#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANKMY1	51281	genome.wustl.edu	37	2	241468736	241468736	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr2:241468736G>A	ENST00000272972.3	-	4	618	c.404C>T	c.(403-405)tCa>tTa	p.S135L	ANKMY1_ENST00000403283.1_Intron|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000401804.1_Missense_Mutation_p.S224L|ANKMY1_ENST00000405002.1_Intron|ANKMY1_ENST00000391987.1_Missense_Mutation_p.S135L|ANKMY1_ENST00000373320.4_Intron|ANKMY1_ENST00000361678.4_Intron|ANKMY1_ENST00000462004.1_Intron|ANKMY1_ENST00000536462.1_Intron|ANKMY1_ENST00000373318.2_Intron|ANKMY1_ENST00000405523.3_Intron	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	135							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		CTCCTCTTCTGAGAGGCTGAT	0.537																																						dbGAP											0													70.0	70.0	70.0					2																	241468736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.404C>T	2.37:g.241468736G>A	ENSP00000272972:p.Ser135Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_MORN,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_MORN,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.S135L	ENST00000272972.3	37	c.404	CCDS2536.1	2	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261793	0.39995	.	.	ENSG00000144504	ENST00000272972;ENST00000391987;ENST00000401804;ENST00000539830;ENST00000418708	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	4.91	2.03	0.26663	.	0.818059	0.10630	N	0.652310	T	0.37433	0.1003	M	0.72118	2.19	0.09310	N	1	P;P	0.39282	0.666;0.666	B;B	0.35039	0.194;0.194	T	0.22906	-1.0203	10	0.40728	T	0.16	-11.2494	6.0426	0.19742	0.1808:0.1597:0.6594:0.0	.	135;135	Q4ZFV3;Q9P2S6	.;ANKY1_HUMAN	L	135;135;224;135;135	ENSP00000272972:S135L;ENSP00000375847:S135L;ENSP00000385887:S224L;ENSP00000407015:S135L	ENSP00000272972:S135L	S	-	2	0	ANKMY1	241117409	0.006000	0.16342	0.006000	0.13384	0.027000	0.11550	1.532000	0.36029	0.575000	0.29434	0.655000	0.94253	TCA	ANKMY1	-	NULL	ENSG00000144504		0.537	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKMY1	HGNC	protein_coding	OTTHUMT00000257187.2	105	0.00	0	G	NM_017844		241468736	241468736	-1	no_errors	ENST00000272972	ensembl	human	known	69_37n	missense	78	27.10	29	SNP	0.002	A
BAG3	9531	genome.wustl.edu	37	10	121429471	121429471	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr10:121429471C>T	ENST00000369085.3	+	2	595	c.289C>T	c.(289-291)Cct>Tct	p.P97S		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	97					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)				endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		CATTCCCATTCCTGTGCTCCA	0.637																																						dbGAP											0													127.0	127.0	127.0					10																	121429471		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.289C>T	10.37:g.121429471C>T	ENSP00000358081:p.Pro97Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L8|Q3B763|Q9NT20|Q9P120	Missense_Mutation	SNP	pfam_BAG_domain,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_BAG_domain,pfscan_BAG_domain,pfscan_WW_Rsp5_WWP	p.P97S	ENST00000369085.3	37	c.289	CCDS7615.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912427	0.92178	.	.	ENSG00000151929	ENST00000369085;ENST00000450186	D;D	0.91740	-1.8;-2.9	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.95974	0.8689	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95758	0.8798	10	0.54805	T	0.06	-10.6369	19.1934	0.93677	0.0:1.0:0.0:0.0	.	97;97	O95817;Q53GY1	BAG3_HUMAN;.	S	97;39	ENSP00000358081:P97S;ENSP00000410036:P39S	ENSP00000358081:P97S	P	+	1	0	BAG3	121419461	1.000000	0.71417	0.819000	0.32651	0.870000	0.49936	7.059000	0.76684	2.536000	0.85505	0.561000	0.74099	CCT	BAG3	-	NULL	ENSG00000151929		0.637	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG3	HGNC	protein_coding	OTTHUMT00000050662.1	66	0.00	0	C	NM_004281		121429471	121429471	+1	no_errors	ENST00000369085	ensembl	human	known	69_37n	missense	30	31.82	14	SNP	1.000	T
CDCA2	157313	genome.wustl.edu	37	8	25325771	25325771	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr8:25325771T>C	ENST00000330560.3	+	6	1054	c.577T>C	c.(577-579)Ttc>Ctc	p.F193L	CDCA2_ENST00000380665.3_Missense_Mutation_p.F178L	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	193					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		GCAGTCTGGGTTCCCTGCAGT	0.403																																						dbGAP											0													58.0	58.0	58.0					8																	25325771		2203	4300	6503	-	-	-	SO:0001583	missense	0			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.577T>C	8.37:g.25325771T>C	ENSP00000328228:p.Phe193Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.F193L	ENST00000330560.3	37	c.577	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	T	11.80	1.747727	0.30955	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.36157	1.27;1.28	5.21	1.3	0.21679	.	0.595457	0.17077	N	0.187950	T	0.28366	0.0701	M	0.72118	2.19	0.09310	N	1	B;B;B	0.13594	0.008;0.008;0.008	B;B;B	0.13407	0.009;0.009;0.009	T	0.25363	-1.0134	10	0.13470	T	0.59	-2.0151	2.8147	0.05452	0.1879:0.2113:0.0:0.6007	.	193;178;193	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	L	193;178	ENSP00000328228:F193L;ENSP00000370040:F178L	ENSP00000328228:F193L	F	+	1	0	CDCA2	25381688	0.003000	0.15002	0.001000	0.08648	0.118000	0.20060	0.752000	0.26362	0.380000	0.24823	0.482000	0.46254	TTC	CDCA2	-	NULL	ENSG00000184661		0.403	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	20	0.00	0	T	NM_152562		25325771	25325771	+1	no_errors	ENST00000330560	ensembl	human	known	69_37n	missense	57	29.63	24	SNP	0.000	C
