	211	16.93	43	SNP	1.000	G
LRRC74A	145497	genome.wustl.edu	37	14	77319604	77319604	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr14:77319604G>A	ENST00000393774.3	+	9	983	c.859G>A	c.(859-861)Ggg>Agg	p.G287R	C14orf166B_ENST00000450042.2_3'UTR	NM_194287.2	NP_919263.2												p.G287R(1)		breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		GAATGGCTTTGGGAATGAGGT	0.557																																					Ovarian(165;1056 1958 32571 36789 48728)	dbGAP											1	Substitution - Missense(1)	breast(1)											169.0	150.0	157.0					14																	77319604		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000393774.3:c.859G>A	14.37:g.77319604G>A	ENSP00000377369:p.Gly287Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.G287R	ENST00000393774.3	37	c.859	CCDS9853.2	14	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867900	0.32977	.	.	ENSG00000100565	ENST00000393774	T	0.58506	0.33	5.13	4.24	0.50183	.	0.066278	0.64402	N	0.000015	T	0.61426	0.2346	M	0.80982	2.52	0.80722	D	1	B	0.27351	0.176	B	0.31614	0.133	T	0.63042	-0.6725	10	0.52906	T	0.07	.	12.8072	0.57619	0.0801:0.0:0.9199:0.0	.	287	Q0VAA2	CN16B_HUMAN	R	287	ENSP00000377369:G287R	ENSP00000377369:G287R	G	+	1	0	C14orf166B	76389357	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	7.001000	0.76297	1.154000	0.42482	0.462000	0.41574	GGG	C14orf166B	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000100565		0.557	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166B	HGNC	protein_coding	OTTHUMT00000316592.1	150	0.00	0	G			77319604	77319604	+1	no_errors	ENST00000393774	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	1.000	A
C17orf97	400566	genome.wustl.edu	37	17	262995	262995	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr17:262995A>T	ENST00000360127.6	+	2	377	c.361A>T	c.(361-363)Atc>Ttc	p.I121F	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	121								p.I121F(2)		breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CTTTCATGACATCTTAAGTCC	0.512																																						dbGAP											2	Substitution - Missense(2)	breast(2)											125.0	113.0	117.0					17																	262995		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.361A>T	17.37:g.262995A>T	ENSP00000353245:p.Ile121Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	NULL	p.I121F	ENST00000360127.6	37	c.361	CCDS32519.2	17	.	.	.	.	.	.	.	.	.	.	A	17.39	3.377131	0.61735	.	.	ENSG00000187624	ENST00000360127;ENST00000491373	T;T	0.55413	0.99;0.52	5.02	5.02	0.67125	.	0.000000	0.42964	D	0.000629	T	0.58821	0.2149	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.60193	-0.7311	10	0.51188	T	0.08	-2.3803	11.7033	0.51583	1.0:0.0:0.0:0.0	.	121	Q6ZQX7-4	.	F	121;115	ENSP00000353245:I121F;ENSP00000419482:I115F	ENSP00000353245:I121F	I	+	1	0	C17orf97	263311	0.003000	0.15002	0.847000	0.33407	0.380000	0.30137	0.343000	0.19944	2.193000	0.70182	0.533000	0.62120	ATC	C17orf97	-	NULL	ENSG00000187624		0.512	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	182	0.55	1	A	NM_001013672		262995	262995	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	missense	88	22.12	25	SNP	0.974	T
PROB1	389333	genome.wustl.edu	37	5	138729040	138729040	+	Silent	SNP	C	C	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr5:138729040C>G	ENST00000434752.2	-	1	1845	c.1731G>C	c.(1729-1731)ggG>ggC	p.G577G		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	577	Pro-rich.							p.G577G(1)									ACTGCTGACTCCCTCCAAAGG	0.632																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											35.0	31.0	33.0					5																	138729040		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.1731G>C	5.37:g.138729040C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E007	Silent	SNP	NULL	p.G577	ENST00000434752.2	37	c.1731	CCDS54909.1	5																																																																																			C5orf65	-	NULL	ENSG00000228672		0.632	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf65	HGNC	protein_coding	OTTHUMT00000470735.1	33	0.00	0	C	NM_001161546		138729040	138729040	-1	no_errors	ENST00000434752	ensembl	human	known	69_37n	silent	18	35.71	10	SNP	0.001	G
CD5L	922	genome.wustl.edu	37	1	157804422	157804422	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:157804422T>C	ENST00000368174.4	-	4	589	c.493A>G	c.(493-495)Aca>Gca	p.T165A	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	165	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.T165A(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTCCAGCCTGTCTGGCACACG	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	94.0	95.0					1																	157804422		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.493A>G	1.37:g.157804422T>C	ENSP00000357156:p.Thr165Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7M5|Q6UX63	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.T165A	ENST00000368174.4	37	c.493	CCDS1171.1	1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.495237	0.26774	.	.	ENSG00000073754	ENST00000368174	T	0.27720	1.65	5.13	-1.73	0.08081	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.992445	0.08176	N	0.986292	T	0.03520	0.0101	N	0.03050	-0.425	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41360	-0.9513	10	0.42905	T	0.14	.	5.6991	0.17873	0.1315:0.4119:0.0:0.4566	.	165	O43866	CD5L_HUMAN	A	165	ENSP00000357156:T165A	ENSP00000357156:T165A	T	-	1	0	CD5L	156071046	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.504000	0.06375	-0.542000	0.06249	-0.301000	0.09380	ACA	CD5L	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000073754		0.627	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5L	HGNC	protein_coding	OTTHUMT00000058346.1	87	0.00	0	T	NM_005894		157804422	157804422	-1	no_errors	ENST00000368174	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	0.000	C
CDC37L1	55664	genome.wustl.edu	37	9	4684908	4684908	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr9:4684908A>G	ENST00000381854.3	+	2	366	c.164A>G	c.(163-165)cAa>cGa	p.Q55R	CDC37L1_ENST00000479095.1_3'UTR|CDC37L1_ENST00000381858.1_Missense_Mutation_p.Q55R	NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	55	Self-association.					cytoplasm (GO:0005737)		p.Q55R(1)		breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		TTGGCTTGCCAAAAGCAGAAA	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	96.0	98.0					9																	4684908		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.164A>G	9.37:g.4684908A>G	ENSP00000371278:p.Gln55Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL70|Q9NWS3|Q9NX16	Missense_Mutation	SNP	pfam_Cdc37_Hsp90-bd	p.Q55R	ENST00000381854.3	37	c.164	CCDS6454.1	9	.	.	.	.	.	.	.	.	.	.	A	18.51	3.638978	0.67130	.	.	ENSG00000106993	ENST00000381858;ENST00000381854	T;T	0.50277	0.77;0.75	5.86	4.72	0.59763	.	0.155068	0.64402	N	0.000014	T	0.41834	0.1176	N	0.19112	0.55	0.35289	D	0.781988	P	0.52316	0.952	P	0.55615	0.78	T	0.49072	-0.8977	10	0.22706	T	0.39	-15.0552	7.7479	0.28879	0.7906:0.1395:0.0699:0.0	.	55	Q7L3B6	CD37L_HUMAN	R	55	ENSP00000371282:Q55R;ENSP00000371278:Q55R	ENSP00000371278:Q55R	Q	+	2	0	CDC37L1	4674908	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.545000	0.53648	1.041000	0.40125	0.460000	0.39030	CAA	CDC37L1	-	NULL	ENSG00000106993		0.388	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC37L1	HGNC	protein_coding	OTTHUMT00000051564.1	253	0.00	0	A	NM_017913		4684908	4684908	+1	no_errors	ENST00000381854	ensembl	human	known	69_37n	missense	148	21.69	41	SNP	1.000	G
CDH23	64072	genome.wustl.edu	37	10	73572580	73572580	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:73572580G>T	ENST00000224721.6	+	67	9586	c.9581G>T	c.(9580-9582)cGg>cTg	p.R3194L	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.R949L	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	3189					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.R3194L(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CGATACCTGCGGGCTGCCATC	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											48.0	52.0	50.0					10																	73572580		2079	4210	6289	-	-	-	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.9581G>T	10.37:g.73572580G>T	ENSP00000224721:p.Arg3194Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R3192L	ENST00000224721.6	37	c.9575		10	.	.	.	.	.	.	.	.	.	.	G	36	5.763129	0.96906	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	D	0.82893	-1.66	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.89979	0.6872	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.997;0.997	D;D;D;D	0.87578	0.998;0.99;0.987;0.987	D	0.89897	0.4041	10	0.72032	D	0.01	.	20.1278	0.97990	0.0:0.0:1.0:0.0	.	86;86;3189;3189	Q5QGS5;Q5QGS6;E9PEX1;Q9H251	.;.;.;CAD23_HUMAN	L	3194;3189;3192;949	ENSP00000381768:R949L	ENSP00000224721:R3194L	R	+	2	0	CDH23	73242586	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.799000	0.99117	2.768000	0.95171	0.561000	0.74099	CGG	CDH23	-	NULL	ENSG00000107736		0.602	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	62	0.00	0	G	NM_052836		73572580	73572580	+1	no_errors	ENST00000224721	ensembl	human	known	69_37n	missense	67	10.67	8	SNP	1.000	T
CHGB	1114	genome.wustl.edu	37	20	5904477	5904477	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr20:5904477T>C	ENST00000378961.4	+	4	1891	c.1687T>C	c.(1687-1689)Ttc>Ctc	p.F563L		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	563						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)	p.F563L(1)		breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GAAGAATTTCTTCCCAGAATA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	63.0	64.0					20																	5904477		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1687T>C	20.37:g.5904477T>C	ENSP00000368244:p.Phe563Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.F563L	ENST00000378961.4	37	c.1687	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	T	20.3	3.964256	0.74131	.	.	ENSG00000089199	ENST00000378961	T	0.03689	3.84	5.79	3.53	0.40419	.	0.163295	0.43919	N	0.000516	T	0.07908	0.0198	M	0.75264	2.295	0.36219	D	0.85187	P	0.46784	0.884	P	0.48227	0.571	T	0.13282	-1.0515	10	0.59425	D	0.04	-8.6744	4.5888	0.12297	0.1206:0.0657:0.1261:0.6876	.	563	P05060	SCG1_HUMAN	L	563	ENSP00000368244:F563L	ENSP00000368244:F563L	F	+	1	0	CHGB	5852477	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.213000	0.42844	0.454000	0.26884	-0.378000	0.06908	TTC	CHGB	-	pfam_Granin	ENSG00000089199		0.473	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	HGNC	protein_coding	OTTHUMT00000077897.2	56	0.00	0	T	NM_001819		5904477	5904477	+1	no_errors	ENST00000378961	ensembl	human	known	69_37n	missense	44	22.81	13	SNP	1.000	C
CLDN19	149461	genome.wustl.edu	37	1	43200803	43200803	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:43200803G>T	ENST00000296387.1	-	5	819	c.629C>A	c.(628-630)cCa>cAa	p.P210Q	CLDN19_ENST00000372539.3_3'UTR|CLDN19_ENST00000539749.1_3'UTR	NM_001123395.1|NM_148960.2	NP_001116867.1|NP_683763.2	Q8N6F1	CLD19_HUMAN	claudin 19	210					apical junction assembly (GO:0043297)|calcium-independent cell-cell adhesion (GO:0016338)|neuronal action potential propagation (GO:0019227)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	apical junction complex (GO:0043296)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.P210Q(1)		breast(2)|large_intestine(1)|lung(2)|skin(1)	6	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTTAACAACTGGTCTGAAAGT	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	88.0	88.0					1																	43200803		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096063	CCDS471.1, CCDS44125.1, CCDS53306.1	1p34.2	2008-05-14			ENSG00000164007	ENSG00000164007		"""Claudins"""	2040	protein-coding gene	gene with protein product		610036					Standard	NM_148960		Approved		uc001cht.1	Q8N6F1	OTTHUMG00000007524	ENST00000296387.1:c.629C>A	1.37:g.43200803G>T	ENSP00000296387:p.Pro210Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5I2|F5H5P9|Q5QT57|Q8N8X0	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.P210Q	ENST00000296387.1	37	c.629	CCDS471.1	1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.958958	0.34565	.	.	ENSG00000164007	ENST00000296387	D	0.90069	-2.61	4.95	3.97	0.46021	.	0.423763	0.20632	N	0.088576	T	0.75989	0.3925	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.70328	-0.4902	10	0.25751	T	0.34	.	11.1029	0.48186	0.0:0.0:0.8157:0.1843	.	210	Q8N6F1	CLD19_HUMAN	Q	210	ENSP00000296387:P210Q	ENSP00000296387:P210Q	P	-	2	0	CLDN19	42973390	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.810000	0.55613	2.438000	0.82558	0.462000	0.41574	CCA	CLDN19	-	NULL	ENSG00000164007		0.592	CLDN19-001	KNOWN	basic|CCDS	protein_coding	CLDN19	HGNC	protein_coding	OTTHUMT00000019788.1	240	0.00	0	G	NM_148960		43200803	43200803	-1	no_errors	ENST00000296387	ensembl	human	known	69_37n	missense	148	14.45	25	SNP	1.000	T
CHI3L1	1116	genome.wustl.edu	37	1	203154456	203154456	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:203154456T>A	ENST00000255409.3	-	3	238	c.113A>T	c.(112-114)gAt>gTt	p.D38V		NM_001276.2	NP_001267.2	P36222	CH3L1_HUMAN	chitinase 3-like 1 (cartilage glycoprotein-39)	38					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to tumor necrosis factor (GO:0071356)|chitin catabolic process (GO:0006032)|inflammatory response (GO:0006954)|interleukin-8 secretion (GO:0072606)|lung development (GO:0030324)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase B signaling (GO:0051897)|response to interleukin-1 (GO:0070555)|response to interleukin-6 (GO:0070741)|response to mechanical stimulus (GO:0009612)|response to tumor necrosis factor (GO:0034612)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|extracellular matrix structural constituent (GO:0005201)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.D38V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|skin(1)	18						GCAGCTCCCATCGCCTTCCCG	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	110.0	114.0					1																	203154456		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008568	CCDS1435.1	1q32.1	2008-02-05			ENSG00000133048	ENSG00000133048			1932	protein-coding gene	gene with protein product		601525				8245017, 9244440	Standard	NM_001276		Approved	GP39, YKL40	uc001gzi.2	P36222	OTTHUMG00000042122	ENST00000255409.3:c.113A>T	1.37:g.203154456T>A	ENSP00000255409:p.Asp38Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7B0|P30923|Q8IVA4|Q96HI7	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.D38V	ENST00000255409.3	37	c.113	CCDS1435.1	1	.	.	.	.	.	.	.	.	.	.	T	5.973	0.363530	0.11296	.	.	ENSG00000133048	ENST00000255409	T	0.27890	1.64	5.35	2.81	0.32909	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.956896	0.08643	N	0.915256	T	0.19485	0.0468	L	0.27053	0.805	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.28586	-1.0039	10	0.21014	T	0.42	-2.5596	5.407	0.16326	0.3022:0.0:0.1567:0.5411	.	38	P36222	CH3L1_HUMAN	V	38	ENSP00000255409:D38V	ENSP00000255409:D38V	D	-	2	0	CHI3L1	201421079	0.000000	0.05858	0.009000	0.14445	0.992000	0.81027	-0.065000	0.11617	0.922000	0.37019	0.533000	0.62120	GAT	CHI3L1	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000133048		0.567	CHI3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHI3L1	HGNC	protein_coding	OTTHUMT00000100265.1	114	0.00	0	T	NM_001276		203154456	203154456	-1	no_errors	ENST00000255409	ensembl	human	known	69_37n	missense	138	10.97	17	SNP	0.000	A
CLN3	1201	genome.wustl.edu	37	16	28493806	28493806	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr16:28493806G>C	ENST00000569430.1	-	13	1717	c.898C>G	c.(898-900)Cag>Gag	p.Q300E	CLN3_ENST00000567963.1_Missense_Mutation_p.Q300E|CLN3_ENST00000565316.1_Intron|CLN3_ENST00000359984.7_Missense_Mutation_p.Q300E|CLN3_ENST00000354630.5_Intron|CLN3_ENST00000357857.9_Missense_Mutation_p.Q246E|CLN3_ENST00000357806.7_Missense_Mutation_p.Q201E|CLN3_ENST00000360019.2_Missense_Mutation_p.Q300E|CLN3_ENST00000357076.5_Missense_Mutation_p.Q190E|CLN3_ENST00000535392.1_Missense_Mutation_p.Q222E|CLN3_ENST00000395653.4_Missense_Mutation_p.Q200E|CLN3_ENST00000333496.9_Missense_Mutation_p.Q276E|CLN3_ENST00000355477.5_Missense_Mutation_p.Q252E|CLN3_ENST00000568224.1_Missense_Mutation_p.Q222E			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	300					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)	p.Q300E(1)		breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						ACAAGTCCCTGGTTAATGAAA	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	82.0	83.0					16																	28493806		2197	4300	6497	-	-	-	SO:0001583	missense	0			U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.898C>G	16.37:g.28493806G>C	ENSP00000454229:p.Gln300Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr,prints_Battenin_disease_Cln3	p.Q300E	ENST00000569430.1	37	c.898	CCDS10632.1	16	.	.	.	.	.	.	.	.	.	.	g	23.3	4.405095	0.83230	.	.	ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000355477;ENST00000357857;ENST00000395653;ENST00000357806;ENST00000357076	D;D;D;D;D;D;D;D	0.97404	-4.37;-4.37;-4.37;-4.37;-4.37;-4.37;-4.37;-3.53	5.5	5.5	0.81552	Major facilitator superfamily domain, general substrate transporter (1);	0.114168	0.64402	D	0.000009	D	0.98629	0.9541	M	0.93062	3.375	0.28964	N	0.889652	B;B;B;P;B;B;P;D	0.67145	0.306;0.223;0.439;0.583;0.306;0.385;0.74;0.996	B;B;B;B;B;B;P;D	0.66847	0.27;0.174;0.273;0.401;0.228;0.176;0.642;0.947	D	0.96048	0.9029	10	0.54805	T	0.06	-16.1742	14.9018	0.70684	0.0:0.0:1.0:0.0	.	276;300;198;200;246;252;300;201	B4DXL3;Q13286-4;O95086;B4DMY6;B4DFF3;Q13286-2;Q13286;O95089	.;.;.;.;.;.;CLN3_HUMAN;.	E	222;300;300;252;246;200;201;190	ENSP00000443221:Q222E;ENSP00000353073:Q300E;ENSP00000353116:Q300E;ENSP00000347660:Q252E;ENSP00000350523:Q246E;ENSP00000379014:Q200E;ENSP00000350457:Q201E;ENSP00000349586:Q190E	ENSP00000347660:Q252E	Q	-	1	0	CLN3	28401307	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.023000	0.70848	2.594000	0.87642	0.556000	0.70494	CAG	CLN3	-	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr,prints_Battenin_disease_Cln3	ENSG00000188603		0.552	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN3	HGNC	protein_coding	OTTHUMT00000214115.2	100	0.00	0	G			28493806	28493806	-1	no_errors	ENST00000359984	ensembl	human	known	69_37n	missense	41	34.92	22	SNP	1.000	C
COL15A1	1306	genome.wustl.edu	37	9	101759318	101759318	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr9:101759318G>C	ENST00000375001.3	+	6	1330	c.907G>C	c.(907-909)Gaa>Caa	p.E303Q		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	303	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.E303Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GGGGACCCTGGAAACCACCAA	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											173.0	159.0	164.0					9																	101759318		2203	4300	6503	-	-	-	SO:0001583	missense	0			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.907G>C	9.37:g.101759318G>C	ENSP00000364140:p.Glu303Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_Collagen,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.E303Q	ENST00000375001.3	37	c.907	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462924	0.43736	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	T	0.06687	3.27	4.42	4.42	0.53409	.	4.212230	0.00481	N	0.000124	T	0.10252	0.0251	L	0.32530	0.975	0.09310	N	1	B	0.25007	0.116	B	0.20577	0.03	T	0.29027	-1.0025	10	0.27082	T	0.32	-7.199	12.7038	0.57049	0.0:0.0:1.0:0.0	.	303	P39059	COFA1_HUMAN	Q	303;273	ENSP00000364140:E303Q	ENSP00000364140:E303Q	E	+	1	0	COL15A1	100799139	0.271000	0.24162	0.030000	0.17652	0.707000	0.40811	3.752000	0.55172	2.429000	0.82318	0.561000	0.74099	GAA	COL15A1	-	NULL	ENSG00000204291		0.498	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	HGNC	protein_coding	OTTHUMT00000053386.3	185	0.00	0	G	NM_001855		101759318	101759318	+1	no_errors	ENST00000375001	ensembl	human	known	69_37n	missense	119	16.78	24	SNP	0.011	C
COL17A1	1308	genome.wustl.edu	37	10	105798207	105798207	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:105798207G>T	ENST00000353479.5	-	45	3317	c.3027C>A	c.(3025-3027)agC>agA	p.S1009R	COL17A1_ENST00000369733.3_Missense_Mutation_p.S964R	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1009	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.S1009R(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CCTGGCCAGAGCTGCTGATAG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	129.0	127.0					10																	105798207		2201	4299	6500	-	-	-	SO:0001583	missense	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3027C>A	10.37:g.105798207G>T	ENSP00000340937:p.Ser1009Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.S1009R	ENST00000353479.5	37	c.3027	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452164	0.43531	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.93659	-3.26;-2.82	4.8	4.8	0.61643	.	0.118731	0.37261	N	0.002168	D	0.86887	0.6041	L	0.27053	0.805	0.80722	D	1	P	0.37015	0.578	B	0.33890	0.172	D	0.85335	0.1092	10	0.15499	T	0.54	-2.428	14.8018	0.69922	0.0:0.0:1.0:0.0	.	1009	Q9UMD9	COHA1_HUMAN	R	1009;964	ENSP00000340937:S1009R;ENSP00000358748:S964R	ENSP00000340937:S1009R	S	-	3	2	COL17A1	105788197	1.000000	0.71417	0.602000	0.28890	0.534000	0.34807	2.775000	0.47702	2.218000	0.71995	0.455000	0.32223	AGC	COL17A1	-	NULL	ENSG00000065618		0.592	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	11	0.00	0	G	NM_130778, NM_000494		105798207	105798207	-1	no_errors	ENST00000353479	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	0.997	T
