#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AHI1	54806	genome.wustl.edu	37	6	135787470	135787470	+	Silent	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:135787470A>T	ENST00000367800.4	-	5	447	c.231T>A	c.(229-231)acT>acA	p.T77T	AHI1_ENST00000327035.6_Silent_p.T77T|AHI1_ENST00000457866.2_Silent_p.T77T	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	77					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		CATCACTTGTAGTTTCTTTAA	0.353																																						dbGAP											0													238.0	217.0	224.0					6																	135787470		1852	4108	5960	-	-	-	SO:0001819	synonymous_variant	0			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.231T>A	6.37:g.135787470A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Silent	SNP	pfam_WD40_repeat,pfam_SH3_domain,pfam_SH3_2,superfamily_WD40_repeat_dom,superfamily_SH3_domain,smart_WD40_repeat,smart_SH3_domain,pfscan_SH3_domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_SH3_domain	p.T77	ENST00000367800.4	37	c.231	CCDS47483.1	6																																																																																			AHI1	-	NULL	ENSG00000135541		0.353	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	AHI1	HGNC	protein_coding	OTTHUMT00000391948.1	274	0.00	0	A	NM_017651		135787470	135787470	-1	no_errors	ENST00000265602	ensembl	human	known	69_37n	silent	420	45.90	358	SNP	0.069	T
AMACR	23600	genome.wustl.edu	37	5	33989557	33989557	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr5:33989557A>G	ENST00000335606.6	-	5	878	c.790T>C	c.(790-792)Tgg>Cgg	p.W264R	AMACR_ENST00000502637.1_Missense_Mutation_p.W249R|AMACR_ENST00000382072.2_3'UTR|AMACR_ENST00000382085.3_Missense_Mutation_p.W264R|AMACR_ENST00000514195.1_5'UTR|RP11-1084J3.4_ENST00000382079.3_3'UTR	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	264					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						ATTTCTGGCCAATCATCCATG	0.413																																						dbGAP											0													62.0	61.0	61.0					5																	33989557		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.790T>C	5.37:g.33989557A>G	ENSP00000334424:p.Trp264Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	pfam_CoA-Trfase_fam_III,superfamily_CoA-Trfase_III_dom	p.W264R	ENST00000335606.6	37	c.790	CCDS3902.1	5	.	.	.	.	.	.	.	.	.	.	A	20.4	3.984684	0.74474	.	.	ENSG00000242110	ENST00000335606;ENST00000382085;ENST00000502637	T;T;T	0.45668	0.89;0.89;0.89	5.7	5.7	0.88788	CoA-transferase family III domain (2);	0.000000	0.85682	D	0.000000	T	0.71888	0.3393	M	0.93898	3.47	0.80722	D	1	D;D;D	0.57899	0.981;0.968;0.968	D;P;P	0.63113	0.911;0.818;0.818	T	0.80151	-0.1502	10	0.72032	D	0.01	-17.0302	16.2624	0.82553	1.0:0.0:0.0:0.0	.	264;249;264	F8W9N1;D6RB81;Q9UHK6	.;.;AMACR_HUMAN	R	264;264;249	ENSP00000334424:W264R;ENSP00000371517:W264R;ENSP00000424351:W249R	ENSP00000334424:W264R	W	-	1	0	AMACR	34025314	1.000000	0.71417	0.966000	0.40874	0.570000	0.35934	8.941000	0.92964	2.297000	0.77311	0.519000	0.50382	TGG	AMACR	-	superfamily_CoA-Trfase_III_dom	ENSG00000242110		0.413	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMACR	HGNC	protein_coding	OTTHUMT00000207467.1	58	0.00	0	A	NM_014324		33989557	33989557	-1	no_errors	ENST00000335606	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	1.000	G
ATG16L1	55054	genome.wustl.edu	37	2	234172686	234172686	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:234172686A>T	ENST00000392017.4	+	4	621	c.364A>T	c.(364-366)Agg>Tgg	p.R122W	ATG16L1_ENST00000373525.5_Intron|ATG16L1_ENST00000392018.1_Missense_Mutation_p.R122W|ATG16L1_ENST00000347464.5_Intron|ATG16L1_ENST00000392020.4_Missense_Mutation_p.R122W	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	122					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		GCGGAAGGACAGGGAGATGCA	0.448																																						dbGAP											0													134.0	133.0	133.0					2																	234172686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.364A>T	2.37:g.234172686A>T	ENSP00000375872:p.Arg122Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_16,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R122W	ENST00000392017.4	37	c.364	CCDS2503.2	2	.	.	.	.	.	.	.	.	.	.	A	28.1	4.888341	0.91814	.	.	ENSG00000085978	ENST00000431917;ENST00000392017;ENST00000417017;ENST00000392020;ENST00000392018	T;T;T	0.50548	0.74;0.75;0.74	5.86	-2.31	0.06765	Autophagy-related protein 16 (1);	0.425259	0.19402	U	0.115159	T	0.59676	0.2211	L	0.48642	1.525	0.80722	D	1	P;P	0.51351	0.931;0.944	D;P	0.72338	0.977;0.886	T	0.65294	-0.6203	10	0.87932	D	0	.	17.2588	0.87064	0.4708:0.5292:0.0:0.0	.	122;122	Q676U5-2;Q676U5	.;A16L1_HUMAN	W	38;122;122;122;122	ENSP00000375872:R122W;ENSP00000375875:R122W;ENSP00000375873:R122W	ENSP00000375872:R122W	R	+	1	2	ATG16L1	233837425	0.965000	0.33210	0.951000	0.38953	0.998000	0.95712	1.036000	0.30228	-0.163000	0.10946	0.460000	0.39030	AGG	ATG16L1	-	pfam_Autophagy-rel_prot_16,superfamily_Prefoldin	ENSG00000085978		0.448	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG16L1	HGNC	protein_coding	OTTHUMT00000257069.2	114	0.00	0	A	NM_017974		234172686	234172686	+1	no_errors	ENST00000392017	ensembl	human	known	69_37n	missense	99	18.70	23	SNP	0.966	T
ATP2C2	9914	genome.wustl.edu	37	16	84449123	84449123	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr16:84449123C>G	ENST00000262429.4	+	7	639	c.550C>G	c.(550-552)Cga>Gga	p.R184G	ATP2C2_ENST00000416219.2_Missense_Mutation_p.R184G|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	184					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.R184R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CCTGCTTGCTCGAGAACTGGT	0.473																																						dbGAP											1	Substitution - coding silent(1)	kidney(1)											121.0	116.0	118.0					16																	84449123		1969	4153	6122	-	-	-	SO:0001583	missense	0			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.550C>G	16.37:g.84449123C>G	ENSP00000262429:p.Arg184Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_ATPase_P-typ_ion-transptr	p.R184G	ENST00000262429.4	37	c.550	CCDS42207.1	16	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141582	0.37825	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	D;D	0.91180	-2.8;-2.8	4.9	1.7	0.24286	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.100427	0.43260	N	0.000582	D	0.88829	0.6543	L	0.58101	1.795	0.38406	D	0.945792	B;B;B;B	0.17038	0.014;0.02;0.005;0.009	B;B;B;B	0.30029	0.11;0.021;0.005;0.084	D	0.84814	0.0792	10	0.72032	D	0.01	.	12.9141	0.58197	0.4255:0.5745:0.0:0.0	.	184;33;201;184	E7ES94;F8WAA5;O75185-2;O75185	.;.;.;AT2C2_HUMAN	G	184;184;33	ENSP00000397925:R184G;ENSP00000262429:R184G	ENSP00000262429:R184G	R	+	1	2	ATP2C2	83006624	0.848000	0.29623	0.259000	0.24435	0.767000	0.43475	1.621000	0.36986	0.173000	0.19788	0.485000	0.47835	CGA	ATP2C2	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Ca-transp_PMR1	ENSG00000064270		0.473	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2C2	HGNC	protein_coding	OTTHUMT00000433404.1	119	0.00	0	C	NM_014861		84449123	84449123	+1	no_errors	ENST00000262429	ensembl	human	known	69_37n	missense	54	30.77	24	SNP	0.736	G
ATXN7L1	222255	genome.wustl.edu	37	7	105283455	105283455	+	Missense_Mutation	SNP	G	G	A	rs533762062		TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr7:105283455G>A	ENST00000419735.3	-	5	737	c.692C>T	c.(691-693)tCg>tTg	p.S231L	ATXN7L1_ENST00000477775.1_Missense_Mutation_p.S107L|ATXN7L1_ENST00000472910.1_5'UTR	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	231										endometrium(1)|large_intestine(4)|lung(5)	10						GGCAGAGGACGAGGTGGAGGA	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		20365	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													362.0	343.0	349.0					7																	105283455		692	1591	2283	-	-	-	SO:0001583	missense	0			AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.692C>T	7.37:g.105283455G>A	ENSP00000410759:p.Ser231Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Q2|B4DTS1|Q8N2T0	Missense_Mutation	SNP	pfam_SCA7_dom	p.S231L	ENST00000419735.3	37	c.692	CCDS47682.1	7	.	.	.	.	.	.	.	.	.	.	G	10.86	1.471138	0.26423	.	.	ENSG00000146776	ENST00000419735;ENST00000477775;ENST00000472195	T;T;T	0.15017	2.46;2.5;2.49	5.84	4.96	0.65561	.	0.343232	0.24781	N	0.035649	T	0.11024	0.0269	N	0.12182	0.205	0.80722	D	1	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.04013	0.0;0.001;0.001	T	0.10613	-1.0622	10	0.30078	T	0.28	.	14.6802	0.69012	0.0695:0.0:0.9305:0.0	.	15;107;231	A4D0Q3;Q9ULK2-3;Q9ULK2	.;.;AT7L1_HUMAN	L	231;107;107	ENSP00000410759:S231L;ENSP00000418476:S107L;ENSP00000419566:S107L	ENSP00000410759:S231L	S	-	2	0	ATXN7L1	105070691	1.000000	0.71417	0.557000	0.28306	0.634000	0.38068	4.736000	0.62059	1.477000	0.48234	0.561000	0.74099	TCG	ATXN7L1	-	NULL	ENSG00000146776		0.473	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L1	HGNC	protein_coding	OTTHUMT00000349037.2	404	0.00	0	G			105283455	105283455	-1	no_errors	ENST00000419735	ensembl	human	known	69_37n	missense	146	23.16	44	SNP	0.935	A
BAI3	577	genome.wustl.edu	37	6	69349109	69349109	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:69349109C>T	ENST00000370598.1	+	3	1363	c.542C>T	c.(541-543)tCa>tTa	p.S181L		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	181					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGCTTAAAATCAGAAAATGGG	0.433																																						dbGAP											0													71.0	71.0	71.0					6																	69349109		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.542C>T	6.37:g.69349109C>T	ENSP00000359630:p.Ser181Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.S181L	ENST00000370598.1	37	c.542	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556765	0.27827	.	.	ENSG00000135298	ENST00000370598	T	0.19394	2.15	5.23	5.23	0.72850	.	0.351788	0.23922	N	0.043228	T	0.04407	0.0121	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21965	-1.0230	10	0.39692	T	0.17	.	12.514	0.56021	0.0:0.9232:0.0:0.0768	.	181	O60242	BAI3_HUMAN	L	181	ENSP00000359630:S181L	ENSP00000359630:S181L	S	+	2	0	BAI3	69405830	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.693000	0.47027	2.610000	0.88304	0.655000	0.94253	TCA	BAI3	-	NULL	ENSG00000135298		0.433	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	28	0.00	0	C			69349109	69349109	+1	no_errors	ENST00000370598	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.996	T
BRCA1	672	genome.wustl.edu	37	17	41201181	41201181	+	Missense_Mutation	SNP	C	C	A	rs80357069		TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:41201181C>A	ENST00000357654.3	-	21	5481	c.5363G>T	c.(5362-5364)gGt>gTt	p.G1788V	BRCA1_ENST00000591849.1_Missense_Mutation_p.G21V|BRCA1_ENST00000586385.1_Missense_Mutation_p.G98V|BRCA1_ENST00000471181.2_Missense_Mutation_p.G1809V|BRCA1_ENST00000493795.1_Missense_Mutation_p.G1741V|BRCA1_ENST00000591534.1_Missense_Mutation_p.G279V|BRCA1_ENST00000351666.3_Missense_Mutation_p.G605V|BRCA1_ENST00000346315.3_Missense_Mutation_p.G1549V|BRCA1_ENST00000354071.3_Missense_Mutation_p.G1523V|BRCA1_ENST00000309486.4_Missense_Mutation_p.G1492V|BRCA1_ENST00000352993.3_Missense_Mutation_p.G646V|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000491747.2_Missense_Mutation_p.G684V	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1788	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.		G -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:17924331}.		androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CACAGAAGCACCACACAGCTG	0.458			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			GRCh37	CM041723|CM041724	BRCA1	M	rs80357069						140.0	109.0	120.0					17																	41201181		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5363G>T	17.37:g.41201181C>A	ENSP00000350283:p.Gly1788Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.G1809V	ENST00000357654.3	37	c.5426	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	C	19.27	3.794716	0.70452	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747	D;D;D;D;D;D;D;D	0.97959	-4.63;-4.63;-4.63;-4.63;-4.63;-4.63;-4.63;-4.63	5.42	5.42	0.78866	BRCT (4);	0.000000	0.49916	D	0.000127	D	0.98451	0.9484	M	0.73962	2.25	0.80722	D	1	D;D;D;D;B;D	0.89917	1.0;1.0;1.0;1.0;0.296;1.0	D;D;D;D;B;D	0.97110	1.0;1.0;1.0;1.0;0.028;1.0	D	0.98781	1.0732	10	0.87932	D	0	.	14.5884	0.68344	0.0:1.0:0.0:0.0	.	637;98;683;1810;1788;1788	B4DES0;C6YB45;E7ETR2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	V	1788;1809;1523;646;1549;605;1492;637;1810;1741;683	ENSP00000350283:G1788V;ENSP00000326002:G1523V;ENSP00000312236:G646V;ENSP00000246907:G1549V;ENSP00000338007:G605V;ENSP00000310938:G1492V;ENSP00000377294:G637V;ENSP00000418775:G1741V	ENSP00000310938:G1492V	G	-	2	0	BRCA1	38454707	1.000000	0.71417	1.000000	0.80357	0.699000	0.40488	4.360000	0.59455	2.817000	0.96982	0.563000	0.77884	GGT	BRCA1	-	pirsf_BRCA1,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000012048		0.458	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	119	0.00	0	C	NM_007294		41201181	41201181	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	1.000	A
C19orf70	125988	genome.wustl.edu	37	19	5679407	5679407	+	Splice_Site	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:5679407G>C	ENST00000309324.4	-	3	617	c.208C>G	c.(208-210)Ctc>Gtc	p.L70V	HSD11B1L_ENST00000411793.2_5'Flank|RPL36_ENST00000577222.1_5'Flank|HSD11B1L_ENST00000301382.4_5'Flank|HSD11B1L_ENST00000583928.1_5'Flank|C19orf70_ENST00000587589.1_Splice_Site_p.L70V|C19orf70_ENST00000587950.1_Splice_Site_p.L92V|HSD11B1L_ENST00000581893.1_5'Flank|HSD11B1L_ENST00000577917.1_5'Flank|C19orf70_ENST00000590389.1_Splice_Site_p.L92V|HSD11B1L_ENST00000342970.2_5'Flank|HSD11B1L_ENST00000339423.2_5'Flank|HSD11B1L_ENST00000581773.1_5'Flank|HSD11B1L_ENST00000581521.1_5'Flank|HSD11B1L_ENST00000422535.2_5'Flank|HSD11B1L_ENST00000423665.2_5'Flank|RPL36_ENST00000579649.1_Intron|C19orf70_ENST00000585605.1_5'UTR	NM_205767.1	NP_991330.1	Q5XKP0	QIL1_HUMAN	chromosome 19 open reading frame 70	70						mitochondrion (GO:0005739)				endometrium(1)|lung(1)	2						GGGGCTGGGAGCTGGGAAAAA	0.567																																						dbGAP											0													45.0	50.0	48.0					19																	5679407		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			BC009557	CCDS12143.1	19p13.3	2012-10-26			ENSG00000174917	ENSG00000174917			33702	protein-coding gene	gene with protein product						14702039, 17353931	Standard	NM_205767		Approved	QIL1, P117	uc002mch.1	Q5XKP0		ENST00000309324.4:c.208-1C>G	19.37:g.5679407G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YE5	Missense_Mutation	SNP	NULL	p.L70V	ENST00000309324.4	37	c.208	CCDS12143.1	19	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194371	0.38806	.	.	ENSG00000174917	ENST00000309324	T	0.27402	1.67	3.52	3.52	0.40303	.	0.134384	0.29783	N	0.011220	T	0.29652	0.0740	M	0.70275	2.135	0.41222	D	0.986513	P	0.41393	0.748	B	0.36959	0.237	T	0.17228	-1.0376	10	0.49607	T	0.09	-25.1426	9.1432	0.36917	0.0:0.224:0.776:0.0	.	70	Q5XKP0	QIL1_HUMAN	V	70	ENSP00000309561:L70V	ENSP00000309561:L70V	L	-	1	0	C19orf70	5630407	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	1.058000	0.30504	2.283000	0.76528	0.462000	0.41574	CTC	C19orf70	-	NULL	ENSG00000174917		0.567	C19orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf70	HGNC	protein_coding	OTTHUMT00000451656.1	118	0.00	0	G	NM_205767	Missense_Mutation	5679407	5679407	-1	no_errors	ENST00000309324	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	C
TBC1D32	221322	genome.wustl.edu	37	6	121577341	121577341	+	Silent	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:121577341C>G	ENST00000398212.2	-	16	1873	c.1824G>C	c.(1822-1824)gtG>gtC	p.V608V	TBC1D32_ENST00000275159.6_Silent_p.V608V	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	608					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										CTCCTTTAACCACAGGCAACA	0.348																																						dbGAP											0													83.0	75.0	77.0					6																	121577341		1809	4082	5891	-	-	-	SO:0001819	synonymous_variant	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1824G>C	6.37:g.121577341C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	superfamily_Rab-GTPase-TBC_dom	p.V608	ENST00000398212.2	37	c.1824	CCDS43501.1	6																																																																																			C6orf170	-	NULL	ENSG00000146350		0.348	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	HGNC	protein_coding	OTTHUMT00000380937.2	103	0.00	0	C	NM_152730		121577341	121577341	-1	no_errors	ENST00000275159	ensembl	human	putative	69_37n	silent	111	62.91	190	SNP	0.614	G
CCDC112	153733	genome.wustl.edu	37	5	114603600	114603600	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr5:114603600C>G	ENST00000512261.1	-	11	1730	c.1314G>C	c.(1312-1314)tgG>tgC	p.W438C	CCDC112_ENST00000379611.5_Missense_Mutation_p.W521C|CCDC112_ENST00000506442.1_Missense_Mutation_p.W406C|CCDC112_ENST00000395557.4_Missense_Mutation_p.W438C			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	438										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		TTCCTTGTCTCCAGGTTGGAA	0.328																																						dbGAP											0													115.0	106.0	109.0					5																	114603600		2202	4299	6501	-	-	-	SO:0001583	missense	0			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.1314G>C	5.37:g.114603600C>G	ENSP00000423712:p.Trp438Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6A334	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.W521C	ENST00000512261.1	37	c.1563	CCDS4117.1	5	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409901	0.62399	.	.	ENSG00000164221	ENST00000379611;ENST00000512261;ENST00000506442;ENST00000395557	T;T;T;T	0.80824	-1.39;-1.27;-1.42;-1.27	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.84938	0.5583	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.86296	0.1677	10	0.87932	D	0	-4.4079	16.4636	0.84071	0.0:1.0:0.0:0.0	.	406;521;438	D6RF76;Q8NEF3-2;Q8NEF3	.;.;CC112_HUMAN	C	521;438;406;438	ENSP00000368931:W521C;ENSP00000423712:W438C;ENSP00000424876:W406C;ENSP00000378925:W438C	ENSP00000368931:W521C	W	-	3	0	CCDC112	114631499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.182000	0.65059	2.738000	0.93877	0.655000	0.94253	TGG	CCDC112	-	NULL	ENSG00000164221		0.328	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CCDC112	HGNC	protein_coding	OTTHUMT00000370999.1	174	0.00	0	C	NM_152549		114603600	114603600	-1	no_errors	ENST00000379611	ensembl	human	known	69_37n	missense	141	37.89	86	SNP	1.000	G
CNKSR2	22866	genome.wustl.edu	37	X	21627269	21627269	+	Missense_Mutation	SNP	T	T	G	rs148103221		TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chrX:21627269T>G	ENST00000379510.3	+	20	2262	c.2226T>G	c.(2224-2226)caT>caG	p.H742Q	CNKSR2_ENST00000543067.1_Missense_Mutation_p.H693Q|CNKSR2_ENST00000425654.2_Missense_Mutation_p.H712Q|CNKSR2_ENST00000279451.4_Missense_Mutation_p.H742Q	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	742					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						AGTCTTCTCATGAGGAGTTTC	0.532																																						dbGAP											0													71.0	70.0	70.0					X																	21627269		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2226T>G	X.37:g.21627269T>G	ENSP00000368824:p.His742Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.H742Q	ENST00000379510.3	37	c.2226	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	T	6.885	0.532685	0.13127	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.16457	2.59;2.34;2.34;2.6	5.63	0.467	0.16721	.	0.044374	0.85682	D	0.000000	T	0.09202	0.0227	L	0.31294	0.92	0.46458	D	0.999052	B;B;B;B	0.31837	0.057;0.03;0.342;0.057	B;B;B;B	0.22386	0.021;0.012;0.039;0.021	T	0.31806	-0.9930	10	0.15066	T	0.55	-21.8743	10.2196	0.43190	0.0:0.3552:0.0:0.6448	.	712;693;334;742	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	Q	712;693;742;742	ENSP00000397906:H712Q;ENSP00000444633:H693Q;ENSP00000279451:H742Q;ENSP00000368824:H742Q	ENSP00000279451:H742Q	H	+	3	2	CNKSR2	21537190	0.428000	0.25522	0.998000	0.56505	0.997000	0.91878	-0.371000	0.07513	-0.030000	0.13804	0.481000	0.45027	CAT	CNKSR2	-	NULL	ENSG00000149970		0.532	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	97	0.00	0	T	NM_014927		21627269	21627269	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	missense	13	53.57	15	SNP	0.999	G