UPK3B	80761	genome.wustl.edu	37	7	76631509	76631509	+	Intron	SNP	C	C	T	rs7784461	byFrequency	TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr7:76631509C>T	ENST00000419923.2	+	6	1408				UPK3B_ENST00000443097.2_Intron|DTX2P1-UPK3BP1-PMS2P11_ENST00000584900.1_RNA			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				AGAAGCTGTCCGCAGCGTCTG	0.602																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-16632C>T	7.37:g.76631509C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			DTX2P1-UPK3BP1-PMS2P11	-	-	ENSG00000265479		0.602	UPK3B-201	KNOWN	basic|CCDS	protein_coding	DTX2P1-UPK3BP1-PMS2P11	HGNC	protein_coding		10	0.00	0	C	NM_030570		76631509	76631509	+1	no_errors	ENST00000579700	ensembl	human	known	69_37n	rna	12	40.00	8	SNP	0.488	T
FAM124A	220108	genome.wustl.edu	37	13	51855020	51855020	+	Silent	SNP	G	G	C			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr13:51855020G>C	ENST00000322475.8	+	4	1404	c.1269G>C	c.(1267-1269)tcG>tcC	p.S423S	FAM124A_ENST00000280057.6_Silent_p.S459S	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	423										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		TGTCCTCATCGGACCTGTCTG	0.612																																						dbGAP											0													52.0	53.0	53.0					13																	51855020		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.1269G>C	13.37:g.51855020G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A324|Q8N8P9|Q8NE66|Q96NJ9	Silent	SNP	NULL	p.S459	ENST00000322475.8	37	c.1377	CCDS55900.1	13																																																																																			FAM124A	-	NULL	ENSG00000150510		0.612	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM124A	HGNC	protein_coding	OTTHUMT00000045019.3	19	0.00	0	G	NM_145019		51855020	51855020	+1	no_errors	ENST00000280057	ensembl	human	known	69_37n	silent	22	43.59	17	SNP	0.748	C
GALNT6	11226	genome.wustl.edu	37	12	51771043	51771043	+	Silent	SNP	G	G	A			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr12:51771043G>A	ENST00000543196.2	-	3	805	c.600C>T	c.(598-600)gtC>gtT	p.V200V	GALNT6_ENST00000603203.1_5'Flank|GALNT6_ENST00000356317.3_Silent_p.V200V			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	200	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TGGTGTGTAGGACGCTGTACA	0.617																																						dbGAP											0													140.0	108.0	119.0					12																	51771043		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.600C>T	12.37:g.51771043G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V200	ENST00000543196.2	37	c.600	CCDS8813.1	12																																																																																			GALNT6	-	pfam_Glyco_trans_2	ENSG00000139629		0.617	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GALNT6	HGNC	protein_coding	OTTHUMT00000469735.1	121	0.00	0	G	NM_007210		51771043	51771043	-1	no_errors	ENST00000356317	ensembl	human	known	69_37n	silent	68	29.90	29	SNP	1.000	A
GRIPAP1	56850	genome.wustl.edu	37	X	48837669	48837669	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chrX:48837669C>T	ENST00000376441.1	-	21	1922	c.1888G>A	c.(1888-1890)Gag>Aag	p.E630K	GRIPAP1_ENST00000376423.4_Missense_Mutation_p.E551K|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.E585K|GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.E599K	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	630						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						TGCAGTCGCTCCTGCAGCTTA	0.622																																						dbGAP											0													88.0	60.0	70.0					X																	48837669		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1888G>A	X.37:g.48837669C>T	ENSP00000365624:p.Glu630Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E630K	ENST00000376441.1	37	c.1888	CCDS35248.1	X	.	.	.	.	.	.	.	.	.	.	c	21.9	4.219182	0.79464	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T	0.52526	0.66	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.60753	0.2293	L	0.57536	1.79	0.49389	D	0.999781	P;D;D	0.71674	0.515;0.998;0.998	B;D;D	0.80764	0.189;0.994;0.994	T	0.56275	-0.8006	10	0.07990	T	0.79	-11.6502	15.1121	0.72365	0.0:1.0:0.0:0.0	.	551;520;630	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	K	599;585;630;599;551	ENSP00000365608:E599K	ENSP00000365606:E551K	E	-	1	0	GRIPAP1	48722613	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	6.825000	0.75293	2.272000	0.75746	0.553000	0.69018	GAG	GRIPAP1	-	NULL	ENSG00000068400		0.622	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2	136	0.00	0	C	NM_207672		48837669	48837669	-1	no_errors	ENST00000376441	ensembl	human	known	69_37n	missense	75	29.25	31	SNP	1.000	T
MROH7	374977	genome.wustl.edu	37	1	55118602	55118602	+	Start_Codon_SNP	SNP	G	G	A			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr1:55118602G>A	ENST00000421030.2	+	3	288	c.3G>A	c.(1-3)atG>atA	p.M1I	MROH7_ENST00000545244.1_Intron|MROH7_ENST00000339553.5_Start_Codon_SNP_p.M1I|MROH7_ENST00000409996.1_Intron|MROH7-TTC4_ENST00000414150.2_Start_Codon_SNP_p.M1I|MROH7_ENST00000472987.1_3'UTR|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000395690.2_Start_Codon_SNP_p.M1I	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GACTGGACATGGCCCTGAGTC	0.562																																						dbGAP											0													66.0	65.0	65.0					1																	55118602		1994	4163	6157	-	-	-	SO:0001582	initiator_codon_variant	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3G>A	1.37:g.55118602G>A	ENSP00000396622:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M1I	ENST00000421030.2	37	c.3	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870549	0.91587	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000339553;ENST00000395690	T;T;T	0.03607	4.39;3.87;3.87	3.58	3.58	0.41010	.	