COL4A5	1287	genome.wustl.edu	37	X	107924995	107924995	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chrX:107924995C>T	ENST00000361603.2	+	45	4319	c.4075C>T	c.(4075-4077)Cct>Tct	p.P1359S	COL4A5_ENST00000328300.6_Missense_Mutation_p.P1365S	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1359	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.P1359S(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CATAGGTCCTCCTGGATTACC	0.463									Alport syndrome with Diffuse Leiomyomatosis																													dbGAP											2	Substitution - Missense(2)	breast(1)|kidney(1)											133.0	118.0	123.0					X																	107924995		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4075C>T	X.37:g.107924995C>T	ENSP00000354505:p.Pro1359Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P1365S	ENST00000361603.2	37	c.4093	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559496	0.65538	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.93019	-3.15;-3.15	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.96408	0.8828	M	0.75884	2.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.994	D	0.96571	0.9423	10	0.52906	T	0.07	.	17.4297	0.87536	0.0:1.0:0.0:0.0	.	1362;1359	E7EVY4;P29400	.;CO4A5_HUMAN	S	1365;1359;1365	ENSP00000331902:P1365S;ENSP00000354505:P1359S	ENSP00000331902:P1365S	P	+	1	0	COL4A5	107811651	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.772000	0.75001	2.128000	0.65567	0.506000	0.49869	CCT	COL4A5	-	pfam_Collagen	ENSG00000188153		0.463	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	344	0.00	0	C			107924995	107924995	+1	no_errors	ENST00000328300	ensembl	human	known	69_37n	missense	176	22.81	52	SNP	1.000	T
COMP	1311	genome.wustl.edu	37	19	18900027	18900027	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:18900027C>T	ENST00000222271.2	-	5	514	c.470G>A	c.(469-471)gGg>gAg	p.G157E	COMP_ENST00000425807.1_Intron|COMP_ENST00000542601.2_Missense_Mutation_p.G124E	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	157	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.G157E(1)		breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GCCGCTGTACCCCGGCGGGCA	0.687																																						dbGAP											1	Substitution - Missense(1)	breast(1)											10.0	12.0	11.0					19																	18900027		2177	4251	6428	-	-	-	SO:0001583	missense	0			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.470G>A	19.37:g.18900027C>T	ENSP00000222271:p.Gly157Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_EGF-like_Ca-bd,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G157E	ENST00000222271.2	37	c.470	CCDS12385.1	19	.	.	.	.	.	.	.	.	.	.	C	31	5.069673	0.93950	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000454701	D;D	0.82081	-1.57;-1.57	4.37	4.37	0.52481	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.93148	0.7818	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95116	0.8242	10	0.87932	D	0	-27.9906	15.9174	0.79531	0.0:1.0:0.0:0.0	.	157	P49747	COMP_HUMAN	E	124;157;144	ENSP00000439156:G124E;ENSP00000222271:G157E	ENSP00000222271:G157E	G	-	2	0	COMP	18761027	1.000000	0.71417	0.359000	0.25824	0.996000	0.88848	7.594000	0.82698	1.990000	0.58119	0.555000	0.69702	GGG	COMP	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000105664		0.687	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMP	HGNC	protein_coding	OTTHUMT00000403457.1	10	0.00	0	C	NM_000095		18900027	18900027	-1	no_errors	ENST00000222271	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	0.995	T
CSTF3	1479	genome.wustl.edu	37	11	33106715	33106715	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr11:33106715G>A	ENST00000323959.4	-	21	2211	c.2072C>T	c.(2071-2073)tCa>tTa	p.S691L	TCP11L1_ENST00000324357.9_3'UTR	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	691					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S691L(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						ATCTTCATCTGAATCCTCGTT	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	93.0	93.0					11																	33106715		2202	4298	6500	-	-	-	SO:0001583	missense	0			U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.2072C>T	11.37:g.33106715G>A	ENSP00000315791:p.Ser691Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	pfam_Suf,smart_HAT	p.S691L	ENST00000323959.4	37	c.2072	CCDS7883.1	11	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860097	0.51482	.	.	ENSG00000176102	ENST00000323959;ENST00000537832	.	.	.	6.01	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.58609	0.2134	L	0.54323	1.7	0.80722	D	1	B	0.29481	0.245	B	0.30179	0.112	T	0.56032	-0.8046	9	0.35671	T	0.21	.	15.6824	0.77381	0.0664:0.0:0.9336:0.0	.	691	Q12996	CSTF3_HUMAN	L	691;624	.	ENSP00000315791:S691L	S	-	2	0	CSTF3	33063291	1.000000	0.71417	0.993000	0.49108	0.683000	0.39861	7.457000	0.80775	2.861000	0.98227	0.650000	0.86243	TCA	CSTF3	-	NULL	ENSG00000176102		0.532	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF3	HGNC	protein_coding	OTTHUMT00000388801.1	119	0.00	0	G	NM_001326		33106715	33106715	-1	no_errors	ENST00000323959	ensembl	human	known	69_37n	missense	113	13.08	17	SNP	0.998	A
DNAH2	146754	genome.wustl.edu	37	17	7662906	7662906	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr17:7662906A>G	ENST00000572933.1	+	16	4075	c.2615A>G	c.(2614-2616)gAt>gGt	p.D872G	DNAH2_ENST00000389173.2_Missense_Mutation_p.D872G			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	872	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D872G(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTGAAGAATGATCTGCAAGGA	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	100.0	102.0					17																	7662906		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.2615A>G	17.37:g.7662906A>G	ENSP00000458355:p.Asp872Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.D872G	ENST00000572933.1	37	c.2615	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	A	12.70	2.016963	0.35606	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.24538	1.85	5.8	5.8	0.92144	.	0.282847	0.31949	N	0.006808	T	0.24509	0.0594	L	0.41027	1.25	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.01951	-1.1241	10	0.51188	T	0.08	.	15.1237	0.72465	1.0:0.0:0.0:0.0	.	872	Q9P225	DYH2_HUMAN	G	872	ENSP00000373825:D872G	ENSP00000353818:D872G	D	+	2	0	DNAH2	7603631	0.994000	0.37717	0.747000	0.31113	0.646000	0.38490	5.651000	0.67951	2.216000	0.71823	0.402000	0.26972	GAT	DNAH2	-	NULL	ENSG00000183914		0.443	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	153	0.00	0	A	NM_020877		7662906	7662906	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	70	29.29	29	SNP	0.969	G
DNAH5	1767	genome.wustl.edu	37	5	13866371	13866371	+	Silent	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr5:13866371G>A	ENST00000265104.4	-	26	4178	c.4074C>T	c.(4072-4074)ggC>ggT	p.G1358G	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1358	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G1358G(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGGGCTTCAAGCCGCTAGCCA	0.323									Kartagener syndrome																													dbGAP											1	Substitution - coding silent(1)	breast(1)											25.0	30.0	28.0					5																	13866371		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4074C>T	5.37:g.13866371G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.G1358	ENST00000265104.4	37	c.4074	CCDS3882.1	5																																																																																			DNAH5	-	NULL	ENSG00000039139		0.323	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	56	0.00	0	G	NM_001369		13866371	13866371	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	silent	77	33.90	40	SNP	0.994	A
DNAH5	1767	genome.wustl.edu	37	5	13902205	13902205	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr5:13902205G>C	ENST00000265104.4	-	13	1791	c.1687C>G	c.(1687-1689)Caa>Gaa	p.Q563E		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	563	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q563E(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTTGTGTTTTGAATCTTTGCA	0.289									Kartagener syndrome																													dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	46.0	48.0					5																	13902205		2202	4292	6494	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1687C>G	5.37:g.13902205G>C	ENSP00000265104:p.Gln563Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q563E	ENST00000265104.4	37	c.1687	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432605	0.25813	.	.	ENSG00000039139	ENST00000265104	T	0.54279	0.58	4.94	4.06	0.47325	Dynein heavy chain, domain-1 (1);	0.404528	0.27513	N	0.019037	T	0.41396	0.1157	L	0.47716	1.5	0.25036	N	0.991236	B	0.11235	0.004	B	0.22601	0.04	T	0.25847	-1.0120	10	0.30078	T	0.28	.	5.3533	0.16047	0.0765:0.1441:0.63:0.1494	.	563	Q8TE73	DYH5_HUMAN	E	563	ENSP00000265104:Q563E	ENSP00000265104:Q563E	Q	-	1	0	DNAH5	13955205	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.874000	0.39568	1.199000	0.43173	0.655000	0.94253	CAA	DNAH5	-	pfam_Dynein_heavy_dom-1	ENSG00000039139		0.289	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	119	0.00	0	G	NM_001369		13902205	13902205	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	missense	144	47.45	130	SNP	1.000	C
DOCK3	1795	genome.wustl.edu	37	3	51378786	51378786	+	Silent	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:51378786G>T	ENST00000266037.9	+	38	3908	c.3885G>T	c.(3883-3885)cgG>cgT	p.R1295R		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1295	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R1295R(1)|p.R1284R(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GACTGTGCCGGAAGATCATTC	0.532																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											61.0	64.0	63.0					3																	51378786		2085	4223	6308	-	-	-	SO:0001819	synonymous_variant	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3885G>T	3.37:g.51378786G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15017	Silent	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.R1295	ENST00000266037.9	37	c.3885	CCDS46835.1	3																																																																																			DOCK3	-	NULL	ENSG00000088538		0.532	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	85	0.00	0	G	NM_004947		51378786	51378786	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	silent	58	21.62	16	SNP	0.666	T
EFEMP1	2202	genome.wustl.edu	37	2	56144946	56144946	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr2:56144946delG	ENST00000394555.2	-	4	806	c.371delC	c.(370-372)gcafs	p.A124fs	EFEMP1_ENST00000394554.1_Frame_Shift_Del_p.A124fs|EFEMP1_ENST00000424836.2_Frame_Shift_Del_p.A66fs|EFEMP1_ENST00000355426.3_Frame_Shift_Del_p.A124fs	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	124					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.A124fs*51(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCCTGCGACTGCAGCAGCACT	0.607																																					GBM(92;934 1319 7714 28760 40110)	dbGAP											1	Deletion - Frameshift(1)	breast(1)											55.0	54.0	54.0					2																	56144946		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.371delC	2.37:g.56144946delG	ENSP00000378058:p.Ala124fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3I4|B4DW75|D6W5D2|Q541U7	Frame_Shift_Del	DEL	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.A124fs	ENST00000394555.2	37	c.371	CCDS1857.1	2																																																																																			EFEMP1	-	NULL	ENSG00000115380		0.607	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	HGNC	protein_coding	OTTHUMT00000251491.2	74	0.00	0	G			56144946	56144946	-1	no_errors	ENST00000355426	ensembl	human	known	69_37n	frame_shift_del	82	25.66	29	DEL	0.986	-
EFEMP1	2202	genome.wustl.edu	37	2	56144947	56144947	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr2:56144947C>A	ENST00000394555.2	-	4	805	c.370G>T	c.(370-372)Gca>Tca	p.A124S	EFEMP1_ENST00000394554.1_Missense_Mutation_p.A124S|EFEMP1_ENST00000424836.2_Missense_Mutation_p.A66S|EFEMP1_ENST00000355426.3_Missense_Mutation_p.A124S	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	124					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.A124S(1)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CCTGCGACTGCAGCAGCACTG	0.602																																					GBM(92;934 1319 7714 28760 40110)	dbGAP											1	Substitution - Missense(1)	breast(1)											55.0	54.0	54.0					2																	56144947		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.370G>T	2.37:g.56144947C>A	ENSP00000378058:p.Ala124Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.A124S	ENST00000394555.2	37	c.370	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177657	0.78564	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000424836;ENST00000355426;ENST00000438672	D;D;T;D;T	0.83914	-1.78;-1.78;-1.3;-1.78;-1.32	5.24	4.28	0.50868	.	0.000000	0.47852	D	0.000203	T	0.62744	0.2453	N	0.08118	0	0.23168	N	0.998182	P;B	0.34522	0.455;0.319	B;B	0.27170	0.077;0.077	T	0.52124	-0.8617	10	0.15499	T	0.54	.	13.4706	0.61279	0.0:0.8413:0.1587:0.0	.	66;124	B4DW75;Q12805	.;FBLN3_HUMAN	S	124;124;66;124;124	ENSP00000378058:A124S;ENSP00000378057:A124S;ENSP00000399145:A66S;ENSP00000347596:A124S;ENSP00000392055:A124S	ENSP00000347596:A124S	A	-	1	0	EFEMP1	55998451	1.000000	0.71417	0.982000	0.44146	0.982000	0.71751	2.127000	0.42035	2.833000	0.97629	0.650000	0.86243	GCA	EFEMP1	-	NULL	ENSG00000115380		0.602	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	HGNC	protein_coding	OTTHUMT00000251491.2	74	0.00	0	C			56144947	56144947	-1	no_errors	ENST00000355426	ensembl	human	known	69_37n	missense	82	26.79	30	SNP	0.992	A
EFHC1	114327	genome.wustl.edu	37	6	52303141	52303141	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:52303141A>G	ENST00000371068.5	+	3	428	c.325A>G	c.(325-327)Atg>Gtg	p.M109V	EFHC1_ENST00000491749.1_3'UTR|EFHC1_ENST00000538167.1_Missense_Mutation_p.M90V|EFHC1_ENST00000433625.2_Missense_Mutation_p.M18V	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	109	DM10 1. {ECO:0000255|PROSITE- ProRule:PRU00665}.					axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.M109V(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					AGATGTTCCTATGTCAACTGA	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											49.0	44.0	46.0					6																	52303141		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.325A>G	6.37:g.52303141A>G	ENSP00000360107:p.Met109Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	pfam_DUF1126,smart_Uncharacterised_DM10,pfscan_EF_HAND_2	p.M109V	ENST00000371068.5	37	c.325	CCDS4942.1	6	.	.	.	.	.	.	.	.	.	.	A	8.523	0.869136	0.17322	.	.	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.66995	0.01;-0.24;-0.19	5.77	-1.28	0.09318	Uncharacterised domain DM10 (2);	0.471455	0.26338	N	0.024959	T	0.13586	0.0329	N	0.01874	-0.695	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.09377	0.004;0.001;0.0	T	0.27365	-1.0076	10	0.48119	T	0.1	-0.005	4.1411	0.10194	0.4492:0.3357:0.1314:0.0837	.	90;18;109	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	V	109;18;90	ENSP00000360107:M109V;ENSP00000416492:M18V;ENSP00000444521:M90V	ENSP00000360107:M109V	M	+	1	0	EFHC1	52411100	0.000000	0.05858	0.666000	0.29783	0.943000	0.58893	-1.119000	0.03276	0.126000	0.18424	-0.256000	0.11100	ATG	EFHC1	-	smart_Uncharacterised_DM10	ENSG00000096093		0.368	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHC1	HGNC	protein_coding	OTTHUMT00000040905.2	70	0.00	0	A	NM_018100		52303141	52303141	+1	no_errors	ENST00000371068	ensembl	human	known	69_37n	missense	67	17.07	14	SNP	0.000	G
EGFLAM	133584	genome.wustl.edu	37	5	38431296	38431296	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr5:38431296C>A	ENST00000354891.3	+	15	2418	c.2072C>A	c.(2071-2073)aCc>aAc	p.T691N	EGFLAM_ENST00000397202.2_Missense_Mutation_p.T57N|EGFLAM_ENST00000322350.5_Missense_Mutation_p.T691N|EGFLAM_ENST00000336740.6_Missense_Mutation_p.T457N	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	691	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)	p.T691N(2)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GATCCCCTCACCCTGGGCAAC	0.443																																					Colon(62;485 1295 3347 17454)	dbGAP											2	Substitution - Missense(2)	breast(2)											111.0	96.0	101.0					5																	38431296		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2072C>A	5.37:g.38431296C>A	ENSP00000346964:p.Thr691Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.T691N	ENST00000354891.3	37	c.2072	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634684	0.47049	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580	T;T;T;T	0.74947	-0.76;-0.76;-0.76;-0.89	5.67	3.85	0.44370	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.678925	0.15151	N	0.277678	T	0.62588	0.2440	N	0.16201	0.385	0.28234	N	0.925993	B;P;P	0.45634	0.433;0.863;0.696	B;P;B	0.46585	0.299;0.521;0.283	T	0.55909	-0.8066	10	0.40728	T	0.16	-12.5951	10.0689	0.42322	0.0:0.5946:0.3294:0.076	.	457;691;691	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	N	691;691;457;57;457	ENSP00000346964:T691N;ENSP00000313084:T691N;ENSP00000337607:T457N;ENSP00000380385:T57N	ENSP00000313084:T691N	T	+	2	0	EGFLAM	38467053	0.633000	0.27181	0.984000	0.44739	0.743000	0.42351	1.512000	0.35812	1.353000	0.45828	0.563000	0.77884	ACC	EGFLAM	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000164318		0.443	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	211	0.00	0	C	NM_152403		38431296	38431296	+1	no_errors	ENST00000354891	ensembl	human	known	69_37n	missense	81	35.71	45	SNP	0.485	A
ELOVL3	83401	genome.wustl.edu	37	10	103988973	103988973	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:103988973C>G	ENST00000370005.3	+	4	998	c.777C>G	c.(775-777)atC>atG	p.I259M		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	259					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.I259M(1)		breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		AGACCTACATCAGGCCCAAGG	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	115.0	118.0					10																	103988973		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.777C>G	10.37:g.103988973C>G	ENSP00000359022:p.Ile259Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZL3|Q8N180	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.I259M	ENST00000370005.3	37	c.777	CCDS7531.1	10	.	.	.	.	.	.	.	.	.	.	C	12.28	1.889421	0.33348	.	.	ENSG00000119915	ENST00000370005	T	0.25250	1.81	5.29	-1.88	0.07713	.	0.946866	0.08684	N	0.909044	T	0.16811	0.0404	L	0.34521	1.04	0.09310	N	1	B	0.26081	0.141	B	0.33121	0.158	T	0.39375	-0.9617	10	0.27785	T	0.31	-3.3527	2.431	0.04471	0.2096:0.3862:0.2563:0.148	.	259	Q9HB03	ELOV3_HUMAN	M	259	ENSP00000359022:I259M	ENSP00000359022:I259M	I	+	3	3	ELOVL3	103978963	0.062000	0.20869	0.000000	0.03702	0.223000	0.24884	0.278000	0.18753	-0.321000	0.08627	-0.157000	0.13467	ATC	ELOVL3	-	pfam_GNS1_SUR4	ENSG00000119915		0.502	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL3	HGNC	protein_coding	OTTHUMT00000050030.1	180	0.00	0	C	NM_152310		103988973	103988973	+1	no_errors	ENST00000370005	ensembl	human	known	69_37n	missense	81	31.36	37	SNP	0.000	G
EMC1	23065	genome.wustl.edu	37	1	19545923	19545923	+	Silent	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:19545923C>T	ENST00000477853.1	-	23	2898	c.2856G>A	c.(2854-2856)caG>caA	p.Q952Q	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_Silent_p.Q930Q|EMC1_ENST00000375199.3_Silent_p.Q951Q|EMC1_ENST00000480380.1_5'UTR	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	952						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)		p.Q952Q(1)									GAACGTCAAACTGCTTGGATG	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											103.0	89.0	94.0					1																	19545923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2856G>A	1.37:g.19545923C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	pfam_DUF1620	p.S175N	ENST00000477853.1	37	c.524	CCDS190.1	1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.774314	0.49786	.	.	ENSG00000127463	ENST00000486405	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	T	0.76898	0.4052	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74791	-0.3545	5	0.46703	T	0.11	.	19.1882	0.93653	0.0:1.0:0.0:0.0	.	.	.	.	N	175	.	ENSP00000419345:S175N	S	-	2	0	KIAA0090	19418510	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.576000	0.60915	2.879000	0.98667	0.650000	0.86243	AGT	EMC1	-	NULL	ENSG00000127463		0.453	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	112	0.00	0	C	NM_015047		19545923	19545923	-1	no_start_codon	ENST00000486405	ensembl	human	putative	69_37n	missense	65	17.72	14	SNP	1.000	T
SIRPD	128646	genome.wustl.edu	37	20	1538282	1538282	+	Silent	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr20:1538282G>T	ENST00000381623.3	-	1	1207	c.18C>A	c.(16-18)tcC>tcA	p.S6S	SIRPD_ENST00000381621.1_Silent_p.S6S|RP4-576H24.4_ENST00000564763.1_Intron			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	6						extracellular region (GO:0005576)		p.S6S(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						GGTGGAGTGGGGAGGCAGGGA	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											259.0	200.0	220.0					20																	1538282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.18C>A	20.37:g.1538282G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS88|Q5TFQ6	Missense_Mutation	SNP	pfam_Ig_V-set	p.P107T	ENST00000381623.3	37	c.319	CCDS13018.1	20																																																																																			RP4-576H24.4	-	NULL	ENSG00000260861		0.582	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000260861	Clone_based_vega_gene	protein_coding	OTTHUMT00000077552.1	300	0.33	1	G	NM_178460		1538282	1538282	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000566961	ensembl	human	putative	69_37n	missense	152	18.28	34	SNP	0.001	T