CNKSR3	154043	genome.wustl.edu	37	6	154762480	154762480	+	Silent	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:154762480G>A	ENST00000607772.1	-	4	997	c.453C>T	c.(451-453)gtC>gtT	p.V151V	CNKSR3_ENST00000479339.1_Silent_p.V71V	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	151	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		TGTTCTTCGTGACTGAGAAAT	0.413																																						dbGAP											0													110.0	109.0	109.0					6																	154762480		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.453C>T	6.37:g.154762480G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SGD5|Q96N65	Silent	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,pfscan_PDZ,pfscan_SAM	p.V151	ENST00000607772.1	37	c.453	CCDS5246.1	6																																																																																			CNKSR3	-	pfam_CRIC_domain_Chordata	ENSG00000153721		0.413	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR3	HGNC	protein_coding	OTTHUMT00000042792.2	107	0.00	0	G	NM_173515		154762480	154762480	-1	no_errors	ENST00000367213	ensembl	human	known	69_37n	silent	67	19.28	16	SNP	0.000	A
CPSF1	29894	genome.wustl.edu	37	8	145625789	145625789	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr8:145625789G>T	ENST00000349769.3	-	8	879	c.785C>A	c.(784-786)cCc>cAc	p.P262H	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	262					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GCAGTCAAAGGGCAGGCTGGT	0.627																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													97.0	98.0	98.0					8																	145625789		2203	4300	6503	-	-	-	SO:0001583	missense	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.785C>A	8.37:g.145625789G>T	ENSP00000339353:p.Pro262His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AF0	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.P262H	ENST00000349769.3	37	c.785	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647149	0.87958	.	.	ENSG00000071894	ENST00000349769	T	0.66995	-0.24	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.84460	0.5477	M	0.87827	2.91	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86711	0.1936	10	0.87932	D	0	-7.391	17.2687	0.87095	0.0:0.0:1.0:0.0	.	262;184;262	B4DEF4;D3DWL9;Q10570	.;.;CPSF1_HUMAN	H	262	ENSP00000339353:P262H	ENSP00000339353:P262H	P	-	2	0	CPSF1	145596597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.532000	0.81985	2.686000	0.91538	0.650000	0.86243	CCC	CPSF1	-	NULL	ENSG00000071894		0.627	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	101	0.00	0	G	NM_013291		145625789	145625789	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	T
CSNK1E	1454	genome.wustl.edu	37	22	38694802	38694802	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr22:38694802T>A	ENST00000396832.1	-	7	1134	c.874A>T	c.(874-876)Atg>Ttg	p.M292L	CSNK1E_ENST00000359867.3_Missense_Mutation_p.M292L|CSNK1E_ENST00000405675.3_Missense_Mutation_p.M292L|CSNK1E_ENST00000413574.2_Missense_Mutation_p.M292L|CSNK1E_ENST00000498529.1_5'UTR|CSNK1E_ENST00000403904.1_Missense_Mutation_p.M292L|CSNK1E_ENST00000400206.2_Missense_Mutation_p.M292L	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	292					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					AATTTCAGCATGTTCCAGTCA	0.597											OREG0026559	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	dbGAP											0													120.0	117.0	118.0					22																	38694802		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.874A>T	22.37:g.38694802T>A	ENSP00000380044:p.Met292Leu	Somatic	880	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.M292L	ENST00000396832.1	37	c.874	CCDS13970.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.11|18.11	3.550211|3.550211	0.65311|0.65311	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000431632|ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904;ENST00000413574;ENST00000405675	.|T;T;T;T;T;T	.|0.12569	.|2.67;2.67;2.67;2.67;2.67;2.67	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.11836|0.11836	0.0288|0.0288	L|L	0.31752|0.31752	0.955|0.955	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.01281	.|0.0;0.0;0.0	T|T	0.07539|0.07539	-1.0767|-1.0767	5|10	.|0.32370	.|T	.|0.25	.|.	14.9846|14.9846	0.71336|0.71336	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|292;292;292	.|B0QY35;B0QY34;P49674	.|.;.;KC1E_HUMAN	L|L	19|292	.|ENSP00000352929:M292L;ENSP00000380044:M292L;ENSP00000383067:M292L;ENSP00000384074:M292L;ENSP00000407235:M292L;ENSP00000384426:M292L	.|ENSP00000352929:M292L	H|M	-|-	2|1	0|0	CSNK1E|CSNK1E	37024748|37024748	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.028000|8.028000	0.88798|0.88798	1.944000|1.944000	0.56390|0.56390	0.533000|0.533000	0.62120|0.62120	CAT|ATG	CSNK1E	-	NULL	ENSG00000213923		0.597	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1E	HGNC	protein_coding	OTTHUMT00000321462.1	86	0.00	0	T	NM_001894		38694802	38694802	-1	no_errors	ENST00000359867	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	1.000	A
DAND5	199699	genome.wustl.edu	37	19	13084353	13084353	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:13084353G>C	ENST00000317060.2	+	2	654	c.475G>C	c.(475-477)Gtc>Ctc	p.V159L	DAND5_ENST00000585548.1_3'UTR	NM_152654.2	NP_689867.1	Q8N907	DAND5_HUMAN	DAN domain family member 5, BMP antagonist	159	CTCK.				atrial septum development (GO:0003283)|determination of heart left/right asymmetry (GO:0061371)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of nodal signaling pathway (GO:1900108)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|sequestering of nodal from receptor via nodal binding (GO:0038101)|ventricular septum development (GO:0003281)	extracellular region (GO:0005576)	morphogen activity (GO:0016015)			kidney(2)|lung(3)|ovary(1)	6			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			GGCACCCGTGGTCCTGTGGTG	0.587																																						dbGAP											0													154.0	127.0	136.0					19																	13084353		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095926	CCDS12291.1	19p13	2013-02-26	2013-02-26			ENSG00000179284			26780	protein-coding gene	gene with protein product		609068	"""DAN domain family, member 5"""			15254711	Standard	NM_152654		Approved	FLJ38607, CKTSF1B3, DANTE, GREM3, CER2, DTE	uc002mwc.1	Q8N907		ENST00000317060.2:c.475G>C	19.37:g.13084353G>C	ENSP00000323155:p.Val159Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DAN,pirsf_Cerberus	p.V159L	ENST00000317060.2	37	c.475	CCDS12291.1	19	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987550	0.35036	.	.	ENSG00000179284	ENST00000317060	T	0.28895	1.59	5.67	-0.924	0.10462	DAN (1);	2.192520	0.02768	N	0.119349	T	0.22282	0.0537	L	0.34521	1.04	0.09310	N	1	B	0.15719	0.014	B	0.14578	0.011	T	0.13469	-1.0508	10	0.23302	T	0.38	-5.2729	5.1862	0.15185	0.0787:0.4055:0.377:0.1388	.	159	Q8N907	DAND5_HUMAN	L	159	ENSP00000323155:V159L	ENSP00000323155:V159L	V	+	1	0	DAND5	12945353	0.384000	0.25164	0.001000	0.08648	0.099000	0.18886	0.699000	0.25586	0.021000	0.15133	-0.165000	0.13383	GTC	DAND5	-	pfam_DAN,pirsf_Cerberus	ENSG00000179284		0.587	DAND5-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DAND5	HGNC	protein_coding	OTTHUMT00000452761.1	199	0.50	1	G	NM_152654		13084353	13084353	+1	no_errors	ENST00000317060	ensembl	human	known	69_37n	missense	62	12.68	9	SNP	0.014	C
DIXDC1	85458	genome.wustl.edu	37	11	111857608	111857608	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr11:111857608G>T	ENST00000440460.2	+	10	1316	c.1019G>T	c.(1018-1020)aGt>aTt	p.S340I	DIXDC1_ENST00000315253.5_Missense_Mutation_p.S129I|DIXDC1_ENST00000389821.4_3'UTR	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	341					camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		ATAATCCAAAGTCGTCTGGAT	0.408																																						dbGAP											0													98.0	91.0	93.0					11																	111857608		1891	4107	5998	-	-	-	SO:0001583	missense	0			AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.1019G>T	11.37:g.111857608G>T	ENSP00000394352:p.Ser340Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	pfam_DIX,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_DIX,pfscan_CH-domain,pfscan_DIX	p.S340I	ENST00000440460.2	37	c.1019		11	.	.	.	.	.	.	.	.	.	.	G	26.3	4.727084	0.89390	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.25250	1.81;1.81	4.96	4.96	0.65561	.	0.037927	0.85682	D	0.000000	T	0.53834	0.1821	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.972;0.996	T	0.58758	-0.7580	9	0.87932	D	0	-5.5543	17.3805	0.87403	0.0:0.0:1.0:0.0	.	129;341	E7EQ17;Q155Q3	.;DIXC1_HUMAN	I	340;129	ENSP00000394352:S340I;ENSP00000314068:S129I	ENSP00000314068:S129I	S	+	2	0	DIXDC1	111362818	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.168000	0.89670	2.595000	0.87683	0.655000	0.94253	AGT	DIXDC1	-	NULL	ENSG00000150764		0.408	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	DIXDC1	HGNC	protein_coding		216	0.00	0	G	NM_001037954		111857608	111857608	+1	no_errors	ENST00000440460	ensembl	human	known	69_37n	missense	233	16.79	47	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20944829	20944829	+	Splice_Site	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr16:20944829C>A	ENST00000261383.3	-	62	11997	c.11998G>T	c.(11998-12000)Gta>Tta	p.V4000L	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	4000					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGTGGGGTTACCTGGAAGAAT	0.473																																						dbGAP											0													62.0	63.0	63.0					16																	20944829		2201	4300	6501	-	-	-	SO:0001630	splice_region_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.11998-1G>T	16.37:g.20944829C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.V4000L	ENST00000261383.3	37	c.11998	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	19.75	3.884840	0.72410	.	.	ENSG00000158486	ENST00000261383	T	0.11930	2.73	5.24	5.24	0.73138	Dynein heavy chain (1);	0.000000	0.64402	D	0.000003	T	0.46405	0.1391	H	0.95470	3.675	0.80722	D	1	D	0.53745	0.962	P	0.55615	0.78	T	0.63932	-0.6525	10	0.62326	D	0.03	.	18.8244	0.92111	0.0:1.0:0.0:0.0	.	4000	Q8TD57	DYH3_HUMAN	L	4000	ENSP00000261383:V4000L	ENSP00000261383:V4000L	V	-	1	0	DNAH3	20852330	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	5.881000	0.69706	2.451000	0.82905	0.563000	0.77884	GTA	DNAH3	-	pfam_Dynein_heavy	ENSG00000158486		0.473	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	154	0.00	0	C	NM_017539	Missense_Mutation	20944829	20944829	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	142	10.69	17	SNP	1.000	A
DNAJC9	23234	genome.wustl.edu	37	10	75005836	75005836	+	Missense_Mutation	SNP	G	G	C	rs146939014	byFrequency	TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr10:75005836G>C	ENST00000372950.4	-	3	2092	c.420C>G	c.(418-420)gaC>gaG	p.D140E	MRPS16_ENST00000479005.1_5'Flank|DNAJC9-AS1_ENST00000440197.2_RNA|DNAJC9-AS1_ENST00000513954.1_RNA|DNAJC9_ENST00000453189.2_5'Flank	NM_015190.3	NP_056005.1	Q8WXX5	DNJC9_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 9	140					social behavior (GO:0035176)	nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|stomach(1)	6	Prostate(51;0.0119)					TCTGATCCATGTCACCCTTGA	0.453																																						dbGAP											0													82.0	80.0	81.0					10																	75005836		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF327347	CCDS7322.1	10q22.3	2011-09-02			ENSG00000213551	ENSG00000213551		"""Heat shock proteins / DNAJ (HSP40)"""	19123	protein-coding gene	gene with protein product		611206					Standard	NM_015190		Approved	JDD1, SB73	uc001jtr.3	Q8WXX5	OTTHUMG00000018461	ENST00000372950.4:c.420C>G	10.37:g.75005836G>C	ENSP00000362041:p.Asp140Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMW6	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.D140E	ENST00000372950.4	37	c.420	CCDS7322.1	10	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166156	0.78339	.	.	ENSG00000213551	ENST00000372950	T	0.20463	2.07	4.88	-0.323	0.12709	.	0.097627	0.64402	D	0.000002	T	0.40670	0.1126	M	0.91300	3.195	0.47778	D	0.99951	D	0.58268	0.982	P	0.55303	0.773	T	0.44726	-0.9309	9	.	.	.	.	8.0458	0.30549	0.5494:0.0:0.4506:0.0	.	140	Q8WXX5	DNJC9_HUMAN	E	140	ENSP00000362041:D140E	.	D	-	3	2	DNAJC9	74675842	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	1.541000	0.36126	0.127000	0.18452	0.586000	0.80456	GAC	DNAJC9	-	NULL	ENSG00000213551		0.453	DNAJC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC9	HGNC	protein_coding	OTTHUMT00000048643.1	192	0.52	1	G	NM_015190		75005836	75005836	-1	no_errors	ENST00000372950	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	1.000	C
DOCK6	57572	genome.wustl.edu	37	19	11348396	11348396	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:11348396delT	ENST00000294618.7	-	17	1903	c.1892delA	c.(1891-1893)catfs	p.H632fs	C19orf80_ENST00000591200.1_Intron|C19orf80_ENST00000252453.8_5'Flank|DOCK6_ENST00000319867.7_5'UTR	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	632	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CAGCAGGTGATGGTTCTCTGT	0.642																																						dbGAP											0													29.0	33.0	32.0					19																	11348396		2074	4228	6302	-	-	-	SO:0001589	frameshift_variant	0				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1892delA	19.37:g.11348396delT	ENSP00000294618:p.His632fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X5|Q7Z7P4|Q9P2F2	Frame_Shift_Del	DEL	pfam_DOCK,pfam_DUF3398	p.H631fs	ENST00000294618.7	37	c.1892	CCDS45975.1	19																																																																																			DOCK6	-	NULL	ENSG00000130158		0.642	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	47	0.00	0	T	NM_020812		11348396	11348396	-1	no_errors	ENST00000294618	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	1.000	-
DOPEY2	9980	genome.wustl.edu	37	21	37612131	37612131	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr21:37612131G>A	ENST00000399151.3	+	18	3030	c.2945G>A	c.(2944-2946)tGg>tAg	p.W982*		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	982					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCCCAGGGCTGGCTGGTGCGT	0.637																																						dbGAP											0													52.0	41.0	45.0					21																	37612131		2192	4289	6481	-	-	-	SO:0001587	stop_gained	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2945G>A	21.37:g.37612131G>A	ENSP00000382104:p.Trp982*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSG5|Q6PJQ7|Q9UEZ3	Nonsense_Mutation	SNP	pfam_Dopey_N	p.W982*	ENST00000399151.3	37	c.2945	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	G	43	9.935297	0.99299	.	.	ENSG00000142197	ENST00000399151	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.878	0.92346	0.0:0.0:1.0:0.0	.	.	.	.	X	982	.	ENSP00000382104:W982X	W	+	2	0	DOPEY2	36534001	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.253000	0.95501	2.470000	0.83445	0.561000	0.74099	TGG	DOPEY2	-	NULL	ENSG00000142197		0.637	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	55	0.00	0	G	NM_005128		37612131	37612131	+1	no_errors	ENST00000399151	ensembl	human	known	69_37n	nonsense	6	40.00	4	SNP	1.000	A
C1ORF220	400798	genome.wustl.edu	37	1	178514978	178514978	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:178514978C>G	ENST00000367636.4	+	2	702	c.364C>G	c.(364-366)Cta>Gta	p.L122V	C1orf220_ENST00000319387.2_3'UTR|C1orf220_ENST00000521244.1_3'UTR																							ATTTCATGCCCTAAACCAAAA	0.438																																						dbGAP											0													90.0	88.0	88.0					1																	178514978		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000367636.4:c.364C>G	1.37:g.178514978C>G	ENSP00000356608:p.Leu122Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L122V	ENST00000367636.4	37	c.364		1	.	.	.	.	.	.	.	.	.	.	C	4.105	0.017584	0.07959	.	.	ENSG00000184909	ENST00000367636	T	0.26810	1.71	3.62	-0.429	0.12303	.	.	.	.	.	T	0.18509	0.0444	.	.	.	0.09310	N	1	P	0.44816	0.844	B	0.43809	0.432	T	0.12811	-1.0533	7	.	.	.	.	3.5765	0.07937	0.0:0.4708:0.1926:0.3366	.	122	Q5T0J3	CA220_HUMAN	V	122	ENSP00000356608:L122V	.	L	+	1	2	AL513013.1	176781601	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.153000	0.10144	-0.069000	0.12931	-0.502000	0.04539	CTA	AL513013.1	-	NULL	ENSG00000184909		0.438	C1ORF220-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000184909	Clone_based_ensembl_gene	protein_coding		151	0.00	0	C			178514978	178514978	+1	no_errors	ENST00000367636	ensembl	human	known	69_37n	missense	77	48.67	73	SNP	0.000	G
EPB41L3	23136	genome.wustl.edu	37	18	5397152	5397152	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr18:5397152G>C	ENST00000341928.2	-	18	3086	c.2746C>G	c.(2746-2748)Cag>Gag	p.Q916E	EPB41L3_ENST00000427684.2_Missense_Mutation_p.Q213E|EPB41L3_ENST00000400111.3_Missense_Mutation_p.Q694E|EPB41L3_ENST00000342933.3_Missense_Mutation_p.Q916E|EPB41L3_ENST00000540638.2_Missense_Mutation_p.Q694E|EPB41L3_ENST00000544123.1_Missense_Mutation_p.Q747E|EPB41L3_ENST00000542146.1_Missense_Mutation_p.Q221E|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	916	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GTCTCTTCCTGTTCCAGGACA	0.532																																						dbGAP											0													116.0	95.0	102.0					18																	5397152		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2746C>G	18.37:g.5397152G>C	ENSP00000343158:p.Gln916Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.Q916E	ENST00000341928.2	37	c.2746	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	G	4.766	0.142476	0.09083	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	5.87	5.0	0.66597	.	1.419610	0.03766	N	0.258974	T	0.38852	0.1056	N	0.16656	0.425	0.33421	D	0.579875	B;B;B;B;B;B;B;P	0.36315	0.183;0.255;0.024;0.081;0.02;0.038;0.001;0.547	B;B;B;B;B;B;B;B	0.39119	0.133;0.291;0.061;0.062;0.014;0.066;0.007;0.276	T	0.18116	-1.0347	10	0.10636	T	0.68	.	13.1753	0.59624	0.0732:0.0:0.9268:0.0	.	747;213;221;308;585;694;916;151	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	E	916;585;747;585;213;221;916;694	ENSP00000343158:Q916E;ENSP00000441174:Q747E;ENSP00000392195:Q213E;ENSP00000442233:Q221E;ENSP00000341138:Q916E;ENSP00000382981:Q694E	ENSP00000343158:Q916E	Q	-	1	0	EPB41L3	5387152	0.619000	0.27059	0.030000	0.17652	0.023000	0.10783	3.526000	0.53509	1.499000	0.48617	0.591000	0.81541	CAG	EPB41L3	-	pirsf_Band_41_protein	ENSG00000082397		0.532	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	103	0.96	1	G	NM_012307		5397152	5397152	-1	no_errors	ENST00000341928	ensembl	human	known	69_37n	missense	17	61.36	27	SNP	0.733	C