.	.	.	.	T	0.07007	0.0178	.	.	.	0.80722	D	1	P;B;P	0.50819	0.597;0.341;0.939	B;B;P	0.47044	0.133;0.08;0.535	T	0.10451	-1.0629	8	0.87932	D	0	.	10.9666	0.47416	0.0:0.0:1.0:0.0	.	1;1;1	F8W8P2;Q68CQ1;Q68CQ1-4	.;HEAT8_HUMAN;.	I	1	ENSP00000396622:M1I;ENSP00000343211:M1I;ENSP00000379044:M1I	ENSP00000343211:M1I	M	+	3	0	HEATR8	54891190	0.999000	0.42202	0.882000	0.34594	0.770000	0.43624	2.722000	0.47269	2.293000	0.77203	0.561000	0.74099	ATG	HEATR8	-	NULL	ENSG00000184313		0.562	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	19	0.00	0	G	NM_198547	Missense_Mutation	55118602	55118602	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	missense	12	57.14	16	SNP	0.901	A
IL1R2	7850	genome.wustl.edu	37	2	102625086	102625089	+	Frame_Shift_Del	DEL	CAGC	CAGC	-			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	CAGC	CAGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr2:102625086_102625089delCAGC	ENST00000332549.3	+	2	278_281	c.49_52delCAGC	c.(49-54)cagcctfs	p.QP17fs	IL1R2_ENST00000393414.2_Frame_Shift_Del_p.QP17fs|IL1R2_ENST00000441002.1_Frame_Shift_Del_p.QP17fs	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	17					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.Q17K(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						CTTCACCCTTCAGCCTGCGGCACA	0.5																																					Pancreas(106;189 1628 2302 5133 12295)	dbGAP											1	Substitution - Missense(1)	kidney(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.49_52delCAGC	2.37:g.102625086_102625089delCAGC	ENSP00000330959:p.Gln17fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVJ5|Q6LCE6|Q9UE68	Frame_Shift_Del	DEL	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like,prints_Interleukin-1_rcpt_II,prints_IL1_rcpt_I/II	p.Q17fs	ENST00000332549.3	37	c.49_52	CCDS2054.1	2																																																																																			IL1R2	-	NULL	ENSG00000115590		0.500	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1R2	HGNC	protein_coding	OTTHUMT00000253191.1	54	0.00	0	CAGC	NM_004633		102625086	102625089	+1	no_errors	ENST00000332549	ensembl	human	known	69_37n	frame_shift_del	87	29.84	37	DEL	0.012:0.005:0.008:0.006	-
IL1R2	7850	genome.wustl.edu	37	2	102625095	102625095	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr2:102625095G>A	ENST00000332549.3	+	2	287	c.58G>A	c.(58-60)Gca>Aca	p.A20T	IL1R2_ENST00000393414.2_Missense_Mutation_p.A20T|IL1R2_ENST00000441002.1_Missense_Mutation_p.A20T	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	20	Ig-like C2-type 1.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						TCAGCCTGCGGCACACACAGG	0.488																																					Pancreas(106;189 1628 2302 5133 12295)	dbGAP											0													204.0	184.0	191.0					2																	102625095		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.58G>A	2.37:g.102625095G>A	ENSP00000330959:p.Ala20Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like,prints_Interleukin-1_rcpt_II,prints_IL1_rcpt_I/II	p.A20T	ENST00000332549.3	37	c.58	CCDS2054.1	2	.	.	.	.	.	.	.	.	.	.	G	10.26	1.300911	0.23650	.	.	ENSG00000115590	ENST00000332549;ENST00000393414;ENST00000457817;ENST00000441002	T;T;T;T	0.33438	2.16;2.16;1.41;2.17	4.74	3.85	0.44370	Immunoglobulin-like (1);	1.056680	0.07420	N	0.893781	T	0.14570	0.0352	N	0.08118	0	0.09310	N	1	B	0.29716	0.255	B	0.23275	0.045	T	0.08452	-1.0721	10	0.13853	T	0.58	.	8.1925	0.31376	0.1082:0.0:0.8918:0.0	.	20	P27930	IL1R2_HUMAN	T	20	ENSP00000330959:A20T;ENSP00000377066:A20T;ENSP00000408415:A20T;ENSP00000414611:A20T	ENSP00000330959:A20T	A	+	1	0	IL1R2	101991527	0.000000	0.05858	0.066000	0.19879	0.011000	0.07611	0.569000	0.23638	2.348000	0.79779	0.462000	0.41574	GCA	IL1R2	-	pfscan_Ig-like	ENSG00000115590		0.488	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1R2	HGNC	protein_coding	OTTHUMT00000253191.1	53	0.00	0	G	NM_004633		102625095	102625095	+1	no_errors	ENST00000332549	ensembl	human	known	69_37n	missense	71	36.61	41	SNP	0.082	A
LRRK2	120892	genome.wustl.edu	37	12	40714892	40714892	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr12:40714892T>C	ENST00000298910.7	+	35	5130	c.5072T>C	c.(5071-5073)aTc>aCc	p.I1691T		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1691					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCTGAAATTATCATCCGACTA	0.398																																						dbGAP											0													193.0	187.0	189.0					12																	40714892		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5072T>C	12.37:g.40714892T>C	ENSP00000298910:p.Ile1691Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.I1691T	ENST00000298910.7	37	c.5072	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690863	0.88735	.	.	ENSG00000188906	ENST00000298910	T	0.74106	-0.81	5.81	5.81	0.92471	.	0.050335	0.85682	D	0.000000	T	0.77651	0.4162	L	0.52126	1.63	0.58432	D	0.999999	D;P	0.54601	0.967;0.728	P;B	0.51079	0.658;0.215	T	0.80013	-0.1560	10	0.66056	D	0.02	.	16.1562	0.81670	0.0:0.0:0.0:1.0	.	1691;1691	Q17RV3;Q5S007	.;LRRK2_HUMAN	T	1691	ENSP00000298910:I1691T	ENSP00000298910:I1691T	I	+	2	0	LRRK2	39001159	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.699000	0.68310	2.210000	0.71456	0.533000	0.62120	ATC	LRRK2	-	NULL	ENSG00000188906		0.398	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	14	0.00	0	T	XM_058513		40714892	40714892	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	missense	161	38.31	100	SNP	1.000	C