ERMAP	114625	genome.wustl.edu	37	1	43296678	43296678	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:43296678G>A	ENST00000372517.2	+	4	569	c.325G>A	c.(325-327)Gtc>Atc	p.V109I	ERMAP_ENST00000372514.3_Missense_Mutation_p.V109I|ERMAP_ENST00000487556.1_Intron|ERMAP_ENST00000328249.3_Missense_Mutation_p.V19I	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	109	Ig-like V-type.		DAQEGSVTLQI -> CPRGKCHSADP (in Sc-3 allele).			cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V109I(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGAGGGAAGTGTCACTCTGCA	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											157.0	132.0	140.0					1																	43296678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.325G>A	1.37:g.43296678G>A	ENSP00000361595:p.Val109Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.V109I	ENST00000372517.2	37	c.325	CCDS475.1	1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.300740	0.23650	.	.	ENSG00000164010	ENST00000372517;ENST00000372514;ENST00000328249	T;T;T	0.67345	-0.26;-0.26;-0.26	4.95	-0.871	0.10642	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.040760	0.07645	N	0.930955	T	0.52533	0.1740	L	0.47078	1.49	0.09310	N	1	P;B	0.34724	0.465;0.012	B;B	0.35039	0.194;0.016	T	0.38415	-0.9662	10	0.23891	T	0.37	.	3.1817	0.06587	0.2804:0.0:0.3659:0.3537	.	170;109	B7Z3C6;Q96PL5	.;ERMAP_HUMAN	I	109;109;19	ENSP00000361595:V109I;ENSP00000361592:V109I;ENSP00000332439:V19I	ENSP00000332439:V19I	V	+	1	0	ERMAP	43069265	0.018000	0.18449	0.000000	0.03702	0.881000	0.50899	0.293000	0.19029	0.011000	0.14865	0.557000	0.71058	GTC	ERMAP	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000164010		0.522	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMAP	HGNC	protein_coding	OTTHUMT00000020180.1	147	0.00	0	G	NM_018538		43296678	43296678	+1	no_errors	ENST00000372514	ensembl	human	known	69_37n	missense	92	14.02	15	SNP	0.000	A
FAM155B	27112	genome.wustl.edu	37	X	68725887	68725887	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chrX:68725887C>A	ENST00000252338.4	+	1	804	c.762C>A	c.(760-762)gaC>gaA	p.D254E	AL158069.1_ENST00000579664.1_RNA	NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	254						integral component of membrane (GO:0016021)		p.D254E(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						AGCGGCTGGACCGACACGCTC	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	30.0	29.0					X																	68725887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.762C>A	X.37:g.68725887C>A	ENSP00000252338:p.Asp254Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	NULL	p.D254E	ENST00000252338.4	37	c.762	CCDS35317.1	X	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535667	0.64972	.	.	ENSG00000130054	ENST00000252338	T	0.10763	2.84	5.17	4.3	0.51218	.	0.000000	0.64402	D	0.000002	T	0.26412	0.0645	M	0.62723	1.935	0.46701	D	0.999163	D	0.89917	1.0	D	0.83275	0.996	T	0.00849	-1.1541	10	0.72032	D	0.01	-13.3436	7.7339	0.28802	0.0:0.8011:0.0:0.1989	.	254	O75949-2	.	E	254	ENSP00000252338:D254E	ENSP00000252338:D254E	D	+	3	2	FAM155B	68642612	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.635000	0.54309	0.946000	0.37632	0.525000	0.51046	GAC	FAM155B	-	NULL	ENSG00000130054		0.602	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155B	HGNC	protein_coding	OTTHUMT00000057037.1	52	0.00	0	C	NM_015686		68725887	68725887	+1	no_errors	ENST00000252338	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	A
FAM161A	84140	genome.wustl.edu	37	2	62081050	62081050	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr2:62081050C>T	ENST00000405894.3	-	1	228	c.127G>A	c.(127-129)Gag>Aag	p.E43K	FAM161A_ENST00000404929.1_Missense_Mutation_p.E43K	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	43					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)		p.E43K(2)		breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAGATCGCCTCCGCTGCCGCC	0.652																																						dbGAP											2	Substitution - Missense(2)	breast(2)											46.0	46.0	46.0					2																	62081050		1568	3582	5150	-	-	-	SO:0001583	missense	0				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.127G>A	2.37:g.62081050C>T	ENSP00000385893:p.Glu43Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJV7|Q9H8R2	Missense_Mutation	SNP	pfam_UPF0564	p.E43K	ENST00000405894.3	37	c.127	CCDS42687.2	2	.	.	.	.	.	.	.	.	.	.	C	6.073	0.381814	0.11524	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.61510	0.1;0.1	4.36	2.52	0.30459	.	.	.	.	.	T	0.35970	0.0950	N	0.14661	0.345	0.09310	N	1	B;B	0.13145	0.004;0.007	B;B	0.13407	0.004;0.009	T	0.18681	-1.0329	9	0.31617	T	0.26	.	6.0861	0.19968	0.0:0.7084:0.1899:0.1017	.	43;43	Q3B820;Q3B820-3	F161A_HUMAN;.	K	43	ENSP00000385158:E43K;ENSP00000385893:E43K	ENSP00000303170:E43K	E	-	1	0	FAM161A	61934554	0.004000	0.15560	0.001000	0.08648	0.000000	0.00434	1.112000	0.31172	0.755000	0.32990	-0.137000	0.14449	GAG	FAM161A	-	NULL	ENSG00000170264		0.652	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM161A	HGNC	protein_coding	OTTHUMT00000325537.2	50	0.00	0	C	NM_032180		62081050	62081050	-1	no_errors	ENST00000405894	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.001	T
FAM217A	222826	genome.wustl.edu	37	6	4073690	4073690	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:4073690C>T	ENST00000274673.3	-	5	614	c.211G>A	c.(211-213)Gtg>Atg	p.V71M	snoU13_ENST00000516859.1_RNA|FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	71																	TGACTATGCACCGACAAATTA	0.313																																						dbGAP											0													90.0	88.0	89.0					6																	4073690		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.211G>A	6.37:g.4073690C>T	ENSP00000274673:p.Val71Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYK1	Missense_Mutation	SNP	NULL	p.V71M	ENST00000274673.3	37	c.211	CCDS4489.1	6	.	.	.	.	.	.	.	.	.	.	C	6.320	0.427132	0.11987	.	.	ENSG00000145975	ENST00000274673;ENST00000470599;ENST00000498677;ENST00000492651	T	0.14893	2.47	5.28	4.4	0.53042	.	0.355341	0.28098	N	0.016614	T	0.03348	0.0097	N	0.14661	0.345	0.09310	N	1	P	0.39624	0.681	B	0.31337	0.128	T	0.20009	-1.0288	10	0.62326	D	0.03	-4.5715	11.088	0.48099	0.1845:0.8155:0.0:0.0	.	71	Q8IXS0	CF146_HUMAN	M	71;199;8;8	ENSP00000274673:V71M	ENSP00000274673:V71M	V	-	1	0	C6orf146	4018689	0.095000	0.21747	0.026000	0.17262	0.002000	0.02628	3.298000	0.51818	1.438000	0.47492	0.591000	0.81541	GTG	FAM217A	-	NULL	ENSG00000145975		0.313	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217A	HGNC	protein_coding	OTTHUMT00000352577.2	185	0.00	0	C	NM_173563		4073690	4073690	-1	no_errors	ENST00000274673	ensembl	human	known	69_37n	missense	239	16.14	46	SNP	0.123	T
FAM21A	387680	genome.wustl.edu	37	10	51859751	51859751	+	Missense_Mutation	SNP	C	C	A	rs201610656	byFrequency	TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:51859751C>A	ENST00000282633.5	+	17	1607	c.1562C>A	c.(1561-1563)tCc>tAc	p.S521Y	FAM21A_ENST00000399339.2_Missense_Mutation_p.S433Y|FAM21A_ENST00000351071.6_Missense_Mutation_p.S521Y|FAM21A_ENST00000314664.7_Missense_Mutation_p.S521Y	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	521					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						ACCTTATCTTCCAGCAAAAAT	0.423																																						dbGAP											0													2.0	2.0	2.0					10																	51859751		1300	2814	4114	-	-	-	SO:0001583	missense	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1562C>A	10.37:g.51859751C>A	ENSP00000282633:p.Ser521Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.S521Y	ENST00000282633.5	37	c.1562	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	c	4.405	0.074822	0.08485	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	4.32	4.32	0.51571	.	0.662706	0.15995	N	0.234623	T	0.57932	0.2087	M	0.67953	2.075	0.42549	P	0.00689799999999996	B;B;P;B;B	0.50528	0.001;0.001;0.936;0.005;0.001	B;B;P;B;B	0.48227	0.004;0.003;0.571;0.02;0.003	T	0.71258	-0.4646	8	0.51188	T	0.08	0.2567	12.3647	0.55222	0.0:1.0:0.0:0.0	.	521;521;433;521;415	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	Y	521;521;415;521;433	.	ENSP00000282633:S521Y	S	+	2	0	FAM21A	51529757	0.619000	0.27059	0.196000	0.23383	0.208000	0.24298	3.741000	0.55090	1.945000	0.56424	0.184000	0.17185	TCC	FAM21A	-	NULL	ENSG00000099290		0.423	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	57	0.00	0	C	NM_001005751		51859751	51859751	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	79	16.84	16	SNP	0.717	A
FBXO34	55030	genome.wustl.edu	37	14	55819095	55819095	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr14:55819095G>C	ENST00000313833.4	+	2	2232	c.1987G>C	c.(1987-1989)Ggg>Cgg	p.G663R	FBXO34_ENST00000440021.1_Missense_Mutation_p.G663R	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	663								p.G663R(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CTATGGGCCAGGGTATTGGAT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	71.0	71.0					14																	55819095		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1987G>C	14.37:g.55819095G>C	ENSP00000313159:p.Gly663Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.G663R	ENST00000313833.4	37	c.1987	CCDS32086.1	14	.	.	.	.	.	.	.	.	.	.	G	18.25	3.581653	0.65992	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.21361	2.01;2.01	6.02	6.02	0.97574	.	0.754900	0.11326	N	0.575563	T	0.52306	0.1726	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.43605	-0.9381	10	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	663	Q9NWN3	FBX34_HUMAN	R	663	ENSP00000313159:G663R;ENSP00000394117:G663R	ENSP00000313159:G663R	G	+	1	0	FBXO34	54888848	1.000000	0.71417	0.993000	0.49108	0.770000	0.43624	4.635000	0.61332	2.865000	0.98341	0.655000	0.94253	GGG	FBXO34	-	NULL	ENSG00000178974		0.542	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	HGNC	protein_coding	OTTHUMT00000411322.1	79	0.00	0	G			55819095	55819095	+1	no_errors	ENST00000313833	ensembl	human	known	69_37n	missense	48	43.53	37	SNP	1.000	C
FLNB	2317	genome.wustl.edu	37	3	58124079	58124079	+	Silent	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:58124079G>C	ENST00000295956.4	+	29	5097	c.4932G>C	c.(4930-4932)ggG>ggC	p.G1644G	FLNB_ENST00000429972.2_Silent_p.G1644G|FLNB_ENST00000348383.5_Silent_p.G1644G|FLNB_ENST00000490882.1_Silent_p.G1675G|FLNB_ENST00000419752.2_Silent_p.G1475G|FLNB_ENST00000357272.4_Silent_p.G1644G|FLNB_ENST00000493452.1_Silent_p.G1475G|FLNB_ENST00000358537.3_Silent_p.G1644G	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1644					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.G1675G(1)|p.G1644G(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		AGACTGCCGGGAAGGGTAAAG	0.522																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											117.0	112.0	113.0					3																	58124079		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.4932G>C	3.37:g.58124079G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.G1644	ENST00000295956.4	37	c.4932	CCDS2885.1	3																																																																																			FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.522	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	124	0.00	0	G	NM_001457		58124079	58124079	+1	no_errors	ENST00000295956	ensembl	human	known	69_37n	silent	42	26.32	15	SNP	1.000	C
HAUS5	23354	genome.wustl.edu	37	19	36104782	36104782	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:36104782G>C	ENST00000203166.5	+	3	199	c.174G>C	c.(172-174)aaG>aaC	p.K58N	HAUS5_ENST00000379045.2_Missense_Mutation_p.K58N|AC002115.9_ENST00000589603.1_lincRNA	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	58					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.K58K(1)|p.K58N(1)		NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						CTGTCAAGAAGATCCGGGGAA	0.542																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	cervix(1)|breast(1)											112.0	125.0	121.0					19																	36104782		2131	4244	6375	-	-	-	SO:0001583	missense	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.174G>C	19.37:g.36104782G>C	ENSP00000439056:p.Lys58Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	NULL	p.K58N	ENST00000203166.5	37	c.174	CCDS42550.1	19	.	.	.	.	.	.	.	.	.	.	G	12.15	1.850243	0.32699	.	.	ENSG00000249115	ENST00000203166;ENST00000379045	T;T	0.30448	1.53;1.53	4.92	2.79	0.32731	.	0.316108	0.33650	N	0.004688	T	0.37404	0.1002	M	0.66939	2.045	0.32189	N	0.579344	P	0.51351	0.944	P	0.50617	0.646	T	0.48525	-0.9028	10	0.45353	T	0.12	-31.7839	7.3238	0.26542	0.198:0.0:0.802:0.0	.	58	O94927	HAUS5_HUMAN	N	58	ENSP00000439056:K58N;ENSP00000444373:K58N	ENSP00000439056:K58N	K	+	3	2	HAUS5	40796622	1.000000	0.71417	0.998000	0.56505	0.195000	0.23768	2.236000	0.43052	0.654000	0.30846	0.655000	0.94253	AAG	HAUS5	-	NULL	ENSG00000249115		0.542	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	145	0.00	0	G			36104782	36104782	+1	no_errors	ENST00000203166	ensembl	human	known	69_37n	missense	104	15.45	19	SNP	1.000	C
HELZ	9931	genome.wustl.edu	37	17	65103686	65103686	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr17:65103686T>G	ENST00000358691.5	-	31	5006	c.4840A>C	c.(4840-4842)Agc>Cgc	p.S1614R	HELZ_ENST00000580168.1_Missense_Mutation_p.S1615R	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1614						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S1614R(1)		NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					GCTGGTGGGCTTCTACTCTGT	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											184.0	179.0	181.0					17																	65103686		1982	4150	6132	-	-	-	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.4840A>C	17.37:g.65103686T>G	ENSP00000351524:p.Ser1614Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	I6L9H4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S1614R	ENST00000358691.5	37	c.4840	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	T	10.69	1.420677	0.25639	.	.	ENSG00000198265	ENST00000358691	D	0.86497	-2.13	5.08	3.98	0.46160	.	0.186389	0.56097	D	0.000037	T	0.80188	0.4577	L	0.32530	0.975	0.42535	D	0.993056	P;P	0.44578	0.838;0.838	B;B	0.39299	0.296;0.296	T	0.79790	-0.1655	10	0.72032	D	0.01	-10.5873	11.1748	0.48593	0.1379:0.0:0.0:0.8621	.	1615;1614	B7ZLW2;P42694	.;HELZ_HUMAN	R	1614	ENSP00000351524:S1614R	ENSP00000351524:S1614R	S	-	1	0	HELZ	62534148	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	4.204000	0.58460	0.754000	0.32968	0.391000	0.25812	AGC	HELZ	-	NULL	ENSG00000198265		0.458	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1	369	0.00	0	T	NM_014877		65103686	65103686	-1	no_errors	ENST00000358691	ensembl	human	known	69_37n	missense	201	16.25	39	SNP	1.000	G
HS6ST1	9394	genome.wustl.edu	37	2	129026227	129026227	+	Missense_Mutation	SNP	G	G	T	rs3958533		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr2:129026227G>T	ENST00000259241.6	-	2	758	c.745C>A	c.(745-747)Cgc>Agc	p.R249S		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	249					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)	p.R249S(1)		endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		CGCACCTGGCGGTTGTTGGCC	0.672																																						dbGAP											1	Substitution - Missense(1)	skin(1)											14.0	18.0	17.0					2																	129026227		1971	4143	6114	-	-	-	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.745C>A	2.37:g.129026227G>T	ENSP00000259241:p.Arg249Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R249S	ENST00000259241.6	37	c.745	CCDS42748.1	2	257	0.11767399267399267	38	0.07723577235772358	38	0.10497237569060773	62	0.10839160839160839	119	0.15699208443271767	G	27.0	4.792392	0.90453	.	.	ENSG00000136720	ENST00000259241	T	0.75821	-0.97	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.02571	0.0078	M	0.89601	3.045	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.48305	-0.9047	9	.	.	.	-0.1889	18.424	0.90602	0.0:0.0:1.0:0.0	rs3958533	249	O60243	H6ST1_HUMAN	S	249	ENSP00000259241:R249S	.	R	-	1	0	HS6ST1	128742697	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.939000	0.70179	2.346000	0.79739	0.462000	0.41574	CGC	HS6ST1	-	pfam_Sulfotransferase	ENSG00000136720		0.672	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	14	0.00	0	G	NM_004807		129026227	129026227	-1	no_errors	ENST00000259241	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	T
HSDL2	84263	genome.wustl.edu	37	9	115221807	115221807	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr9:115221807C>T	ENST00000398805.3	+	10	1321	c.1094C>T	c.(1093-1095)gCa>gTa	p.A365V	HSDL2_ENST00000262542.7_Missense_Mutation_p.A245V|HSDL2_ENST00000539114.1_Missense_Mutation_p.A160V|HSDL2_ENST00000398803.1_Missense_Mutation_p.A292V	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	365	SCP2.					membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)	p.A365V(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						TCTGATCAGGCAGATGTGGTG	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											252.0	244.0	246.0					9																	115221807		1976	4161	6137	-	-	-	SO:0001583	missense	0			AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.1094C>T	9.37:g.115221807C>T	ENSP00000381785:p.Ala365Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	pfam_SCP2_sterol-bd_dom,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,prints_Glc/ribitol_DH	p.A365V	ENST00000398805.3	37	c.1094	CCDS43864.1	9	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053470	0.55218	.	.	ENSG00000119471	ENST00000398805;ENST00000398803;ENST00000262542;ENST00000539114	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	6.07	5.08	0.68730	SCP2 sterol-binding domain (2);	0.093033	0.64402	D	0.000001	T	0.31544	0.0800	M	0.62154	1.92	0.53688	D	0.999976	B;B;B	0.29136	0.02;0.234;0.101	B;B;B	0.30716	0.016;0.119;0.094	T	0.05869	-1.0859	10	0.40728	T	0.16	.	10.9873	0.47528	0.0:0.8529:0.0:0.1471	.	292;292;365	Q6YN16-2;B2R923;Q6YN16	.;.;HSDL2_HUMAN	V	365;292;245;160	ENSP00000381785:A365V;ENSP00000381783:A292V;ENSP00000262542:A245V;ENSP00000442278:A160V	ENSP00000262542:A245V	A	+	2	0	HSDL2	114261628	0.993000	0.37304	0.926000	0.36857	0.946000	0.59487	2.183000	0.42565	2.884000	0.98904	0.655000	0.94253	GCA	HSDL2	-	pfam_SCP2_sterol-bd_dom,superfamily_SCP2_sterol-bd_dom	ENSG00000119471		0.383	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	HSDL2	HGNC	protein_coding	OTTHUMT00000053681.1	437	0.23	1	C	NM_032303		115221807	115221807	+1	no_errors	ENST00000398805	ensembl	human	known	69_37n	missense	318	13.35	49	SNP	0.954	T
IGSF10	285313	genome.wustl.edu	37	3	151154674	151154674	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:151154674C>G	ENST00000282466.3	-	6	7674	c.7675G>C	c.(7675-7677)Gaa>Caa	p.E2559Q	IGSF10_ENST00000495443.1_5'UTR|MED12L_ENST00000474524.1_3'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2559	Ig-like C2-type 12.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.E2559Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CATGTGATTTCTGGCTTGGGA	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	67.0	69.0					3																	151154674		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7675G>C	3.37:g.151154674C>G	ENSP00000282466:p.Glu2559Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E2559Q	ENST00000282466.3	37	c.7675	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132255	0.37630	.	.	ENSG00000152580	ENST00000282466	T	0.67865	-0.29	5.14	2.29	0.28610	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.270733	0.25863	N	0.027814	T	0.48696	0.1514	N	0.13299	0.325	0.39683	D	0.970927	B;B	0.26577	0.153;0.128	B;B	0.32724	0.151;0.056	T	0.33292	-0.9874	10	0.31617	T	0.26	.	10.4196	0.44341	0.0:0.6775:0.2528:0.0696	.	2559;586	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	Q	2559	ENSP00000282466:E2559Q	ENSP00000282466:E2559Q	E	-	1	0	IGSF10	152637364	1.000000	0.71417	0.785000	0.31869	0.829000	0.46940	1.929000	0.40114	0.240000	0.21263	0.655000	0.94253	GAA	IGSF10	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000152580		0.527	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	70	0.00	0	C	NM_178822		151154674	151154674	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	missense	48	40.00	32	SNP	1.000	G
IL22	50616	genome.wustl.edu	37	12	68647221	68647221	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr12:68647221G>T	ENST00000538666.1	-	2	78	c.8C>A	c.(7-9)gCc>gAc	p.A3D	IL22_ENST00000328087.4_Missense_Mutation_p.A3D			Q9GZX6	IL22_HUMAN	interleukin 22	3					acute-phase response (GO:0006953)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-22 receptor binding (GO:0045518)	p.A3D(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	14		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		TTTCTGCAGGGCGGCCATTGC	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	52.0	52.0					12																	68647221		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF279437	CCDS8982.1	12q15	2014-05-22			ENSG00000127318	ENSG00000127318		"""Interleukins and interleukin receptors"""	14900	protein-coding gene	gene with protein product	"""IL-10-related T-cell-derived inducible factor"""	605330				10954742, 10875937	Standard	NM_020525		Approved	ILTIF, IL-21, zcyto18, IL-TIF, IL-D110, TIFa, TIFIL-23, IL-22, MGC79382, MGC79384	uc001sty.1	Q9GZX6	OTTHUMG00000169119	ENST00000538666.1:c.8C>A	12.37:g.68647221G>T	ENSP00000442424:p.Ala3Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core,prints_Interleukin-22,prints_Interleukin-24	p.A3D	ENST00000538666.1	37	c.8	CCDS8982.1	12	.	.	.	.	.	.	.	.	.	.	G	9.217	1.032369	0.19590	.	.	ENSG00000127318	ENST00000538666;ENST00000328087	T;T	0.47528	0.84;0.84	5.31	2.45	0.29901	.	0.988525	0.08252	N	0.974510	T	0.45135	0.1327	L	0.47716	1.5	0.22961	N	0.998505	B	0.31859	0.343	B	0.38880	0.284	T	0.40924	-0.9537	9	.	.	.	-0.3775	8.3652	0.32382	0.2586:0.0:0.7414:0.0	.	3	Q9GZX6	IL22_HUMAN	D	3	ENSP00000442424:A3D;ENSP00000329384:A3D	.	A	-	2	0	IL22	66933488	0.352000	0.24895	0.421000	0.26609	0.007000	0.05969	0.512000	0.22755	0.431000	0.26258	-0.291000	0.09656	GCC	IL22	-	NULL	ENSG00000127318		0.532	IL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL22	HGNC	protein_coding	OTTHUMT00000402318.1	67	0.00	0	G	NM_020525		68647221	68647221	-1	no_errors	ENST00000328087	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	0.663	T