ESYT3	83850	genome.wustl.edu	37	3	138183231	138183231	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr3:138183231G>C	ENST00000389567.4	+	9	1146	c.960G>C	c.(958-960)caG>caC	p.Q320H		NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	320	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						AGCTGGCCCAGAAGGACAACT	0.587																																						dbGAP											0													68.0	65.0	66.0					3																	138183231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.960G>C	3.37:g.138183231G>C	ENSP00000374218:p.Gln320His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.Q320H	ENST00000389567.4	37	c.960	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	G	12.59	1.984203	0.35036	.	.	ENSG00000158220	ENST00000389567	T	0.69561	-0.41	4.93	3.97	0.46021	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.371383	0.27891	N	0.017432	T	0.58104	0.2099	L	0.35854	1.095	0.80722	D	1	P	0.47484	0.896	P	0.48524	0.58	T	0.57165	-0.7858	10	0.42905	T	0.14	-18.8173	5.4757	0.16694	0.1106:0.2068:0.6825:0.0	.	320	A0FGR9	ESYT3_HUMAN	H	320	ENSP00000374218:Q320H	ENSP00000374218:Q320H	Q	+	3	2	ESYT3	139665921	0.974000	0.33945	1.000000	0.80357	0.668000	0.39293	0.710000	0.25748	2.580000	0.87095	0.455000	0.32223	CAG	ESYT3	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000158220		0.587	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	69	0.00	0	G	NM_031913		138183231	138183231	+1	no_errors	ENST00000389567	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.803	C
F2	2147	genome.wustl.edu	37	11	46750993	46750993	+	Silent	SNP	A	A	T	rs377628196		TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr11:46750993A>T	ENST00000311907.5	+	12	1592	c.1536A>T	c.(1534-1536)acA>acT	p.T512T	F2_ENST00000530231.1_Silent_p.T473T	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	512	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	AGACGTGGACAGCCAACGTTG	0.622																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)	dbGAP											0													116.0	97.0	103.0					11																	46750993		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1536A>T	11.37:g.46750993A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1_S6,pirsf_Peptidase_S1A_prothrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A_prothrombin,prints_Peptidase_S1A,prints_GLA_domain	p.T512	ENST00000311907.5	37	c.1536	CCDS31476.1	11																																																																																			F2	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Peptidase_S1A_prothrombin,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A_prothrombin	ENSG00000180210		0.622	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	HGNC	protein_coding	OTTHUMT00000317706.1	73	0.00	0	A			46750993	46750993	+1	no_errors	ENST00000311907	ensembl	human	known	69_37n	silent	14	30.00	6	SNP	0.000	T
FAM111B	374393	genome.wustl.edu	37	11	58893517	58893517	+	Silent	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr11:58893517C>G	ENST00000343597.3	+	4	2138	c.1947C>G	c.(1945-1947)tcC>tcG	p.S649S	FAM111B_ENST00000411426.1_Silent_p.S619S|FAM111B_ENST00000529618.1_Silent_p.S619S	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	649							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						CTGATGGGTCCTCAGGCTCCC	0.408																																						dbGAP											0													130.0	113.0	119.0					11																	58893517		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.1947C>G	11.37:g.58893517C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2G2|Q6P661	Silent	SNP	superfamily_Pept_cys/ser_Trypsin-like	p.S649	ENST00000343597.3	37	c.1947	CCDS7972.1	11																																																																																			FAM111B	-	superfamily_Pept_cys/ser_Trypsin-like	ENSG00000189057		0.408	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM111B	HGNC	protein_coding	OTTHUMT00000393974.1	196	0.00	0	C	NM_198947		58893517	58893517	+1	no_errors	ENST00000343597	ensembl	human	known	69_37n	silent	118	21.33	32	SNP	0.248	G
FANCI	55215	genome.wustl.edu	37	15	89849398	89849398	+	Silent	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr15:89849398C>T	ENST00000310775.7	+	32	3596	c.3510C>T	c.(3508-3510)taC>taT	p.Y1170Y	FANCI_ENST00000300027.8_Silent_p.Y1110Y	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	1170					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					GCAAAATGTACACCACACTTA	0.502								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													123.0	109.0	114.0					15																	89849398		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.3510C>T	15.37:g.89849398C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	NULL	p.H936Y	ENST00000310775.7	37	c.2806	CCDS45346.1	15																																																																																			FANCI	-	NULL	ENSG00000140525		0.502	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	118	0.84	1	C	NM_018193		89849398	89849398	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000561894	ensembl	human	putative	69_37n	missense	94	13.76	15	SNP	1.000	T
FLNC	2318	genome.wustl.edu	37	7	128496688	128496688	+	Silent	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr7:128496688C>G	ENST00000325888.8	+	44	7629	c.7368C>G	c.(7366-7368)gtC>gtG	p.V2456V	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.V2423V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2456	Interaction with INPPL1.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGTGCTACGTCTCTGAGCTGG	0.662																																						dbGAP											0													56.0	64.0	62.0					7																	128496688		2139	4250	6389	-	-	-	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7368C>G	7.37:g.128496688C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V2456	ENST00000325888.8	37	c.7368	CCDS43644.1	7																																																																																			FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.662	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	82	0.00	0	C			128496688	128496688	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	silent	7	69.57	16	SNP	1.000	G
GBE1	2632	genome.wustl.edu	37	3	81635276	81635276	+	Silent	SNP	T	T	G	rs532448572		TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr3:81635276T>G	ENST00000429644.2	-	10	1945	c.1302A>C	c.(1300-1302)cgA>cgC	p.R434R	GBE1_ENST00000489715.1_Silent_p.R393R	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	434					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		CCATGGCTAGTCGATAGTCAA	0.393									Glycogen Storage Disease, type IV																													dbGAP											0													133.0	128.0	129.0					3																	81635276		1854	4087	5941	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Andersen Disease, Brancher deficiency		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.1302A>C	3.37:g.81635276T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWV3|Q96EN0	Silent	SNP	pfam_A-amylase_b_C,pfam_Glyco_hydro_13_cat_dom,pfam_Glyco_hydro_13_N,superfamily_Glycoside_hydrolase_SF,superfamily_Ig_E-set,smart_Glyco_hydro_13_sub_cat_dom	p.R434	ENST00000429644.2	37	c.1302	CCDS54612.1	3																																																																																			GBE1	-	superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000114480		0.393	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBE1	HGNC	protein_coding	OTTHUMT00000352760.2	155	0.00	0	T			81635276	81635276	-1	no_errors	ENST00000429644	ensembl	human	known	69_37n	silent	94	22.31	27	SNP	0.995	G
GBP7	388646	genome.wustl.edu	37	1	89613451	89613451	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:89613451C>A	ENST00000294671.2	-	8	1302	c.1164G>T	c.(1162-1164)gaG>gaT	p.E388D		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	388						membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		CCTTCTTTTTCTCCATGGTGT	0.438																																						dbGAP											0													107.0	105.0	106.0					1																	89613451		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.1164G>T	1.37:g.89613451C>A	ENSP00000294671:p.Glu388Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.E388D	ENST00000294671.2	37	c.1164	CCDS720.1	1	.	.	.	.	.	.	.	.	.	.	C	5.062	0.197093	0.09599	.	.	ENSG00000213512	ENST00000294671	T	0.55930	0.49	3.95	0.65	0.17812	Guanylate-binding protein, C-terminal (3);	0.288405	0.33346	N	0.005012	T	0.18509	0.0444	L	0.56199	1.76	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.20174	-1.0283	10	0.20046	T	0.44	.	4.2247	0.10575	0.1872:0.5775:0.0:0.2353	.	388	Q8N8V2	GBP7_HUMAN	D	388	ENSP00000294671:E388D	ENSP00000294671:E388D	E	-	3	2	GBP7	89386039	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.366000	0.07563	0.326000	0.23384	-0.293000	0.09583	GAG	GBP7	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000213512		0.438	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	HGNC	protein_coding	OTTHUMT00000029401.1	152	0.00	0	C	NM_207398		89613451	89613451	-1	no_errors	ENST00000294671	ensembl	human	known	69_37n	missense	69	21.35	19	SNP	0.020	A
GGCX	2677	genome.wustl.edu	37	2	85777243	85777243	+	Silent	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:85777243C>G	ENST00000233838.4	-	15	2171	c.2091G>C	c.(2089-2091)ctG>ctC	p.L697L	GGCX_ENST00000430215.3_Silent_p.L640L|GGCX_ENST00000473665.1_5'Flank	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	697					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	TACAAGTCATCAGGAAGCTGA	0.483																																						dbGAP											0													50.0	49.0	49.0					2																	85777243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.2091G>C	2.37:g.85777243C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMC5|E9PEE1|Q14415|Q6GU45	Silent	SNP	pfam_VKG_COase,superfamily_RmlC_Cupin,smart_HTTM	p.L697	ENST00000233838.4	37	c.2091	CCDS1978.1	2																																																																																			GGCX	-	NULL	ENSG00000115486		0.483	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	HGNC	protein_coding	OTTHUMT00000252490.3	45	0.00	0	C	NM_000821		85777243	85777243	-1	no_errors	ENST00000233838	ensembl	human	known	69_37n	silent	36	29.41	15	SNP	1.000	G
GJA1	2697	genome.wustl.edu	37	6	121768943	121768943	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:121768943A>G	ENST00000282561.3	+	2	1107	c.950A>G	c.(949-951)cAa>cGa	p.Q317R		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	317					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	AGTGCAGAACAAAATCGAATG	0.463																																						dbGAP											0													75.0	76.0	76.0					6																	121768943		2203	4297	6500	-	-	-	SO:0001583	missense	0			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.950A>G	6.37:g.121768943A>G	ENSP00000282561:p.Gln317Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,pfam_Connexin43_C,smart_Connexin_N,prints_Connexin,prints_Connexin43	p.Q317R	ENST00000282561.3	37	c.950	CCDS5123.1	6	.	.	.	.	.	.	.	.	.	.	A	10.46	1.357025	0.24598	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	T	0.79653	-1.29	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000001	T	0.77398	0.4124	L	0.27053	0.805	0.58432	D	0.999998	P	0.41188	0.741	D	0.63703	0.917	T	0.75637	-0.3249	10	0.22706	T	0.39	.	14.9505	0.71071	1.0:0.0:0.0:0.0	.	317	P17302	CXA1_HUMAN	R	301;317	ENSP00000282561:Q317R	ENSP00000282561:Q317R	Q	+	2	0	GJA1	121810642	1.000000	0.71417	1.000000	0.80357	0.096000	0.18686	6.921000	0.75805	2.176000	0.68965	0.477000	0.44152	CAA	GJA1	-	NULL	ENSG00000152661		0.463	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA1	HGNC	protein_coding	OTTHUMT00000042023.1	76	0.00	0	A	NM_000165		121768943	121768943	+1	no_errors	ENST00000282561	ensembl	human	known	69_37n	missense	86	13.13	13	SNP	1.000	G
GLB1L2	89944	genome.wustl.edu	37	11	134238554	134238554	+	Silent	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr11:134238554G>T	ENST00000535456.2	+	10	1094	c.906G>T	c.(904-906)gtG>gtT	p.V302V	GLB1L2_ENST00000389881.3_Silent_p.V302V|GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Silent_p.V302V	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	302					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		TGAAAACCGTGTCTGCCATTG	0.532																																						dbGAP											0													78.0	76.0	77.0					11																	134238554		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.906G>T	11.37:g.134238554G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.V241F	ENST00000535456.2	37	c.721	CCDS31724.1	11	.	.	.	.	.	.	.	.	.	.	G	0.426	-0.906037	0.02453	.	.	ENSG00000149328	ENST00000525089;ENST00000533324	D;D	0.98150	-4.75;-4.75	5.19	3.1	0.35709	.	0.200224	0.42420	D	0.000701	D	0.96639	0.8903	.	.	.	0.54753	D	0.999984	.	.	.	.	.	.	D	0.94601	0.7796	7	0.41790	T	0.15	-30.9888	5.7759	0.18279	0.1809:0.0:0.6141:0.205	.	.	.	.	F	241;130	ENSP00000432527:V241F;ENSP00000434601:V130F	ENSP00000432527:V241F	V	+	1	0	GLB1L2	133743764	0.847000	0.29606	0.998000	0.56505	0.024000	0.10985	-0.070000	0.11523	1.179000	0.42884	-0.140000	0.14226	GTC	GLB1L2	-	pfam_Glycoside_Hdrlase_35,superfamily_Glycoside_hydrolase_SF	ENSG00000149328		0.532	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L2	HGNC	protein_coding	OTTHUMT00000393629.2	93	0.00	0	G	NM_138342		134238554	134238554	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000525089	ensembl	human	putative	69_37n	missense	33	13.16	5	SNP	0.724	T
HOXB2	3212	genome.wustl.edu	37	17	46622059	46622059	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:46622059G>A	ENST00000330070.4	-	1	1382	c.215C>T	c.(214-216)gCc>gTc	p.A72V	HOXB-AS1_ENST00000504972.3_RNA|HOXB2_ENST00000504772.3_5'Flank|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000502764.2_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	72					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						CCCATCTTCGGCTCGCTTTTG	0.652																																						dbGAP											0													18.0	25.0	23.0					17																	46622059		2200	4296	6496	-	-	-	SO:0001583	missense	0				CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.215C>T	17.37:g.46622059G>A	ENSP00000331741:p.Ala72Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P10913|P17485	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	p.A72V	ENST00000330070.4	37	c.215	CCDS11527.1	17	.	.	.	.	.	.	.	.	.	.	G	17.32	3.358654	0.61403	.	.	ENSG00000173917	ENST00000330070	D	0.92495	-3.05	5.05	5.05	0.67936	.	0.401807	0.26207	N	0.025713	D	0.85080	0.5615	L	0.29908	0.895	0.48185	D	0.999602	P	0.35745	0.518	B	0.30401	0.115	T	0.83158	-0.0100	10	0.25106	T	0.35	.	12.9767	0.58542	0.0:0.0:0.8375:0.1624	.	72	P14652	HXB2_HUMAN	V	72	ENSP00000331741:A72V	ENSP00000331741:A72V	A	-	2	0	HOXB2	43977058	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.004000	0.49513	2.629000	0.89072	0.650000	0.86243	GCC	HOXB2	-	NULL	ENSG00000173917		0.652	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB2	HGNC	protein_coding	OTTHUMT00000358384.2	50	0.00	0	G			46622059	46622059	-1	no_errors	ENST00000330070	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	A
HOXB3	3213	genome.wustl.edu	37	17	46629421	46629421	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:46629421G>A	ENST00000470495.1	-	1	1863	c.416C>T	c.(415-417)aCg>aTg	p.T139M	HOXB3_ENST00000498678.1_Missense_Mutation_p.T139M|HOXB3_ENST00000460160.1_Missense_Mutation_p.T7M|HOXB3_ENST00000489475.1_Missense_Mutation_p.T66M|HOXB3_ENST00000476342.1_Missense_Mutation_p.T139M|HOXB3_ENST00000311626.4_Missense_Mutation_p.T139M|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000472863.1_Missense_Mutation_p.T66M|HOXB3_ENST00000485909.2_Missense_Mutation_p.T7M|HOXB-AS1_ENST00000508688.1_RNA|HOXB3_ENST00000490677.1_Intron|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000502764.2_RNA			P14651	HXB3_HUMAN	homeobox B3	139					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						CAGCTTGGACGTTTGCCTCGA	0.557																																						dbGAP											0													270.0	301.0	290.0					17																	46629421		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.416C>T	17.37:g.46629421G>A	ENSP00000417207:p.Thr139Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.T139M	ENST00000470495.1	37	c.416	CCDS11528.1	17	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121952	0.56613	.	.	ENSG00000120093	ENST00000470495;ENST00000472863;ENST00000311626;ENST00000498678;ENST00000460160;ENST00000485909;ENST00000489475;ENST00000476342;ENST00000471459	D;D;D;D;D;D;D;D;T	0.91407	-2.2;-2.2;-2.2;-2.2;-2.84;-2.84;-2.2;-2.2;1.47	4.35	3.3	0.37823	.	0.335471	0.25851	U	0.027881	D	0.86218	0.5880	L	0.34521	1.04	0.80722	D	1	D	0.61697	0.99	P	0.46885	0.53	D	0.86909	0.2059	10	0.87932	D	0	.	10.0781	0.42373	0.0:0.0:0.6017:0.3983	.	139	P14651	HXB3_HUMAN	M	139;66;139;139;7;7;66;139;66	ENSP00000417207:T139M;ENSP00000419676:T66M;ENSP00000308252:T139M;ENSP00000420595:T139M;ENSP00000418035:T7M;ENSP00000438747:T7M;ENSP00000418729:T66M;ENSP00000418892:T139M;ENSP00000417400:T66M	ENSP00000308252:T139M	T	-	2	0	HOXB3	43984420	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.041000	0.57339	2.430000	0.82344	0.555000	0.69702	ACG	HOXB3	-	NULL	ENSG00000120093		0.557	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB3	HGNC	protein_coding	OTTHUMT00000358261.1	159	0.00	0	G			46629421	46629421	-1	no_errors	ENST00000311626	ensembl	human	known	69_37n	missense	60	31.82	28	SNP	1.000	A
HSD3B2	3284	genome.wustl.edu	37	1	119964794	119964794	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:119964794T>C	ENST00000543831.1	+	4	919	c.670T>C	c.(670-672)Tat>Cat	p.Y224H	HSD3B2_ENST00000369416.3_Missense_Mutation_p.Y224H	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	224					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	CAACCCAGTCTATGTTGGCAA	0.527																																						dbGAP											0													61.0	63.0	62.0					1																	119964794		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.670T>C	1.37:g.119964794T>C	ENSP00000445122:p.Tyr224His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	p.Y224H	ENST00000543831.1	37	c.670	CCDS902.1	1	.	.	.	.	.	.	.	.	.	.	-	17.87	3.495386	0.64186	.	.	ENSG00000203859	ENST00000543831;ENST00000369416	D;D	0.94457	-3.43;-3.43	3.98	3.98	0.46160	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95990	0.8694	M	0.77820	2.39	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95741	0.8783	9	.	.	.	-0.0382	12.0934	0.53739	0.0:0.0:0.0:1.0	.	224	P26439	3BHS2_HUMAN	H	224	ENSP00000445122:Y224H;ENSP00000358424:Y224H	.	Y	+	1	0	HSD3B2	119766317	1.000000	0.71417	0.993000	0.49108	0.599000	0.36880	7.312000	0.78968	1.463000	0.47967	0.248000	0.18094	TAT	HSD3B2	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct	ENSG00000203859		0.527	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	HGNC	protein_coding	OTTHUMT00000034994.1	96	0.00	0	T	NM_000198		119964794	119964794	+1	no_errors	ENST00000369416	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	0.998	C
IGFL2	147920	genome.wustl.edu	37	19	46663943	46663943	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:46663943A>T	ENST00000377693.4	+	3	182	c.146A>T	c.(145-147)gAg>gTg	p.E49V	AC007193.6_ENST00000597989.1_lincRNA|IGFL2_ENST00000600243.1_3'UTR|IGFL2_ENST00000434646.2_Missense_Mutation_p.E60V	NM_001135113.1	NP_001128585.1	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2	49						extracellular region (GO:0005576)				cervix(1)|lung(5)	6		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		AACCCCTTGGAGCAGTGCTGT	0.587																																						dbGAP											0													168.0	182.0	177.0					19																	46663943		2200	4300	6500	-	-	-	SO:0001583	missense	0			AY672112	CCDS46121.1, CCDS46122.1	19q13.32	2006-07-14							32929	protein-coding gene	gene with protein product		610545				14702039	Standard	NM_001002915		Approved	UNQ645	uc010xxv.2	Q6UWQ7		ENST00000377693.4:c.146A>T	19.37:g.46663943A>T	ENSP00000366922:p.Glu49Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PAV1|Q6B9Z3	Missense_Mutation	SNP	NULL	p.E60V	ENST00000377693.4	37	c.179	CCDS46121.1	19	.	.	.	.	.	.	.	.	.	.	A	15.19	2.759834	0.49468	.	.	ENSG00000204866	ENST00000434646;ENST00000377693	T;T	0.25749	1.78;1.78	2.83	2.83	0.33086	.	.	.	.	.	T	0.38746	0.1052	L	0.43923	1.385	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.984	T	0.06954	-1.0798	9	0.87932	D	0	-15.6476	7.5364	0.27712	1.0:0.0:0.0:0.0	.	49;60	Q6UWQ7;Q6UWQ7-2	IGFL2_HUMAN;.	V	60;49	ENSP00000395219:E60V;ENSP00000366922:E49V	ENSP00000366922:E49V	E	+	2	0	IGFL2	51355783	0.008000	0.16893	0.006000	0.13384	0.062000	0.15995	2.012000	0.40932	1.546000	0.49388	0.333000	0.21579	GAG	IGFL2	-	NULL	ENSG00000204866		0.587	IGFL2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGFL2	HGNC	protein_coding	OTTHUMT00000461705.1	90	0.00	0	A	NM_001002915		46663943	46663943	+1	no_errors	ENST00000434646	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.009	T