KRT18	3875	genome.wustl.edu	37	12	53344651	53344651	+	Silent	SNP	C	C	T			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr12:53344651C>T	ENST00000388835.3	+	3	828	c.618C>T	c.(616-618)ctC>ctT	p.L206L	KRT8_ENST00000552551.1_5'Flank|KRT8_ENST00000546897.1_5'Flank|AC107016.2_ENST00000581256.1_RNA|KRT18_ENST00000550600.1_Silent_p.L206L|KRT8_ENST00000549198.1_5'Flank|KRT18_ENST00000388837.2_Silent_p.L206L	NM_000224.2	NP_000215.1	P05783	K1C18_HUMAN	keratin 18	206	Coil 1B.|Necessary for interaction with PNN.|Rod.				anatomical structure morphogenesis (GO:0009653)|cell cycle (GO:0007049)|extrinsic apoptotic signaling pathway (GO:0097191)|Golgi to plasma membrane CFTR protein transport (GO:0043000)|hepatocyte apoptotic process (GO:0097284)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of apoptotic process (GO:0043066)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell periphery (GO:0071944)|centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			central_nervous_system(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	11						TCGAGGCTCTCAAGGAGGAGC	0.572																																						dbGAP											0													17.0	14.0	15.0					12																	53344651		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS31809.1	12q13	2013-01-16			ENSG00000111057	ENSG00000111057		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6430	protein-coding gene	gene with protein product		148070				1705144, 16831889	Standard	NM_000224		Approved		uc001sbg.3	P05783	OTTHUMG00000169882	ENST00000388835.3:c.618C>T	12.37:g.53344651C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53G38|Q5U0N8|Q9BW26	Silent	SNP	pfam_F,prints_Keratin_I	p.L206	ENST00000388835.3	37	c.618	CCDS31809.1	12																																																																																			KRT18	-	pfam_F	ENSG00000111057		0.572	KRT18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT18	HGNC	protein_coding	OTTHUMT00000406405.1	15	0.00	0	C	NM_199187		53344651	53344651	+1	no_errors	ENST00000388835	ensembl	human	known	69_37n	silent	10	41.18	7	SNP	1.000	T
MUC12	10071	genome.wustl.edu	37	7	100637074	100637074	+	Missense_Mutation	SNP	G	G	A	rs200730762	byFrequency	TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr7:100637074G>A	ENST00000379442.3	+	5	3659	c.3659G>A	c.(3658-3660)cGc>cAc	p.R1220H	MUC12_ENST00000536621.1_Missense_Mutation_p.R1077H			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1220	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACAACCTCACGCATCAGTCCA	0.512													g|||	147	0.029353	0.0121	0.0389	5008	,	,		29769	0.0109		0.0209	False		,,,				2504	0.0736					dbGAP											0													9.0	8.0	8.0					7																	100637074		555	1239	1794	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3659G>A	7.37:g.100637074G>A	ENSP00000368755:p.Arg1220His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.R1220H	ENST00000379442.3	37	c.3659		7	.	.	.	.	.	.	.	.	.	.	g	0.099	-1.155707	0.01686	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13657	2.57;2.57	0.713	-1.43	0.08884	.	.	.	.	.	T	0.05777	0.0151	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.33369	-0.9871	7	0.40728	T	0.16	.	3.6003	0.08021	0.0:0.2214:0.4862:0.2924	.	.	.	.	H	1220;1077	ENSP00000368755:R1220H;ENSP00000441929:R1077H	ENSP00000368755:R1220H	R	+	2	0	MUC12	100423794	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.324000	0.00512	-1.374000	0.02131	-1.406000	0.01132	CGC	MUC12	-	NULL	ENSG00000205277		0.512	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	21	0.00	0	G	XM_379904		100637074	100637074	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	0.000	A
NAV3	89795	genome.wustl.edu	37	12	78444719	78444719	+	Nonsense_Mutation	SNP	C	C	T	rs267603687		TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr12:78444719C>T	ENST00000397909.2	+	11	2481	c.2308C>T	c.(2308-2310)Cga>Tga	p.R770*	NAV3_ENST00000536525.2_Nonsense_Mutation_p.R770*|RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000228327.6_Nonsense_Mutation_p.R770*|NAV3_ENST00000266692.7_Nonsense_Mutation_p.R770*			Q8IVL0	NAV3_HUMAN	neuron navigator 3	770						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGGTACCAGTCGATTCATCCA	0.587										HNSCC(70;0.22)																												dbGAP											0													70.0	71.0	71.0					12																	78444719		2069	4206	6275	-	-	-	SO:0001587	stop_gained	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2308C>T	12.37:g.78444719C>T	ENSP00000381007:p.Arg770*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFW7|Q9Y2E7	Nonsense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.R770*	ENST00000397909.2	37	c.2308		12	.	.	.	.	.	.	.	.	.	.	C	38	6.887933	0.97912	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	.	.	.	5.79	3.96	0.45880	.	0.000000	0.34411	U	0.003996	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0344	15.2999	0.73940	0.2561:0.7439:0.0:0.0	.	.	.	.	X	770	.	ENSP00000228327:R770X	R	+	1	2	NAV3	76968850	0.996000	0.38824	0.162000	0.22713	0.311000	0.27955	2.988000	0.49386	0.780000	0.33566	-0.152000	0.13540	CGA	NAV3	-	NULL	ENSG00000067798		0.587	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	49	0.00	0	C	NM_001024383		78444719	78444719	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	nonsense	48	39.24	31	SNP	1.000	T