ITGB1	3688	genome.wustl.edu	37	10	33199265	33199265	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:33199265G>C	ENST00000396033.2	-	14	2185	c.2050C>G	c.(2050-2052)Caa>Gaa	p.Q684E	ITGB1_ENST00000302278.3_Missense_Mutation_p.Q684E|ITGB1_ENST00000423113.1_Missense_Mutation_p.Q684E|ITGB1_ENST00000374956.4_Missense_Mutation_p.Q684E	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	684					axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)	p.Q684E(2)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	GGATCAGGTTGGACCGGCTGG	0.428																																						dbGAP											2	Substitution - Missense(2)	breast(2)											62.0	56.0	58.0					10																	33199265		2202	4281	6483	-	-	-	SO:0001583	missense	0			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.2050C>G	10.37:g.33199265G>C	ENSP00000379350:p.Gln684Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.Q684E	ENST00000396033.2	37	c.2050	CCDS7174.1	10	.	.	.	.	.	.	.	.	.	.	G	0.250	-1.007045	0.02112	.	.	ENSG00000150093	ENST00000396033;ENST00000423113;ENST00000302278;ENST00000374956	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	5.58	4.65	0.58169	Integrin beta subunit, tail (2);	0.162066	0.56097	N	0.000030	D	0.85539	0.5720	M	0.62723	1.935	0.52501	D	0.999957	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.001	B;B;B;B;B	0.11329	0.004;0.006;0.002;0.003;0.004	T	0.79215	-0.1895	10	0.02654	T	1	.	16.3339	0.83052	0.0:0.1323:0.8677:0.0	.	684;684;684;684;684	P05556-2;P05556;P05556-5;P05556-3;P05556-4	.;ITB1_HUMAN;.;.;.	E	684	ENSP00000379350:Q684E;ENSP00000388694:Q684E;ENSP00000303351:Q684E;ENSP00000364094:Q684E	ENSP00000303351:Q684E	Q	-	1	0	ITGB1	33239271	1.000000	0.71417	0.905000	0.35620	0.182000	0.23217	4.524000	0.60552	1.340000	0.45581	0.555000	0.69702	CAA	ITGB1	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_tail,superfamily_Integrin_bsu_tail	ENSG00000150093		0.428	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGB1	HGNC	protein_coding	OTTHUMT00000047496.1	137	0.72	1	G	NM_002211		33199265	33199265	-1	no_errors	ENST00000374956	ensembl	human	known	69_37n	missense	89	33.08	44	SNP	1.000	C
IVL	3713	genome.wustl.edu	37	1	152883341	152883341	+	Silent	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:152883341G>T	ENST00000368764.3	+	2	1132	c.1068G>T	c.(1066-1068)ctG>ctT	p.L356L	IVL_ENST00000392667.2_Silent_p.L210L			P07476	INVO_HUMAN	involucrin	356	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.L356L(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			tggagcacctggagcaccagg	0.652																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											15.0	14.0	14.0					1																	152883341		2099	4119	6218	-	-	-	SO:0001819	synonymous_variant	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1068G>T	1.37:g.152883341G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7P4	Silent	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.L356	ENST00000368764.3	37	c.1068	CCDS1030.1	1																																																																																			IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.652	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	61	0.00	0	G	NM_005547		152883341	152883341	+1	no_errors	ENST00000368764	ensembl	human	known	69_37n	silent	63	12.50	9	SNP	0.007	T
ITLN1	55600	genome.wustl.edu	37	1	160850397	160850397	+	Silent	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:160850397A>G	ENST00000326245.3	-	6	781	c.666T>C	c.(664-666)taT>taC	p.Y222Y	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	222	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)	p.Y222Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			AGGGTGAGTAATAAGATGCTG	0.458																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											190.0	191.0	191.0					1																	160850397		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.666T>C	1.37:g.160850397A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Silent	SNP	superfamily_Fibrinogen_a/b/g_C	p.Y222	ENST00000326245.3	37	c.666	CCDS1211.1	1																																																																																			ITLN1	-	superfamily_Fibrinogen_a/b/g_C	ENSG00000179914		0.458	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN1	HGNC	protein_coding	OTTHUMT00000071462.1	114	0.00	0	A	NM_017625		160850397	160850397	-1	no_errors	ENST00000326245	ensembl	human	known	69_37n	silent	156	12.36	22	SNP	0.981	G
KDR	3791	genome.wustl.edu	37	4	55979642	55979642	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr4:55979642G>A	ENST00000263923.4	-	7	1100	c.805C>T	c.(805-807)Cat>Tat	p.H269Y		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	269	Ig-like C2-type 3.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.H269Y(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGTTTCTTATGCTGATGCTGA	0.388			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																												dbGAP		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	1	Substitution - Missense(1)	breast(1)											93.0	91.0	92.0					4																	55979642		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.805C>T	4.37:g.55979642G>A	ENSP00000263923:p.His269Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR2_rcpt,prints_Tyr_kinase_VEGFR_rcpt_N	p.H269Y	ENST00000263923.4	37	c.805	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	G	8.299	0.819452	0.16607	.	.	ENSG00000128052	ENST00000263923	T	0.65364	-0.15	5.15	4.25	0.50352	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.718627	0.13400	N	0.390741	T	0.55862	0.1947	L	0.51422	1.61	0.09310	N	1	P;P	0.39157	0.58;0.662	B;B	0.35039	0.048;0.194	T	0.55964	-0.8057	10	0.59425	D	0.04	.	13.6325	0.62204	0.0:0.2036:0.7964:0.0	.	269;269	P35968-2;P35968	.;VGFR2_HUMAN	Y	269	ENSP00000263923:H269Y	ENSP00000263923:H269Y	H	-	1	0	KDR	55674399	0.990000	0.36364	0.943000	0.38184	0.188000	0.23474	2.456000	0.44997	2.557000	0.86248	0.563000	0.77884	CAT	KDR	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000128052		0.388	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	215	0.46	1	G			55979642	55979642	-1	no_errors	ENST00000263923	ensembl	human	known	69_37n	missense	170	19.81	42	SNP	0.020	A
ZSWIM8	23053	genome.wustl.edu	37	10	75556956	75556956	+	Missense_Mutation	SNP	G	G	C	rs372585326		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:75556956G>C	ENST00000605216.1	+	17	3562	c.3345G>C	c.(3343-3345)ttG>ttC	p.L1115F	ZSWIM8_ENST00000604524.1_Missense_Mutation_p.L1115F|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.L1120F|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.L1082F|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.L1120F	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1115							zinc ion binding (GO:0008270)	p.L1120F(1)|p.L1115F(1)|p.L500F(1)									CTAGCCGCTTGGCACTTGGCA	0.572																																						dbGAP											3	Substitution - Missense(3)	breast(3)											42.0	42.0	42.0					10																	75556956		1882	4118	6000	-	-	-	SO:0001583	missense	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3345G>C	10.37:g.75556956G>C	ENSP00000474748:p.Leu1115Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.L1120F	ENST00000605216.1	37	c.3360		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.47|15.47|15.47	2.841877|2.841877|2.841877	0.51057|0.51057|0.51057	.|.|.	.|.|.	ENSG00000214655|ENSG00000214655|ENSG00000214655	ENST00000433366|ENST00000398706|ENST00000412198	.|T|.	.|0.49432|.	.|0.78|.	4.78|4.78|4.78	3.86|3.86|3.86	0.44501|0.44501|0.44501	.|.|.	.|0.483471|.	.|0.16215|.	.|U|.	.|0.224309|.	T|T|T	0.65091|0.65091|0.65091	0.2658|0.2658|0.2658	M|M|M	0.71036|0.71036|0.71036	2.16|2.16|2.16	0.46317|0.46317|0.46317	D|D|D	0.99898|0.99898|0.99898	.|D;D;D;D|.	.|0.76494|.	.|0.999;0.998;0.999;0.999|.	.|D;D;D;D|.	.|0.80764|.	.|0.994;0.961;0.994;0.994|.	T|T|T	0.64028|0.64028|0.64028	-0.6503|-0.6503|-0.6503	5|10|5	.|0.40728|.	.|T|.	.|0.16|.	-3.3352|-3.3352|-3.3352	9.6516|9.6516|9.6516	0.39902|0.39902|0.39902	0.1703:0.0:0.8297:0.0|0.1703:0.0:0.8297:0.0|0.1703:0.0:0.8297:0.0	.|.|.	.|1115;1127;1115;1120|.	.|A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4|.	.|K0913_HUMAN;.;.;.|.	R|F|S	831|1120|390	.|ENSP00000381693:L1120F|.	.|ENSP00000381693:L1120F|.	G|L|W	+|+|+	1|3|2	0|2|0	KIAA0913|KIAA0913|KIAA0913	75226962|75226962|75226962	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.986000|0.986000|0.986000	0.45419|0.45419|0.45419	0.941000|0.941000|0.941000	0.58515|0.58515|0.58515	4.334000|4.334000|4.334000	0.59291|0.59291|0.59291	1.208000|1.208000|1.208000	0.43306|0.43306|0.43306	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GGC|TTG|TGG	KIAA0913	-	NULL	ENSG00000214655		0.572	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	60	0.00	0	G	NM_001242487		75556956	75556956	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	missense	87	19.44	21	SNP	1.000	C
KRTAP6-1	337966	genome.wustl.edu	37	21	31986039	31986039	+	Missense_Mutation	SNP	C	C	A	rs144374144		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr21:31986039C>A	ENST00000329122.2	-	1	210	c.185G>T	c.(184-186)gGa>gTa	p.G62V	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	62						cytosol (GO:0005829)|intermediate filament (GO:0005882)		p.G62V(1)		breast(2)|endometrium(1)|lung(7)	10						AGAGCCGCATCCATAGCCATA	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	100.0	99.0					21																	31986039		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.185G>T	21.37:g.31986039C>A	ENSP00000332690:p.Gly62Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G62V	ENST00000329122.2	37	c.185	CCDS13602.1	21	.	.	.	.	.	.	.	.	.	.	C	7.491	0.650735	0.14516	.	.	ENSG00000184724	ENST00000329122	T	0.21543	2.0	4.22	3.32	0.38043	.	0.428672	0.17005	U	0.190723	T	0.38081	0.1027	.	.	.	0.40666	D	0.982171	D	0.67145	0.996	P	0.58721	0.844	T	0.30736	-0.9968	9	0.87932	D	0	.	10.0845	0.42410	0.0:0.7954:0.2046:0.0	.	62	Q3LI64	KRA61_HUMAN	V	62	ENSP00000332690:G62V	ENSP00000332690:G62V	G	-	2	0	KRTAP6-1	30907910	0.996000	0.38824	0.689000	0.30133	0.612000	0.37316	3.246000	0.51414	1.103000	0.41568	0.643000	0.83706	GGA	KRTAP6-1	-	NULL	ENSG00000184724		0.562	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP6-1	HGNC	protein_coding	OTTHUMT00000128240.2	252	0.40	1	C	NM_181602		31986039	31986039	-1	no_errors	ENST00000329122	ensembl	human	known	69_37n	missense	87	26.89	32	SNP	0.865	A
LGALS3	3958	genome.wustl.edu	37	14	55605046	55605046	+	Missense_Mutation	SNP	A	A	C	rs200922957		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr14:55605046A>C	ENST00000254301.9	+	3	563	c.302A>C	c.(301-303)tAc>tCc	p.Y101S	LGALS3_ENST00000553755.1_3'UTR|LGALS3_ENST00000554715.1_Missense_Mutation_p.Y101S	NM_002306.3	NP_002297.2	P17931	LEG3_HUMAN	lectin, galactoside-binding, soluble, 3	101	8 X 9 AA tandem repeats of Y-P-G-X(3)-P- G-A.				eosinophil chemotaxis (GO:0048245)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|mononuclear cell migration (GO:0071674)|mRNA processing (GO:0006397)|negative regulation of endocytosis (GO:0045806)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of immunological synapse formation (GO:2000521)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell receptor signaling pathway (GO:0050860)|neutrophil chemotaxis (GO:0030593)|positive chemotaxis (GO:0050918)|positive regulation of calcium ion import (GO:0090280)|positive regulation of mononuclear cell migration (GO:0071677)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of T cell apoptotic process (GO:0070232)|regulation of T cell proliferation (GO:0042129)|RNA splicing (GO:0008380)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)	carbohydrate binding (GO:0030246)|chemoattractant activity (GO:0042056)|IgE binding (GO:0019863)|laminin binding (GO:0043236)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|prostate(1)	3						ACCGGAGCCTACCCTGCCACT	0.632																																						dbGAP											0													17.0	19.0	19.0					14																	55605046		1597	3768	5365	-	-	-	SO:0001583	missense	0			M64303	CCDS41956.1	14q22.3	2014-03-19	2007-02-01		ENSG00000131981	ENSG00000131981		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6563	protein-coding gene	gene with protein product	"""galectin 3"""	153619		LGALS2		2009535, 8063692	Standard	NR_003225		Approved	MAC-2, GALIG	uc001xbr.3	P17931	OTTHUMG00000171030	ENST00000254301.9:c.302A>C	14.37:g.55605046A>C	ENSP00000254301:p.Tyr101Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC38|Q16005|Q6IBA7|Q96J47	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.Y101S	ENST00000254301.9	37	c.302	CCDS41956.1	14	.	.	.	.	.	.	.	.	.	.	A	13.28	2.189784	0.38707	.	.	ENSG00000131981	ENST00000254301;ENST00000554715	T;T	0.08896	3.69;3.04	4.96	4.96	0.65561	.	0.532662	0.21089	N	0.080359	T	0.12987	0.0315	N	0.14661	0.345	0.33379	D	0.574625	D	0.71674	0.998	D	0.80764	0.994	T	0.28038	-1.0056	10	0.23302	T	0.38	-5.3912	12.1652	0.54125	1.0:0.0:0.0:0.0	.	101	P17931	LEG3_HUMAN	S	101	ENSP00000254301:Y101S;ENSP00000451381:Y101S	ENSP00000254301:Y101S	Y	+	2	0	LGALS3	54674799	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	3.173000	0.50839	1.871000	0.54225	0.533000	0.62120	TAC	LGALS3	-	NULL	ENSG00000131981		0.632	LGALS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3	HGNC	protein_coding	OTTHUMT00000411309.1	8	0.00	0	A	NM_002306		55605046	55605046	+1	no_errors	ENST00000254301	ensembl	human	known	69_37n	missense	3	66.67	6	SNP	1.000	C
LIMA1	51474	genome.wustl.edu	37	12	50571618	50571618	+	Silent	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr12:50571618G>T	ENST00000341247.4	-	11	1658	c.1509C>A	c.(1507-1509)gtC>gtA	p.V503V	LIMA1_ENST00000552909.1_Silent_p.V342V|LIMA1_ENST00000394943.3_Silent_p.V504V|LIMA1_ENST00000552783.1_Silent_p.V344V|LIMA1_ENST00000547825.1_Silent_p.V201V|LIMA1_ENST00000552823.1_Silent_p.V343V|LIMA1_ENST00000552491.1_Silent_p.V200V	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	503					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)	p.V503V(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						TTGCAGCCAGGACACCCACCT	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											123.0	120.0	121.0					12																	50571618		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.1509C>A	12.37:g.50571618G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.V504	ENST00000341247.4	37	c.1512	CCDS8802.1	12																																																																																			LIMA1	-	NULL	ENSG00000050405		0.562	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	144	0.00	0	G	NM_016357		50571618	50571618	-1	no_errors	ENST00000394943	ensembl	human	known	69_37n	silent	126	21.74	35	SNP	0.999	T
LRRC29	26231	genome.wustl.edu	37	16	67241593	67241593	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr16:67241593A>C	ENST00000409037.1	-	4	1483	c.587T>G	c.(586-588)gTc>gGc	p.V196G	LRRC29_ENST00000462169.1_5'Flank|LRRC29_ENST00000341546.3_Missense_Mutation_p.V196G|LRRC29_ENST00000409509.1_Missense_Mutation_p.V196G|LRRC29_ENST00000393992.1_Missense_Mutation_p.V196G			Q8WV35	LRC29_HUMAN	leucine rich repeat containing 29	196								p.V196G(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GAAGCGTCTGACGGCGGCCAT	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	48.0	50.0					16																	67241593		2198	4299	6497	-	-	-	SO:0001583	missense	0			AF176701	CCDS32465.1	16q22.1	2008-02-05	2004-08-23	2004-08-26	ENSG00000125122	ENSG00000125122			13605	protein-coding gene	gene with protein product			"""F-box and leucine-rich repeat protein 9"""	FBXL9		10531037	Standard	NM_012163		Approved	FBL9	uc002esf.3	Q8WV35	OTTHUMG00000154403	ENST00000409037.1:c.587T>G	16.37:g.67241593A>C	ENSP00000387318:p.Val196Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE92|Q9UKA0	Missense_Mutation	SNP	smart_Leu-rich_rpt_Cys-con_subtyp	p.V196G	ENST00000409037.1	37	c.587	CCDS32465.1	16	.	.	.	.	.	.	.	.	.	.	A	11.66	1.704309	0.30232	.	.	ENSG00000125122	ENST00000409509;ENST00000393992;ENST00000409037;ENST00000341546;ENST00000433915	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;2.8	5.06	5.06	0.68205	.	0.727099	0.12629	N	0.452372	T	0.43411	0.1246	M	0.79926	2.475	0.46317	D	0.998986	P	0.38642	0.641	B	0.42653	0.394	T	0.45687	-0.9244	10	0.87932	D	0	.	11.2032	0.48754	1.0:0.0:0.0:0.0	.	196	Q8WV35	LRC29_HUMAN	G	196;196;196;196;148	ENSP00000386622:V196G;ENSP00000377561:V196G;ENSP00000387318:V196G;ENSP00000344364:V196G;ENSP00000413129:V148G	ENSP00000344364:V196G	V	-	2	0	LRRC29	65799094	0.999000	0.42202	0.900000	0.35374	0.182000	0.23217	5.466000	0.66731	1.917000	0.55516	0.418000	0.28097	GTC	LRRC29	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000125122		0.642	LRRC29-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC29	HGNC	protein_coding	OTTHUMT00000335073.1	42	0.00	0	A	NM_012163		67241593	67241593	-1	no_errors	ENST00000341546	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.976	C
LRRC49	54839	genome.wustl.edu	37	15	71211475	71211475	+	Silent	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr15:71211475T>C	ENST00000260382.5	+	7	914	c.654T>C	c.(652-654)ctT>ctC	p.L218L	LRRC49_ENST00000443425.2_Silent_p.L174L|LRRC49_ENST00000560369.1_Silent_p.L223L|LRRC49_ENST00000544974.2_Silent_p.L208L|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560691.1_5'UTR	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	218						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.L218L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TTGATAATCTTAATGGGCTGG	0.313																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											131.0	136.0	134.0					15																	71211475		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.654T>C	15.37:g.71211475T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L218	ENST00000260382.5	37	c.654	CCDS32282.1	15																																																																																			LRRC49	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000137821		0.313	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRC49	HGNC	protein_coding	OTTHUMT00000417209.3	319	0.31	1	T	NM_017691		71211475	71211475	+1	no_errors	ENST00000260382	ensembl	human	known	69_37n	silent	194	26.79	71	SNP	1.000	C
MACF1	23499	genome.wustl.edu	37	1	39907664	39907664	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:39907664G>A	ENST00000372915.3	+	74	18497	c.18410G>A	c.(18409-18411)tGc>tAc	p.C6137Y	MACF1_ENST00000564288.1_Missense_Mutation_p.C6238Y|MACF1_ENST00000289893.4_Missense_Mutation_p.C4681Y|MACF1_ENST00000317713.7_Missense_Mutation_p.C4179Y|MACF1_ENST00000545844.1_Missense_Mutation_p.C4179Y|MACF1_ENST00000539005.1_Missense_Mutation_p.C4049Y|MACF1_ENST00000567887.1_Missense_Mutation_p.C6275Y|MACF1_ENST00000361689.2_Missense_Mutation_p.C4179Y			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6137					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.C4179Y(1)|p.C4681Y(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATTAAACTCTGCACCATGCCC	0.378																																						dbGAP											2	Substitution - Missense(2)	breast(2)											144.0	132.0	136.0					1																	39907664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18410G>A	1.37:g.39907664G>A	ENSP00000362006:p.Cys6137Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.C4179Y	ENST00000372915.3	37	c.12536		1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252126	0.59212	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.50548	1.38;0.74;1.38;1.38;1.38;0.74	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000001	T	0.62282	0.2415	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.87578	0.998;0.946	T	0.62421	-0.6858	10	0.56958	D	0.05	.	19.6758	0.95932	0.0:0.0:1.0:0.0	.	6137;4179	Q9UPN3;F8W8Q1	MACF1_HUMAN;.	Y	4179;6137;4179;4179;4049;4681	ENSP00000439537:C4179Y;ENSP00000362006:C6137Y;ENSP00000354573:C4179Y;ENSP00000313438:C4179Y;ENSP00000444364:C4049Y;ENSP00000289893:C4681Y	ENSP00000289893:C4681Y	C	+	2	0	MACF1	39680251	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.411000	0.66386	2.644000	0.89710	0.561000	0.74099	TGC	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.378	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	304	0.00	0	G	NM_033044		39907664	39907664	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	207	18.50	47	SNP	1.000	A
MCOLN1	57192	genome.wustl.edu	37	19	7592840	7592840	+	Silent	SNP	C	C	T	rs113261161	byFrequency	TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:7592840C>T	ENST00000264079.6	+	6	896	c.771C>T	c.(769-771)agC>agT	p.S257S		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	257					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						ATACCTTCAGCGTCCTGGTGA	0.597																																						dbGAP											0													54.0	55.0	54.0					19																	7592840		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.771C>T	19.37:g.7592840C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	pfam_PKD1_2_channel,superfamily_Glycoside_hydrolase_SF	p.S257	ENST00000264079.6	37	c.771	CCDS12180.1	19																																																																																			MCOLN1	-	NULL	ENSG00000090674		0.597	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN1	HGNC	protein_coding	OTTHUMT00000458974.2	58	0.00	0	C	NM_020533		7592840	7592840	+1	no_errors	ENST00000264079	ensembl	human	known	69_37n	silent	64	13.51	10	SNP	0.721	T