INMT	11185	genome.wustl.edu	37	7	30791789	30791789	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr7:30791789G>A	ENST00000013222.5	+	1	39	c.23G>A	c.(22-24)gGt>gAt	p.G8D	INMT_ENST00000484180.1_Intron|INMT-FAM188B_ENST00000458257.1_Missense_Mutation_p.G8D|INMT_ENST00000409539.1_Missense_Mutation_p.G8D	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	8					amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)			kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						TTCACTGGGGGTGATGAGTAC	0.567																																						dbGAP											0													123.0	119.0	121.0					7																	30791789		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.23G>A	7.37:g.30791789G>A	ENSP00000013222:p.Gly8Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	Missense_Mutation	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.G8D	ENST00000013222.5	37	c.23	CCDS5430.1	7	.	.	.	.	.	.	.	.	.	.	G	12.20	1.865268	0.32977	.	.	ENSG00000241644	ENST00000013222;ENST00000409539	T;T	0.09163	3.01;3.01	3.35	-0.827	0.10802	.	0.328368	0.24788	N	0.035582	T	0.11879	0.0289	M	0.68593	2.085	0.09310	N	1	P;P	0.45594	0.862;0.862	P;P	0.46110	0.504;0.504	T	0.20240	-1.0281	10	0.22109	T	0.4	-3.8275	5.2542	0.15539	0.2983:0.1583:0.5433:0.0	.	8;8	B8ZZ69;O95050	.;INMT_HUMAN	D	8	ENSP00000013222:G8D;ENSP00000386961:G8D	ENSP00000013222:G8D	G	+	2	0	INMT	30758314	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.349000	0.07731	-0.189000	0.10482	0.655000	0.94253	GGT	INMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	ENSG00000241644		0.567	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INMT	HGNC	protein_coding	OTTHUMT00000214993.3	58	0.00	0	G	NM_006774		30791789	30791789	+1	no_errors	ENST00000013222	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.000	A
ITGA10	8515	genome.wustl.edu	37	1	145527965	145527965	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:145527965G>T	ENST00000369304.3	+	3	377	c.202G>T	c.(202-204)Gac>Tac	p.D68Y	ITGA10_ENST00000539363.1_Intron|ITGA10_ENST00000538811.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	68					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.D68N(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCCTTCAGGCGACCGGAGGGG	0.602																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											9.0	10.0	10.0					1																	145527965		2157	4271	6428	-	-	-	SO:0001583	missense	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.202G>T	1.37:g.145527965G>T	ENSP00000358310:p.Asp68Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.D68Y	ENST00000369304.3	37	c.202	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897275	0.33535	.	.	ENSG00000143127	ENST00000369304	T	0.70986	-0.53	5.4	3.53	0.40419	.	0.129111	0.51477	D	0.000097	T	0.63224	0.2493	L	0.40543	1.245	0.80722	D	1	B;D	0.60575	0.015;0.988	B;P	0.61397	0.02;0.888	T	0.67488	-0.5658	10	0.87932	D	0	.	7.3764	0.26831	0.2659:0.0:0.7341:0.0	.	68;68	O75578;O75578-2	ITA10_HUMAN;.	Y	68	ENSP00000358310:D68Y	ENSP00000358310:D68Y	D	+	1	0	ITGA10	144239322	0.996000	0.38824	0.773000	0.31616	0.947000	0.59692	2.781000	0.47750	0.665000	0.31066	0.563000	0.77884	GAC	ITGA10	-	smart_Int_alpha_beta-p	ENSG00000143127		0.602	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	41	0.00	0	G	NM_003637		145527965	145527965	+1	no_errors	ENST00000369304	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	0.913	T
ITGAL	3683	genome.wustl.edu	37	16	30528336	30528336	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr16:30528336C>A	ENST00000356798.6	+	26	3085	c.2905C>A	c.(2905-2907)Ctg>Atg	p.L969M	ITGAL_ENST00000358164.5_Missense_Mutation_p.L885M|ITGAL_ENST00000433423.2_Missense_Mutation_p.L203M	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	969					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.L969M(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CATACCCACCCTGGAGGCTGT	0.637																																					NSCLC(110;1462 1641 3311 33990 49495)	dbGAP											1	Substitution - Missense(1)	lung(1)											138.0	145.0	143.0					16																	30528336		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2905C>A	16.37:g.30528336C>A	ENSP00000349252:p.Leu969Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.L969M	ENST00000356798.6	37	c.2905	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616532	0.66672	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.51817	0.69;0.69;0.69	4.61	3.66	0.41972	Integrin alpha-2 (1);	0.000000	0.41500	D	0.000867	T	0.64249	0.2581	M	0.75447	2.3	0.80722	D	1	D;D;D	0.89917	1.0;0.988;0.975	D;D;P	0.97110	1.0;0.936;0.822	T	0.65344	-0.6191	10	0.56958	D	0.05	.	8.5855	0.33655	0.0:0.8945:0.0:0.1055	.	203;885;969	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	M	969;885;203	ENSP00000349252:L969M;ENSP00000350886:L885M;ENSP00000409377:L203M	ENSP00000349252:L969M	L	+	1	2	ITGAL	30435837	0.023000	0.18921	0.859000	0.33776	0.385000	0.30292	0.621000	0.24418	1.285000	0.44548	0.557000	0.71058	CTG	ITGAL	-	pfam_Integrin_alpha-2	ENSG00000005844		0.637	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2	49	0.00	0	C			30528336	30528336	+1	no_errors	ENST00000356798	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.897	A
ITIH4	3700	genome.wustl.edu	37	3	52858309	52858309	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr3:52858309delC	ENST00000266041.4	-	9	1164	c.1068delG	c.(1066-1068)atgfs	p.M356fs	ITIH4_ENST00000467462.1_5'Flank|ITIH4-AS1_ENST00000478366.1_RNA|ITIH4_ENST00000406595.1_Frame_Shift_Del_p.M356fs|ITIH4_ENST00000346281.5_Frame_Shift_Del_p.M356fs|ITIH4_ENST00000485816.1_Frame_Shift_Del_p.M356fs|RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000434759.3_Frame_Shift_Del_p.M268fs	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	356	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CAGCCATCAGCATTGCATCAT	0.612																																						dbGAP											0													114.0	106.0	109.0					3																	52858309		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.1068delG	3.37:g.52858309delC	ENSP00000266041:p.Met356fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Frame_Shift_Del	DEL	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.M356fs	ENST00000266041.4	37	c.1068	CCDS2865.1	3																																																																																			ITIH4	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000055955		0.612	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITIH4	HGNC	protein_coding	OTTHUMT00000317715.1	51	0.00	0	C	NM_002218		52858309	52858309	-1	no_errors	ENST00000266041	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.994	-
ITLN2	142683	genome.wustl.edu	37	1	160924178	160924178	+	Splice_Site	SNP	T	T	G	rs139849754		TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:160924178T>G	ENST00000368029.3	-	2	135	c.78A>C	c.(76-78)gcA>gcC	p.A26A		NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	26						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GCCATTTACCTGCACTGCACC	0.557											OREG0013934	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													90.0	84.0	86.0					1																	160924178		2197	4298	6495	-	-	-	SO:0001630	splice_region_variant	0			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.79+1A>C	1.37:g.160924178T>G		Somatic	1812	WXS	Illumina GAIIx	Phase_IV	Q17RR2|Q5VYI0	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C	p.A26	ENST00000368029.3	37	c.78	CCDS1212.1	1																																																																																			ITLN2	-	NULL	ENSG00000158764		0.557	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN2	HGNC	protein_coding	OTTHUMT00000071465.1	150	0.00	0	T	NM_080878	Silent	160924178	160924178	-1	no_errors	ENST00000368029	ensembl	human	known	69_37n	silent	118	13.87	19	SNP	0.018	G
KATNAL1	84056	genome.wustl.edu	37	13	30854326	30854326	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr13:30854326A>T	ENST00000380615.3	-	3	364	c.197T>A	c.(196-198)gTt>gAt	p.V66D	KATNAL1_ENST00000380617.3_Missense_Mutation_p.V66D|RNU6-64P_ENST00000517119.1_RNA	NM_032116.4	NP_115492.1			katanin p60 subunit A-like 1											autonomic_ganglia(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)|urinary_tract(3)	19		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)		AATACTTTTAACTTGTTCATA	0.323																																						dbGAP											0													61.0	66.0	65.0					13																	30854326		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097423	CCDS31956.1	13q12.3	2010-04-21			ENSG00000102781	ENSG00000102781		"""ATPases / AAA-type"""	28361	protein-coding gene	gene with protein product		614764				12477932	Standard	NM_001014380		Approved	MGC2599	uc001uss.4	Q9BW62	OTTHUMG00000016665	ENST00000380615.3:c.197T>A	13.37:g.30854326A>T	ENSP00000369989:p.Val66Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,smart_AAA+_ATPase	p.V66D	ENST00000380615.3	37	c.197	CCDS31956.1	13	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703089	0.68501	.	.	ENSG00000102781	ENST00000380615;ENST00000380617;ENST00000414289;ENST00000441394	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.62220	-0.6900	10	0.87932	D	0	-0.1854	15.3789	0.74637	1.0:0.0:0.0:0.0	.	66	Q9BW62	KATL1_HUMAN	D	66	ENSP00000369989:V66D;ENSP00000369991:V66D;ENSP00000397776:V66D;ENSP00000407792:V66D	ENSP00000369989:V66D	V	-	2	0	KATNAL1	29752326	1.000000	0.71417	0.999000	0.59377	0.571000	0.35966	8.841000	0.92131	2.043000	0.60533	0.260000	0.18958	GTT	KATNAL1	-	NULL	ENSG00000102781		0.323	KATNAL1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KATNAL1	HGNC	protein_coding	OTTHUMT00000044346.2	86	0.00	0	A	NM_032116		30854326	30854326	-1	no_errors	ENST00000380615	ensembl	human	known	69_37n	missense	119	52.78	133	SNP	1.000	T
KAZALD1	81621	genome.wustl.edu	37	10	102824287	102824287	+	Silent	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr10:102824287G>T	ENST00000370200.5	+	4	1028	c.702G>T	c.(700-702)gtG>gtT	p.V234V		NM_030929.4	NP_112191.2	Q96I82	KAZD1_HUMAN	Kazal-type serine peptidase inhibitor domain 1	234	Ig-like C2-type.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|regulation of cell growth (GO:0001558)	interstitial matrix (GO:0005614)				endometrium(1)|ovary(1)|prostate(2)	4				Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)		GGTTTGAGGTGACTGGCTGGC	0.637																																						dbGAP											0													58.0	53.0	55.0					10																	102824287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF333487	CCDS7509.1	10q24.32	2013-01-11	2005-08-17		ENSG00000107821	ENSG00000107821		"""Immunoglobulin superfamily / I-set domain containing"""	25460	protein-coding gene	gene with protein product		609208	"""Kazal-type serine protease inhibitor domain 1"""			12975309	Standard	NM_030929		Approved	FKSG40, FKSG28	uc001ksr.3	Q96I82	OTTHUMG00000018918	ENST00000370200.5:c.702G>T	10.37:g.102824287G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR74|Q6ZMB1|Q9BQ73	Silent	SNP	pfam_Ig_I-set,pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,pfam_Immunoglobulin,pfam_IGFBP-like,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pirsf_IGFBP_rP_mac25,pfscan_Ig-like	p.V234	ENST00000370200.5	37	c.702	CCDS7509.1	10																																																																																			KAZALD1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_IGFBP_rP_mac25,pfscan_Ig-like	ENSG00000107821		0.637	KAZALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZALD1	HGNC	protein_coding	OTTHUMT00000049891.2	79	0.00	0	G	NM_030929		102824287	102824287	+1	no_errors	ENST00000370200	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	1.000	T
KLHL40	131377	genome.wustl.edu	37	3	42733450	42733450	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr3:42733450G>T	ENST00000287777.4	+	6	1931	c.1831G>T	c.(1831-1833)Gtg>Ttg	p.V611L		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	611					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											CTTCCTACCAGTGCGGCTCAA	0.587																																						dbGAP											0													131.0	105.0	114.0					3																	42733450		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.1831G>T	3.37:g.42733450G>T	ENSP00000287777:p.Val611Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SI1|Q96MR2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V611L	ENST00000287777.4	37	c.1831	CCDS2703.1	3	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063816	0.36373	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	T	0.72051	-0.62	3.29	3.29	0.37713	.	0.069438	0.56097	U	0.000024	T	0.64382	0.2593	L	0.48642	1.525	0.54753	D	0.999985	B	0.29552	0.248	B	0.31614	0.133	T	0.64512	-0.6390	10	0.32370	T	0.25	.	15.4287	0.75075	0.0:0.0:1.0:0.0	.	611	Q2TBA0	KBTB5_HUMAN	L	611;356	ENSP00000287777:V611L	ENSP00000287777:V611L	V	+	1	0	KBTBD5	42708454	1.000000	0.71417	0.995000	0.50966	0.151000	0.21798	5.325000	0.65869	1.786000	0.52430	0.195000	0.17529	GTG	KBTBD5	-	pirsf_Kelch-like_gigaxonin	ENSG00000157119		0.587	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD5	HGNC	protein_coding	OTTHUMT00000256651.1	99	0.00	0	G	NM_152393		42733450	42733450	+1	no_errors	ENST00000287777	ensembl	human	known	69_37n	missense	6	72.73	16	SNP	1.000	T
KCNH6	81033	genome.wustl.edu	37	17	61619620	61619620	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:61619620G>T	ENST00000583023.1	+	9	1984	c.1973G>T	c.(1972-1974)gGg>gTg	p.G658V	KCNH6_ENST00000581784.1_Missense_Mutation_p.G605V|KCNH6_ENST00000314672.5_Missense_Mutation_p.G658V|KCNH6_ENST00000456941.2_Missense_Mutation_p.G605V	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	658					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GACATCTTTGGGGAACCCGTC	0.602																																						dbGAP											0													91.0	68.0	76.0					17																	61619620		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1973G>T	17.37:g.61619620G>T	ENSP00000463533:p.Gly658Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRD7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.G658V	ENST00000583023.1	37	c.1973	CCDS11638.1	17	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212967	0.58452	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.99671	-6.35;-6.35	4.72	4.72	0.59763	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.99849	0.9930	H	0.99582	4.64	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.96194	0.9140	10	0.87932	D	0	.	17.6768	0.88233	0.0:0.0:1.0:0.0	.	535;658;605;658	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	V	658;605	ENSP00000318212:G658V;ENSP00000396900:G605V	ENSP00000318212:G658V	G	+	2	0	KCNH6	58973352	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	9.869000	0.99810	2.151000	0.67156	0.591000	0.81541	GGG	KCNH6	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom	ENSG00000173826		0.602	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	76	0.00	0	G	NM_030779		61619620	61619620	+1	no_errors	ENST00000583023	ensembl	human	known	69_37n	missense	3	83.33	15	SNP	1.000	T
KEL	3792	genome.wustl.edu	37	7	142658026	142658026	+	Missense_Mutation	SNP	C	C	T	rs201110152	byFrequency	TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr7:142658026C>T	ENST00000355265.2	-	4	863	c.389G>A	c.(388-390)cGg>cAg	p.R130Q	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	130					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CAGTATTCTCCGAAGTCGGTT	0.502													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19818	0.0		0.0	False		,,,				2504	0.001					dbGAP											0			GRCh37	CM973368	KEL	M							185.0	189.0	188.0					7																	142658026		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.389G>A	7.37:g.142658026C>T	ENSP00000347409:p.Arg130Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.R130Q	ENST00000355265.2	37	c.389	CCDS34766.1	7	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	8.993	0.978135	0.18812	.	.	ENSG00000197993	ENST00000355265;ENST00000476829;ENST00000467543	T;T;T	0.76186	-1.0;-1.0;-1.0	5.84	2.05	0.26809	Peptidase M13 (1);	0.616178	0.14380	N	0.323161	T	0.58623	0.2135	L	0.33485	1.01	0.09310	N	1	P	0.44006	0.824	B	0.37047	0.24	T	0.51482	-0.8700	10	0.54805	T	0.06	-17.8298	7.4412	0.27185	0.0:0.6748:0.0:0.3252	.	130	P23276	KELL_HUMAN	Q	130;130;111	ENSP00000347409:R130Q;ENSP00000419889:R130Q;ENSP00000420011:R111Q	ENSP00000347409:R130Q	R	-	2	0	KEL	142368148	0.003000	0.15002	0.005000	0.12908	0.046000	0.14306	0.086000	0.14935	0.816000	0.34421	0.655000	0.94253	CGG	KEL	-	pfam_Peptidase_M13_N	ENSG00000197993		0.502	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	HGNC	protein_coding	OTTHUMT00000347671.2	216	0.00	0	C	NM_000420		142658026	142658026	-1	no_errors	ENST00000355265	ensembl	human	known	69_37n	missense	185	18.50	42	SNP	0.045	T
KIF5C	3800	genome.wustl.edu	37	2	149864578	149864578	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:149864578G>C	ENST00000435030.1	+	23	2915	c.2547G>C	c.(2545-2547)aaG>aaC	p.K849N	KIF5C_ENST00000397413.1_Missense_Mutation_p.K617N|KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.K754N			O60282	KIF5C_HUMAN	kinesin family member 5C	849					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		AAGTTCACAAGCAGGTAGGAG	0.547																																						dbGAP											0													58.0	62.0	61.0					2																	149864578		1913	4119	6032	-	-	-	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2547G>C	2.37:g.149864578G>C	ENSP00000393379:p.Lys849Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K849N	ENST00000435030.1	37	c.2547		2	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651517	0.67472	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	D;D;D	0.91011	-2.77;-2.77;-2.77	5.82	-1.73	0.08081	.	0.000000	0.85682	D	0.000000	D	0.93413	0.7899	.	.	.	0.47698	D	0.999498	D;D	0.76494	0.981;0.999	D;D	0.80764	0.938;0.994	D	0.90758	0.4662	8	.	.	.	.	10.8929	0.47006	0.6119:0.0:0.3881:0.0	.	849;157	O60282;Q59GB8	KIF5C_HUMAN;.	N	849;754;752;617	ENSP00000393379:K849N;ENSP00000410115:K754N;ENSP00000380560:K617N	.	K	+	3	2	KIF5C	149572824	0.999000	0.42202	0.978000	0.43139	0.905000	0.53344	0.833000	0.27504	-0.543000	0.06240	-0.244000	0.11960	AAG	KIF5C	-	NULL	ENSG00000168280		0.547	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	61	0.00	0	G	NM_004522		149864578	149864578	+1	no_errors	ENST00000435030	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	0.996	C
KL	9365	genome.wustl.edu	37	13	33635059	33635059	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr13:33635059A>G	ENST00000380099.3	+	4	1851	c.1843A>G	c.(1843-1845)Atc>Gtc	p.I615V	KL_ENST00000426690.2_3'UTR|KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	615	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		GAACCACACCATCCTGCAGTA	0.577																																						dbGAP											0													112.0	101.0	105.0					13																	33635059		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1843A>G	13.37:g.33635059A>G	ENSP00000369442:p.Ile615Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.I615V	ENST00000380099.3	37	c.1843	CCDS9347.1	13	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.191476	0.00302	.	.	ENSG00000133116	ENST00000380099	T	0.31510	1.49	5.57	0.874	0.19124	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.690130	0.15058	N	0.282894	T	0.08802	0.0218	N	0.00960	-1.095	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32161	-0.9917	10	0.26408	T	0.33	-10.9491	6.0962	0.20021	0.4315:0.1699:0.3987:0.0	.	615	Q9UEF7	KLOT_HUMAN	V	615	ENSP00000369442:I615V	ENSP00000369442:I615V	I	+	1	0	KL	32533059	0.013000	0.17824	0.104000	0.21259	0.138000	0.21146	1.344000	0.33941	0.219000	0.20840	-0.408000	0.06270	ATC	KL	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000133116		0.577	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KL	HGNC	protein_coding	OTTHUMT00000045987.1	125	0.00	0	A			33635059	33635059	+1	no_errors	ENST00000380099	ensembl	human	known	69_37n	missense	10	70.59	24	SNP	0.075	G