OR1Q1	158131	genome.wustl.edu	37	9	125377610	125377610	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr9:125377610G>A	ENST00000297913.2	+	1	663	c.594G>A	c.(592-594)atG>atA	p.M198I	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	198					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M198I(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						ACACCCTTATGATTCACACAG	0.507																																						dbGAP											1	Substitution - Missense(1)	skin(1)											144.0	139.0	140.0					9																	125377610		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.594G>A	9.37:g.125377610G>A	ENSP00000297913:p.Met198Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFN4|Q8NGR7|Q96R82	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M198I	ENST00000297913.2	37	c.594	CCDS35125.1	9	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581313	0.28180	.	.	ENSG00000165202	ENST00000297913	T	0.36157	1.27	5.47	3.61	0.41365	GPCR, rhodopsin-like superfamily (1);	0.355021	0.25019	N	0.033762	T	0.21509	0.0518	N	0.20304	0.555	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.11817	-1.0572	10	0.49607	T	0.09	-7.6293	7.1808	0.25772	0.3132:0.0:0.6868:0.0	.	198	Q15612	OR1Q1_HUMAN	I	198	ENSP00000297913:M198I	ENSP00000297913:M198I	M	+	3	0	OR1Q1	124417431	0.000000	0.05858	0.996000	0.52242	0.892000	0.51952	-0.725000	0.04942	1.547000	0.49401	0.650000	0.86243	ATG	OR1Q1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000165202		0.507	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1Q1	HGNC	protein_coding	OTTHUMT00000053946.1	92	0.00	0	G			125377610	125377610	+1	no_errors	ENST00000297913	ensembl	human	known	69_37n	missense	86	11.34	11	SNP	0.014	A
OR2T5	401993	genome.wustl.edu	37	1	248652175	248652175	+	Missense_Mutation	SNP	G	G	A	rs199519459		TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr1:248652175G>A	ENST00000366473.2	+	1	291	c.286G>A	c.(286-288)Gtc>Atc	p.V96I		NM_001004697.1	NP_001004697.1	Q6IEZ7	OR2T5_HUMAN	olfactory receptor, family 2, subfamily T, member 5	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(2)|pancreas(1)|skin(2)	9	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTGAATAAGGTCTCAGCCCC	0.498																																						dbGAP											0													6.0	10.0	9.0					1																	248652175		1715	4115	5830	-	-	-	SO:0001583	missense	0			BK004465	CCDS31118.1	1q44	2012-08-09			ENSG00000203661	ENSG00000203661		"""GPCR / Class A : Olfactory receptors"""	15017	protein-coding gene	gene with protein product							Standard	NM_001004697		Approved		uc001iem.1	Q6IEZ7	OTTHUMG00000040481	ENST00000366473.2:c.286G>A	1.37:g.248652175G>A	ENSP00000355429:p.Val96Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V96I	ENST00000366473.2	37	c.286	CCDS31118.1	1	.	.	.	.	.	.	.	.	.	.	a	0.944	-0.708606	0.03230	.	.	ENSG00000203661	ENST00000366473	T	0.00634	6.07	2.64	2.64	0.31445	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	N	0.000201	T	0.00178	0.0005	N	0.00053	-2.385	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.29088	-1.0023	9	0.02654	T	1	.	6.9965	0.24784	0.8755:0.0:0.1245:0.0	.	96	Q6IEZ7	OR2T5_HUMAN	I	96	ENSP00000355429:V96I	ENSP00000355429:V96I	V	+	1	0	OR2T5	246718798	0.983000	0.35010	0.743000	0.31040	0.975000	0.68041	3.417000	0.52714	0.106000	0.17784	-1.475000	0.01000	GTC	OR2T5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000203661		0.498	OR2T5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T5	HGNC	protein_coding	OTTHUMT00000097422.1	17	0.00	0	G	NM_001004697		248652175	248652175	+1	no_errors	ENST00000366473	ensembl	human	known	69_37n	missense	51	21.54	14	SNP	0.406	A
PACS2	23241	genome.wustl.edu	37	14	105856299	105856299	+	Splice_Site	SNP	C	C	G			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr14:105856299C>G	ENST00000325438.8	+	19	2494	c.1990C>G	c.(1990-1992)Cct>Gct	p.P664A	PACS2_ENST00000430725.2_Splice_Site_p.P589A|PACS2_ENST00000447393.1_Splice_Site_p.P668A|PACS2_ENST00000551743.1_Splice_Site_p.P178A|PACS2_ENST00000458164.2_Splice_Site_p.P679A|PACS2_ENST00000551801.1_5'Flank|PACS2_ENST00000547217.1_Splice_Site_p.P634A			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	664					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		TGCTCTTAGCCCTGACGAAGA	0.572																																						dbGAP											0													202.0	198.0	199.0					14																	105856299		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.1989-1C>G	14.37:g.105856299C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.P679A	ENST00000325438.8	37	c.2035	CCDS32168.1	14	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618071	0.66787	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217;ENST00000551743	T;T;T;T;T	0.22945	1.96;1.96;1.93;1.96;1.95	4.21	4.21	0.49690	.	0.061378	0.64402	D	0.000003	T	0.39759	0.1090	L	0.41710	1.295	0.80722	D	1	D;P;D;D	0.89917	0.967;0.537;0.99;1.0	P;B;D;D	0.87578	0.846;0.236;0.943;0.998	T	0.08371	-1.0725	10	0.20046	T	0.44	-7.6848	15.4925	0.75619	0.0:1.0:0.0:0.0	.	668;679;664;665	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	A	589;664;679;668;634;178	ENSP00000393524:P589A;ENSP00000321834:P664A;ENSP00000399732:P679A;ENSP00000393559:P668A;ENSP00000449525:P634A	ENSP00000321834:P664A	P	+	1	0	PACS2	104927344	1.000000	0.71417	0.995000	0.50966	0.709000	0.40893	5.913000	0.69957	2.062000	0.61559	0.561000	0.74099	CCT	PACS2	-	pfam_Phosphofurin_acidic_CS-1	ENSG00000179364		0.572	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PACS2	HGNC	protein_coding	OTTHUMT00000409209.1	39	0.00	0	C	XM_377355	Missense_Mutation	105856299	105856299	+1	no_errors	ENST00000458164	ensembl	human	known	69_37n	missense	127	23.03	38	SNP	1.000	G