MMP9	4318	genome.wustl.edu	37	20	44639873	44639873	+	Silent	SNP	C	C	T	rs200792951		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr20:44639873C>T	ENST00000372330.3	+	5	760	c.741C>T	c.(739-741)gaC>gaT	p.D247D	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	247	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D247D(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	GCACCACCGACGGTCGCTCCG	0.647																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											77.0	81.0	80.0					20																	44639873		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.741C>T	20.37:g.44639873C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin/matrixin_repeat,pfam_PT,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin/matrixin_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A_matrixin	p.D247	ENST00000372330.3	37	c.741	CCDS13390.1	20																																																																																			MMP9	-	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	ENSG00000100985		0.647	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP9	HGNC	protein_coding	OTTHUMT00000080337.1	21	0.00	0	C			44639873	44639873	+1	no_errors	ENST00000372330	ensembl	human	known	69_37n	silent	24	22.58	7	SNP	1.000	T
MYH10	4628	genome.wustl.edu	37	17	8396156	8396156	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr17:8396156C>T	ENST00000269243.4	-	31	4441	c.4303G>A	c.(4303-4305)Gac>Aac	p.D1435N	MYH10_ENST00000360416.3_Missense_Mutation_p.D1466N|MYH10_ENST00000396239.1_Missense_Mutation_p.D1456N|MYH10_ENST00000379980.4_Missense_Mutation_p.D1451N	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1435					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.D1435N(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TGGTCCAGGTCCACCGTGAGG	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											75.0	66.0	69.0					17																	8396156		2203	4300	6503	-	-	-	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.4303G>A	17.37:g.8396156C>T	ENSP00000269243:p.Asp1435Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1456N	ENST00000269243.4	37	c.4366	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549894	0.86127	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.31	5.31	0.75309	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.85106	0.5621	M	0.82056	2.57	0.80722	D	1	B;B;B	0.21452	0.056;0.045;0.056	B;B;B	0.33750	0.169;0.105;0.169	D	0.83601	0.0128	10	0.87932	D	0	.	19.1704	0.93575	0.0:1.0:0.0:0.0	.	1444;1466;1435	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	N	1435;1466;1456;1451	ENSP00000269243:D1435N;ENSP00000353590:D1466N;ENSP00000379539:D1456N;ENSP00000369315:D1451N	ENSP00000269243:D1435N	D	-	1	0	MYH10	8336881	1.000000	0.71417	0.999000	0.59377	0.881000	0.50899	7.609000	0.82925	2.755000	0.94549	0.650000	0.86243	GAC	MYH10	-	pfam_Myosin_tail	ENSG00000133026		0.617	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	47	0.00	0	C			8396156	8396156	-1	no_errors	ENST00000396239	ensembl	human	known	69_37n	missense	15	65.91	29	SNP	1.000	T
MYH9	4627	genome.wustl.edu	37	22	36689868	36689868	+	Silent	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr22:36689868G>A	ENST00000216181.5	-	29	4109	c.3879C>T	c.(3877-3879)gaC>gaT	p.D1293D		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1293					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.D1293D(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TGGACTTGCTGTCGGACTGGC	0.652			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - coding silent(1)	breast(1)											62.0	56.0	58.0					22																	36689868		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.3879C>T	22.37:g.36689868G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.D1293	ENST00000216181.5	37	c.3879	CCDS13927.1	22																																																																																			MYH9	-	pfam_Myosin_tail	ENSG00000100345		0.652	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	68	0.00	0	G	NM_002473		36689868	36689868	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	silent	39	20.41	10	SNP	1.000	A
MYL12B	103910	genome.wustl.edu	37	18	3277358	3277358	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr18:3277358G>T	ENST00000581193.1	+	3	675	c.292G>T	c.(292-294)Gat>Tat	p.D98Y	MYL12B_ENST00000584539.1_Missense_Mutation_p.D98Y|MYL12B_ENST00000237500.5_Missense_Mutation_p.D98Y|MYL12B_ENST00000400175.5_Missense_Mutation_p.D98Y	NM_001144945.1	NP_001138417.1	O14950	ML12B_HUMAN	myosin, light chain 12B, regulatory	98	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|regulation of cell shape (GO:0008360)	apical part of cell (GO:0045177)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)	p.D98Y(1)		breast(1)|large_intestine(1)|lung(2)	4						AAATGGCACAGATCCTGAAGA	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											135.0	117.0	123.0					18																	3277358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY320408	CCDS11831.1	18p11.31	2013-01-10			ENSG00000118680	ENSG00000118680		"""Myosins / Light chain"", ""EF-hand domain containing"""	29827	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2"""	609211				11942626	Standard	NM_033546		Approved	MRLC2	uc002klt.4	O14950	OTTHUMG00000131510	ENST00000581193.1:c.292G>T	18.37:g.3277358G>T	ENSP00000463559:p.Asp98Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUH6|Q13182|Q7Z5Z4	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D98Y	ENST00000581193.1	37	c.292	CCDS11831.1	18	.	.	.	.	.	.	.	.	.	.	G	32	5.131253	0.94473	.	.	ENSG00000118680	ENST00000237500;ENST00000400177;ENST00000400175;ENST00000400174	T;T	0.72167	-0.63;-0.63	5.87	5.87	0.94306	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89805	0.6821	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91610	0.5302	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	98	O14950	ML12B_HUMAN	Y	98	ENSP00000237500:D98Y;ENSP00000383037:D98Y	ENSP00000237500:D98Y	D	+	1	0	MYL12B	3267358	1.000000	0.71417	0.849000	0.33467	0.980000	0.70556	9.724000	0.98775	2.941000	0.99782	0.655000	0.94253	GAT	MYL12B	-	pfscan_EF_HAND_2	ENSG00000118680		0.448	MYL12B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYL12B	HGNC	protein_coding	OTTHUMT00000258908.1	123	0.00	0	G	NM_033546		3277358	3277358	+1	no_errors	ENST00000237500	ensembl	human	known	69_37n	missense	104	21.21	28	SNP	1.000	T
NEK10	152110	genome.wustl.edu	37	3	27394317	27394317	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:27394317T>G	ENST00000429845.2	-	3	419	c.57A>C	c.(55-57)caA>caC	p.Q19H	NEK10_ENST00000341435.5_Missense_Mutation_p.Q19H			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	19					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q19H(3)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TGGTGATTTCTTGCTGTTTAT	0.368																																						dbGAP											3	Substitution - Missense(3)	breast(3)											191.0	162.0	171.0					3																	27394317		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.57A>C	3.37:g.27394317T>G	ENSP00000395849:p.Gln19His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Aminoglycoside_PTrfase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q19H	ENST00000429845.2	37	c.57		3	.	.	.	.	.	.	.	.	.	.	T	12.79	2.042638	0.35989	.	.	ENSG00000163491	ENST00000341435;ENST00000396636;ENST00000435750;ENST00000429845	T;T;T	0.70399	-0.4;1.48;-0.48	5.67	3.23	0.37069	Armadillo-like helical (1);	0.502444	0.18901	N	0.128040	T	0.40595	0.1123	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18681	-1.0329	10	0.66056	D	0.02	.	5.093	0.14718	0.1334:0.1501:0.0:0.7165	.	19	Q6ZWH5	NEK10_HUMAN	H	19	ENSP00000343847:Q19H;ENSP00000395338:Q19H;ENSP00000395849:Q19H	ENSP00000343847:Q19H	Q	-	3	2	NEK10	27369321	1.000000	0.71417	0.976000	0.42696	0.801000	0.45260	1.588000	0.36633	0.391000	0.25143	0.533000	0.62120	CAA	NEK10	-	NULL	ENSG00000163491		0.368	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	HGNC	protein_coding	OTTHUMT00000438156.1	385	0.00	0	T	NM_152534		27394317	27394317	-1	no_errors	ENST00000341435	ensembl	human	known	69_37n	missense	283	31.48	130	SNP	0.993	G
NFATC3	4775	genome.wustl.edu	37	16	68156087	68156087	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr16:68156087G>C	ENST00000346183.3	+	2	325	c.301G>C	c.(301-303)Ggt>Cgt	p.G101R	RP11-67A1.2_ENST00000548144.1_RNA|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Missense_Mutation_p.G101R|NFATC3_ENST00000329524.4_Missense_Mutation_p.G101R|NFATC3_ENST00000349223.5_Missense_Mutation_p.G101R	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	101					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G101R(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		TAGCCCATTAGGTGGTCCCAA	0.393																																						dbGAP											2	Substitution - Missense(2)	breast(2)											116.0	106.0	110.0					16																	68156087		2198	4300	6498	-	-	-	SO:0001583	missense	0			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.301G>C	16.37:g.68156087G>C	ENSP00000300659:p.Gly101Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.G101R	ENST00000346183.3	37	c.301	CCDS10860.1	16	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027677	0.35797	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524	T;T;T	0.10005	2.92;2.93;2.93	5.5	0.0723	0.14386	.	0.415940	0.27345	N	0.019800	T	0.11024	0.0269	M	0.73217	2.22	0.33678	D	0.611788	B;P;B;B	0.42757	0.368;0.789;0.368;0.368	B;B;B;B	0.38106	0.244;0.265;0.244;0.244	T	0.15178	-1.0446	10	0.72032	D	0.01	-2.1074	5.9199	0.19076	0.3196:0.0:0.5651:0.1153	.	101;101;101;101	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	R	101	ENSP00000264008:G101R;ENSP00000300659:G101R;ENSP00000331324:G101R	ENSP00000331324:G101R	G	+	1	0	NFATC3	66713588	1.000000	0.71417	0.996000	0.52242	0.951000	0.60555	3.122000	0.50446	-0.097000	0.12307	-0.252000	0.11476	GGT	NFATC3	-	NULL	ENSG00000072736		0.393	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC3	HGNC	protein_coding	OTTHUMT00000268890.2	210	0.00	0	G	NM_004555		68156087	68156087	+1	no_errors	ENST00000346183	ensembl	human	known	69_37n	missense	173	20.64	45	SNP	1.000	C
NRD1	4898	genome.wustl.edu	37	1	52344078	52344078	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:52344078C>G	ENST00000354831.7	-	1	399	c.210G>C	c.(208-210)caG>caC	p.Q70H	NRD1_ENST00000539524.1_5'Flank|NRD1_ENST00000352171.7_Missense_Mutation_p.Q70H|NRD1_ENST00000544028.1_Intron	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	70					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.Q70H(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CGCCCAGATCCTGTCCATTGG	0.592																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	65.0	64.0					1																	52344078		2203	4300	6503	-	-	-	SO:0001583	missense	0			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.210G>C	1.37:g.52344078C>G	ENSP00000346890:p.Gln70His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.Q70H	ENST00000354831.7	37	c.210	CCDS559.1	1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294451	0.60086	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000546169	T;T	0.37235	1.33;1.21	5.17	4.26	0.50523	.	0.195266	0.36066	N	0.002811	T	0.31167	0.0788	N	0.22421	0.69	0.80722	D	1	D;P;P	0.53745	0.962;0.838;0.838	P;B;B	0.49276	0.605;0.276;0.276	T	0.03555	-1.1025	10	0.35671	T	0.21	-5.6179	11.5753	0.50858	0.0:0.914:0.0:0.086	.	70;70;70	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	H	70	ENSP00000262679:Q70H;ENSP00000346890:Q70H	ENSP00000262679:Q70H	Q	-	3	2	NRD1	52116666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.598000	0.36740	1.419000	0.47118	0.650000	0.86243	CAG	NRD1	-	NULL	ENSG00000078618		0.592	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	HGNC	protein_coding	OTTHUMT00000023045.1	65	0.00	0	C	NM_002525		52344078	52344078	-1	no_errors	ENST00000354831	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	G
NRF1	4899	genome.wustl.edu	37	7	129297253	129297253	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr7:129297253C>T	ENST00000393232.1	+	2	179	c.62C>T	c.(61-63)gCc>gTc	p.A21V	NRF1_ENST00000223190.4_Missense_Mutation_p.A21V|NRF1_ENST00000539636.1_5'UTR|NRF1_ENST00000393230.2_Missense_Mutation_p.A21V|NRF1_ENST00000393231.3_Missense_Mutation_p.A21V|NRF1_ENST00000311967.2_Missense_Mutation_p.A21V|NRF1_ENST00000353868.4_Missense_Mutation_p.A21V	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	21	Dimerization.				cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.A21V(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						CATGCAGTGGCCCAGCAAGTG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	108.0	112.0					7																	129297253		2203	4300	6503	-	-	-	SO:0001583	missense	0			L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.62C>T	7.37:g.129297253C>T	ENSP00000376924:p.Ala21Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	pfam_Nrf1_NLS/DNA-bd_dimer,pfam_Nrf1_activation-bd	p.A21V	ENST00000393232.1	37	c.62	CCDS5813.2	7	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534830	0.64972	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000454688;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	.	.	.	5.53	5.53	0.82687	.	0.145912	0.64402	D	0.000009	T	0.41465	0.1160	N	0.08118	0	0.80722	D	1	B;B	0.29531	0.247;0.079	B;B	0.28139	0.086;0.014	T	0.40534	-0.9558	9	0.51188	T	0.08	-21.2276	18.4511	0.90704	0.0:1.0:0.0:0.0	.	21;21	Q96AN2;Q16656	.;NRF1_HUMAN	V	21	.	ENSP00000223190:A21V	A	+	2	0	NRF1	129084489	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.246000	0.58740	2.617000	0.88574	0.585000	0.79938	GCC	NRF1	-	NULL	ENSG00000106459		0.488	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	NRF1	HGNC	protein_coding	OTTHUMT00000289813.1	83	0.00	0	C	NM_001040110		129297253	129297253	+1	no_errors	ENST00000393231	ensembl	human	known	69_37n	missense	59	19.18	14	SNP	1.000	T
ODF2	4957	genome.wustl.edu	37	9	131247725	131247725	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr9:131247725C>A	ENST00000434106.3	+	13	1735	c.1372C>A	c.(1372-1374)Ctt>Att	p.L458I	ODF2_ENST00000448249.3_Missense_Mutation_p.L377I|ODF2_ENST00000372807.5_Missense_Mutation_p.L453I|ODF2_ENST00000372791.3_Missense_Mutation_p.L439I|ODF2_ENST00000604420.1_Missense_Mutation_p.L458I|ODF2_ENST00000351030.3_Missense_Mutation_p.L453I|ODF2_ENST00000393533.2_Missense_Mutation_p.L458I|ODF2_ENST00000372814.3_Missense_Mutation_p.L502I|ODF2_ENST00000393527.3_Missense_Mutation_p.L434I|ODF2_ENST00000546203.1_Missense_Mutation_p.L439I|ODF2_ENST00000444119.2_Missense_Mutation_p.L434I	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	458					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.L458I(1)|p.L434I(1)|p.L502I(1)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						AAAGGGAGACCTTGAGCTGGA	0.498																																						dbGAP											3	Substitution - Missense(3)	breast(3)											83.0	73.0	77.0					9																	131247725		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1372C>A	9.37:g.131247725C>A	ENSP00000403453:p.Leu458Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	NULL	p.L458I	ENST00000434106.3	37	c.1372	CCDS56588.1	9	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281157	0.80692	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;1.39;0.91;0.91;0.91	5.58	5.58	0.84498	.	0.136685	0.50627	D	0.000101	T	0.58652	0.2137	L	0.55481	1.735	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.992;0.996;0.996;1.0;0.998;0.998	D;D;D;P;D;D;D;D;D	0.77004	0.989;0.968;0.989;0.756;0.947;0.947;0.989;0.92;0.941	T	0.59085	-0.7520	10	0.62326	D	0.03	-9.7172	13.1358	0.59409	0.16:0.84:0.0:0.0	.	439;453;377;392;458;502;439;458;434	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;ODFP2_HUMAN;.	I	458;502;453;458;434;377;439;439	ENSP00000377166:L458I;ENSP00000361901:L502I;ENSP00000342581:L453I;ENSP00000361882:L458I;ENSP00000307781:L434I;ENSP00000396687:L377I;ENSP00000437579:L439I;ENSP00000361877:L439I	ENSP00000307781:L434I	L	+	1	0	ODF2	130287546	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	3.060000	0.49955	2.641000	0.89580	0.561000	0.74099	CTT	ODF2	-	NULL	ENSG00000136811		0.498	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3	181	0.00	0	C			131247725	131247725	+1	no_errors	ENST00000372796	ensembl	human	known	69_37n	missense	88	21.43	24	SNP	0.998	A
OR2AE1	81392	genome.wustl.edu	37	7	99474106	99474106	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr7:99474106A>C	ENST00000316368.2	-	1	574	c.551T>G	c.(550-552)gTt>gGt	p.V184G		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V184G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CAACTTCACAACAGCTGGGAA	0.498																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	116.0	121.0					7																	99474106		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.551T>G	7.37:g.99474106A>C	ENSP00000313936:p.Val184Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPD2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V184G	ENST00000316368.2	37	c.551	CCDS34696.1	7	.	.	.	.	.	.	.	.	.	.	A	14.07	2.424913	0.43020	.	.	ENSG00000244623	ENST00000316368	T	0.00245	8.45	3.62	2.43	0.29744	GPCR, rhodopsin-like superfamily (1);	0.722768	0.11350	N	0.573105	T	0.00580	0.0019	M	0.92738	3.34	0.09310	N	0.999997	D	0.62365	0.991	P	0.59424	0.857	T	0.39663	-0.9603	10	0.87932	D	0	.	7.7889	0.29108	0.8133:0.0:0.0:0.1867	.	184	Q8NHA4	O2AE1_HUMAN	G	184	ENSP00000313936:V184G	ENSP00000313936:V184G	V	-	2	0	OR2AE1	99312042	0.092000	0.21681	0.007000	0.13788	0.497000	0.33675	3.749000	0.55150	0.719000	0.32188	0.405000	0.27470	GTT	OR2AE1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000244623		0.498	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AE1	HGNC	protein_coding	OTTHUMT00000345053.1	83	0.00	0	A			99474106	99474106	-1	no_errors	ENST00000316368	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	0.010	C
OR2M2	391194	genome.wustl.edu	37	1	248343859	248343859	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:248343859A>G	ENST00000359682.2	+	1	572	c.572A>G	c.(571-573)gAc>gGc	p.D191G		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D191G(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCATGCAATGACACATCAATA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											231.0	225.0	227.0					1																	248343859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.572A>G	1.37:g.248343859A>G	ENSP00000352710:p.Asp191Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFT4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D191G	ENST00000359682.2	37	c.572	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	a	11.91	1.778621	0.31502	.	.	ENSG00000198601	ENST00000359682	T	0.00262	8.4	1.88	1.88	0.25563	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32372	U	0.006198	T	0.00440	0.0014	M	0.92604	3.325	0.09310	N	1	P	0.46142	0.873	P	0.51945	0.685	T	0.28586	-1.0039	10	0.87932	D	0	.	5.1532	0.15021	0.8465:0.0:0.1535:0.0	.	191	Q96R28	OR2M2_HUMAN	G	191	ENSP00000352710:D191G	ENSP00000352710:D191G	D	+	2	0	OR2M2	246410482	0.000000	0.05858	0.006000	0.13384	0.018000	0.09664	1.048000	0.30379	0.873000	0.35799	0.373000	0.22412	GAC	OR2M2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000198601		0.408	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	HGNC	protein_coding	OTTHUMT00000097356.2	305	0.00	0	A	NM_001004688		248343859	248343859	+1	no_errors	ENST00000359682	ensembl	human	known	69_37n	missense	436	12.10	60	SNP	0.003	G
OR4C12	283093	genome.wustl.edu	37	11	50003128	50003129	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr11:50003128_50003129insT	ENST00000335238.4	-	1	942_943	c.909_910insA	c.(907-912)aaagtgfs	p.V304fs		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						TCTGAAGTCACTTTTTTTCTCC	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.910dupA	11.37:g.50003135_50003135dupT	ENSP00000334418:p.Val304fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNF0|Q6IF49	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V303fs	ENST00000335238.4	37	c.910_909	CCDS31496.1	11																																																																																			OR4C12	-	NULL	ENSG00000221954		0.347	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	HGNC	protein_coding	OTTHUMT00000391104.1	101	0.00	0	-	NM_001005270		50003128	50003129	-1	no_errors	ENST00000335238	ensembl	human	known	69_37n	frame_shift_ins	141	11.88	19	INS	0.980:0.987	T
OR7D4	125958	genome.wustl.edu	37	19	9324928	9324928	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:9324928T>A	ENST00000308682.2	-	1	614	c.586A>T	c.(586-588)Aac>Tac	p.N196Y		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N196Y(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						AAGACAATGTTATTGAGGAGG	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	100.0	102.0					19																	9324928		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.586A>T	19.37:g.9324928T>A	ENSP00000310488:p.Asn196Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N196Y	ENST00000308682.2	37	c.586	CCDS32901.1	19	.	.	.	.	.	.	.	.	.	.	T	8.883	0.952191	0.18431	.	.	ENSG00000174667	ENST00000308682	T	0.00145	8.67	4.0	-1.18	0.09617	GPCR, rhodopsin-like superfamily (1);	0.625201	0.15773	N	0.245331	T	0.00144	0.0004	M	0.65677	2.01	0.09310	N	1	B	0.20459	0.045	B	0.27262	0.078	T	0.42258	-0.9462	10	0.44086	T	0.13	.	1.5397	0.02553	0.1607:0.373:0.1649:0.3014	.	196	Q8NG98	OR7D4_HUMAN	Y	196	ENSP00000310488:N196Y	ENSP00000310488:N196Y	N	-	1	0	OR7D4	9185928	0.003000	0.15002	0.000000	0.03702	0.005000	0.04900	0.148000	0.16224	-0.074000	0.12820	0.358000	0.22013	AAC	OR7D4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174667		0.512	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	HGNC	protein_coding	OTTHUMT00000449004.1	67	0.00	0	T			9324928	9324928	-1	no_errors	ENST00000308682	ensembl	human	known	69_37n	missense	60	30.23	26	SNP	0.000	A