LGI4	163175	genome.wustl.edu	37	19	35625006	35625006	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:35625006G>A	ENST00000310123.3	-	2	692	c.173C>T	c.(172-174)tCa>tTa	p.S58L	LGI4_ENST00000591633.1_Missense_Mutation_p.S58L|LGI4_ENST00000493050.1_5'UTR|LGI4_ENST00000392225.3_Missense_Mutation_p.S58L	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	58					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCTGACGAGTGAGCTGGGGAT	0.622																																						dbGAP											0													64.0	53.0	57.0					19																	35625006		2193	4292	6485	-	-	-	SO:0001583	missense	0			AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.173C>T	19.37:g.35625006G>A	ENSP00000312273:p.Ser58Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	pfam_EPTP,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.S58L	ENST00000310123.3	37	c.173	CCDS12444.1	19	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469667	0.63625	.	.	ENSG00000153902	ENST00000310123;ENST00000392225;ENST00000437421	D;D	0.90004	-2.6;-2.6	4.68	4.68	0.58851	.	0.000000	0.50627	D	0.000106	D	0.92224	0.7534	M	0.65677	2.01	0.47407	D	0.999414	D;D	0.61697	0.99;0.972	P;P	0.62014	0.897;0.895	D	0.92081	0.5672	10	0.51188	T	0.08	.	12.9549	0.58421	0.0:0.0:1.0:0.0	.	58;58	Q8N135-2;Q8N135	.;LGI4_HUMAN	L	58	ENSP00000312273:S58L;ENSP00000376059:S58L	ENSP00000312273:S58L	S	-	2	0	LGI4	40316846	1.000000	0.71417	0.940000	0.37924	0.016000	0.09150	6.587000	0.74071	2.420000	0.82092	0.563000	0.77884	TCA	LGI4	-	NULL	ENSG00000153902		0.622	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI4	HGNC	protein_coding	OTTHUMT00000103963.1	93	0.00	0	G			35625006	35625006	-1	no_errors	ENST00000310123	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.998	A
LGR4	55366	genome.wustl.edu	37	11	27406951	27406951	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr11:27406951G>A	ENST00000379214.4	-	5	909	c.466C>T	c.(466-468)Cgg>Tgg	p.R156W	LGR4_ENST00000389858.4_Missense_Mutation_p.R132W|LGR4_ENST00000480977.2_Missense_Mutation_p.R108W	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	156					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						CACAGATGCCGTAACTGAACA	0.502																																						dbGAP											0													97.0	88.0	91.0					11																	27406951		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.466C>T	11.37:g.27406951G>A	ENSP00000368516:p.Arg156Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.R156W	ENST00000379214.4	37	c.466	CCDS31449.1	11	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532759	0.85812	.	.	ENSG00000205213	ENST00000379214;ENST00000389858;ENST00000480977	T;T;T	0.61158	0.13;2.76;0.13	5.94	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.76385	0.3980	M	0.77406	2.37	0.53688	D	0.999972	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78947	-0.2003	10	0.87932	D	0	.	15.951	0.79840	0.0:0.0:0.8645:0.1355	.	132;156	G5E9B3;Q9BXB1	.;LGR4_HUMAN	W	156;132;108	ENSP00000368516:R156W;ENSP00000374508:R132W;ENSP00000431650:R108W	ENSP00000368516:R156W	R	-	1	2	LGR4	27363527	1.000000	0.71417	0.848000	0.33437	0.971000	0.66376	3.880000	0.56145	2.812000	0.96745	0.557000	0.71058	CGG	LGR4	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000205213		0.502	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR4	HGNC	protein_coding	OTTHUMT00000257467.1	140	0.00	0	G	NM_018490		27406951	27406951	-1	no_errors	ENST00000379214	ensembl	human	known	69_37n	missense	70	11.39	9	SNP	0.995	A
LOXHD1	125336	genome.wustl.edu	37	18	44104856	44104856	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr18:44104856C>T	ENST00000398722.4	-	23	3720	c.3721G>A	c.(3721-3723)Gct>Act	p.A1241T	LOXHD1_ENST00000441551.2_Missense_Mutation_p.A1313T|LOXHD1_ENST00000536736.1_Missense_Mutation_p.A1519T|LOXHD1_ENST00000582408.1_Missense_Mutation_p.A408T|LOXHD1_ENST00000441893.2_Missense_Mutation_p.A452T|LOXHD1_ENST00000579038.1_Missense_Mutation_p.A312T|LOXHD1_ENST00000300591.6_Missense_Mutation_p.A408T			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1241	PLAT 9. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CCTAGGTCAGCGGCCTCGATG	0.582																																						dbGAP											0													112.0	109.0	110.0					18																	44104856		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.3721G>A	18.37:g.44104856C>T	ENSP00000381707:p.Ala1241Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.A1519T	ENST00000398722.4	37	c.4555		18	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417700	0.62622	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.34	5.34	0.76211	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.180462	0.47852	D	0.000211	T	0.64918	0.2642	N	0.16368	0.405	0.46823	D	0.999216	D;D;D;D	0.76494	0.998;0.999;0.998;0.999	P;D;P;D	0.65233	0.865;0.917;0.877;0.933	T	0.65084	-0.6254	10	0.33940	T	0.23	.	17.8022	0.88591	0.0:1.0:0.0:0.0	.	1519;452;1241;1241	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	T	408;1241;1519;452;1241	ENSP00000300591:A408T;ENSP00000381707:A1241T;ENSP00000444586:A1519T;ENSP00000409062:A452T	ENSP00000300591:A408T	A	-	1	0	LOXHD1	42358854	1.000000	0.71417	0.974000	0.42286	0.899000	0.52679	7.575000	0.82447	2.501000	0.84356	0.561000	0.74099	GCT	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.582	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		152	0.00	0	C	NM_144612		44104856	44104856	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	33	28.26	13	SNP	0.999	T
MAML2	84441	genome.wustl.edu	37	11	95825480	95825480	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr11:95825480G>A	ENST00000524717.1	-	2	2999	c.1715C>T	c.(1714-1716)cCt>cTt	p.P572L		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	572					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CAAAACAGAAGGCATCTGCTG	0.527			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																	dbGAP		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0													64.0	72.0	69.0					11																	95825480		2176	4292	6468	-	-	-	SO:0001583	missense	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1715C>T	11.37:g.95825480G>A	ENSP00000434552:p.Pro572Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.P572L	ENST00000524717.1	37	c.1715	CCDS44714.1	11	.	.	.	.	.	.	.	.	.	.	G	15.95	2.982648	0.53827	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.69685	-0.42;-0.42	5.26	5.26	0.73747	.	0.094060	0.46145	D	0.000315	T	0.66307	0.2776	M	0.66297	2.02	0.54753	D	0.99998	P	0.42692	0.787	B	0.37091	0.241	T	0.72067	-0.4402	10	0.54805	T	0.06	-12.682	18.8795	0.92351	0.0:0.0:1.0:0.0	.	572	Q8IZL2	MAML2_HUMAN	L	572	ENSP00000434552:P572L;ENSP00000412394:P572L	ENSP00000412394:P572L	P	-	2	0	MAML2	95465128	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.978000	0.56881	2.452000	0.82932	0.555000	0.69702	CCT	MAML2	-	NULL	ENSG00000184384		0.527	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1	288	0.00	0	G			95825480	95825480	-1	no_errors	ENST00000440572	ensembl	human	known	69_37n	missense	150	17.13	31	SNP	1.000	A
MARCO	8685	genome.wustl.edu	37	2	119727689	119727689	+	Splice_Site	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:119727689G>A	ENST00000327097.4	+	3	334		c.e3-1		MARCO_ENST00000541757.1_Splice_Site	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure						apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GTGGGGCCCAGTTCTGAATCT	0.537																																					GBM(8;18 374 7467 11269 32796)	dbGAP											0													56.0	66.0	62.0					2																	119727689		2201	4300	6501	-	-	-	SO:0001630	splice_region_variant	0			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.200-1G>A	2.37:g.119727689G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DW79|Q9Y5S3	Splice_Site	SNP	-	e3-1	ENST00000327097.4	37	c.200-1	CCDS2124.1	2	.	.	.	.	.	.	.	.	.	.	G	18.20	3.572072	0.65765	.	.	ENSG00000019169	ENST00000327097;ENST00000410021	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8619	0.57918	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MARCO	119444159	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.703000	0.54808	2.756000	0.94617	0.561000	0.74099	.	MARCO	-	-	ENSG00000019169		0.537	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCO	HGNC	protein_coding	OTTHUMT00000254190.2	118	0.00	0	G	NM_006770	Intron	119727689	119727689	+1	no_errors	ENST00000327097	ensembl	human	known	69_37n	splice_site	20	42.86	15	SNP	1.000	A
MYO1G	64005	genome.wustl.edu	37	7	45009012	45009012	+	Splice_Site	DEL	G	G	-			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr7:45009012delG	ENST00000258787.7	-	12	1710	c.1574delC	c.(1573-1575)acg>ag	p.T525fs		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	525	Myosin motor.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						GGGCCCTTACGTGACGTCCCC	0.612																																						dbGAP											0													157.0	145.0	149.0					7																	45009012		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.1574+1C>-	7.37:g.45009012delG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.T525fs	ENST00000258787.7	37	c.1574	CCDS34629.1	7																																																																																			MYO1G	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000136286		0.612	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1G	HGNC	protein_coding	OTTHUMT00000341832.2	57	0.00	0	G		Frame_Shift_Del	45009012	45009012	-1	no_errors	ENST00000258787	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	1.000	-
MYO3A	53904	genome.wustl.edu	37	10	26436364	26436364	+	Silent	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr10:26436364C>T	ENST00000265944.5	+	23	2677	c.2511C>T	c.(2509-2511)ctC>ctT	p.L837L	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	837	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AACAGGTCCTCTATAATGCAA	0.393																																						dbGAP											0													176.0	148.0	157.0					10																	26436364		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2511C>T	10.37:g.26436364C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.L837	ENST00000265944.5	37	c.2511	CCDS7148.1	10																																																																																			MYO3A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000095777		0.393	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	159	0.00	0	C	NM_017433		26436364	26436364	+1	no_errors	ENST00000265944	ensembl	human	known	69_37n	silent	60	18.92	14	SNP	0.961	T
NASP	4678	genome.wustl.edu	37	1	46072992	46072992	+	Splice_Site	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:46072992G>C	ENST00000350030.3	+	6	496		c.e6-1		NASP_ENST00000372052.4_Intron|NASP_ENST00000537798.1_Splice_Site|NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_Splice_Site	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)						blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					TAACCATGTAGAGGAAGCAAG	0.373																																						dbGAP											0													51.0	49.0	49.0					1																	46072992		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.410-1G>C	1.37:g.46072992G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Splice_Site	SNP	-	e6-1	ENST00000350030.3	37	c.416-1	CCDS524.1	1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.784049	0.70222	.	.	ENSG00000132780	ENST00000527470;ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030;ENST00000470768	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4227	0.90597	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NASP	45845579	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.615000	0.98356	2.639000	0.89480	0.650000	0.86243	.	NASP	-	-	ENSG00000132780		0.373	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NASP	HGNC	protein_coding	OTTHUMT00000021533.2	63	0.00	0	G	NM_002482	Intron	46072992	46072992	+1	no_errors	ENST00000402363	ensembl	human	known	69_37n	splice_site	76	16.48	15	SNP	1.000	C
NRP2	8828	genome.wustl.edu	37	2	206631527	206631527	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:206631527G>T	ENST00000360409.3	+	15	3216	c.2425G>T	c.(2425-2427)Ggt>Tgt	p.G809C	NRP2_ENST00000540841.1_Intron|NRP2_ENST00000357785.5_Splice_Site_p.V809L|NRP2_ENST00000357118.4_Splice_Site_p.G809W|AC007362.3_ENST00000423425.1_RNA|NRP2_ENST00000485684.1_3'UTR|AC007362.3_ENST00000598710.1_RNA|NRP2_ENST00000540178.1_Intron|NRP2_ENST00000272849.3_Missense_Mutation_p.G809C|AC007362.3_ENST00000596616.1_RNA|NRP2_ENST00000412873.2_Splice_Site_p.D809Y	NM_003872.2|NM_201266.1|NM_201279.1	NP_003863.2|NP_957718|NP_958436.1	Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						GGCTTTTGCAGGTGAGAATTT	0.343											OREG0015156	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													92.0	91.0	91.0					2																	206631527		2148	4289	6437	-	-	-	SO:0001583	missense	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000360409.3:c.2425G>T	2.37:g.206631527G>T	ENSP00000353582:p.Gly809Cys	Somatic	2161	WXS	Illumina GAIIx	Phase_IV	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.G809C	ENST00000360409.3	37	c.2425	CCDS2364.1	2	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	.|.|.|.	G|G|G|G	15.59|15.59|15.59|15.59	2.879410|2.879410|2.879410|2.879410	0.51801|0.51801|0.51801|0.51801	.|.|.|.	.|.|.|.	ENSG00000118257|ENSG00000118257|ENSG00000118257|ENSG00000118257	ENST00000412873|ENST00000360409;ENST00000272849|ENST00000357118|ENST00000357785	D|D;D|D|D	0.88354|0.87809|0.87650|0.87029	-2.37|-2.15;-2.3|-2.28|-2.2	5.45|5.45|5.45|5.45	5.45|5.45|5.45|5.45	0.79879|0.79879|0.79879|0.79879	.|.|.|.	.|0.418439|0.418439|.	.|0.28067|0.28067|.	.|N|N|.	.|0.016737|0.016737|.	T|T|T|T	0.76863|0.76863|0.76863|0.76863	0.4047|0.4047|0.4047|0.4047	N|N|N|N	0.08118|0.08118|0.08118|0.08118	0|0|0|0	0.80722|0.80722|0.80722|0.80722	D|D|D|D	1|1|1|1	B|D;P|P|B	0.12013|0.89917|0.50156|0.06786	0.005|1.0;0.954|0.932|0.001	B|D;B|B|B	0.09377|0.91635|0.43331|0.04013	0.004|0.999;0.394|0.416|0.001	T|T|T|T	0.71745|0.71745|0.71745|0.71745	-0.4500|-0.4500|-0.4500|-0.4500	9|10|10|9	0.62326|0.56958|0.32370|0.45353	D|D|T|T	0.03|0.05|0.25|0.12	-12.7882|-12.7882|-12.7882|-12.7882	16.4443|16.4443|16.4443|16.4443	0.83913|0.83913|0.83913|0.83913	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.|.	809|809;809|809|809	O60462-2|O60462;O60462-5|O60462-4|O60462-3	.|NRP2_HUMAN;.|.|.	Y|C|W|L	809|809|809|809	ENSP00000407626:D809Y|ENSP00000353582:G809C;ENSP00000272849:G809C|ENSP00000349632:G809W|ENSP00000350432:V809L	ENSP00000407626:D809Y|ENSP00000272849:G809C|ENSP00000349632:G809W|ENSP00000350432:V809L	D|G|G|V	+|+|+|+	1|1|1|1	0|0|0|0	NRP2|NRP2|NRP2|NRP2	206339772|206339772|206339772|206339772	1.000000|1.000000|1.000000|1.000000	0.71417|0.71417|0.71417|0.71417	1.000000|1.000000|1.000000|1.000000	0.80357|0.80357|0.80357|0.80357	0.991000|0.991000|0.991000|0.991000	0.79684|0.79684|0.79684|0.79684	5.682000|5.682000|5.682000|5.682000	0.68182|0.68182|0.68182|0.68182	2.555000|2.555000|2.555000|2.555000	0.86185|0.86185|0.86185|0.86185	0.655000|0.655000|0.655000|0.655000	0.94253|0.94253|0.94253|0.94253	GAT|GGT|GGG|GTG	NRP2	-	pirsf_Neuropilin	ENSG00000118257		0.343	NRP2-001	KNOWN	basic|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000256392.1	180	0.00	0	G			206631527	206631527	+1	no_errors	ENST00000360409	ensembl	human	known	69_37n	missense	673	27.94	261	SNP	1.000	T
NUF2	83540	genome.wustl.edu	37	1	163318796	163318796	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:163318796C>G	ENST00000271452.3	+	13	1465	c.1186C>G	c.(1186-1188)Caa>Gaa	p.Q396E	NUF2_ENST00000367900.3_Missense_Mutation_p.Q396E|NUF2_ENST00000524800.1_Missense_Mutation_p.Q349E	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	396	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					CACAATTAATCAAGAAATCCA	0.338																																						dbGAP											0													65.0	69.0	68.0					1																	163318796		2203	4299	6502	-	-	-	SO:0001583	missense	0			BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1186C>G	1.37:g.163318796C>G	ENSP00000271452:p.Gln396Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	pfam_Kinetochore_Nuf2	p.Q396E	ENST00000271452.3	37	c.1186	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577492	0.28180	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.30182	1.54;1.65;1.65	5.5	4.53	0.55603	.	0.464316	0.24825	N	0.035290	T	0.06462	0.0166	L	0.40543	1.245	0.32669	N	0.516982	P;P	0.40083	0.702;0.702	B;B	0.33042	0.112;0.157	T	0.15954	-1.0419	9	0.02654	T	1	-8.2553	6.2876	0.21041	0.0:0.7118:0.1892:0.099	.	349;396	E9PQC4;Q9BZD4	.;NUF2_HUMAN	E	349;396;396	ENSP00000436888:Q349E;ENSP00000356875:Q396E;ENSP00000271452:Q396E	ENSP00000271452:Q396E	Q	+	1	0	NUF2	161585420	0.971000	0.33674	0.962000	0.40283	0.995000	0.86356	0.508000	0.22692	2.854000	0.98071	0.655000	0.94253	CAA	NUF2	-	NULL	ENSG00000143228		0.338	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	HGNC	protein_coding	OTTHUMT00000082812.1	88	0.00	0	C	NM_145697		163318796	163318796	+1	no_errors	ENST00000271452	ensembl	human	known	69_37n	missense	248	11.74	33	SNP	0.133	G
OR1D5	8386	genome.wustl.edu	37	17	2966511	2966511	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:2966511G>A	ENST00000575751.1	-	1	390	c.391C>T	c.(391-393)Cac>Tac	p.H131Y		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	131					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|lung(10)	11						GTGACATAGTGGAGGGGGCAG	0.582																																						dbGAP											0													55.0	63.0	60.0					17																	2966511		2193	4296	6489	-	-	-	SO:0001583	missense	0			AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.391C>T	17.37:g.2966511G>A	ENSP00000459028:p.His131Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96RA6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H131Y	ENST00000575751.1	37	c.391	CCDS58499.1	17																																																																																			OR1D5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000262628		0.582	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1D5	Clone_based_vega_gene	protein_coding	OTTHUMT00000438410.2	189	0.00	0	G	NM_014566		2966511	2966511	-1	no_errors	ENST00000575751	ensembl	human	known	69_37n	missense	18	80.00	72	SNP	1.000	A
OR1A1	8383	genome.wustl.edu	37	17	3119462	3119462	+	Missense_Mutation	SNP	C	C	T	rs544502398	byFrequency	TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:3119462C>T	ENST00000304094.1	+	1	548	c.548C>T	c.(547-549)cCc>cTc	p.P183L		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GACATTACCCCCTTGCTGAAG	0.483													C|||	2	0.000399361	0.0	0.0	5008	,	,		23192	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													201.0	171.0	181.0					17																	3119462		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.548C>T	17.37:g.3119462C>T	ENSP00000305207:p.Pro183Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P183L	ENST00000304094.1	37	c.548	CCDS11022.1	17	.	.	.	.	.	.	.	.	.	.	C	13.01	2.107987	0.37242	.	.	ENSG00000172146	ENST00000304094	T	0.00224	8.51	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.264877	0.27531	N	0.018957	T	0.00300	0.0009	M	0.79926	2.475	0.21579	N	0.99963	P	0.35174	0.488	B	0.36418	0.224	T	0.36601	-0.9741	10	0.62326	D	0.03	.	12.7992	0.57576	0.1643:0.8357:0.0:0.0	.	183	Q9P1Q5	OR1A1_HUMAN	L	183	ENSP00000305207:P183L	ENSP00000305207:P183L	P	+	2	0	OR1A1	3066212	0.112000	0.22096	0.917000	0.36280	0.580000	0.36256	3.540000	0.53611	2.584000	0.87258	0.436000	0.28706	CCC	OR1A1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172146		0.483	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A1	HGNC	protein_coding	OTTHUMT00000207292.1	252	0.00	0	C	NM_014565		3119462	3119462	+1	no_errors	ENST00000304094	ensembl	human	known	69_37n	missense	26	85.06	148	SNP	0.196	T