PBXIP1	57326	genome.wustl.edu	37	1	154918213	154918213	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr1:154918213T>A	ENST00000368463.3	-	10	2008	c.1937A>T	c.(1936-1938)gAt>gTt	p.D646V	PBXIP1_ENST00000498553.1_5'Flank|PBXIP1_ENST00000368465.1_Missense_Mutation_p.D617V|PBXIP1_ENST00000542459.1_Missense_Mutation_p.D491V|PBXIP1_ENST00000539880.1_Missense_Mutation_p.D473V	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1	646					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GAAGATGCCATCCTCACCAAA	0.582																																						dbGAP											0													99.0	88.0	92.0					1																	154918213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.1937A>T	1.37:g.154918213T>A	ENSP00000357448:p.Asp646Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Missense_Mutation	SNP	NULL	p.D646V	ENST00000368463.3	37	c.1937	CCDS1074.1	1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.836552	0.50951	.	.	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000351146;ENST00000539880;ENST00000543593;ENST00000542459	T;T;T;T	0.17370	2.28;2.31;2.36;2.34	5.24	5.24	0.73138	.	0.065059	0.64402	D	0.000013	T	0.22244	0.0536	L	0.60455	1.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.79108	0.992	T	0.02774	-1.1112	10	0.30078	T	0.28	-19.3732	9.3478	0.38120	0.0:0.0:0.1805:0.8195	.	646	Q96AQ6	PBIP1_HUMAN	V	617;646;577;473;422;491	ENSP00000357450:D617V;ENSP00000357448:D646V;ENSP00000440142:D473V;ENSP00000438584:D491V	ENSP00000295523:D577V	D	-	2	0	PBXIP1	153184837	0.966000	0.33281	0.997000	0.53966	0.574000	0.36063	2.943000	0.49026	1.978000	0.57642	0.374000	0.22700	GAT	PBXIP1	-	NULL	ENSG00000163346		0.582	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PBXIP1	HGNC	protein_coding	OTTHUMT00000090943.1	48	0.00	0	T	NM_020524		154918213	154918213	-1	no_errors	ENST00000368463	ensembl	human	known	69_37n	missense	37	48.61	35	SNP	1.000	A
PCDH10	57575	genome.wustl.edu	37	4	134071406	134071406	+	Silent	SNP	C	C	T			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr4:134071406C>T	ENST00000264360.5	+	1	937	c.111C>T	c.(109-111)atC>atT	p.I37I	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	37	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGGGGAATATCGCTGAAGATC	0.507																																						dbGAP											0													131.0	124.0	127.0					4																	134071406		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.111C>T	4.37:g.134071406C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I37	ENST00000264360.5	37	c.111	CCDS34063.1	4																																																																																			PCDH10	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000138650		0.507	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	31	0.00	0	C	NM_032961		134071406	134071406	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	silent	52	16.13	10	SNP	1.000	T
PHF19	26147	genome.wustl.edu	37	9	123629214	123629214	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr9:123629214C>G	ENST00000373896.3	-	7	896	c.644G>C	c.(643-645)cGg>cCg	p.R215P	PHF19_ENST00000419155.1_Missense_Mutation_p.R6P|PHF19_ENST00000487555.1_5'UTR	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	215					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTGCCTGCACCGGTAACATTG	0.582																																						dbGAP											0													84.0	70.0	75.0					9																	123629214		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.644G>C	9.37:g.123629214C>G	ENSP00000363003:p.Arg215Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD	p.R215P	ENST00000373896.3	37	c.644	CCDS35116.1	9	.	.	.	.	.	.	.	.	.	.	C	32	5.187009	0.94923	.	.	ENSG00000119403	ENST00000544082;ENST00000373896;ENST00000419155;ENST00000453868;ENST00000439674	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	5.24	5.24	0.73138	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.44052	0.1275	M	0.77103	2.36	0.80722	D	1	P	0.38597	0.639	P	0.46685	0.524	T	0.45731	-0.9241	10	0.66056	D	0.02	-20.4395	17.8211	0.88651	0.0:1.0:0.0:0.0	.	215	Q5T6S3	PHF19_HUMAN	P	215;215;6;6;6	ENSP00000363003:R215P;ENSP00000407433:R6P;ENSP00000395938:R6P;ENSP00000404655:R6P	ENSP00000363003:R215P	R	-	2	0	PHF19	122669035	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.797000	0.62503	2.439000	0.82584	0.563000	0.77884	CGG	PHF19	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	ENSG00000119403		0.582	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF19	HGNC	protein_coding	OTTHUMT00000053838.3	44	0.00	0	C	XM_045308		123629214	123629214	-1	no_errors	ENST00000373896	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	1.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178928079	178928079	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr3:178928079G>A	ENST00000263967.3	+	8	1514	c.1357G>A	c.(1357-1359)Gaa>Aaa	p.E453K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	453	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		E -> Q (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).|Missing (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E453K(11)|p.E453Q(5)|p.H450fs*9(1)|p.G451_L456>V(1)|p.P449_L455del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCATGGATTAGAAGATTTGCT	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	19	Substitution - Missense(16)|Complex - frameshift(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	endometrium(8)|breast(6)|lung(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)											137.0	130.0	132.0					3																	178928079		1829	4090	5919	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1357G>A	3.37:g.178928079G>A	ENSP00000263967:p.Glu453Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E453K	ENST00000263967.3	37	c.1357	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.164616	0.94727	.	