PAK2	5062	genome.wustl.edu	37	3	196509620	196509620	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:196509620C>G	ENST00000327134.3	+	2	425	c.103C>G	c.(103-105)Cac>Gac	p.H35D	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	35					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.H35D(2)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GTCAGCCAATCACAGTTTGAA	0.473																																						dbGAP											2	Substitution - Missense(2)	breast(2)											143.0	150.0	147.0					3																	196509620		2203	4300	6503	-	-	-	SO:0001583	missense	0			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.103C>G	3.37:g.196509620C>G	ENSP00000314067:p.His35Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13154|Q6ISC3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.H35D	ENST00000327134.3	37	c.103	CCDS3321.1	3	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565140	0.45694	.	.	ENSG00000180370	ENST00000327134	T	0.67698	-0.28	5.21	5.21	0.72293	.	0.049986	0.85682	D	0.000000	T	0.60353	0.2262	L	0.47716	1.5	0.52099	D	0.999948	B	0.06786	0.001	B	0.08055	0.003	T	0.55976	-0.8055	10	0.34782	T	0.22	.	15.1575	0.72755	0.1416:0.8584:0.0:0.0	.	35	Q13177	PAK2_HUMAN	D	35	ENSP00000314067:H35D	ENSP00000314067:H35D	H	+	1	0	PAK2	197994017	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.539000	0.67199	2.456000	0.83038	0.655000	0.94253	CAC	PAK2	-	NULL	ENSG00000180370		0.473	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK2	HGNC	protein_coding	OTTHUMT00000340548.1	83	0.00	0	C	NM_002577		196509620	196509620	+1	no_errors	ENST00000327134	ensembl	human	known	69_37n	missense	121	14.69	21	SNP	1.000	G
PEX14	5195	genome.wustl.edu	37	1	10678420	10678420	+	Silent	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:10678420C>T	ENST00000356607.4	+	5	410	c.330C>T	c.(328-330)ggC>ggT	p.G110G	PEX14_ENST00000538836.1_Silent_p.G46G|RN7SL614P_ENST00000461850.2_RNA	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	110					microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)	p.G110G(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		GAGATTACGGCGCCCTGGCCA	0.632																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											84.0	73.0	77.0					1																	10678420		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.330C>T	1.37:g.10678420C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N1|B3KML6|B7Z1N2|Q8WX51	Silent	SNP	pfam_Pex14_N	p.G110	ENST00000356607.4	37	c.330	CCDS30582.1	1																																																																																			PEX14	-	pfam_Pex14_N	ENSG00000142655		0.632	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX14	HGNC	protein_coding	OTTHUMT00000005414.1	53	0.00	0	C			10678420	10678420	+1	no_errors	ENST00000356607	ensembl	human	known	69_37n	silent	17	34.62	9	SNP	0.581	T
PGBD4	161779	genome.wustl.edu	37	15	34395268	34395268	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr15:34395268C>A	ENST00000397766.2	+	1	995	c.536C>A	c.(535-537)aCa>aAa	p.T179K	EMC7_ENST00000532113.1_5'Flank|EMC7_ENST00000256545.4_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	179								p.T179K(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		TTTTGGTCAACAAGGCCTCTT	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	106.0	107.0					15																	34395268		2201	4298	6499	-	-	-	SO:0001583	missense	0			AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.536C>A	15.37:g.34395268C>A	ENSP00000380872:p.Thr179Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L487|A8K0C6|Q8N9E8	Missense_Mutation	SNP	NULL	p.T179K	ENST00000397766.2	37	c.536	CCDS10033.1	15	.	.	.	.	.	.	.	.	.	.	c	13.73	2.324368	0.41197	.	.	ENSG00000182405	ENST00000397766	T	0.18338	2.22	0.781	-0.315	0.12746	.	0.711478	0.11339	U	0.574267	T	0.18635	0.0447	L	0.35854	1.095	0.09310	N	1	B	0.32653	0.379	P	0.47528	0.549	T	0.45542	-0.9254	10	0.27785	T	0.31	.	4.8087	0.13333	0.0:0.7326:0.0:0.2674	.	179	Q96DM1	PGBD4_HUMAN	K	179	ENSP00000380872:T179K	ENSP00000380872:T179K	T	+	2	0	PGBD4	32182560	0.912000	0.30974	0.282000	0.24776	0.939000	0.58152	0.481000	0.22260	-0.110000	0.12022	0.291000	0.19559	ACA	PGBD4	-	NULL	ENSG00000182405		0.383	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PGBD4	HGNC	protein_coding	OTTHUMT00000251522.1	182	0.54	1	C			34395268	34395268	+1	no_errors	ENST00000397766	ensembl	human	known	69_37n	missense	98	25.76	34	SNP	0.265	A
PIK3C2G	5288	genome.wustl.edu	37	12	18435045	18435045	+	Silent	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr12:18435045T>C	ENST00000266497.5	+	1	68	c.30T>C	c.(28-30)aaT>aaC	p.N10N	RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000433979.1_Silent_p.N10N|PIK3C2G_ENST00000535651.1_Silent_p.N10N|PIK3C2G_ENST00000538779.1_Silent_p.N10N			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	10					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.N10N(2)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CGGATCCAAATCCTAATGAAT	0.363																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											52.0	48.0	49.0					12																	18435045		1841	4086	5927	-	-	-	SO:0001819	synonymous_variant	0			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.30T>C	12.37:g.18435045T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U0	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.N10	ENST00000266497.5	37	c.30	CCDS44839.1	12																																																																																			PIK3C2G	-	NULL	ENSG00000139144		0.363	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	148	0.00	0	T	NM_004570		18435045	18435045	+1	no_errors	ENST00000538779	ensembl	human	known	69_37n	silent	56	22.22	16	SNP	0.043	C
PKD1L1	168507	genome.wustl.edu	37	7	47897212	47897212	+	Silent	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr7:47897212A>G	ENST00000289672.2	-	28	4631	c.4581T>C	c.(4579-4581)gcT>gcC	p.A1527A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1527	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A1527A(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCTGCCCAGGAGCTTGGCTCC	0.493																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	57.0	57.0					7																	47897212		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4581T>C	7.37:g.47897212A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Silent	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.A1527	ENST00000289672.2	37	c.4581	CCDS34633.1	7																																																																																			PKD1L1	-	pfscan_REJ-like	ENSG00000158683		0.493	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	66	0.00	0	A	NM_138295		47897212	47897212	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	silent	62	16.22	12	SNP	0.027	G
PKHD1L1	93035	genome.wustl.edu	37	8	110441588	110441588	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr8:110441588T>C	ENST00000378402.5	+	26	3124	c.3020T>C	c.(3019-3021)aTt>aCt	p.I1007T		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1007					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.I1009T(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCCAACATTATTGGAGAAAAG	0.328										HNSCC(38;0.096)																												dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	58.0	60.0					8																	110441588		1848	4090	5938	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3020T>C	8.37:g.110441588T>C	ENSP00000367655:p.Ile1007Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.I1007T	ENST00000378402.5	37	c.3020	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	4.124	0.021280	0.08006	.	.	ENSG00000205038	ENST00000378402	D	0.83250	-1.7	5.02	3.69	0.42338	.	0.331114	0.27433	N	0.019386	T	0.56016	0.1957	N	0.02368	-0.58	0.25474	N	0.987799	B	0.06786	0.001	B	0.04013	0.001	T	0.41142	-0.9525	10	0.19590	T	0.45	.	5.0958	0.14733	0.0:0.1642:0.0:0.8358	.	1007	Q86WI1	PKHL1_HUMAN	T	1007	ENSP00000367655:I1007T	ENSP00000367655:I1007T	I	+	2	0	PKHD1L1	110510764	0.714000	0.27936	1.000000	0.80357	0.995000	0.86356	-0.520000	0.06252	2.021000	0.59480	0.528000	0.53228	ATT	PKHD1L1	-	NULL	ENSG00000205038		0.328	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	171	0.00	0	T	NM_177531		110441588	110441588	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	236	16.61	47	SNP	1.000	C
PLEKHG1	57480	genome.wustl.edu	37	6	151055039	151055039	+	Silent	SNP	G	G	A	rs147707807	byFrequency	TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:151055039G>A	ENST00000358517.2	+	2	433	c.222G>A	c.(220-222)acG>acA	p.T74T	PLEKHG1_ENST00000367328.1_Silent_p.T74T			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	74							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T74T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ACCCCGCCACGGGGCAACAGA	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											38.0	42.0	41.0					6																	151055039		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.222G>A	6.37:g.151055039G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1F2	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T74	ENST00000358517.2	37	c.222	CCDS34552.1	6																																																																																			PLEKHG1	-	NULL	ENSG00000120278		0.607	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	HGNC	protein_coding	OTTHUMT00000042691.1	38	0.00	0	G			151055039	151055039	+1	no_errors	ENST00000358517	ensembl	human	known	69_37n	silent	32	25.58	11	SNP	0.011	A
PLOD2	5352	genome.wustl.edu	37	3	145841966	145841966	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:145841966G>A	ENST00000360060.3	-	2	337	c.160C>T	c.(160-162)Cga>Tga	p.R54*	PLOD2_ENST00000282903.5_Nonsense_Mutation_p.R54*|PLOD2_ENST00000494950.1_5'UTR	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	54					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)	p.R54*(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	TGCATAAATCGATGGAATCCA	0.318																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											149.0	147.0	148.0					3																	145841966		2202	4298	6500	-	-	-	SO:0001587	stop_gained	0			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.160C>T	3.37:g.145841966G>A	ENSP00000353170:p.Arg54*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWS3|Q59ED2|Q8N170	Nonsense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.R54*	ENST00000360060.3	37	c.160	CCDS3131.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.209553	0.97380	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000469350	.	.	.	4.86	3.95	0.45737	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.407	13.5871	0.61937	0.0:0.0:0.838:0.1619	.	.	.	.	X	54;54;26	.	ENSP00000282903:R54X	R	-	1	2	PLOD2	147324656	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.376000	0.59556	0.971000	0.38288	0.471000	0.43371	CGA	PLOD2	-	NULL	ENSG00000152952		0.318	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD2	HGNC	protein_coding	OTTHUMT00000355185.1	345	0.00	0	G	NM_000935		145841966	145841966	-1	no_errors	ENST00000282903	ensembl	human	known	69_37n	nonsense	261	16.35	51	SNP	1.000	A
PTGDR	5729	genome.wustl.edu	37	14	52735064	52735064	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr14:52735064T>G	ENST00000306051.2	+	1	634	c.532T>G	c.(532-534)Tgc>Ggc	p.C178G	PTGDR_ENST00000553372.1_Missense_Mutation_p.C178G	NM_000953.2	NP_000944.1	Q13258	PD2R_HUMAN	prostaglandin D2 receptor (DP)	178					adenosine metabolic process (GO:0046085)|cellular response to prostaglandin D stimulus (GO:0071799)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|male sex determination (GO:0030238)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin D receptor activity (GO:0004956)|prostaglandin J receptor activity (GO:0001785)	p.C178G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CGTGCAGTACTGCCCCGGCAC	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	83.0	84.0					14																	52735064		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31332	CCDS9707.1, CCDS61454.1	14q22.1	2012-08-08			ENSG00000168229	ENSG00000168229		"""GPCR / Class A : Prostanoid receptors"""	9591	protein-coding gene	gene with protein product		604687				7642548	Standard	NM_000953		Approved	DP, DP1, PTGDR1	uc001wzq.3	Q13258	OTTHUMG00000140299	ENST00000306051.2:c.532T>G	14.37:g.52735064T>G	ENSP00000303424:p.Cys178Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V5L3|Q13250|Q13251|Q1ZZ52	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Pglndn_D_rcpt,prints_Prostanoid_rcpt	p.C178G	ENST00000306051.2	37	c.532	CCDS9707.1	14	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508661	0.64410	.	.	ENSG00000168229	ENST00000306051;ENST00000553372	T;T	0.71461	-0.57;-0.57	4.62	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000062	D	0.82393	0.5027	M	0.76838	2.35	0.44825	D	0.99783	D	0.89917	1.0	D	0.87578	0.998	T	0.81147	-0.1065	10	0.27785	T	0.31	-31.1318	13.542	0.61679	0.0:0.0:0.0:1.0	.	178	Q13258	PD2R_HUMAN	G	178	ENSP00000303424:C178G;ENSP00000452408:C178G	ENSP00000303424:C178G	C	+	1	0	PTGDR	51804814	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	3.914000	0.56401	2.023000	0.59567	0.460000	0.39030	TGC	PTGDR	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Prostanoid_rcpt	ENSG00000168229		0.647	PTGDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDR	HGNC	protein_coding	OTTHUMT00000276889.1	63	0.00	0	T	NM_000953		52735064	52735064	+1	no_errors	ENST00000306051	ensembl	human	known	69_37n	missense	44	33.33	22	SNP	1.000	G
RANGAP1	5905	genome.wustl.edu	37	22	41652046	41652046	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr22:41652046G>A	ENST00000455915.2	-	9	2521	c.1052C>T	c.(1051-1053)gCc>gTc	p.A351V	RANGAP1_ENST00000405486.1_Missense_Mutation_p.A351V|RANGAP1_ENST00000407260.4_Missense_Mutation_p.A296V|RANGAP1_ENST00000356244.3_Missense_Mutation_p.A351V			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	351					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)	p.A351V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CAGCACCTTGGCCATGTTGAA	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	43.0	46.0					22																	41652046		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1052C>T	22.37:g.41652046G>A	ENSP00000401470:p.Ala351Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JJ2	Missense_Mutation	SNP	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.A351V	ENST00000455915.2	37	c.1052	CCDS14012.1	22	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310700	0.60414	.	.	ENSG00000100401	ENST00000405486;ENST00000356244;ENST00000405383;ENST00000455915;ENST00000407260	T;T;T;T	0.53423	0.66;0.66;0.66;0.62	5.25	4.23	0.50019	.	0.154222	0.56097	D	0.000029	T	0.42404	0.1201	L	0.48362	1.52	0.58432	D	0.999999	B;B	0.17038	0.02;0.006	B;B	0.22880	0.042;0.013	T	0.33343	-0.9872	10	0.38643	T	0.18	-12.4549	14.1112	0.65121	0.073:0.0:0.927:0.0	.	296;351	F8W7I9;P46060	.;RAGP1_HUMAN	V	351;351;351;351;296	ENSP00000385866:A351V;ENSP00000348577:A351V;ENSP00000401470:A351V;ENSP00000385354:A296V	ENSP00000348577:A351V	A	-	2	0	RANGAP1	39981992	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	2.275000	0.43399	2.467000	0.83353	0.561000	0.74099	GCC	RANGAP1	-	NULL	ENSG00000100401		0.587	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RANGAP1	HGNC	protein_coding	OTTHUMT00000320606.1	26	0.00	0	G	NM_002883		41652046	41652046	-1	no_errors	ENST00000356244	ensembl	human	known	69_37n	missense	25	39.02	16	SNP	0.897	A
RUNX1T1	862	genome.wustl.edu	37	8	92982889	92982889	+	Silent	SNP	G	G	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr8:92982889G>A	ENST00000523629.1	-	11	1990	c.1536C>T	c.(1534-1536)agC>agT	p.S512S	RUNX1T1_ENST00000422361.2_Silent_p.S475S|RUNX1T1_ENST00000265814.3_Silent_p.S512S|RUNX1T1_ENST00000396218.1_Silent_p.S485S|RUNX1T1_ENST00000360348.2_Silent_p.S475S|RUNX1T1_ENST00000518844.1_Silent_p.S485S|RUNX1T1_ENST00000520724.1_Silent_p.S475S|RUNX1T1_ENST00000436581.2_Silent_p.S523S	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	512					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S523S(1)|p.S475S(1)|p.S512S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GCCTCACCTCGCTTGAATCCT	0.488																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											63.0	59.0	60.0					8																	92982889		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1536C>T	8.37:g.92982889G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.S523	ENST00000523629.1	37	c.1569	CCDS6256.1	8																																																																																			RUNX1T1	-	NULL	ENSG00000079102		0.488	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	95	0.00	0	G	NM_004349, NM_175635		92982889	92982889	-1	no_errors	ENST00000436581	ensembl	human	known	69_37n	silent	89	16.04	17	SNP	0.962	A
SEMG2	6407	genome.wustl.edu	37	20	43851144	43851144	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr20:43851144T>C	ENST00000372769.3	+	2	961	c.871T>C	c.(871-873)Tca>Cca	p.S291P		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	291	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.S291P(1)		autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				ATACCCGTCTTCACGTACAGA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	88.0	91.0					20																	43851144		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.871T>C	20.37:g.43851144T>C	ENSP00000361855:p.Ser291Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	pfam_Semenogelin	p.S291P	ENST00000372769.3	37	c.871	CCDS13346.1	20	.	.	.	.	.	.	.	.	.	.	T	9.814	1.184035	0.21870	.	.	ENSG00000124157	ENST00000372769	T	0.12984	2.63	1.53	0.152	0.14893	.	.	.	.	.	T	0.28134	0.0694	M	0.67700	2.07	0.09310	N	1	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.87578	0.993;0.998;0.998	T	0.10660	-1.0620	9	0.87932	D	0	.	3.4476	0.07486	0.0:0.6007:0.0:0.3993	.	291;291;291	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	P	291	ENSP00000361855:S291P	ENSP00000361855:S291P	S	+	1	0	SEMG2	43284558	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.661000	0.01972	0.038000	0.15604	-0.408000	0.06270	TCA	SEMG2	-	pfam_Semenogelin	ENSG00000124157		0.393	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	HGNC	protein_coding	OTTHUMT00000079417.1	138	0.00	0	T	NM_003008		43851144	43851144	+1	no_errors	ENST00000372769	ensembl	human	known	69_37n	missense	138	16.36	27	SNP	0.001	C
SLC29A1	2030	genome.wustl.edu	37	6	44195040	44195040	+	5'UTR	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:44195040A>G	ENST00000393841.1	+	0	481				SLC29A1_ENST00000393844.1_5'UTR|SLC29A1_ENST00000371713.1_5'UTR|SLC29A1_ENST00000371724.1_5'UTR|SLC29A1_ENST00000371708.1_5'UTR|SLC29A1_ENST00000371740.5_5'UTR|SLC29A1_ENST00000427851.2_5'UTR|SLC29A1_ENST00000313248.7_Missense_Mutation_p.N76S|SLC29A1_ENST00000371755.3_5'UTR|SLC29A1_ENST00000371731.1_5'UTR	NM_001078177.1	NP_001071645.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1						cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	AAAACCGAGAACACCATCACC	0.622																																						dbGAP											0													119.0	95.0	103.0					6																	44195040		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393841.1:c.-11A>G	6.37:g.44195040A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	Missense_Mutation	SNP	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt,tigrfam_Eqnu_transpt	p.N76S	ENST00000393841.1	37	c.227	CCDS4908.1	6	.	.	.	.	.	.	.	.	.	.	A	9.981	1.228177	0.22542	.	.	ENSG00000112759	ENST00000313248	T	0.55930	0.49	4.69	-5.72	0.02406	.	.	.	.	.	T	0.06690	0.0171	.	.	.	0.26163	N	0.979976	B	0.09022	0.002	B	0.04013	0.001	T	0.19549	-1.0302	8	0.09338	T	0.73	.	2.0206	0.03508	0.2472:0.3974:0.2256:0.1298	.	76	B3KQV7	.	S	76	ENSP00000319152:N76S	ENSP00000319152:N76S	N	+	2	0	SLC29A1	44303018	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-0.789000	0.04609	-0.948000	0.03668	0.533000	0.62120	AAC	SLC29A1	-	NULL	ENSG00000112759		0.622	SLC29A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A1	HGNC	protein_coding	OTTHUMT00000040721.1	187	0.00	0	A			44195040	44195040	+1	no_errors	ENST00000313248	ensembl	human	known	69_37n	missense	94	18.26	21	SNP	0.000	G