OR2T12	127064	genome.wustl.edu	37	1	248458366	248458366	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:248458366A>T	ENST00000317996.1	-	1	514	c.515T>A	c.(514-516)aTc>aAc	p.I172N		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GAAGTGATCGATCTCGTGTGC	0.562																																						dbGAP											0													123.0	103.0	110.0					1																	248458366		2201	4297	6498	-	-	-	SO:0001583	missense	0			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.515T>A	1.37:g.248458366A>T	ENSP00000324583:p.Ile172Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I172N	ENST00000317996.1	37	c.515	CCDS31110.1	1	.	.	.	.	.	.	.	.	.	.	a	12.83	2.055012	0.36277	.	.	ENSG00000177201	ENST00000317996	T	0.00158	8.65	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35739	U	0.003019	T	0.00637	0.0021	H	0.98111	4.15	0.09310	N	1	P	0.51537	0.946	D	0.64506	0.926	T	0.22730	-1.0208	10	0.87932	D	0	.	8.3975	0.32566	1.0:0.0:0.0:0.0	.	172	Q8NG77	O2T12_HUMAN	N	172	ENSP00000324583:I172N	ENSP00000324583:I172N	I	-	2	0	OR2T12	246524989	0.450000	0.25697	0.021000	0.16686	0.047000	0.14425	4.756000	0.62205	0.540000	0.28808	0.147000	0.16070	ATC	OR2T12	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000177201		0.562	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T12	HGNC	protein_coding	OTTHUMT00000097353.1	241	0.00	0	A	NM_001004692		248458366	248458366	-1	no_errors	ENST00000317996	ensembl	human	known	69_37n	missense	113	24.67	37	SNP	0.006	T
OR4K15	81127	genome.wustl.edu	37	14	20444111	20444111	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr14:20444111A>T	ENST00000305051.5	+	1	509	c.434A>T	c.(433-435)gAc>gTc	p.D145V		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATGGCCTATGACCGTTATGTT	0.468																																						dbGAP											0													147.0	141.0	143.0					14																	20444111		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.434A>T	14.37:g.20444111A>T	ENSP00000304077:p.Asp145Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIL3|Q6IEZ4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D145V	ENST00000305051.5	37	c.434	CCDS32026.1	14	.	.	.	.	.	.	.	.	.	.	.	19.05	3.752744	0.69648	.	.	ENSG00000169488	ENST00000305051	T	0.54866	0.55	3.8	3.8	0.43715	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000059	T	0.81245	0.4782	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86199	0.1617	10	0.87932	D	0	.	10.5358	0.45002	1.0:0.0:0.0:0.0	.	145	Q8NH41	OR4KF_HUMAN	V	145	ENSP00000304077:D145V	ENSP00000304077:D145V	D	+	2	0	OR4K15	19513951	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.502000	0.90505	1.578000	0.49821	0.477000	0.44152	GAC	OR4K15	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000169488		0.468	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K15	HGNC	protein_coding	OTTHUMT00000409883.1	194	0.00	0	A			20444111	20444111	+1	no_errors	ENST00000305051	ensembl	human	known	69_37n	missense	71	46.62	62	SNP	1.000	T
PCDH19	57526	genome.wustl.edu	37	X	99551519	99551519	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chrX:99551519G>T	ENST00000373034.4	-	6	4878	c.3203C>A	c.(3202-3204)cCc>cAc	p.P1068H	PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000420881.2_Missense_Mutation_p.P1020H|PCDH19_ENST00000255531.7_Missense_Mutation_p.P1021H	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1068					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						GAGGTGGAGGGGGGAGGTGAC	0.592																																						dbGAP											0													53.0	58.0	56.0					X																	99551519		2116	4213	6329	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3203C>A	X.37:g.99551519G>T	ENSP00000362125:p.Pro1068His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1068H	ENST00000373034.4	37	c.3203	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810274	0.70797	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.55760	0.5;0.63;0.5	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	L	0.51422	1.61	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.997	D;P;P	0.85130	0.997;0.896;0.79	T	0.70532	-0.4846	10	0.62326	D	0.03	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	1068;1021;1020	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	H	1020;1068;1021	ENSP00000400327:P1020H;ENSP00000362125:P1068H;ENSP00000255531:P1021H	ENSP00000255531:P1021H	P	-	2	0	PCDH19	99438175	1.000000	0.71417	0.950000	0.38849	0.966000	0.64601	9.087000	0.94110	2.413000	0.81919	0.600000	0.82982	CCC	PCDH19	-	NULL	ENSG00000165194		0.592	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	167	0.00	0	G	NM_020766		99551519	99551519	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	10	74.36	29	SNP	1.000	T
PIK3C3	5289	genome.wustl.edu	37	18	39542488	39542488	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr18:39542488C>T	ENST00000262039.4	+	3	378	c.292C>T	c.(292-294)Cct>Tct	p.P98S	PIK3C3_ENST00000586545.1_Missense_Mutation_p.P98S|PIK3C3_ENST00000398870.3_Missense_Mutation_p.P35S	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	98	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						AGTAAAATACCCTGACCTGCC	0.408										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	dbGAP											0													90.0	82.0	84.0					18																	39542488		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.292C>T	18.37:g.39542488C>T	ENSP00000262039:p.Pro98Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15134	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pirsf_PI3K_Vps34,pfscan_PI3/4_kinase_cat_dom	p.P98S	ENST00000262039.4	37	c.292	CCDS11920.1	18	.	.	.	.	.	.	.	.	.	.	C	7.501	0.652587	0.14580	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	T;T	0.73681	-0.77;-0.77	5.88	5.88	0.94601	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.050712	0.85682	D	0.000000	T	0.48874	0.1524	N	0.01817	-0.705	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.50816	-0.8783	9	.	.	.	.	15.6842	0.77396	0.0:0.8638:0.1362:0.0	.	35;98	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	S	98;35	ENSP00000262039:P98S;ENSP00000381845:P35S	.	P	+	1	0	PIK3C3	37796486	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.832000	0.55783	2.789000	0.95967	0.591000	0.81541	CCT	PIK3C3	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom,pirsf_PI3K_Vps34	ENSG00000078142		0.408	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C3	HGNC	protein_coding	OTTHUMT00000255804.1	127	0.00	0	C	NM_002647		39542488	39542488	+1	no_errors	ENST00000262039	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	T
PKD1L2	114780	genome.wustl.edu	37	16	81232651	81232651	+	RNA	SNP	C	C	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr16:81232651C>G	ENST00000525539.1	-	0	1158				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CCCAAAAGCACAGTGTAAGTC	0.483																																						dbGAP											0													66.0	66.0	66.0					16																	81232651		1921	4123	6044	-	-	-			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81232651C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	pfam_Lectin_gal-bd_dom,pfam_C-type_lectin,pfam_PKD/REJ-like,superfamily_C-type_lectin_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_PKD_dom,smart_C-type_lectin,pfscan_C-type_lectin,pfscan_Lectin_gal-bd_dom,pfscan_REJ-like	p.V387L	ENST00000525539.1	37	c.1159		16	.	.	.	.	.	.	.	.	.	.	C	8.011	0.757555	0.15846	.	.	ENSG00000166473	ENST00000337114	T	0.01599	4.74	5.24	3.26	0.37387	.	0.340876	0.27539	N	0.018901	T	0.01523	0.0049	.	.	.	0.09310	N	1	B;B	0.23377	0.084;0.016	B;B	0.20184	0.028;0.014	T	0.46843	-0.9162	9	0.35671	T	0.21	-10.992	6.7638	0.23556	0.0:0.6595:0.1266:0.2139	.	387;387	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	L	387	ENSP00000337397:V387L	ENSP00000337397:V387L	V	-	1	0	PKD1L2	79790152	0.004000	0.15560	0.873000	0.34254	0.139000	0.21198	-0.041000	0.12084	1.212000	0.43366	0.542000	0.68232	GTG	PKD1L2	-	NULL	ENSG00000166473		0.483	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387972.2	150	0.00	0	C			81232651	81232651	-1	no_errors	ENST00000337114	ensembl	human	known	69_37n	missense	68	22.73	20	SNP	0.148	G
PNMAL1	55228	genome.wustl.edu	37	19	46973059	46973059	+	Missense_Mutation	SNP	C	C	T	rs547519581		TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:46973059C>T	ENST00000313683.10	-	2	1539	c.1234G>A	c.(1234-1236)Gag>Aag	p.E412K	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_Intron	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	412										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		GCTGTTGCCTCGGCAGGCTGC	0.602																																						dbGAP											0													53.0	49.0	50.0					19																	46973059		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.1234G>A	19.37:g.46973059C>T	ENSP00000318131:p.Glu412Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	NULL	p.E412K	ENST00000313683.10	37	c.1234	CCDS33059.1	19	.	.	.	.	.	.	.	.	.	.	C	14.19	2.461685	0.43736	.	.	ENSG00000182013	ENST00000313683	T	0.22743	1.94	3.65	3.65	0.41850	.	0.344162	0.21196	N	0.078542	T	0.14485	0.0350	N	0.24115	0.695	0.36718	D	0.88102	D	0.54047	0.964	B	0.44044	0.439	T	0.09640	-1.0665	10	0.20519	T	0.43	-7.5559	11.1416	0.48406	0.0:1.0:0.0:0.0	.	412	Q86V59	PNML1_HUMAN	K	412	ENSP00000318131:E412K	ENSP00000318131:E412K	E	-	1	0	PNMAL1	51664899	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	-0.114000	0.10757	2.330000	0.79161	0.655000	0.94253	GAG	PNMAL1	-	NULL	ENSG00000182013		0.602	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNMAL1	HGNC	protein_coding	OTTHUMT00000403929.1	90	0.00	0	C	NM_018215		46973059	46973059	-1	no_errors	ENST00000313683	ensembl	human	known	69_37n	missense	3	90.00	27	SNP	0.007	T
PPP2R2D	55844	genome.wustl.edu	37	10	133748053	133748053	+	IGR	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr10:133748053A>T								AL450307.1 (125518 upstream) : PPP2R2D (5479 downstream)																							TTCAGCGTGAACAAGAGGTCA	0.393																																						dbGAP											0													182.0	179.0	180.0					10																	133748053		1912	4116	6028	-	-	-	SO:0001628	intergenic_variant	0																															10.37:g.133748053A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.E33D		37	c.99		10	.	.	.	.	.	.	.	.	.	.	A	12.90	2.075715	0.36662	.	.	ENSG00000175470	ENST00000455566	T	0.28454	1.61	4.8	1.3	0.21679	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.15998	0.0385	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.08330	-1.0727	9	0.15952	T	0.53	-17.5529	7.6303	0.28236	0.7593:0.0:0.2407:0.0	.	64	Q66LE6	2ABD_HUMAN	D	33	ENSP00000399970:E33D	ENSP00000399970:E33D	E	+	3	2	PPP2R2D	133598043	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.534000	0.36051	0.704000	0.31869	0.528000	0.53228	GAA	PPP2R2D	-	superfamily_WD40_repeat_dom,pirsf_PP2A_PR55	ENSG00000175470	0	0.393					PPP2R2D	HGNC			162	0.00	0	A			133748053	133748053	+1	no_errors	ENST00000455566	ensembl	human	known	69_37n	missense	83	20.95	22	SNP	1.000	T
RAB13	5872	genome.wustl.edu	37	1	153955065	153955065	+	Silent	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:153955065C>T	ENST00000368575.3	-	6	541	c.426G>A	c.(424-426)gaG>gaA	p.E142E	RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family	142					cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGATTCCATGCTCTCGAGCCA	0.483																																					Ovarian(138;395 2427 24306 43415)	dbGAP											0													114.0	111.0	112.0					1																	153955065		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.426G>A	1.37:g.153955065C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E142	ENST00000368575.3	37	c.426	CCDS1058.1	1																																																																																			RAB13	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000143545		0.483	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	HGNC	protein_coding	OTTHUMT00000088992.1	260	0.00	0	C	NM_002870		153955065	153955065	-1	no_errors	ENST00000368575	ensembl	human	known	69_37n	silent	173	14.78	30	SNP	0.995	T
RASGRF1	5923	genome.wustl.edu	37	15	79291119	79291119	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr15:79291119C>A	ENST00000419573.3	-	19	3117	c.2843G>T	c.(2842-2844)aGa>aTa	p.R948I	RASGRF1_ENST00000394745.3_Missense_Mutation_p.R164I|RASGRF1_ENST00000558480.2_Missense_Mutation_p.R932I|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	948					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GGTGGCTGCTCTGCGGATCAC	0.612																																						dbGAP											0													118.0	108.0	111.0					15																	79291119		2196	4293	6489	-	-	-	SO:0001583	missense	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2843G>T	15.37:g.79291119C>A	ENSP00000405963:p.Arg948Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R948I	ENST00000419573.3	37	c.2843	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006636	0.93287	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.30981	1.51;1.51	4.74	4.74	0.60224	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56514	0.1990	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;0.998	D;D;D;D	0.91635	0.999;0.981;0.999;0.992	T	0.59637	-0.7417	10	0.52906	T	0.07	.	15.25	0.73536	0.0:1.0:0.0:0.0	.	344;932;950;932	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	I	948;932;164	ENSP00000405963:R948I;ENSP00000378228:R164I	ENSP00000378224:R932I	R	-	2	0	RASGRF1	77078174	1.000000	0.71417	0.979000	0.43373	0.971000	0.66376	7.247000	0.78257	2.437000	0.82529	0.591000	0.81541	AGA	RASGRF1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N	ENSG00000058335		0.612	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	144	0.00	0	C	NM_002891		79291119	79291119	-1	no_errors	ENST00000419573	ensembl	human	known	69_37n	missense	26	57.38	35	SNP	0.999	A
RBMX	27316	genome.wustl.edu	37	X	135960146	135960147	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chrX:135960146_135960147insAA	ENST00000320676.7	-	4	469_470	c.315_316insTT	c.(313-318)cctccafs	p.P106fs	RBMX_ENST00000562646.1_Frame_Shift_Ins_p.P106fs|RBMX_ENST00000570135.1_Intron|RBMX_ENST00000431446.3_Intron|SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000565438.1_5'UTR	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	106					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P106fs*32(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AGACCTCTTGGAGGGCCTCTAC	0.535																																						dbGAP											1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.315_316insTT	X.37:g.135960146_135960147insAA	ENSP00000359645:p.Pro106fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.P105fs	ENST00000320676.7	37	c.316_315	CCDS14661.1	X																																																																																			RBMX	-	NULL	ENSG00000147274		0.535	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	HGNC	protein_coding	OTTHUMT00000058507.1	153	0.65	1	-	NM_002139		135960146	135960147	-1	no_errors	ENST00000320676	ensembl	human	known	69_37n	frame_shift_ins	95	15.93	18	INS	1.000:1.000	AA
RPP40	10799	genome.wustl.edu	37	6	5000125	5000125	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:5000125C>A	ENST00000380051.2	-	4	395	c.351G>T	c.(349-351)ttG>ttT	p.L117F	RPP40_ENST00000464646.1_Missense_Mutation_p.L57F|RPP40_ENST00000319533.5_Missense_Mutation_p.L94F	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	117					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				TATCCAGTGACAAAATTAATT	0.328																																						dbGAP											0													79.0	89.0	86.0					6																	5000125		2203	4299	6502	-	-	-	SO:0001583	missense	0			U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.351G>T	6.37:g.5000125C>A	ENSP00000369391:p.Leu117Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX97|Q8WVK8	Missense_Mutation	SNP	pfam_RNase_P_Rpp40	p.L117F	ENST00000380051.2	37	c.351	CCDS34333.1	6	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030140	0.54790	.	.	ENSG00000124787	ENST00000380051;ENST00000319533;ENST00000464646	T;T;T	0.64085	-0.08;-0.08;-0.08	5.54	1.94	0.25998	.	0.000000	0.85682	D	0.000000	T	0.70141	0.3190	M	0.86651	2.83	0.53005	D	0.999968	D;D	0.89917	0.997;1.0	D;D	0.79108	0.94;0.992	T	0.71619	-0.4538	10	0.72032	D	0.01	-5.47	6.7743	0.23611	0.0:0.4234:0.0:0.5766	.	94;117	O75818-2;O75818	.;RPP40_HUMAN	F	117;94;57	ENSP00000369391:L117F;ENSP00000317998:L94F;ENSP00000419431:L57F	ENSP00000317998:L94F	L	-	3	2	RPP40	4945124	0.998000	0.40836	1.000000	0.80357	0.812000	0.45895	0.302000	0.19192	0.418000	0.25898	-0.312000	0.09012	TTG	RPP40	-	pfam_RNase_P_Rpp40	ENSG00000124787		0.328	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPP40	HGNC	protein_coding	OTTHUMT00000039733.2	90	0.00	0	C	NM_006638		5000125	5000125	-1	no_errors	ENST00000380051	ensembl	human	known	69_37n	missense	45	73.53	125	SNP	1.000	A
SCN3A	6328	genome.wustl.edu	37	2	166032862	166032862	+	Missense_Mutation	SNP	G	G	A	rs558749829	byFrequency	TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:166032862G>A	ENST00000360093.3	-	3	534	c.43C>T	c.(43-45)Cgc>Tgc	p.R15C	SCN3A_ENST00000409101.3_Missense_Mutation_p.R15C|SCN3A_ENST00000283254.7_Missense_Mutation_p.R15C	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	15					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTAAAAAGGCGGAAGCTTTCA	0.428													G|||	2	0.000399361	0.0	0.0	5008	,	,		16681	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													120.0	119.0	120.0					2																	166032862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.43C>T	2.37:g.166032862G>A	ENSP00000353206:p.Arg15Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R15C	ENST00000360093.3	37	c.43		2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064103	0.76187	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431;ENST00000453007	D;D;D;D;T	0.97016	-4.21;-4.2;-4.15;-4.01;7.94	5.32	4.44	0.53790	.	0.198976	0.36167	N	0.002753	D	0.97826	0.9286	M	0.92833	3.35	0.80722	D	1	B;B;D	0.69078	0.005;0.005;0.997	B;B;P	0.54100	0.001;0.001;0.742	D	0.98298	1.0517	10	0.72032	D	0.01	.	14.4228	0.67196	0.0717:0.0:0.9283:0.0	.	15;15;15	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	C	15	ENSP00000353206:R15C;ENSP00000283254:R15C;ENSP00000386726:R15C;ENSP00000403348:R15C;ENSP00000391569:R15C	ENSP00000283254:R15C	R	-	1	0	SCN3A	165741108	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.223000	0.51231	1.383000	0.46405	0.467000	0.42956	CGC	SCN3A	-	NULL	ENSG00000153253		0.428	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		189	0.00	0	G	NM_006922		166032862	166032862	-1	no_errors	ENST00000283254	ensembl	human	known	69_37n	missense	94	51.04	98	SNP	1.000	A