.	ENSG00000121879	ENST00000263967	T	0.71103	-0.54	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77130	0.4085	M	0.68317	2.08	0.80722	D	1	P	0.50528	0.936	P	0.50970	0.655	T	0.72500	-0.4274	10	0.20046	T	0.44	-22.2286	19.6973	0.96031	0.0:0.0:1.0:0.0	.	453	P42336	PK3CA_HUMAN	K	453	ENSP00000263967:E453K	ENSP00000263967:E453K	E	+	1	0	PIK3CA	180410773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.448000	0.97600	2.674000	0.91012	0.655000	0.94253	GAA	PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000121879		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	11	0.00	0	G			178928079	178928079	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	110	56.52	143	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	8	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	94	46.89	83	SNP	1.000	A
PHB2	11331	genome.wustl.edu	37	12	7076766	7076766	+	Intron	SNP	C	C	T			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr12:7076766C>T	ENST00000535923.1	-	6	993				PHB2_ENST00000440277.1_Intron|PHB2_ENST00000542912.1_Intron|SCARNA12_ENST00000459155.1_RNA|U47924.29_ENST00000606539.1_RNA|PHB2_ENST00000399433.2_Intron|PHB2_ENST00000546111.1_Intron|PHB2_ENST00000544134.1_5'Flank	NM_001144831.1	NP_001138303.1			prohibitin 2											ovary(2)|pancreas(1)	3						GTCTCATCAGCCTGCCCATGA	0.567																																						dbGAP											0													74.0	73.0	73.0					12																	7076766		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AF126021	CCDS53741.1, CCDS58207.1	12p13	2013-03-11			ENSG00000215021	ENSG00000215021			30306	protein-coding gene	gene with protein product		610704				11302691, 9259555	Standard	NM_001144831		Approved	REA, BCAP37, Bap37, p22	uc021quf.1	Q99623	OTTHUMG00000168519	ENST00000535923.1:c.711+72G>A	12.37:g.7076766C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000535923.1	37	NULL	CCDS53741.1	12																																																																																			SCARNA12	-	-	ENSG00000238795		0.567	PHB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCARNA12	HGNC	protein_coding	OTTHUMT00000400040.3	25	0.00	0	C	NM_007273		7076766	7076766	-1	no_errors	ENST00000459155	ensembl	human	known	69_37n	rna	26	35.00	14	SNP	0.968	T
SNRNP200	23020	genome.wustl.edu	37	2	96964156	96964156	+	Silent	SNP	A	A	G			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr2:96964156A>G	ENST00000323853.5	-	9	1062	c.985T>C	c.(985-987)Tta>Cta	p.L329L	SNRNP200_ENST00000349783.5_Silent_p.L329L	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	329					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GTACAGTATAAAACTACCCAC	0.418																																						dbGAP											0													76.0	78.0	78.0					2																	96964156		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.985T>C	2.37:g.96964156A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L329	ENST00000323853.5	37	c.985	CCDS2020.1	2																																																																																			SNRNP200	-	NULL	ENSG00000144028		0.418	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	42	0.00	0	A	NM_014014		96964156	96964156	-1	no_errors	ENST00000323853	ensembl	human	known	69_37n	silent	155	32.90	76	SNP	1.000	G
TBC1D3P2	440452	genome.wustl.edu	37	17	60342663	60342663	+	RNA	SNP	G	G	A	rs201034916	byFrequency	TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr17:60342663G>A	ENST00000581291.1	-	0	1490									TBC1 domain family, member 3 pseudogene 2											breast(2)|kidney(1)|lung(2)	5						TCATAACGGCGGAACCAAGGG	0.647													.|||	379	0.0756789	0.1528	0.085	5008	,	,		17074	0.005		0.0736	False		,,,				2504	0.0399					dbGAP											0																																										-	-	-			0					17q23.2	2009-05-14				ENSG00000188755			27783	pseudogene	pseudogene							Standard	NR_027486		Approved		uc002izq.2				17.37:g.60342663G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581291.1	37	NULL		17																																																																																			TBC1D3P2	-	-	ENSG00000188755		0.647	TBC1D3P2-002	KNOWN	basic	processed_transcript	TBC1D3P2	HGNC	pseudogene	OTTHUMT00000445021.1	10	0.00	0	G	NR_027486		60342663	60342663	-1	no_errors	ENST00000339120	ensembl	human	known	69_37n	rna	6	50.00	6	SNP	0.003	A
TBC1D4	9882	genome.wustl.edu	37	13	76055696	76055696	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr13:76055696C>T	ENST00000377636.3	-	1	554	c.208G>A	c.(208-210)Gag>Aag	p.E70K	TBC1D4_ENST00000431480.2_Missense_Mutation_p.E70K|TBC1D4_ENST00000377625.2_Missense_Mutation_p.E70K|TBC1D4_ENST00000425511.1_5'UTR	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	70	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		ccgcccgccTCGGGCTTCTGG	0.751																																						dbGAP											0													6.0	8.0	7.0					13																	76055696		1720	3883	5603	-	-	-	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.208G>A	13.37:g.76055696C>T	ENSP00000366863:p.Glu70Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.E70K	ENST00000377636.3	37	c.208	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331713	0.60853	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.30981	1.51;1.51;1.51	3.95	3.95	0.45737	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.390542	0.20292	N	0.095202	T	0.20414	0.0491	L	0.29908	0.895	0.80722	D	1	B;P;P	0.43909	0.003;0.821;0.727	B;B;B	0.33339	0.002;0.162;0.078	T	0.07481	-1.0770	10	0.28530	T	0.3	-5.6865	16.1706	0.81812	0.0:1.0:0.0:0.0	.	70;70;70	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	K	70	ENSP00000366863:E70K;ENSP00000395986:E70K;ENSP00000366852:E70K	ENSP00000366852:E70K	E	-	1	0	TBC1D4	74953697	0.127000	0.22367	0.994000	0.49952	0.960000	0.62799	0.746000	0.26275	2.017000	0.59298	0.561000	0.74099	GAG	TBC1D4	-	smart_PTyr_interaction_dom	ENSG00000136111		0.751	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	15	0.00	0	C	NM_014832		76055696	76055696	-1	no_errors	ENST00000377636	ensembl	human	known	69_37n	missense	2	81.82	9	SNP	0.998	T