SLC38A7	55238	genome.wustl.edu	37	16	58709846	58709846	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr16:58709846G>T	ENST00000570101.1	-	7	1764	c.881C>A	c.(880-882)aCa>aAa	p.T294K	SLC38A7_ENST00000564010.1_Missense_Mutation_p.T205K|SLC38A7_ENST00000566953.1_5'UTR|SLC38A7_ENST00000219320.4_Missense_Mutation_p.T294K|SLC38A7_ENST00000564100.1_Missense_Mutation_p.T294K			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	294					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						GCACTCACCTGTCCCCATGTA	0.612																																						dbGAP											0													67.0	44.0	52.0					16																	58709846		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.881C>A	16.37:g.58709846G>T	ENSP00000454646:p.Thr294Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GJ9|Q9H9I5	Missense_Mutation	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.T294K	ENST00000570101.1	37	c.881	CCDS10800.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.112865	0.94339	.	.	ENSG00000103042	ENST00000219320	T	0.02421	4.3	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.15739	0.0379	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.00032	-1.2274	9	.	.	.	.	19.3514	0.94389	0.0:0.0:1.0:0.0	.	294;294	Q9NVC3;Q9NVC3-2	S38A7_HUMAN;.	K	294	ENSP00000219320:T294K	.	T	-	2	0	SLC38A7	57267347	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	9.067000	0.93955	2.826000	0.97356	0.561000	0.74099	ACA	SLC38A7	-	pfam_AA_transpt_TM	ENSG00000103042		0.612	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A7	HGNC	protein_coding	OTTHUMT00000422206.2	47	0.00	0	G	NM_018231		58709846	58709846	-1	no_errors	ENST00000219320	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	1.000	T
SLC6A19	340024	genome.wustl.edu	37	5	1219062	1219062	+	Silent	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr5:1219062C>T	ENST00000304460.10	+	9	1274	c.1218C>T	c.(1216-1218)gcC>gcT	p.A406A		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	406					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.A406A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TCACCGAGGCCATCACCAAGA	0.602																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											360.0	270.0	301.0					5																	1219062		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1218C>T	5.37:g.1219062C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K446	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.A406	ENST00000304460.10	37	c.1218	CCDS34130.1	5																																																																																			SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000174358		0.602	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	375	0.00	0	C	XM_291120		1219062	1219062	+1	no_errors	ENST00000304460	ensembl	human	known	69_37n	silent	328	12.06	45	SNP	1.000	T
SPEN	23013	genome.wustl.edu	37	1	16255132	16255132	+	Silent	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:16255132G>C	ENST00000375759.3	+	11	2601	c.2397G>C	c.(2395-2397)ccG>ccC	p.P799P		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	799	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.P799P(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CTTTTGATCCGGAGAGAGTGG	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											78.0	84.0	82.0					1																	16255132		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2397G>C	1.37:g.16255132G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.P799	ENST00000375759.3	37	c.2397	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.433	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	52	0.00	0	G	NM_015001		16255132	16255132	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	silent	66	18.52	15	SNP	0.003	C
STAMBPL1	57559	genome.wustl.edu	37	10	90672857	90672857	+	Splice_Site	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:90672857G>T	ENST00000371926.3	+	6	1378		c.e6-1		STAMBPL1_ENST00000371922.1_5'UTR|STAMBPL1_ENST00000371927.3_Splice_Site|STAMBPL1_ENST00000371924.1_Splice_Site	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1							membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.?(2)		breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		ACACTTTTTAGAACAAATATA	0.403																																						dbGAP											2	Unknown(2)	breast(2)											67.0	79.0	75.0					10																	90672857		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.421-1G>T	10.37:g.90672857G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Splice_Site	SNP	-	e5-1	ENST00000371926.3	37	c.421-1	CCDS7391.1	10	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370070	0.61624	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1639	0.86810	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAMBPL1	90662837	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.229000	0.78088	2.834000	0.97654	0.655000	0.94253	.	STAMBPL1	-	-	ENSG00000138134		0.403	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049283.1	18	0.00	0	G	NM_020799	Intron	90672857	90672857	+1	no_errors	ENST00000371927	ensembl	human	known	69_37n	splice_site	17	22.73	5	SNP	1.000	T
STK11IP	114790	genome.wustl.edu	37	2	220473482	220473484	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	CCC	CCC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr2:220473482_220473484delCCC	ENST00000456909.1	+	15	1871_1873	c.1781_1783delCCC	c.(1780-1785)gcccag>gag	p.594_595AQ>E	STK11IP_ENST00000295641.10_In_Frame_Del_p.605_606AQ>E			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	605	Glu-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGCCGGAGGCCCAGGCCCAGAG	0.635																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1781_1783delCCC	2.37:g.220473482_220473484delCCC	ENSP00000389383:p.Ala594_Gln595delinsGlu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	In_Frame_Del	DEL	NULL	p.AQ594in_frame_delE	ENST00000456909.1	37	c.1781_1783		2																																																																																			STK11IP	-	NULL	ENSG00000144589		0.635	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	HGNC	protein_coding	OTTHUMT00000131432.1	21	0.00	0	CCC	NM_052902		220473482	220473484	+1	no_errors	ENST00000456909	ensembl	human	novel	69_37n	in_frame_del	24	50.00	24	DEL	0.000:0.000:0.000	-
STOX1	219736	genome.wustl.edu	37	10	70645645	70645645	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr10:70645645G>T	ENST00000298596.6	+	3	2176	c.2093G>T	c.(2092-2094)gGa>gTa	p.G698V	STOX1_ENST00000399162.2_Intron|STOX1_ENST00000421961.2_Missense_Mutation_p.G588V|STOX1_ENST00000399169.4_Missense_Mutation_p.G698V|STOX1_ENST00000399165.4_Intron	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	698						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G698V(1)		breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						TTGAGAAAAGGATTTGTCCAG	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											113.0	102.0	106.0					10																	70645645		1904	4129	6033	-	-	-	SO:0001583	missense	0			AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.2093G>T	10.37:g.70645645G>T	ENSP00000298596:p.Gly698Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.G698V	ENST00000298596.6	37	c.2093	CCDS41535.1	10	.	.	.	.	.	.	.	.	.	.	G	0.599	-0.829889	0.02734	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	T;T;T	0.73789	-0.78;-0.78;-0.46	5.49	1.57	0.23409	.	1.422770	0.03962	N	0.290156	T	0.48909	0.1526	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38672	-0.9650	10	0.37606	T	0.19	.	5.2298	0.15416	0.1193:0.6333:0.1184:0.129	.	698	Q6ZVD7	STOX1_HUMAN	V	698;698;588	ENSP00000382121:G698V;ENSP00000298596:G698V;ENSP00000394509:G588V	ENSP00000298596:G698V	G	+	2	0	STOX1	70315651	0.015000	0.18098	0.008000	0.14137	0.165000	0.22458	0.336000	0.19823	0.098000	0.17522	-2.169000	0.00324	GGA	STOX1	-	NULL	ENSG00000165730		0.423	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX1	HGNC	protein_coding	OTTHUMT00000276849.3	100	0.00	0	G	NM_152709		70645645	70645645	+1	no_errors	ENST00000298596	ensembl	human	known	69_37n	missense	73	23.96	23	SNP	0.017	T
SUSD5	26032	genome.wustl.edu	37	3	33194513	33194513	+	Silent	SNP	C	C	A	rs201659670		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr3:33194513C>A	ENST00000309558.3	-	5	2028	c.1611G>T	c.(1609-1611)ctG>ctT	p.L537L		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	537					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)	p.L537L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						AGTCTTCAGACAGCAGGTATG	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											101.0	103.0	102.0					3																	33194513		2045	4192	6237	-	-	-	SO:0001819	synonymous_variant	0			AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.1611G>T	3.37:g.33194513C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Link,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Link,pfscan_Link,pfscan_Sushi_SCR_CCP	p.L537	ENST00000309558.3	37	c.1611	CCDS46787.1	3																																																																																			SUSD5	-	NULL	ENSG00000173705		0.567	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD5	HGNC	protein_coding	OTTHUMT00000341902.1	248	0.00	0	C	XM_171054		33194513	33194513	-1	no_errors	ENST00000309558	ensembl	human	known	69_37n	silent	178	14.83	31	SNP	0.749	A
SYNE1	23345	genome.wustl.edu	37	6	152737562	152737562	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:152737562C>T	ENST00000367255.5	-	41	6611	c.6010G>A	c.(6010-6012)Gag>Aag	p.E2004K	SYNE1_ENST00000341594.5_Missense_Mutation_p.E2041K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E2004K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E2011K|SYNE1_ENST00000448038.1_Missense_Mutation_p.E2011K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2004					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E2004K(2)|p.E2011K(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCAATCGCTCTTTGTCAGTC	0.433										HNSCC(10;0.0054)																												dbGAP											3	Substitution - Missense(3)	breast(3)											225.0	237.0	233.0					6																	152737562		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.6010G>A	6.37:g.152737562C>T	ENSP00000356224:p.Glu2004Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E2004K	ENST00000367255.5	37	c.6010	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705229	0.30232	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000008	T	0.42966	0.1226	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.67145	0.976;0.996;0.996;0.995	P;P;P;D	0.63703	0.541;0.831;0.831;0.917	T	0.33497	-0.9866	10	0.05721	T	0.95	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	1987;2004;2004;2011	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	2004;2011;2004;2011;2041	ENSP00000356224:E2004K;ENSP00000396024:E2011K;ENSP00000265368:E2004K;ENSP00000390975:E2011K;ENSP00000341887:E2041K	ENSP00000265368:E2004K	E	-	1	0	SYNE1	152779255	1.000000	0.71417	0.388000	0.26195	0.172000	0.22775	4.970000	0.63742	2.836000	0.97738	0.655000	0.94253	GAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.433	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	201	0.00	0	C	NM_182961		152737562	152737562	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	217	11.79	29	SNP	0.989	T
TAF1	6872	genome.wustl.edu	37	X	70607214	70607214	+	Nonsense_Mutation	SNP	T	T	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chrX:70607214T>G	ENST00000373790.4	+	15	2378	c.2327T>G	c.(2326-2328)tTa>tGa	p.L776*	TAF1_ENST00000423759.1_Nonsense_Mutation_p.L797*|TAF1_ENST00000276072.3_Nonsense_Mutation_p.L797*|TAF1_ENST00000449580.1_Nonsense_Mutation_p.L776*	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	776	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.L797*(1)|p.L776*(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATTCGGGAATTAGTGGATATT	0.413																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											149.0	136.0	141.0					X																	70607214		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2327T>G	X.37:g.70607214T>G	ENSP00000362895:p.Leu776*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Nonsense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L776*	ENST00000373790.4	37	c.2327	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	41	8.896062	0.98994	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	.	.	.	4.7	4.7	0.59300	.	0.206543	0.41097	D	0.000959	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	13.6252	0.62159	0.0:0.0:0.0:1.0	.	.	.	.	X	776;776;797;797	.	ENSP00000276072:L797X	L	+	2	0	TAF1	70523939	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.691000	0.84191	1.660000	0.50760	0.373000	0.22412	TTA	TAF1	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000147133		0.413	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	462	0.00	0	T	NM_004606		70607214	70607214	+1	no_errors	ENST00000449580	ensembl	human	known	69_37n	nonsense	213	23.93	67	SNP	0.979	G
TEP1	7011	genome.wustl.edu	37	14	20846384	20846384	+	Silent	SNP	T	T	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr14:20846384T>G	ENST00000262715.5	-	39	5560	c.5520A>C	c.(5518-5520)gcA>gcC	p.A1840A	TEP1_ENST00000556935.1_Silent_p.A1732A|TEP1_ENST00000545983.1_Silent_p.A178A	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1840					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AGGCTCCGGGTGCCCCCAGGT	0.587																																						dbGAP											0													46.0	56.0	53.0					14																	20846384		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.5520A>C	14.37:g.20846384T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV9	Silent	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1840	ENST00000262715.5	37	c.5520	CCDS9548.1	14																																																																																			TEP1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000129566		0.587	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	63	0.00	0	T	NM_007110		20846384	20846384	-1	no_errors	ENST00000262715	ensembl	human	known	69_37n	silent	32	10.81	4	SNP	0.231	G
TGS1	96764	genome.wustl.edu	37	8	56699101	56699101	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr8:56699101A>T	ENST00000260129.5	+	4	1121	c.644A>T	c.(643-645)cAa>cTa	p.Q215L		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	215					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)	p.Q215L(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			CAAAGTTGGCAAGAAAAACAT	0.378																																					Esophageal Squamous(34;275 823 4842 34837 48447)	dbGAP											1	Substitution - Missense(1)	breast(1)											142.0	143.0	143.0					8																	56699101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.644A>T	8.37:g.56699101A>T	ENSP00000260129:p.Gln215Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.Q215L	ENST00000260129.5	37	c.644	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	A	2.805	-0.248377	0.05867	.	.	ENSG00000137574	ENST00000260129	T	0.16897	2.31	5.79	4.64	0.57946	.	0.149633	0.44483	D	0.000451	T	0.11750	0.0286	L	0.52573	1.65	0.28102	N	0.931364	B;B	0.22604	0.072;0.072	B;B	0.15870	0.014;0.014	T	0.38156	-0.9674	10	0.02654	T	1	-7.7489	6.0566	0.19815	0.6909:0.0:0.0731:0.236	.	215;215	B2RBJ7;Q96RS0	.;TGS1_HUMAN	L	215	ENSP00000260129:Q215L	ENSP00000260129:Q215L	Q	+	2	0	TGS1	56861655	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	3.269000	0.51592	1.025000	0.39708	0.533000	0.62120	CAA	TGS1	-	NULL	ENSG00000137574		0.378	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	213	0.00	0	A	NM_024831		56699101	56699101	+1	no_errors	ENST00000260129	ensembl	human	known	69_37n	missense	282	12.69	41	SNP	1.000	T
TM2D1	83941	genome.wustl.edu	37	1	62165923	62165923	+	Intron	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:62165923C>A	ENST00000606498.1	-	4	460				TM2D1_ENST00000371177.2_Missense_Mutation_p.V155F|TM2D1_ENST00000472989.1_Intron|TM2D1_ENST00000294613.5_Intron|TM2D1_ENST00000371180.2_Intron			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1						apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)	p.V155F(1)		large_intestine(2)|lung(3)|ovary(1)	6						aatcccttaacctctctggtg	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)																																								-	-	-	SO:0001627	intron_variant	0			AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.439+682G>T	1.37:g.62165923C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDA8	Missense_Mutation	SNP	pfam_TM2	p.V155F	ENST00000606498.1	37	c.463		1	.	.	.	.	.	.	.	.	.	.	C	9.390	1.075309	0.20227	.	.	ENSG00000162604	ENST00000371177	.	.	.	3.59	2.66	0.31614	.	.	.	.	.	T	0.60064	0.2240	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58036	-0.7707	5	0.42905	T	0.14	.	8.3676	0.32395	0.234:0.766:0.0:0.0	.	.	.	.	F	155	.	ENSP00000360219:V155F	V	-	1	0	TM2D1	61938511	0.053000	0.20554	0.818000	0.32626	0.981000	0.71138	0.392000	0.20801	1.061000	0.40601	0.455000	0.32223	GTT	TM2D1	-	NULL	ENSG00000162604		0.368	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	TM2D1	HGNC	protein_coding	OTTHUMT00000470779.2	156	0.00	0	C	NM_032027		62165923	62165923	-1	no_errors	ENST00000371177	ensembl	human	known	69_37n	missense	116	18.31	26	SNP	0.884	A
TMEM63C	57156	genome.wustl.edu	37	14	77723060	77723060	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr14:77723060G>C	ENST00000298351.4	+	24	2556	c.2412G>C	c.(2410-2412)caG>caC	p.Q804H		NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	804					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)	p.Q804H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		GCCAGAACCAGTACCACTGAC	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											53.0	57.0	56.0					14																	77723060		1989	4149	6138	-	-	-	SO:0001583	missense	0				CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.2412G>C	14.37:g.77723060G>C	ENSP00000298351:p.Gln804His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Missense_Mutation	SNP	pfam_DUF221	p.Q804H	ENST00000298351.4	37	c.2412	CCDS45141.1	14	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914489	0.33815	.	.	ENSG00000165548	ENST00000298351;ENST00000536110	T	0.18016	2.24	4.99	-1.59	0.08453	.	0.436559	0.22515	N	0.059044	T	0.07999	0.0200	L	0.31294	0.92	0.22968	N	0.998495	B	0.15141	0.012	B	0.13407	0.009	T	0.19063	-1.0317	10	0.30854	T	0.27	-13.0442	0.4928	0.00567	0.3689:0.1754:0.2591:0.1965	.	804	Q9P1W3	TM63C_HUMAN	H	804;374	ENSP00000298351:Q804H	ENSP00000298351:Q804H	Q	+	3	2	TMEM63C	76792813	0.990000	0.36364	0.998000	0.56505	0.956000	0.61745	0.057000	0.14279	0.158000	0.19367	0.655000	0.94253	CAG	TMEM63C	-	NULL	ENSG00000165548		0.647	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63C	HGNC	protein_coding	OTTHUMT00000414193.1	69	0.00	0	G			77723060	77723060	+1	no_errors	ENST00000298351	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.876	C
TMEM82	388595	genome.wustl.edu	37	1	16069647	16069647	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:16069647G>C	ENST00000375782.1	+	3	432	c.294G>C	c.(292-294)gaG>gaC	p.E98D	RP11-169K16.4_ENST00000418525.1_RNA|TMEM82_ENST00000465575.1_3'UTR	NM_001013641.1	NP_001013663.1	A0PJX8	TMM82_HUMAN	transmembrane protein 82	98	Leu-rich.					integral component of membrane (GO:0016021)		p.E98D(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|lung(5)|prostate(1)|skin(1)	13		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGCTCGAGTTCTCCCTCC	0.706																																						dbGAP											1	Substitution - Missense(1)	breast(1)											47.0	45.0	46.0					1																	16069647		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS30608.1	1p36.13	2008-02-05				ENSG00000162460			32350	protein-coding gene	gene with protein product							Standard	NM_001013641		Approved		uc001axc.4	A0PJX8		ENST00000375782.1:c.294G>C	1.37:g.16069647G>C	ENSP00000364938:p.Glu98Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP27|Q5VVD4	Missense_Mutation	SNP	NULL	p.E98D	ENST00000375782.1	37	c.294	CCDS30608.1	1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828238	0.90955	.	.	ENSG00000162460	ENST00000375782	T	0.60797	0.16	4.44	3.5	0.40072	.	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	M	0.75264	2.295	0.42502	D	0.992937	D	0.61697	0.99	P	0.57371	0.819	T	0.71504	-0.4573	10	0.62326	D	0.03	-20.6623	9.7038	0.40203	0.166:0.0:0.834:0.0	.	98	A0PJX8	TMM82_HUMAN	D	98	ENSP00000364938:E98D	ENSP00000364938:E98D	E	+	3	2	TMEM82	15942234	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.486000	0.60286	2.171000	0.68590	0.561000	0.74099	GAG	TMEM82	-	NULL	ENSG00000162460		0.706	TMEM82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM82	HGNC	protein_coding	OTTHUMT00000008471.2	67	0.00	0	G	NM_001013641		16069647	16069647	+1	no_errors	ENST00000375782	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578556	7578556	+	Splice_Site	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr17:7578556T>C	ENST00000269305.4	-	5	565		c.e5-2		TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(34)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGGGAGTACTGTAGGAAGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Unknown(34)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(19)|breast(7)|central_nervous_system(4)|ovary(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|oesophagus(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)											41.0	42.0	41.0					17																	7578556		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-2A>G	17.37:g.7578556T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4-2	ENST00000269305.4	37	c.376-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336894	0.60963	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6026	0.45375	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519281	1.000000	0.71417	0.994000	0.49952	0.902000	0.53008	6.214000	0.72200	2.078000	0.62432	0.533000	0.62120	.	TP53	-	-	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	53	0.00	0	T	NM_000546	Intron	7578556	7578556	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	16	40.74	11	SNP	1.000	C