SECTM1	6398	genome.wustl.edu	37	17	80282641	80282641	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:80282641C>A	ENST00000269389.3	-	3	570	c.220G>T	c.(220-222)Gag>Tag	p.E74*	SECTM1_ENST00000580437.1_Nonsense_Mutation_p.E74*	NM_003004.2	NP_002995.1	Q8WVN6	SCTM1_HUMAN	secreted and transmembrane 1	74					immune response (GO:0006955)|mesoderm development (GO:0007498)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine activity (GO:0005125)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(2)|lung(1)	4	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			ATGGCGCTCTCCTGCCCGTGG	0.612																																						dbGAP											0													124.0	85.0	98.0					17																	80282641		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U77643	CCDS11808.1	17q25	2008-07-18				ENSG00000141574			10707	protein-coding gene	gene with protein product	"""K12 protein"", ""type 1a transmembrane protein"""	602602				9480746	Standard	NM_003004		Approved	K12	uc002keo.3	Q8WVN6		ENST00000269389.3:c.220G>T	17.37:g.80282641C>A	ENSP00000269389:p.Glu74*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7H0|O00466	Nonsense_Mutation	SNP	NULL	p.E74*	ENST00000269389.3	37	c.220	CCDS11808.1	17	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793321	0.50102	.	.	ENSG00000141574	ENST00000269389	.	.	.	2.94	-5.88	0.02290	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	5.6494	0.17608	0.0:0.2979:0.3961:0.3059	.	.	.	.	X	74	.	ENSP00000269389:E74X	E	-	1	0	SECTM1	77875930	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.993000	0.00318	-1.719000	0.01382	-0.715000	0.03620	GAG	SECTM1	-	NULL	ENSG00000141574		0.612	SECTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECTM1	HGNC	protein_coding	OTTHUMT00000442856.1	134	0.00	0	C	NM_003004		80282641	80282641	-1	no_errors	ENST00000269389	ensembl	human	known	69_37n	nonsense	36	28.00	14	SNP	0.000	A
SETD1B	23067	genome.wustl.edu	37	12	122255181	122255182	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr12:122255181_122255182delTG	ENST00000604567.1	+	8	3026_3027	c.2958_2959delTG	c.(2956-2961)tctgtgfs	p.V987fs	SETD1B_ENST00000542440.1_Frame_Shift_Del_p.V987fs|SETD1B_ENST00000267197.5_Frame_Shift_Del_p.V987fs			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	987	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CCTCGACCTCTGTGGATGAGGA	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.2958_2959delTG	12.37:g.122255183_122255184delTG	ENSP00000474253:p.Val987fs	Somatic		WXS	Illumina GAIIx	Phase_IV	F6MFW1	Frame_Shift_Del	DEL	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.V987fs	ENST00000604567.1	37	c.2958_2959		12																																																																																			SETD1B	-	NULL	ENSG00000139718		0.634	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1	56	0.00	0	TG	XM_037523		122255181	122255182	+1	no_errors	ENST00000267197	ensembl	human	known	69_37n	frame_shift_del	3	50.00	3	DEL	0.821:1.000	-
SLC35A1	10559	genome.wustl.edu	37	6	88216123	88216123	+	Silent	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:88216123G>T	ENST00000369552.4	+	5	558	c.531G>T	c.(529-531)ggG>ggT	p.G177G	SLC35A1_ENST00000369556.3_Silent_p.G177G|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000464978.1_Intron|SLC35A1_ENST00000369557.5_Intron|SLC35A1_ENST00000544441.1_Silent_p.G43G	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	177					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)			breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CATTATTAGGGTTTGGCGCTA	0.308																																					NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)	dbGAP											0													189.0	184.0	186.0					6																	88216123		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.531G>T	6.37:g.88216123G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W1L8	Silent	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.G177	ENST00000369552.4	37	c.531	CCDS5010.1	6																																																																																			SLC35A1	-	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	ENSG00000164414		0.308	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A1	HGNC	protein_coding	OTTHUMT00000041446.1	266	0.37	1	G			88216123	88216123	+1	no_errors	ENST00000369552	ensembl	human	known	69_37n	silent	443	16.73	89	SNP	0.759	T
SMG8	55181	genome.wustl.edu	37	17	57288018	57288018	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:57288018C>A	ENST00000543872.2	+	2	870	c.606C>A	c.(604-606)taC>taA	p.Y202*	SMG8_ENST00000578922.1_Nonsense_Mutation_p.Y202*|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000300917.5_Nonsense_Mutation_p.Y202*|SMG8_ENST00000580498.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	202					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						GTCTCCTTTACCTATTCTCTG	0.488																																						dbGAP											0													91.0	78.0	82.0					17																	57288018		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.606C>A	17.37:g.57288018C>A	ENSP00000438748:p.Tyr202*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Nonsense_Mutation	SNP	pfam_Smg8/Smg9	p.Y202*	ENST00000543872.2	37	c.606	CCDS11615.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.724041	0.96847	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	.	.	.	5.69	3.71	0.42584	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-12.1823	9.957	0.41673	0.0:0.8123:0.0:0.1877	.	.	.	.	X	202	.	ENSP00000300917:Y202X	Y	+	3	2	SMG8	54642800	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.014000	0.29950	0.873000	0.35799	0.655000	0.94253	TAC	SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.488	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	166	0.00	0	C	NM_018149		57288018	57288018	+1	no_errors	ENST00000300917	ensembl	human	known	69_37n	nonsense	105	16.67	21	SNP	1.000	A
SPEN	23013	genome.wustl.edu	37	1	16199441	16199442	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:16199441_16199442delAG	ENST00000375759.3	+	2	418_419	c.214_215delAG	c.(214-216)agafs	p.R72fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	72	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AATGGGTGACAGAGACCTACGC	0.49																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.214_215delAG	1.37:g.16199443_16199444delAG	ENSP00000364912:p.Arg72fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.D73fs	ENST00000375759.3	37	c.214_215	CCDS164.1	1																																																																																			SPEN	-	smart_RRM_dom,pfscan_RRM_dom	ENSG00000065526		0.490	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	100	0.00	0	AG	NM_015001		16199441	16199442	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_del	41	47.44	37	DEL	1.000:1.000	-
SPTB	6710	genome.wustl.edu	37	14	65271779	65271779	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr14:65271779A>T	ENST00000389721.5	-	2	210	c.178T>A	c.(178-180)Ttc>Atc	p.F60I	SPTB_ENST00000389722.3_Missense_Mutation_p.F60I|SPTB_ENST00000556626.1_Missense_Mutation_p.F60I|SPTB_ENST00000542895.1_Missense_Mutation_p.F60I|SPTB_ENST00000389720.3_Missense_Mutation_p.F60I	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	60	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CATTTCGTGAAGGTCTTTTTC	0.567																																						dbGAP											0													105.0	95.0	98.0					14																	65271779		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.178T>A	14.37:g.65271779A>T	ENSP00000374371:p.Phe60Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.F60I	ENST00000389721.5	37	c.178	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	A	33	5.221609	0.95139	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34	4.67	4.67	0.58626	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.122605	0.56097	D	0.000029	D	0.84529	0.5492	M	0.90870	3.155	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88097	0.2817	10	0.87932	D	0	.	13.5751	0.61868	1.0:0.0:0.0:0.0	.	60;64	P11277;Q59FP5	SPTB1_HUMAN;.	I	64;60;60;60;60;60	ENSP00000374372:F60I;ENSP00000451752:F60I;ENSP00000374371:F60I;ENSP00000443882:F60I;ENSP00000374370:F60I	ENSP00000374370:F60I	F	-	1	0	SPTB	64341532	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.943000	0.92975	2.103000	0.63969	0.529000	0.55759	TTC	SPTB	-	pirsf_Spectrin_bsu,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000070182		0.567	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	159	0.00	0	A			65271779	65271779	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	missense	76	24.00	24	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2818050	2818050	+	Silent	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr16:2818050G>A	ENST00000301740.8	+	11	8070	c.7521G>A	c.(7519-7521)ggG>ggA	p.G2507G	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2507	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTGATGTGGGGGAGCCACCTG	0.642																																						dbGAP											0													52.0	52.0	52.0					16																	2818050		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7521G>A	16.37:g.2818050G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	NULL	p.G110R	ENST00000301740.8	37	c.328	CCDS32373.1	16																																																																																			SRRM2	-	NULL	ENSG00000167978		0.642	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	145	0.00	0	G			2818050	2818050	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000572883	ensembl	human	known	69_37n	missense	13	71.74	33	SNP	1.000	A
STAG1	10274	genome.wustl.edu	37	3	136078104	136078104	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr3:136078104T>A	ENST00000383202.2	-	27	3078	c.2822A>T	c.(2821-2823)aAc>aTc	p.N941I	STAG1_ENST00000434713.2_Missense_Mutation_p.N681I|STAG1_ENST00000236698.5_Missense_Mutation_p.N941I|STAG1_ENST00000536929.1_Missense_Mutation_p.N525I	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	941					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CCTATCTAGGTTGGGACCTTG	0.373																																						dbGAP											0													93.0	83.0	87.0					3																	136078104		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.2822A>T	3.37:g.136078104T>A	ENSP00000372689:p.Asn941Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O00539|Q6P275	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.N941I	ENST00000383202.2	37	c.2822	CCDS3090.1	3	.	.	.	.	.	.	.	.	.	.	T	26.5	4.742395	0.89573	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.34072	1.79;1.81;1.79;1.38	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.53786	0.1818	M	0.64997	1.995	0.80722	D	1	D;P	0.56968	0.978;0.527	P;B	0.59825	0.864;0.284	T	0.51004	-0.8760	10	0.39692	T	0.17	.	16.1668	0.81768	0.0:0.0:0.0:1.0	.	941;941	Q6P275;Q8WVM7	.;STAG1_HUMAN	I	941;941;681;525	ENSP00000372689:N941I;ENSP00000236698:N941I;ENSP00000404396:N681I;ENSP00000445787:N525I	ENSP00000236698:N941I	N	-	2	0	STAG1	137560794	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.851000	0.62896	2.210000	0.71456	0.533000	0.62120	AAC	STAG1	-	NULL	ENSG00000118007		0.373	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	108	0.00	0	T	NM_005862		136078104	136078104	-1	no_errors	ENST00000383202	ensembl	human	known	69_37n	missense	63	10.00	7	SNP	1.000	A
SYCP2	10388	genome.wustl.edu	37	20	58467482	58467482	+	Splice_Site	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr20:58467482C>A	ENST00000357552.3	-	24	2153		c.e24-1		SYCP2_ENST00000371001.2_Splice_Site			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2						female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ATAACAATATCTATTGGGGAA	0.224																																						dbGAP											0													21.0	21.0	21.0					20																	58467482		2150	4220	6370	-	-	-	SO:0001630	splice_region_variant	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1928-1G>T	20.37:g.58467482C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Splice_Site	SNP	-	e22-1	ENST00000357552.3	37	c.1928-1	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	C	6.811	0.518793	0.13005	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3109	0.60380	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYCP2	57900877	0.991000	0.36638	0.586000	0.28679	0.034000	0.12701	3.812000	0.55628	2.591000	0.87537	0.591000	0.81541	.	SYCP2	-	-	ENSG00000196074		0.224	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	78	0.00	0	C	NM_014258	Intron	58467482	58467482	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	splice_site	253	17.05	52	SNP	0.919	A
TEP1	7011	genome.wustl.edu	37	14	20873681	20873681	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr14:20873681C>T	ENST00000262715.5	-	4	839	c.799G>A	c.(799-801)Gac>Aac	p.D267N	TEP1_ENST00000556935.1_Missense_Mutation_p.D267N	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	267	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AGGGTGGGGTCAGATGTATTG	0.488																																						dbGAP											0													124.0	119.0	121.0					14																	20873681		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.799G>A	14.37:g.20873681C>T	ENSP00000262715:p.Asp267Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV9	Missense_Mutation	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D267N	ENST00000262715.5	37	c.799	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	C	11.35	1.613986	0.28712	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.15487	2.42;2.42	4.58	-1.89	0.07689	TROVE (2);	0.534882	0.17764	N	0.162797	T	0.10637	0.0260	L	0.48362	1.52	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.10450	0.003;0.005	T	0.22730	-1.0208	10	0.35671	T	0.21	0.0079	1.2083	0.01899	0.2643:0.393:0.1167:0.226	.	267;267	G3V5X7;Q99973	.;TEP1_HUMAN	N	267	ENSP00000262715:D267N;ENSP00000452574:D267N	ENSP00000262715:D267N	D	-	1	0	TEP1	19943521	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.465000	0.06680	-0.510000	0.06523	0.655000	0.94253	GAC	TEP1	-	pfam_TROVE,pfscan_TROVE	ENSG00000129566		0.488	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	269	0.00	0	C	NM_007110		20873681	20873681	-1	no_errors	ENST00000262715	ensembl	human	known	69_37n	missense	142	18.39	32	SNP	0.000	T
TEPP	374739	genome.wustl.edu	37	16	58021301	58021301	+	Splice_Site	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr16:58021301C>T	ENST00000441824.2	+	8	824	c.787C>T	c.(787-789)Cgt>Tgt	p.R263C	TEPP_ENST00000569996.1_3'UTR|TEPP_ENST00000290871.5_Splice_Site_p.R290C	NM_199456.2	NP_955535.2	Q6URK8	TEPP_HUMAN	testis, prostate and placenta expressed	263						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	8						TCTCCACAGTCGTGTCAACTA	0.577																																						dbGAP											0													105.0	89.0	94.0					16																	58021301		2198	4294	6492	-	-	-	SO:0001630	splice_region_variant	0			BC104458	CCDS10790.1, CCDS45496.1	16q13	2009-04-20			ENSG00000159648	ENSG00000159648			33745	protein-coding gene	gene with protein product		610264				14652002	Standard	NM_199456		Approved		uc002emv.4	Q6URK8	OTTHUMG00000133463	ENST00000441824.2:c.786-1C>T	16.37:g.58021301C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6URK7	Missense_Mutation	SNP	NULL	p.R290C	ENST00000441824.2	37	c.868	CCDS45496.1	16	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482327	0.63962	.	.	ENSG00000159648	ENST00000290871;ENST00000441824	T;T	0.52983	0.64;0.64	4.59	4.59	0.56863	.	0.450856	0.21289	N	0.077005	T	0.68210	0.2976	M	0.81942	2.565	0.31181	N	0.702111	D;D	0.89917	1.0;1.0	P;D	0.70016	0.901;0.967	T	0.72683	-0.4219	10	0.87932	D	0	.	13.0947	0.59184	0.0:1.0:0.0:0.0	.	263;290	Q6URK8;Q6URK8-2	TEPP_HUMAN;.	C	290;263	ENSP00000290871:R290C;ENSP00000401917:R263C	ENSP00000290871:R290C	R	+	1	0	TEPP	56578802	0.137000	0.22531	0.534000	0.28014	0.890000	0.51754	0.933000	0.28897	2.521000	0.84997	0.542000	0.68232	CGT	TEPP	-	NULL	ENSG00000159648		0.577	TEPP-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TEPP	HGNC	protein_coding	OTTHUMT00000431966.1	260	0.00	0	C	NM_199456	Missense_Mutation	58021301	58021301	+1	no_errors	ENST00000290871	ensembl	human	known	69_37n	missense	98	41.32	69	SNP	0.403	T
TMEM178A	130733	genome.wustl.edu	37	2	39934291	39934291	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:39934291C>A	ENST00000281961.2	+	3	673	c.617C>A	c.(616-618)aCc>aAc	p.T206N	TMEM178A_ENST00000482239.1_3'UTR	NM_152390.2	NP_689603.2	Q8NBL3	T178A_HUMAN	transmembrane protein 178A	206						integral component of membrane (GO:0016021)											GAGAGCTTGACCCAGCACGTG	0.587																																						dbGAP											0													69.0	59.0	62.0					2																	39934291		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029530	CCDS1804.1	2p22.1	2012-06-29	2012-06-29	2012-06-29	ENSG00000152154	ENSG00000152154			28517	protein-coding gene	gene with protein product			"""transmembrane protein 178"""	TMEM178		12975309	Standard	NM_001167959		Approved	MGC33926	uc002rrt.3	Q8NBL3	OTTHUMG00000128591	ENST00000281961.2:c.617C>A	2.37:g.39934291C>A	ENSP00000281961:p.Thr206Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWI6|Q8N6N4	Missense_Mutation	SNP	NULL	p.T206N	ENST00000281961.2	37	c.617	CCDS1804.1	2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325745	0.81580	.	.	ENSG00000152154	ENST00000281961	T	0.69306	-0.39	5.18	5.18	0.71444	.	0.051055	0.85682	D	0.000000	T	0.75517	0.3860	L	0.47716	1.5	0.58432	D	0.999998	D	0.76494	0.999	D	0.67231	0.95	T	0.74210	-0.3739	9	.	.	.	-18.1825	16.2065	0.82133	0.0:1.0:0.0:0.0	.	206	Q8NBL3	TM178_HUMAN	N	206	ENSP00000281961:T206N	.	T	+	2	0	TMEM178	39787795	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	4.237000	0.58681	2.433000	0.82419	0.650000	0.86243	ACC	TMEM178A	-	NULL	ENSG00000152154		0.587	TMEM178A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM178A	HGNC	protein_coding	OTTHUMT00000250445.2	96	0.00	0	C	NM_152390		39934291	39934291	+1	no_errors	ENST00000281961	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	A
TMEFF2	23671	genome.wustl.edu	37	2	192820999	192820999	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:192820999A>G	ENST00000272771.5	-	8	2035	c.851T>C	c.(850-852)aTg>aCg	p.M284T	AC098617.1_ENST00000428980.2_RNA|AC098617.1_ENST00000424116.2_RNA|TMEFF2_ENST00000392314.1_Missense_Mutation_p.M284T	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	284	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TGGCTCCTGCATATTGATAGA	0.358																																					Pancreas(50;1277 1381 28487 47072)	dbGAP											0													131.0	114.0	120.0					2																	192820999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.851T>C	2.37:g.192820999A>G	ENSP00000272771:p.Met284Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,pfscan_EG-like_dom	p.M284T	ENST00000272771.5	37	c.851	CCDS2314.1	2	.	.	.	.	.	.	.	.	.	.	A	7.151	0.583747	0.13749	.	.	ENSG00000144339	ENST00000392314;ENST00000272771	T;T	0.12984	2.63;2.63	4.55	4.55	0.56014	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.384643	0.30791	N	0.008874	T	0.09818	0.0241	N	0.25485	0.75	0.80722	D	1	B	0.12630	0.006	B	0.11329	0.006	T	0.11470	-1.0586	10	0.10111	T	0.7	-14.1921	14.3426	0.66639	1.0:0.0:0.0:0.0	.	284	Q9UIK5	TEFF2_HUMAN	T	284	ENSP00000376128:M284T;ENSP00000272771:M284T	ENSP00000272771:M284T	M	-	2	0	TMEFF2	192529244	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.659000	0.61504	2.022000	0.59522	0.402000	0.26972	ATG	TMEFF2	-	pfscan_EG-like_dom	ENSG00000144339		0.358	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEFF2	HGNC	protein_coding	OTTHUMT00000256065.2	183	0.00	0	A	NM_016192		192820999	192820999	-1	no_errors	ENST00000272771	ensembl	human	known	69_37n	missense	185	10.63	22	SNP	1.000	G