TTC27	55622	genome.wustl.edu	37	2	32889484	32889484	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr2:32889484A>G	ENST00000317907.4	+	6	986	c.755A>G	c.(754-756)gAt>gGt	p.D252G		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	252										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						AAAGCAAAAGATCAGTTGGAT	0.289																																						dbGAP											0													100.0	103.0	102.0					2																	32889484		2202	4296	6498	-	-	-	SO:0001583	missense	0			BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.755A>G	2.37:g.32889484A>G	ENSP00000313953:p.Asp252Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D252G	ENST00000317907.4	37	c.755	CCDS33176.1	2	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486766	0.26686	.	.	ENSG00000018699	ENST00000317907	T	0.59638	0.25	4.67	4.67	0.58626	.	0.160833	0.52532	D	0.000070	T	0.54581	0.1867	M	0.62723	1.935	0.37862	D	0.929748	B	0.18013	0.025	B	0.21708	0.036	T	0.56541	-0.7962	10	0.30078	T	0.28	-5.378	13.3868	0.60801	1.0:0.0:0.0:0.0	.	252	Q6P3X3	TTC27_HUMAN	G	252	ENSP00000313953:D252G	ENSP00000313953:D252G	D	+	2	0	TTC27	32742988	1.000000	0.71417	0.996000	0.52242	0.144000	0.21451	7.060000	0.76692	1.869000	0.54173	0.533000	0.62120	GAT	TTC27	-	NULL	ENSG00000018699		0.289	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC27	HGNC	protein_coding	OTTHUMT00000325395.1	9	0.00	0	A	NM_017735		32889484	32889484	+1	no_errors	ENST00000317907	ensembl	human	known	69_37n	missense	165	23.96	52	SNP	1.000	G
VPS72	6944	genome.wustl.edu	37	1	151162528	151162528	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr1:151162528C>T	ENST00000354473.4	-	1	106	c.70G>A	c.(70-72)Gag>Aag	p.E24K	VPS72_ENST00000496809.1_Intron			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	24	Asp/Glu-rich (acidic).				chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCTTCCTCCTCTGCCTCCAAA	0.617																																					Pancreas(109;1131 2287 3209 24201)	dbGAP											0													99.0	110.0	106.0					1																	151162528		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.70G>A	1.37:g.151162528C>T	ENSP00000346464:p.Glu24Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Missense_Mutation	SNP	pfam_YL1,pfam_YL1_C	p.E24K	ENST00000354473.4	37	c.70	CCDS59201.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.480457	0.96307	.	.	ENSG00000163159	ENST00000368892;ENST00000354473	.	.	.	5.3	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.80037	0.4550	M	0.90650	3.135	0.53688	D	0.999973	D	0.61080	0.989	D	0.67103	0.949	D	0.84926	0.0857	9	0.72032	D	0.01	-3.8849	13.8703	0.63615	0.0:0.9257:0.0:0.0743	.	24	Q15906	VPS72_HUMAN	K	24	.	ENSP00000346464:E24K	E	-	1	0	VPS72	149429152	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.461000	0.73522	1.462000	0.47948	0.563000	0.77884	GAG	VPS72	-	pfam_YL1	ENSG00000163159		0.617	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	VPS72	HGNC	protein_coding	OTTHUMT00000034394.3	39	0.00	0	C	NM_005997		151162528	151162528	-1	no_errors	ENST00000368892	ensembl	human	known	69_37n	missense	131	26.40	47	SNP	1.000	T
ZMYM2	7750	genome.wustl.edu	37	13	20641448	20641448	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XO-01A-11D-A10G-09	TCGA-AN-A0XO-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f63863f5-cb60-4961-a5b4-ed5ea1fb3dc8	ea2d9f54-744b-4e56-bc97-d9492168db87	g.chr13:20641448A>G	ENST00000382874.2	+	22	3561	c.3371A>G	c.(3370-3372)cAt>cGt	p.H1124R	ZMYM2_ENST00000382869.3_Missense_Mutation_p.H1124R|ZMYM2_ENST00000494061.2_3'UTR|ZMYM2_ENST00000382871.2_Missense_Mutation_p.H1124R	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GGGTTAGCTCATTTTGTCAAT	0.363																																						dbGAP											0													69.0	65.0	67.0					13																	20641448		1866	4106	5972	-	-	-	SO:0001583	missense	0			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3371A>G	13.37:g.20641448A>G	ENSP00000372327:p.His1124Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.H1124R	ENST00000382874.2	37	c.3371	CCDS45016.1	13	.	.	.	.	.	.	.	.	.	.	A	10.88	1.476525	0.26511	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.14893	2.47	5.55	4.39	0.52855	.	0.405906	0.30235	N	0.010083	T	0.06645	0.0170	N	0.01874	-0.695	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28839	-1.0031	10	0.30078	T	0.28	-20.6705	10.8926	0.47004	0.9268:0.0:0.0732:0.0	.	1124	Q9UBW7	ZMYM2_HUMAN	R	1124;1124;1122;1122;502	ENSP00000372322:H1124R	ENSP00000372322:H1124R	H	+	2	0	ZMYM2	19539448	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	2.753000	0.47524	2.113000	0.64589	0.459000	0.35465	CAT	ZMYM2	-	NULL	ENSG00000121741		0.363	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	HGNC	protein_coding	OTTHUMT00000044051.2	11	0.00	0	A	NM_003453		20641448	20641448	+1	no_errors	ENST00000382869	ensembl	human	known	69_37n	missense	90	34.78	48	SNP	1.000	G