TTLL1	25809	genome.wustl.edu	37	22	43465764	43465764	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr22:43465764T>C	ENST00000266254.7	-	4	440	c.200A>G	c.(199-201)aAc>aGc	p.N67S	TTLL1_ENST00000331018.7_Missense_Mutation_p.N67S	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	67	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)	p.N67S(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TTCATAGTGGTTTGGAAAATG	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											183.0	175.0	177.0					22																	43465764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.200A>G	22.37:g.43465764T>C	ENSP00000266254:p.Asn67Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.N67S	ENST00000266254.7	37	c.200	CCDS14043.1	22	.	.	.	.	.	.	.	.	.	.	T	26.7	4.767391	0.90020	.	.	ENSG00000100271	ENST00000331018;ENST00000266254	T;T	0.05855	3.38;3.38	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.28300	0.0699	M	0.84326	2.69	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.973;0.984	T	0.01549	-1.1327	10	0.49607	T	0.09	.	16.3083	0.82859	0.0:0.0:0.0:1.0	.	67;67	O95922-4;O95922	.;TTLL1_HUMAN	S	67	ENSP00000333734:N67S;ENSP00000266254:N67S	ENSP00000266254:N67S	N	-	2	0	TTLL1	41795708	1.000000	0.71417	0.995000	0.50966	0.934000	0.57294	7.691000	0.84191	2.250000	0.74265	0.455000	0.32223	AAC	TTLL1	-	pfam_Tub_tyr_ligase	ENSG00000100271		0.453	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL1	HGNC	protein_coding	OTTHUMT00000319659.1	329	0.30	1	T	NM_012263		43465764	43465764	-1	no_errors	ENST00000266254	ensembl	human	known	69_37n	missense	200	18.03	44	SNP	1.000	C
TXNL4A	10907	genome.wustl.edu	37	18	77733812	77733814	+	In_Frame_Del	DEL	TTG	TTG	-	rs369317289		TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	TTG	TTG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr18:77733812_77733814delTTG	ENST00000269601.5	-	3	500_502	c.300_302delCAA	c.(298-303)aacaag>aag	p.N100del	TXNL4A_ENST00000592837.1_In_Frame_Del_p.N29del|TXNL4A_ENST00000592957.1_In_Frame_Del_p.N29del|TXNL4A_ENST00000585474.1_In_Frame_Del_p.N29del|TXNL4A_ENST00000588162.1_3'UTR	NM_006701.2	NP_006692.1	P83876	TXN4A_HUMAN	thioredoxin-like 4A	100					gene expression (GO:0010467)|mitotic nuclear division (GO:0007067)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)		p.N100delN(1)		breast(1)|large_intestine(1)|lung(3)	5		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		CCAGTTAATCTTGTTGTTGTTGC	0.522																																					Ovarian(160;2333 2597 11821 36245)	dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0			AF023612	CCDS32852.1	18q23	2013-07-16	2004-08-11	2004-08-12		ENSG00000141759			30551	protein-coding gene	gene with protein product	"""similar to S. pombe dim1+"""	611595	"""thioredoxin-like 4"""	TXNL4		11015569	Standard	NM_006701		Approved	U5-15kD, DIM1, HsT161, DIB1, SNRNP15	uc002lnp.3	P83876		ENST00000269601.5:c.300_302delCAA	18.37:g.77733821_77733823delTTG	ENSP00000269601:p.Asn100del	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC18|O14834	In_Frame_Del	DEL	pfam_mRNA_splic_U5,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,pirsf_mRNA_splic_U5	p.N100in_frame_del	ENST00000269601.5	37	c.302_300	CCDS32852.1	18																																																																																			TXNL4A	-	pfam_mRNA_splic_U5,superfamily_Thioredoxin-like_fold,pirsf_mRNA_splic_U5	ENSG00000141759		0.522	TXNL4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNL4A	HGNC	protein_coding	OTTHUMT00000451036.1	154	0.00	0	TTG	NM_006701		77733812	77733814	-1	no_errors	ENST00000269601	ensembl	human	known	69_37n	in_frame_del	89	15.24	16	DEL	1.000:1.000:1.000	-
UBQLN4	56893	genome.wustl.edu	37	1	156021546	156021546	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:156021546C>T	ENST00000368309.3	-	2	303	c.211G>A	c.(211-213)Gga>Aga	p.G71R	UBQLN4_ENST00000472638.1_5'UTR|LAMTOR2_ENST00000368305.4_5'Flank	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	71	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)	p.G71R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					TCCTTGATTCCGTGCTGGTTC	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	106.0	115.0					1																	156021546		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.211G>A	1.37:g.156021546C>T	ENSP00000357292:p.Gly71Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_UBA/transl_elong_EF1B_N,pfam_SUMO,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.G71R	ENST00000368309.3	37	c.211	CCDS1127.1	1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887330	0.91814	.	.	ENSG00000160803	ENST00000368309;ENST00000368307	D;D	0.97455	-4.39;-4.39	4.9	4.9	0.64082	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.97720	0.9252	M	0.74647	2.275	0.80722	D	1	D;D	0.56287	0.975;0.975	P;P	0.59761	0.863;0.863	D	0.98411	1.0572	10	0.87932	D	0	-30.0998	16.8122	0.85724	0.0:1.0:0.0:0.0	.	71;71	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	R	71	ENSP00000357292:G71R;ENSP00000357290:G71R	ENSP00000357290:G71R	G	-	1	0	UBQLN4	154288170	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	7.643000	0.83403	2.530000	0.85305	0.561000	0.74099	GGA	UBQLN4	-	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	ENSG00000160803		0.542	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN4	HGNC	protein_coding	OTTHUMT00000046193.1	123	0.00	0	C	NM_020131		156021546	156021546	-1	no_errors	ENST00000368309	ensembl	human	known	69_37n	missense	117	13.97	19	SNP	1.000	T
URB1	9875	genome.wustl.edu	37	21	33750825	33750825	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr21:33750825T>G	ENST00000382751.3	-	5	708	c.593A>C	c.(592-594)tAc>tCc	p.Y198S	SNORA80_ENST00000363922.1_RNA	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	198						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.Y198S(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						AAACTGAACGTAGGCCTGCCG	0.483																																						dbGAP											2	Substitution - Missense(2)	breast(2)											161.0	128.0	138.0					21																	33750825		692	1591	2283	-	-	-	SO:0001583	missense	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.593A>C	21.37:g.33750825T>G	ENSP00000372199:p.Tyr198Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.Y198S	ENST00000382751.3	37	c.593	CCDS46645.1	21	.	.	.	.	.	.	.	.	.	.	T	16.51	3.143494	0.57044	.	.	ENSG00000142207	ENST00000382751	T	0.35421	1.31	5.74	5.74	0.90152	.	0.073495	0.56097	D	0.000021	T	0.53916	0.1826	L	0.45581	1.43	0.49798	D	0.999829	D	0.76494	0.999	D	0.75020	0.985	T	0.53493	-0.8431	10	0.56958	D	0.05	-23.7395	16.3426	0.83092	0.0:0.0:0.0:1.0	.	198	O60287	NPA1P_HUMAN	S	198	ENSP00000372199:Y198S	ENSP00000372199:Y198S	Y	-	2	0	URB1	32672696	1.000000	0.71417	0.999000	0.59377	0.212000	0.24457	3.271000	0.51608	2.317000	0.78254	0.460000	0.39030	TAC	URB1	-	pfam_Npa1_N	ENSG00000142207		0.483	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	96	0.00	0	T			33750825	33750825	-1	no_errors	ENST00000382751	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	1.000	G
USP12	219333	genome.wustl.edu	37	13	27645275	27645275	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr13:27645275C>T	ENST00000282344.6	-	8	1200	c.944G>A	c.(943-945)cGa>cAa	p.R315Q		NM_182488.3	NP_872294.2	O75317	UBP12_HUMAN	ubiquitin specific peptidase 12	315	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R315Q(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)		ATAATGGCCTCGATTGGGACC	0.274																																					Ovarian(37;808 911 7590 44442 44991)	dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	63.0	63.0					13																	27645275		2203	4296	6499	-	-	-	SO:0001583	missense	0			AL049221	CCDS31952.1	13q12.13	2010-05-12	2005-08-08	2003-10-08	ENSG00000152484	ENSG00000152484		"""Ubiquitin-specific peptidases"""	20485	protein-coding gene	gene with protein product			"""ubiquitin specific protease 12 like 1"", ""ubiquitin specific protease 12"""	USP12L1		12838346	Standard	NM_182488		Approved		uc001uqy.3	O75317	OTTHUMG00000016626	ENST00000282344.6:c.944G>A	13.37:g.27645275C>T	ENSP00000282344:p.Arg315Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X0|Q5VZV3|Q8TC49	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.R315Q	ENST00000282344.6	37	c.944	CCDS31952.1	13	.	.	.	.	.	.	.	.	.	.	C	30	5.055827	0.93793	.	.	ENSG00000152484	ENST00000282344	T	0.30182	1.54	5.02	5.02	0.67125	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.45357	0.1338	L	0.28504	0.86	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.41360	-0.9513	10	0.52906	T	0.07	-8.8316	18.6939	0.91593	0.0:1.0:0.0:0.0	.	315	O75317	UBP12_HUMAN	Q	315	ENSP00000282344:R315Q	ENSP00000282344:R315Q	R	-	2	0	USP12	26543275	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.689000	0.84165	2.503000	0.84419	0.655000	0.94253	CGA	USP12	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000152484		0.274	USP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP12	HGNC	protein_coding	OTTHUMT00000044264.1	115	0.00	0	C	NM_182488		27645275	27645275	-1	no_errors	ENST00000282344	ensembl	human	known	69_37n	missense	73	51.33	77	SNP	1.000	T
USP29	57663	genome.wustl.edu	37	19	57642432	57642432	+	Missense_Mutation	SNP	A	A	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:57642432A>C	ENST00000254181.4	+	4	2843	c.2389A>C	c.(2389-2391)Att>Ctt	p.I797L	USP29_ENST00000598197.1_Missense_Mutation_p.I797L|U3_ENST00000516874.1_RNA	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	797	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.I797L(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAACAAAAACATTTTAGATGC	0.458																																						dbGAP											1	Substitution - Missense(1)	breast(1)											54.0	47.0	49.0					19																	57642432		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.2389A>C	19.37:g.57642432A>C	ENSP00000254181:p.Ile797Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.I797L	ENST00000254181.4	37	c.2389	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	A	8.473	0.857965	0.17178	.	.	ENSG00000131864	ENST00000254181	T	0.72835	-0.69	1.59	-3.17	0.05202	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.60573	0.2279	L	0.43152	1.355	0.09310	N	1	P	0.39624	0.681	B	0.43950	0.437	T	0.54330	-0.8310	9	0.54805	T	0.06	-0.0742	3.6152	0.08075	0.3572:0.4673:0.1755:0.0	.	797	Q9HBJ7	UBP29_HUMAN	L	797	ENSP00000254181:I797L	ENSP00000254181:I797L	I	+	1	0	USP29	62334244	0.865000	0.29922	0.000000	0.03702	0.009000	0.06853	0.147000	0.16202	-1.061000	0.03185	-0.644000	0.03951	ATT	USP29	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000131864		0.458	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	HGNC	protein_coding	OTTHUMT00000465075.1	90	0.00	0	A			57642432	57642432	+1	no_errors	ENST00000254181	ensembl	human	known	69_37n	missense	53	28.38	21	SNP	0.000	C
USP9X	8239	genome.wustl.edu	37	X	41048632	41048633	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chrX:41048632_41048633insA	ENST00000324545.8	+	26	4514_4515	c.3881_3882insA	c.(3880-3885)ttatgtfs	p.C1295fs	USP9X_ENST00000378308.2_Frame_Shift_Ins_p.C1295fs	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1295					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.C1288fs*13(1)|p.C1295fs*13(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GTGATGACCTTATGTTTTGCCT	0.406																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											2	Insertion - Frameshift(2)	breast(2)																																								-	-	-	SO:0001589	frameshift_variant	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.3882dupA	X.37:g.41048633_41048633dupA	ENSP00000316357:p.Cys1295fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Frame_Shift_Ins	INS	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.C1295fs	ENST00000324545.8	37	c.3881_3882	CCDS43930.1	X																																																																																			USP9X	-	NULL	ENSG00000124486		0.406	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	358	0.00	0	-	NM_004652		41048632	41048633	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	frame_shift_ins	116	46.54	101	INS	0.736:0.310	A
ZFP82	284406	genome.wustl.edu	37	19	36883688	36883688	+	Silent	SNP	A	A	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:36883688A>G	ENST00000392161.3	-	5	1796	c.1554T>C	c.(1552-1554)caT>caC	p.H518H	ZFP82_ENST00000392171.1_Silent_p.H518H	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H518H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TAAGGTGTGAATGTTGCCTAA	0.323																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	54.0	54.0					19																	36883688		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.1554T>C	19.37:g.36883688A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC63|Q8TF53	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H518	ENST00000392161.3	37	c.1554	CCDS12493.1	19																																																																																			ZFP82	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181007		0.323	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFP82	HGNC	protein_coding	OTTHUMT00000109552.2	109	0.00	0	A	NM_133466		36883688	36883688	-1	no_errors	ENST00000392161	ensembl	human	known	69_37n	silent	120	20.00	30	SNP	0.046	G
ZMYM4	9202	genome.wustl.edu	37	1	35835672	35835672	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr1:35835672C>G	ENST00000314607.6	+	6	963	c.883C>G	c.(883-885)Ctg>Gtg	p.L295V	ZMYM4_ENST00000482131.1_3'UTR|ZMYM4_ENST00000373297.2_Missense_Mutation_p.L295V	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	295					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L295V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGAGGGGGAACTGAAAATTAG	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	75.0	76.0					1																	35835672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.883C>G	1.37:g.35835672C>G	ENSP00000322915:p.Leu295Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH	p.L295V	ENST00000314607.6	37	c.883	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.69|18.69	3.677937|3.677937	0.68042|0.68042	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	T;T|.	0.27720|.	1.74;1.65|.	5.63|5.63	4.72|4.72	0.59763|0.59763	.|.	0.103621|.	0.43260|.	D|.	0.000584|.	T|T	0.61874|0.61874	0.2382|0.2382	L|L	0.57536|0.57536	1.79|1.79	0.36258|0.36258	D|D	0.854363|0.854363	B|.	0.32051|.	0.354|.	B|.	0.36092|.	0.217|.	T|T	0.67745|0.67745	-0.5591|-0.5591	10|5	0.27082|.	T|.	0.32|.	-6.1376|-6.1376	10.6345|10.6345	0.45556|0.45556	0.0:0.854:0.0:0.146|0.0:0.854:0.0:0.146	.|.	295|.	Q5VZL5|.	ZMYM4_HUMAN|.	V|S	295|43	ENSP00000322915:L295V;ENSP00000362394:L295V|.	ENSP00000322915:L295V|.	L|T	+|+	1|2	2|0	ZMYM4|ZMYM4	35608259|35608259	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.367000|2.367000	0.44213|0.44213	1.386000|1.386000	0.46466|0.46466	0.591000|0.591000	0.81541|0.81541	CTG|ACT	ZMYM4	-	NULL	ENSG00000146463		0.348	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3	86	0.00	0	C	NM_005095		35835672	35835672	+1	no_errors	ENST00000314607	ensembl	human	known	69_37n	missense	90	11.76	12	SNP	1.000	G
ZNF131	7690	genome.wustl.edu	37	5	43174618	43174618	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr5:43174618C>A	ENST00000399534.1	+	7	1299	c.1255C>A	c.(1255-1257)Ccc>Acc	p.P419T	ZNF131_ENST00000505606.2_Missense_Mutation_p.P385T|ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000509156.1_Missense_Mutation_p.P419T|ZNF131_ENST00000509634.1_Missense_Mutation_p.P385T|ZNF131_ENST00000306938.4_Missense_Mutation_p.P385T			P52739	ZN131_HUMAN	zinc finger protein 131	419					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P385T(1)		breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						TGGAGATAAACCCAACCATTG	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	57.0	59.0					5																	43174618		1885	4106	5991	-	-	-	SO:0001583	missense	0			U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.1255C>A	5.37:g.43174618C>A	ENSP00000382450:p.Pro419Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRL3|Q6PIF0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P419T	ENST00000399534.1	37	c.1255		5	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695189	0.68386	.	.	ENSG00000172262	ENST00000509156;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	5.47	5.47	0.80525	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.43478	0.1249	M	0.65677	2.01	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.24548	-1.0157	10	0.59425	D	0.04	-5.9483	19.3221	0.94246	0.0:1.0:0.0:0.0	.	419;385	P52739;P52739-2	ZN131_HUMAN;.	T	419;385;419;385;385	ENSP00000426504:P419T;ENSP00000305804:P385T;ENSP00000382450:P419T;ENSP00000423945:P385T;ENSP00000421246:P385T	ENSP00000305804:P385T	P	+	1	0	ZNF131	43210375	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.373000	0.79623	2.555000	0.86185	0.460000	0.39030	CCC	ZNF131	-	pfscan_Znf_C2H2	ENSG00000172262		0.383	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	ZNF131	HGNC	protein_coding	OTTHUMT00000367982.1	58	0.00	0	C	NM_003432		43174618	43174618	+1	no_errors	ENST00000399534	ensembl	human	known	69_37n	missense	82	19.61	20	SNP	1.000	A
ZNF334	55713	genome.wustl.edu	37	20	45130495	45130495	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr20:45130495C>A	ENST00000347606.4	-	5	1665	c.1483G>T	c.(1483-1485)Ggt>Tgt	p.G495C	ZNF334_ENST00000457685.2_Missense_Mutation_p.G457C|ZNF334_ENST00000593880.1_Missense_Mutation_p.G518C	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	495					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G495C(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				GAGATTCTACCACATTTATTA	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											130.0	123.0	125.0					20																	45130495		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1483G>T	20.37:g.45130495C>A	ENSP00000255129:p.Gly495Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G495C	ENST00000347606.4	37	c.1483	CCDS33480.1	20	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523354	0.27299	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.09073	3.27;3.02	3.45	0.324	0.15898	.	.	.	.	.	T	0.22742	0.0549	M	0.76328	2.33	0.27844	N	0.940997	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.70016	0.952;0.952;0.967	T	0.05716	-1.0868	9	0.87932	D	0	.	6.6375	0.22891	0.0:0.6418:0.0:0.3582	.	457;495;518	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	C	457;495	ENSP00000402582:G457C;ENSP00000255129:G495C	ENSP00000255129:G495C	G	-	1	0	ZNF334	44563902	0.001000	0.12720	0.000000	0.03702	0.144000	0.21451	0.796000	0.26986	-0.025000	0.13918	0.591000	0.81541	GGT	ZNF334	-	NULL	ENSG00000198185		0.388	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF334	HGNC	protein_coding	OTTHUMT00000079575.1	116	0.00	0	C			45130495	45130495	-1	no_errors	ENST00000347606	ensembl	human	known	69_37n	missense	152	13.64	24	SNP	0.983	A
ZSCAN1	284312	genome.wustl.edu	37	19	58564986	58564986	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr19:58564986T>C	ENST00000282326.1	+	6	1041	c.794T>C	c.(793-795)cTc>cCc	p.L265P		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	265					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)	p.L265P(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CAGCCATCCCTCAAGCACACC	0.632																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	71.0	70.0					19																	58564986		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.794T>C	19.37:g.58564986T>C	ENSP00000282326:p.Leu265Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L265P	ENST00000282326.1	37	c.794	CCDS12969.1	19	.	.	.	.	.	.	.	.	.	.	T	1.960	-0.439069	0.04636	.	.	ENSG00000152467	ENST00000282326	T	0.04654	3.58	1.14	1.14	0.20703	.	.	.	.	.	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B	0.32893	0.389	B	0.26770	0.073	T	0.46735	-0.9170	9	0.28530	T	0.3	.	4.482	0.11771	0.0:0.0:0.0:1.0	.	265	Q8NBB4	ZSCA1_HUMAN	P	265	ENSP00000282326:L265P	ENSP00000282326:L265P	L	+	2	0	ZSCAN1	63256798	0.000000	0.05858	0.015000	0.15790	0.032000	0.12392	0.113000	0.15499	0.774000	0.33427	0.402000	0.26972	CTC	ZSCAN1	-	NULL	ENSG00000152467		0.632	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	HGNC	protein_coding	OTTHUMT00000466427.1	49	0.00	0	T	NM_182572		58564986	58564986	+1	no_errors	ENST00000282326	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.003	C
ZSCAN23	222696	genome.wustl.edu	37	6	28403825	28403825	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AN-A0XN-01A-21D-A10G-09	TCGA-AN-A0XN-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	94a6c172-25e2-4438-945c-9b310f89ae22	b840005e-ca83-4444-ad1d-e3e263ae4fed	g.chr6:28403825G>T	ENST00000289788.4	-	2	364	c.219C>A	c.(217-219)tgC>tgA	p.C73*	ZSCAN23_ENST00000486481.1_Intron	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	73	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C73*(1)		breast(1)|prostate(1)|stomach(2)	4						GCCACTGATGGCAGAGCTCCT	0.577																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											42.0	42.0	42.0					6																	28403825		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.219C>A	6.37:g.28403825G>T	ENSP00000289788:p.Cys73*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96KV9	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.C73*	ENST00000289788.4	37	c.219	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530541	0.85706	.	.	ENSG00000187987	ENST00000289788	.	.	.	3.6	3.6	0.41247	.	0.000000	0.51477	D	0.000096	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5359	0.61646	0.0:0.0:1.0:0.0	.	.	.	.	X	73	.	ENSP00000289788:C73X	C	-	3	2	ZSCAN23	28511804	0.697000	0.27767	0.990000	0.47175	0.997000	0.91878	0.339000	0.19875	2.272000	0.75746	0.557000	0.71058	TGC	ZSCAN23	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000187987		0.577	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	102	0.00	0	G	XM_167147		28403825	28403825	-1	no_errors	ENST00000289788	ensembl	human	known	69_37n	nonsense	96	15.04	17	SNP	0.985	T