TNIK	23043	genome.wustl.edu	37	3	170819300	170819300	+	Silent	SNP	C	C	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr3:170819300C>T	ENST00000436636.2	-	22	2873	c.2529G>A	c.(2527-2529)gaG>gaA	p.E843E	TNIK_ENST00000369326.5_Silent_p.E821E|TNIK_ENST00000475336.1_Silent_p.E751E|TNIK_ENST00000488470.1_Silent_p.E788E|TNIK_ENST00000341852.6_Silent_p.E759E|TNIK_ENST00000538048.1_Silent_p.E795E|TNIK_ENST00000357327.5_Silent_p.E814E|TNIK_ENST00000470834.1_Silent_p.E806E|TNIK_ENST00000284483.8_Silent_p.E835E|TNIK_ENST00000460047.1_Silent_p.E780E	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	843	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CTCCATCTTCCTCCTCTTCCT	0.493																																						dbGAP											0													305.0	304.0	304.0					3																	170819300		2103	4245	6348	-	-	-	SO:0001819	synonymous_variant	0			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.2529G>A	3.37:g.170819300C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.E843	ENST00000436636.2	37	c.2529	CCDS46956.1	3																																																																																			TNIK	-	NULL	ENSG00000154310		0.493	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2	275	0.00	0	C	XM_039796		170819300	170819300	-1	no_errors	ENST00000436636	ensembl	human	known	69_37n	silent	192	37.25	114	SNP	1.000	T
TNRC6B	23112	genome.wustl.edu	37	22	40662003	40662003	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr22:40662003G>A	ENST00000454349.2	+	5	1980	c.1769G>A	c.(1768-1770)cGt>cAt	p.R590H	TNRC6B_ENST00000335727.9_Missense_Mutation_p.R590H|TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000402203.1_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	590	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						AACTCTGGCCGTCGGTCGTAC	0.527																																						dbGAP											0													109.0	113.0	112.0					22																	40662003		1999	4170	6169	-	-	-	SO:0001583	missense	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.1769G>A	22.37:g.40662003G>A	ENSP00000401946:p.Arg590His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.R590H	ENST00000454349.2	37	c.1769	CCDS54533.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.89|13.89	2.370739|2.370739	0.42003|0.42003	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727|ENST00000446273	T;T|.	0.13538|.	2.61;2.58|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.106556|.	0.64402|.	D|.	0.000003|.	T|T	0.55940|0.55940	0.1952|0.1952	N|N	0.22421|0.22421	0.69|0.69	0.39099|0.39099	D|D	0.961253|0.961253	D;D;D|.	0.76494|.	0.999;0.991;0.986|.	D;B;P|.	0.74674|.	0.984;0.375;0.579|.	T|T	0.52823|0.52823	-0.8524|-0.8524	10|5	0.42905|.	T|.	0.14|.	-4.2093|-4.2093	19.447|19.447	0.94851|0.94851	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	590;590;590|.	Q9UPQ9;A8MYY3;Q9UPQ9-1|.	TNR6B_HUMAN;.;.|.	H|I	590|333	ENSP00000401946:R590H;ENSP00000338371:R590H|.	ENSP00000338371:R590H|.	R|V	+|+	2|1	0|0	TNRC6B|TNRC6B	38991949|38991949	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.893000|5.893000	0.69798|0.69798	2.607000|2.607000	0.88179|0.88179	0.555000|0.555000	0.69702|0.69702	CGT|GTC	TNRC6B	-	NULL	ENSG00000100354		0.527	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		84	0.00	0	G			40662003	40662003	+1	no_errors	ENST00000454349	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577110	7577110	+	Silent	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr17:7577110G>C	ENST00000269305.4	-	8	1017	c.828C>G	c.(826-828)gcC>gcG	p.A276A	TP53_ENST00000420246.2_Silent_p.A276A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Silent_p.A276A|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Silent_p.A276A|TP53_ENST00000455263.2_Silent_p.A276A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	276	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.A276A(2)|p.?(2)|p.A276fs*69(2)|p.C277fs*29(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.A276fs*68(1)|p.L265_K305del41(1)|p.A276_C277delAC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCCAGGACAGGCACAAACAC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	28	Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(5)|Insertion - Frameshift(2)|Unknown(2)|Complex - frameshift(2)|Substitution - coding silent(2)	upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|bone(4)|central_nervous_system(3)|stomach(2)|oesophagus(2)|skin(2)|urinary_tract(1)|prostate(1)|pancreas(1)											72.0	62.0	65.0					17																	7577110		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.828C>G	17.37:g.7577110G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.A276	ENST00000269305.4	37	c.828	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	229	0.00	0	G	NM_000546		7577110	7577110	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.993	C
TRIP12	9320	genome.wustl.edu	37	2	230678609	230678609	+	Silent	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:230678609G>A	ENST00000283943.5	-	12	1997	c.1819C>T	c.(1819-1821)Cta>Tta	p.L607L	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Silent_p.L655L|TRIP12_ENST00000389045.3_Silent_p.L310L	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	607					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CTTTGGGTTAGCAATGGGAGT	0.318																																						dbGAP											0													65.0	61.0	62.0					2																	230678609		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1819C>T	2.37:g.230678609G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.L607	ENST00000283943.5	37	c.1819	CCDS33391.1	2																																																																																			TRIP12	-	superfamily_ARM-type_fold	ENSG00000153827		0.318	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	63	0.00	0	G	NM_004238		230678609	230678609	-1	no_errors	ENST00000283943	ensembl	human	known	69_37n	silent	36	40.98	25	SNP	1.000	A
TRMT13	54482	genome.wustl.edu	37	1	100613873	100613873	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr1:100613873delG	ENST00000370141.2	+	10	1247	c.1241delG	c.(1240-1242)tgtfs	p.C414fs		NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	414					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										GGCGCTGATTGTTTGCCTGGG	0.348																																						dbGAP											0													114.0	111.0	112.0					1																	100613873		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.1241delG	1.37:g.100613873delG	ENSP00000359160:p.Cys414fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVL0|Q9NW65	Frame_Shift_Del	DEL	pfam_Methyltransferase_TRM13,pfam_Znf_CCCH-type_TRM13,pfam_TRM13/UPF0224_CHHC_Znf_dom	p.C414fs	ENST00000370141.2	37	c.1241	CCDS765.1	1																																																																																			TRMT13	-	pfam_Methyltransferase_TRM13	ENSG00000122435		0.348	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT13	HGNC	protein_coding	OTTHUMT00000029919.1	46	0.00	0	G	NM_019083		100613873	100613873	+1	no_errors	ENST00000370141	ensembl	human	known	69_37n	frame_shift_del	25	39.02	16	DEL	0.012	-
TSC22D1	8848	genome.wustl.edu	37	13	45148403	45148403	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr13:45148403G>A	ENST00000458659.2	-	1	2298	c.1808C>T	c.(1807-1809)cCc>cTc	p.P603L	TSC22D1_ENST00000460842.1_5'Flank|TSC22D1_ENST00000501704.2_Intron	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	603	Gln-rich.				negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		TGGTAGCTGGGGTTGAGCCAA	0.517																																						dbGAP											0													71.0	69.0	70.0					13																	45148403		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.1808C>T	13.37:g.45148403G>A	ENSP00000397435:p.Pro603Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Missense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.P603L	ENST00000458659.2	37	c.1808	CCDS31966.1	13	.	.	.	.	.	.	.	.	.	.	G	9.742	1.165186	0.21538	.	.	ENSG00000102804	ENST00000458659	T	0.34472	1.36	4.44	4.44	0.53790	.	0.120626	0.39020	N	0.001481	T	0.25382	0.0617	L	0.27053	0.805	0.80722	D	1	B	0.19073	0.033	B	0.16289	0.015	T	0.07578	-1.0765	10	0.62326	D	0.03	.	10.1614	0.42853	0.0:0.0:0.6983:0.3017	.	603	Q15714	T22D1_HUMAN	L	603	ENSP00000397435:P603L	ENSP00000397435:P603L	P	-	2	0	TSC22D1	44046403	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	2.434000	0.44802	2.466000	0.83321	0.491000	0.48974	CCC	TSC22D1	-	NULL	ENSG00000102804		0.517	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	TSC22D1	HGNC	protein_coding	OTTHUMT00000044743.2	173	0.00	0	G	NM_006022		45148403	45148403	-1	no_errors	ENST00000458659	ensembl	human	known	69_37n	missense	37	22.92	11	SNP	1.000	A
TYR	7299	genome.wustl.edu	37	11	88911483	88911483	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr11:88911483G>T	ENST00000263321.5	+	1	864	c.362G>T	c.(361-363)aGa>aTa	p.R121I	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	121					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	TTGGTGAGAAGAAACATCTTC	0.473																																						dbGAP											0													116.0	112.0	113.0					11																	88911483		2201	4299	6500	-	-	-	SO:0001583	missense	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.362G>T	11.37:g.88911483G>T	ENSP00000263321:p.Arg121Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.R121I	ENST00000263321.5	37	c.362	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843094	0.71488	.	.	ENSG00000077498	ENST00000263321	D	0.99121	-5.45	6.07	3.14	0.36123	Uncharacterised domain, di-copper centre (2);	0.085417	0.85682	D	0.000000	D	0.99029	0.9668	M	0.92691	3.335	0.58432	D	0.999999	P	0.48089	0.905	P	0.53988	0.739	D	0.98662	1.0684	9	.	.	.	.	8.651	0.34035	0.2967:0.0:0.7033:0.0	.	121	P14679	TYRO_HUMAN	I	121	ENSP00000263321:R121I	.	R	+	2	0	TYR	88551131	1.000000	0.71417	0.999000	0.59377	0.836000	0.47400	2.627000	0.46469	0.411000	0.25702	0.655000	0.94253	AGA	TYR	-	superfamily_Unchr_di-copper_centre	ENSG00000077498		0.473	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	76	0.00	0	G	NM_000372		88911483	88911483	+1	no_errors	ENST00000263321	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	1.000	T
URI1	8725	genome.wustl.edu	37	19	30505914	30505914	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:30505914T>A	ENST00000542441.2	+	11	1843	c.1546T>A	c.(1546-1548)Tct>Act	p.S516T	URI1_ENST00000360605.4_Intron|URI1_ENST00000392271.1_Missense_Mutation_p.S440T|URI1_ENST00000312051.6_Missense_Mutation_p.S476T			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	516					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										GTTGGAAGCATCTGAAGAAAC	0.433																																						dbGAP											0													111.0	110.0	111.0					19																	30505914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1546T>A	19.37:g.30505914T>A	ENSP00000442436:p.Ser516Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	pfam_Prefoldin_subunit,superfamily_Prefoldin	p.S516T	ENST00000542441.2	37	c.1546	CCDS12420.1	19	.	.	.	.	.	.	.	.	.	.	T	6.961	0.547179	0.13312	.	.	ENSG00000105176	ENST00000392271;ENST00000542441;ENST00000312051	T	0.52057	0.68	6.07	2.75	0.32379	.	0.244290	0.43416	D	0.000579	T	0.39462	0.1079	L	0.53249	1.67	0.25918	N	0.983152	P;P	0.35433	0.493;0.501	B;B	0.39379	0.298;0.156	T	0.21724	-1.0237	10	0.17832	T	0.49	-0.6469	6.0354	0.19704	0.0:0.3437:0.1338:0.5226	.	476;516	F8W9T0;O94763	.;RMP_HUMAN	T	440;516;476	ENSP00000442436:S516T	ENSP00000312530:S476T	S	+	1	0	C19orf2	35197754	0.039000	0.19947	0.016000	0.15963	0.178000	0.23041	0.290000	0.18975	0.160000	0.19432	0.528000	0.53228	TCT	URI1	-	NULL	ENSG00000105176		0.433	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URI1	HGNC	protein_coding	OTTHUMT00000439756.1	128	0.00	0	T	NM_134447		30505914	30505914	+1	no_errors	ENST00000542441	ensembl	human	known	69_37n	missense	155	29.41	65	SNP	0.309	A
VWF	7450	genome.wustl.edu	37	12	6078528	6078528	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr12:6078528G>T	ENST00000261405.5	-	45	7832	c.7578C>A	c.(7576-7578)aaC>aaA	p.N2526K		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2526					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TGAGGCAGGGGTTCTCCGGGG	0.617																																						dbGAP											0													50.0	52.0	52.0					12																	6078528		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7578C>A	12.37:g.6078528G>T	ENSP00000261405:p.Asn2526Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.N2526K	ENST00000261405.5	37	c.7578	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838248	0.32513	.	.	ENSG00000110799	ENST00000261405	T	0.37584	1.19	4.67	1.81	0.25067	.	0.299903	0.23935	N	0.043110	T	0.28200	0.0696	L	0.52364	1.645	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.07693	-1.0759	10	0.56958	D	0.05	.	5.5593	0.17133	0.1765:0.0:0.6648:0.1587	.	2526	P04275	VWF_HUMAN	K	2526	ENSP00000261405:N2526K	ENSP00000261405:N2526K	N	-	3	2	VWF	5948789	0.999000	0.42202	0.827000	0.32855	0.681000	0.39784	0.477000	0.22196	0.194000	0.20326	0.561000	0.74099	AAC	VWF	-	pirsf_VWF	ENSG00000110799		0.617	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	53	0.00	0	G	NM_000552		6078528	6078528	-1	no_errors	ENST00000261405	ensembl	human	known	69_37n	missense	12	57.14	16	SNP	0.993	T
XIRP2	129446	genome.wustl.edu	37	2	168107363	168107363	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr2:168107363C>A	ENST00000409195.1	+	9	9550	c.9461C>A	c.(9460-9462)cCa>cAa	p.P3154Q	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.P2932Q|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.P3154Q|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2979					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTTGAACCCCCACCAAGAAGG	0.458																																						dbGAP											0													80.0	77.0	78.0					2																	168107363		1880	4100	5980	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9461C>A	2.37:g.168107363C>A	ENSP00000386840:p.Pro3154Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.P3154Q	ENST00000409195.1	37	c.9461	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	C	1.226	-0.625490	0.03610	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.03441	3.94;3.94;3.93	5.35	3.51	0.40186	.	0.651566	0.16169	N	0.226370	T	0.06188	0.0160	L	0.34521	1.04	0.24195	N	0.99554	P;P;P	0.41188	0.624;0.741;0.741	B;P;P	0.49252	0.4;0.604;0.604	T	0.36939	-0.9727	10	0.29301	T	0.29	1.0175	11.6681	0.51385	0.0:0.8483:0.0:0.1517	.	2979;2979;2932	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Q	3154;3154;2932;568	ENSP00000386840:P3154Q;ENSP00000295237:P3154Q;ENSP00000387255:P2932Q	ENSP00000295237:P3154Q	P	+	2	0	XIRP2	167815609	0.004000	0.15560	0.086000	0.20670	0.027000	0.11550	2.016000	0.40971	1.471000	0.48121	0.557000	0.71058	CCA	XIRP2	-	NULL	ENSG00000163092		0.458	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	42	0.00	0	C	NM_152381		168107363	168107363	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	0.375	A
ZMIZ1	57178	genome.wustl.edu	37	10	81058277	81058277	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr10:81058277G>A	ENST00000334512.5	+	15	2178	c.1606G>A	c.(1606-1608)Gtc>Atc	p.V536I		NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	536	Pro-rich.				artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CAGCCAAGACGTCAAACCACC	0.627																																						dbGAP											0													117.0	112.0	114.0					10																	81058277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.1606G>A	10.37:g.81058277G>A	ENSP00000334474:p.Val536Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.V536I	ENST00000334512.5	37	c.1606	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433072	0.83776	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	T	0.54479	0.57	5.12	5.12	0.69794	.	0.000000	0.37437	N	0.002094	T	0.39200	0.1069	N	0.22421	0.69	0.80722	D	1	P	0.47604	0.898	B	0.38296	0.27	T	0.24621	-1.0155	10	0.26408	T	0.33	-12.3651	18.5564	0.91086	0.0:0.0:1.0:0.0	.	536	Q9ULJ6	ZMIZ1_HUMAN	I	536;466;443	ENSP00000334474:V536I	ENSP00000334474:V536I	V	+	1	0	ZMIZ1	80728283	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.390000	0.97246	2.391000	0.81399	0.462000	0.41574	GTC	ZMIZ1	-	NULL	ENSG00000108175		0.627	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	HGNC	protein_coding	OTTHUMT00000048944.2	145	0.00	0	G	NM_020338		81058277	81058277	+1	no_errors	ENST00000334512	ensembl	human	known	69_37n	missense	18	55.00	22	SNP	1.000	A
ZNF292	23036	genome.wustl.edu	37	6	87953320	87953320	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr6:87953320A>G	ENST00000369577.3	+	6	912	c.869A>G	c.(868-870)tAc>tGc	p.Y290C	ZNF292_ENST00000339907.4_Missense_Mutation_p.Y285C	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	290						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GGAGATATGTACTGCGCTTGG	0.333																																						dbGAP											0													87.0	78.0	81.0					6																	87953320		1832	4073	5905	-	-	-	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.869A>G	6.37:g.87953320A>G	ENSP00000358590:p.Tyr290Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y290C	ENST00000369577.3	37	c.869	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252313	0.80135	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.43294	0.95;0.95	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.53626	0.1808	L	0.61387	1.9	0.54753	D	0.999982	D	0.89917	1.0	D	0.91635	0.999	T	0.60276	-0.7295	10	0.87932	D	0	.	14.7721	0.69688	1.0:0.0:0.0:0.0	.	290	O60281	ZN292_HUMAN	C	290;285	ENSP00000358590:Y290C;ENSP00000342847:Y285C	ENSP00000342847:Y285C	Y	+	2	0	ZNF292	88010039	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	8.962000	0.93254	1.905000	0.55150	0.477000	0.44152	TAC	ZNF292	-	NULL	ENSG00000188994		0.333	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	131	0.76	1	A	NM_015021		87953320	87953320	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	missense	299	14.29	50	SNP	1.000	G
ZNF543	125919	genome.wustl.edu	37	19	57839308	57839308	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr19:57839308G>C	ENST00000321545.4	+	4	823	c.478G>C	c.(478-480)Gat>Cat	p.D160H		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTTGGGGTCAGATGATGGTGT	0.448																																						dbGAP											0													81.0	82.0	82.0					19																	57839308		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.478G>C	19.37:g.57839308G>C	ENSP00000322545:p.Asp160His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D160H	ENST00000321545.4	37	c.478	CCDS33130.1	19	.	.	.	.	.	.	.	.	.	.	G	5.693	0.312380	0.10789	.	.	ENSG00000178229	ENST00000321545	T	0.23552	1.9	2.87	-2.17	0.07059	.	.	.	.	.	T	0.10981	0.0268	N	0.22421	0.69	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.35151	-0.9800	9	0.15066	T	0.55	.	0.3386	0.00329	0.269:0.2035:0.3204:0.2071	.	160	Q08ER8	ZN543_HUMAN	H	160	ENSP00000322545:D160H	ENSP00000322545:D160H	D	+	1	0	ZNF543	62531120	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.586000	0.05787	-0.207000	0.10187	0.555000	0.69702	GAT	ZNF543	-	NULL	ENSG00000178229		0.448	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF543	HGNC	protein_coding	OTTHUMT00000465780.1	89	0.00	0	G	XM_064865		57839308	57839308	+1	no_errors	ENST00000321545	ensembl	human	known	69_37n	missense	38	49.33	37	SNP	0.001	C
ZNF876P	642280	genome.wustl.edu	37	4	248578	248578	+	RNA	SNP	G	G	C			TCGA-AN-A0XU-01A-11D-A10G-09	TCGA-AN-A0XU-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	537c5818-eb89-4b46-8915-2bb2b9e4545f	0c389ec9-719e-4bcb-96f2-9889efd47a4a	g.chr4:248578G>C	ENST00000356347.3	+	0	1402					NR_027481.1		Q49A33	Z876P_HUMAN	zinc finger protein 876, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ATGTGGCAAAGATTTTACTTG	0.368																																						dbGAP											0																																										-	-	-			0			BC028359		4p16.3	2011-04-20	2010-08-03	2009-07-22	ENSG00000198155	ENSG00000198155			32472	pseudogene	pseudogene							Standard	NR_027481		Approved		uc010iba.4	Q49A33	OTTHUMG00000159874		4.37:g.248578G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000356347.3	37	NULL		4																																																																																			ZNF876P	-	-	ENSG00000198155		0.368	ZNF876P-001	KNOWN	basic	processed_transcript	ZNF876P	HGNC	pseudogene	OTTHUMT00000357870.2	28	0.00	0	G	NR_027481		248578	248578	+1	no_errors	ENST00000356347	ensembl	human	known	69_37n	rna	8	38.46	5	SNP	0.315	C
